Slide 1

Warm UpName as many of the types of inheritance you can remember from Friday.What are the different blood types a person can have?AgendaObjective: SWBAT: identify that DNA is made up of the nucleotides adenine, guanine, cytosine, and thymineKWL Chart on DNADNA Building ActivityNotes on DNA

You will not always get a stamp if you simply finished the warm up. I will start checking for correct answers.

Testing

QuizzesIf you did not take the quiz last week, you need to make it up in order to avoid earning a zero.

If you earned below a C on the quiz, you can come in to do a retake.

KWL ChartWhat do we already know about DNA?It stands for Deoxyribonucleic AcidAll living things have DNAIn Eukaryotic cells, DNA is found in the nucleusIt carries our genetic information and determines our traitsSegments of DNA are called genesDNA is bundled up into chromosomes5Why is DNA important?DNA contains our genetic informationDNA is a set of instructions for making proteinsProteins determine just about everything about youWhether you are lactose intolerantWhat skin color you haveYour eye colorControl the rate of reactions in our body

DNA building activityWarm upDirections: Unless I tell you otherwise, you do not have to copy the questions anymore But you need to date every warm up and try to answer the questions correctly.

Name at least two reasons why DNA is important. Write in complete sentences.Warm upWrite three observations about this picture.Make an inference about what you think is happening.

AgendaObjectives: SWBAT Describe what happens during replication and use the base pairing rule to determine sequences of DNA. NotesPractice ProblemsCracking the Code Video

What is the Structure of DNA?Deoxyribonucleic Acid or DNA looks like a twisted ladder or double helix

Its made up of subunits called nucleotides

-Each nucleotide has a sugar, a phosphate and a nitrogen base

11Label the parts on your copy:

PhosphateSugar (Deoxyribose)Nitrogen BaseHydrogen Bonds12Types of Nitrogen BasesThere are 4 types of nitrogen bases in DNAA= AdenineT= ThymineC= CytosineG= Guanine

Nitrogen bases connect the 2 strands of DNA together, like the rungs (steps) of a ladder13Base PairingNitrogen bases pair up to make the steps of the ladder

In DNA -A always pairs with T And-C always pairs with G14Complementary StrandsEach strand of DNA is complimentary to the otherThat means that each strands nitrogen bases match up (A - T, C - G)

Example: If the code on one strand of DNA is ACGTC, then the complimentary strand would be TGCAG15Practice Problems: Write the Complimentary Strand in your notebook1. ATCGC

2. TGCAGA

3. CCCGTACGTA

4. TAGTGACTAGC

5. AAAGTAATGTTCAGTACTTT

16Before a cell divides, what does it need to do?DNA Replication Video

18

19EnzymesEnzymes are responsible for unzipping the DNA and adding the bases to form the 2 molecules of DNA.

Enzymes are proteins in our cells. They help regulate chemical reactions in our body.

Helicases are enzymes that split the DNA and DNA polymerase adds the bases

Proteins help make proteins!20DNA- Cracking the Codehttp://www.pbs.org/wgbh/nova/body/cracking-the-code-of-life.html

Warm upWhat happens during Replication?If a strand of DNA is ATGATTTAGTACCC, what is the complimentary strand of DNA?Whats different about these two structures? (Name at least two differences)What happens during Replication?If a strand of DNA is ATGATTTAGTACCC, what is the complimentary strand of DNA?

Whats different about these two structures?

25AgendaObjectives: SWBAT: compare and contrast DNA and RNA by creating a chartTest Taking StrategiesComparison ChartVideo ClipWorksheetCracking the Code video

RNARNA is another type of nucleic acid thats found in the nucleus and cytoplasm of a cell

Unlike DNA, RNA is made up of only one strand of nucleotides

27Difference in Nitrogen BasesInstead of having the base thymine, RNA has the base uracilThat means when RNA is formed, adenine pairs with uracil (A - U)

28Difference in SugarsOne main difference between RNA and DNA is that they are made up of different sugars-RNA has the sugar ribose-DNA has the sugar deoxyribose

29Different segmentsDNA is split up into segments called genesmRNA is split up into sections called codons.Every three bases of mRNA = one codon. Example: AUC or GGUCodons code for amino acids that make up proteinsDraw the following chartDNARNAEx. Type of sugarHas deoxyriboseHas ribose31How are proteins made?In order to make proteins, 3 processes must occur

DNA ReplicationMolecule of DNA is copiedTranscription Strand of mRNA is made using DNA as a templateTranslationmRNA codes for specific amino acids that make a protein

32WorksheetWarm UpAgendaObjectives: SWBAT explain that replication, transcription and translation are codependent processes that ultimately make proteins.

NotesPractice WorksheetWhite Board Practice??Video

What happens during Transcription?A strand of messenger RNA (mRNA) is made using DNA as a template.37What happens during Transcription?One strand of the DNA is the templateNitrogen bases attach to the DNA by following the base pairing rule except U will replace TThe sequence (order of the nitrogen bases) of RNA depends on the strand of DNAExample:A-C-C-A-A-AU-G-G-U-U-U38

demoDNA- Cracking the Codehttp://www.pbs.org/wgbh/nova/body/cracking-the-code-of-life.html

Practice Work SheetWhite Board PracticeWhats missing in this nucleotide?deoxyribose + phosphate + _________ ______44What type of sugar does RNA have?45A pairs with ____

C pairs with ____46(DNA or RNA)_________ is made up of 2 strands of nucleotides.47If the code of bases on one strand of DNA is AGCCTAGG, then what is the code on the complimentary strand?48What is the process that makes a copy of DNA? 49In RNA, Thymine is replaced with ________If a strand of DNA is ATGACCATGTAAA, what would be the complimentary mRNA strand?What is made at the end of translation?Is this a strand of DNA or RNA?

AGCCGUUAUGCGAU

http://www.youtube.com/watch?v=983lhh20rGY

Brain Pop Videohttp://www.brainpop.com/health/geneticsgrowthanddevelopment/rna/

Warm UpIn RNA, A pairs with _____In order to make a protein, three processes must occur: ___________________________________________________In which of the three processes is a protein made?

AgendaObjectives: SWBAT explain that replication, transcription and translation are codependent processes that ultimately make proteins AND In transcription, a strand of mRNA is created from a strand of DNA with uracil replacing thymine.

VideoPractice Protein SynthesisDNA- Cracking the Code VideoProtein Synthesis Video

Transcription.DNA to mRNAThe only difference is that mRNA has a U instead of a T. mRNA is only one strand of nucleotides, so we only need to use one strand of DNA as a template.

Practice Problems: Copy and answer the following problems in your notebook.1. ATGGCA UACCGU2. TGCAGATTA

3. CCAGTACGT

4. AAGTGGGTAGCA

5. ATAGTAATGAACAGTACCGTG

61PracticeNow split each of your answers into codons

1. ATGGCA UAC CGU

What happens after transcription??TranslationUse a genetic code chart to find the amino acids1. ATCGCA UAG CGU Tyr -- Arg

Practice WorksheetsDNA- Cracking the Codehttp://www.pbs.org/wgbh/nova/body/cracking-the-code-of-life.html

AgendaObjectives: SWBAT explain that replication, transcription and translation are codependent processes that ultimately make proteins AND In transcription, a strand of mRNA is created from a strand of DNA with uracil replacing thymine.

Spelling out Proteins LabDNA- Cracking the Code VideoSpelling out Proteins LabDirections: Answer review questions at the topReceive a strip of DNA from the teacherWrite down the strand of DNATranscribe the DNA into mRNASeparate the mRNA into codonsFind each codon around the roomFlip the card up to find the wordWrite each word down until youve completed your sentenceCheck the sentence with Mrs. LAReceive next strip of DNA

The first 3 people who finish all 10 sentences correctly will receive extra credit!DNA- Cracking the Codehttp://www.pbs.org/wgbh/nova/body/cracking-the-code-of-life.html