Virus Structure New
-
Upload
liezyl-lyn-defensor -
Category
Documents
-
view
119 -
download
0
Transcript of Virus Structure New
Introduction to Virus Structure
From Medical Microbiology, 5th ed., Murray, Rosenthal & Pfaller, Mosby Inc., 2005, Fig. 6-4.
Structures compared
From Medical Microbiology, 5th ed., Murray, Rosenthal & Pfaller, Mosby Inc., 2005, Fig. 6-1.
Basic virus structure
Virus GenomesVirus genome could either be a DNA or an RNA but not both.
Each nucleic acid could either be double-stranded or single stranded.
4 Categories:
1.dsDNA2.ssDNA3.dsRNA4.ssRNA
Viral nucleic acid can either be linear or circular.Some linear molecules may be in circular conformation. Ex.
Hepadnavirus virions, influenza virions
DNA Genomes
1. ss, linear parvoviruses2. ds, linear poxviruses3. Ss, circular phage ϕX1744. ds, circular baculoviruses
RNA Genomes
• ss, linear tobacco mosaic virus• ds, linear reoviruses• ss, circular hepatitis delta virus
CapsidsMajor function is protection of the genome.
Second major function is recognition and attachment to host cells.
Viral Symmetry
1.Helix2.Icosahedron3.Rod4.Cone
• Size– 17 nm – 3000 nm diameter
• Basic shape– Rod-like– “Spherical”
• Protective Shell - Capsid– Made of many identical protein
subunits– Symmetrically organized– 50% of weight– Enveloped or non-enveloped
From Medical Microbiology, 5th ed., Murray, Rosenthal & Pfaller, Mosby Inc., 2005, Fig. 6-5.
Basic virus structure
http://www.med.sc.edu:85/mhunt/intro-vir.htm
From Medical Microbiology, 5th ed., Murray, Rosenthal & Pfaller, Mosby Inc., 2005, Box 6-4.
Properties of naked capsid viruses
From Medical Microbiology, 5th ed., Murray, Rosenthal & Pfaller, Mosby Inc., 2005, Fig. Box 6-5.
Properties of enveloped viruses
Virus Structure
• Virus capsids function in: – Packaging and protecting nucleic acid– Host cell recognition
• Protein on coat or envelope “feels” or “recognizes” host cell receptors
– Genomic material delivery• Enveloped: cell fusion event• Non-enveloped: more complex strategies &
specialized structures
Helical Symmetry
• Found in many ssRNA viruses• RNA is coiled in the form of a helix and protein species
are arranged around the coil• Length of the capsid determined by length of the nucleic
acid• The helical nucleic acid coated with proteins to form a
nucleocapsid (inside envelope) e.g. measles and influenza viruses
Icosahedral Symmetry
• 20 faces, each an equilateral triangle• 12 vertices, each formed where the vertices of the five
triangles meet• 30 edges at each of which sides of two triangles• Have less contact with virus genome• 3 per triangular face, total 60
History
• In 1953, Crick & Watson proposed … principles of virus structure– Key insight:
• Limited volume of virion capsid => nucleic acid sufficient to code for only a few sorts of proteins of limited size
– Conclusion:• Identical subunits in identical environments• Icosahedral, dodecahedral symmetry
X-ray Crystallography of Viruses
• Symmetry of protein shells makes them uniquely well-suited to crystallographic methods
• Viruses are the largest assemblies of biological macromolecules whose structures have been determined at high resolution
History con’t
• In 50’s & 60’s Klug and others confirmed that several (unrelated) “spherical” viruses had icosahedral symmetry– (Used negative staining & electron microscopy)
• Conclusion:– Icosahedral symmetry is preferred in virus structure
Similarity to Buckminster Fuller’sGeodesic Domes
Icosahedral Symmetry• 12 vertices
• 20 faces(equilateral triangles)
• 5-3-2 symmetry axes
• 60 identical* subunits in identical environments can form icosahedral shell * asymmetric
Caspar and Klug’s Icosahedral shell
But …• Clear evolutionary pressure to make larger capsid
– Using larger subunits helps very little– Using more subunits helps a lot
• Not possible to form icosahedral shell (of identical units in identical environments) with more than 60 subunits
• Viruses with more than 60 subunits were observed
• Question:– How can >60 subunits form an icosahedral shell?– Will any number of subunits work?– If so, how would they be organized?
Quasi-equivalence• In 1962, Caspar & Klug proposed the
theory of “quasi-equivalence”
– Not all protein subunits are equivalent• “Identical” subunits in slightly different
environments
– Only certain numbers of subunits will can be packed into closed regular lattice.
Caspar & Klug, Cold Spring Harbor, 1962
Quasi-equivalence
• Subunits are in “minimally” different environments– Pentamers at vertices– Hexamers elsewhere
• Predicts packing arrangements of larger capsids– Shift from T1 to T4 packing=> 8-fold increase in volume
Spherical viruses have icosahedral symmetry
Homunculattice
HK97 Asymmetric Unit
Outside Inside
from Wah Chiu and Frazer Rixon in Virus Research (2002)
Herpes Simplex Virus at 8.5 Å resolution
Classification of Human Viruses
"Group" Family Genome Genome size (kb) Capsid EnvelopedsDNA
Poxviridae dsDNA, linear 130 to 375 Ovoid YesHerpesviridae dsDNA, linear 125 to 240 Icosahedral YesAdenoviridae dsDNA, linear 26 to 45 Icosahedral NoPolyomaviridae dsDNA, circular 5 Icosahedral NoPapillomaviridae dsDNA, circular 7 to 8 Icosahedral No
ssDNAAnellovirus ssDNA circular 3 to 4 Isometric NoParvoviradae ssDNA, linear, (- or +/-) 5 Icosahedral No
RetroHepadnaviridae dsDNA (partial), circular 3 to 4 Icosahedral YesRetroviridae ssRNA (+), diploid 7 to 13 Spherical, rod or cone shaped Yes
dsRNAReoviridae dsRNA, segmented 19 to 32 Icosahedral No
ssRNA (-)Rhabdoviridae ssRNA (-) 11 to 15 Helical YesFiloviridae ssRNA (-) 19 Helical YesParamyxoviridae ssRNA (-) 10 to 15 Helical YesOrthomyxoviridae ssRNA (-), segmented 10 to 13.6 Helical YesBunyaviridae ssRNA (-, ambi), segmented 11 to 19 Helical YesArenaviridae ssRNA (-, ambi), segmented 11 Circular, nucleosomal YesDeltavirus ssRNA (-) circular 2 Spherical Yes
ssRNA (+)Picornaviridae ssRNA (+) 7 to 9 Icosahedral NoCalciviridae ssRNA (+) 7 to 8 Icosahedral NoHepevirus ssRNA (+) 7 Icosahedral NoAstroviridae ssRNA (+) 6 to 7 Isometric NoCoronaviridae ssRNA (+) 28 to 31 Helical YesFlaviviridae ssRNA (+) 10 to 12 Spherical YesTogaviridae ssRNA (+) 11 to 12 Icosahedral Yes
From Medical Microbiology, 5th ed., Murray, Rosenthal & Pfaller, Mosby Inc., 2005, Fig. 6-9
Virus replication
From Medical Microbiology, 5th ed., Murray, Rosenthal & Pfaller, Mosby Inc., 2005, Fig. 6-11
Variations on the replication theme
M K A K L L V L L C A L A A T D A D T I F1 * R Q N Y W S C Y V H L Q L Q M Q T Q Y F2 E G K T T G P V M C T C S Y R C R H N M F35’ atgaaggcaaaactactggtcctgttatgtgcacttgcagctacagatgcagacacaata 3’ ----:----|----:----|----:----|----:----|----:----|----:----|3’ tacttccgttttgatgaccaggacaatacacgtgaacgtcgatgtctacgtctgtgttat 5’ X F A F S S T R N H A S A A V S A S V I F6 X S P L V V P G T I H V Q L * L H L C L F5 H L C F * Q D Q * T C K C S C I C V C Y F4
+ and - RNA+
-
+ sense RNA viruses package + polarity RNA in virions as genome.
This + sense RNA can be translated directly into protein upon uncoating of the virion in the cell- sense RNA viruses package - polarity RNA in virions as
genome.This - sense RNA must be transcribed by a virus coded, virion packaged RNA dependent RNA polymerase immediately following uncoating.
M K A K L L V L L C A L A A T D A D T I F1 * R Q N Y W S C Y V H L Q L Q M Q T Q Y F2 E G K T T G P V M C T C S Y R C R H N M F35’ atgaaggcaaaactactggtcctgttatgtgcacttgcagctacagatgcagacacaata 60 ----:----|----:----|----:----|----:----|----:----|----:----|3’ tacttccgttttgatgaccaggacaatacacgtgaacgtcgatgtctacgtctgtgttat 60 X F A F S S T R N H A S A A V S A S V I F6 X S P L V V P G T I H V Q L * L H L C L F5 H L C F * Q D Q * T C K C S C I C V C Y F4
C I G Y H A N N S T D T V D T L L E K N F1 V * A T M R T T Q P T L L T H Y S R R M F2 Y R L P C E Q L N R H C * H T T R E E C F361 tgtataggctaccatgcgaacaactcaaccgacactgttgacacactactcgagaagaat 3’ ----:----|----:----|----:----|----:----|----:----|----:----|61 acatatccgatggtacgcttgttgagttggctgtgacaactgtgtgatgagctcttctta 5’ H I P * W A F L E V S V T S V S S S F F F6 I Y L S G H S C S L R C Q Q C V V R S S F5 T Y A V M R V V * G V S N V C * E L L I F4
+ and - RNA
From Medical Microbiology, 5th ed., Murray, Rosenthal & Pfaller, Mosby Inc., 2005, Fig. 6-11
Variations on the replication theme
From Medical Microbiology, 5th ed., Murray, Rosenthal & Pfaller, Mosby Inc., 2005, Fig. 6-10
Virus growth
Influenza
• Infection depends on spike proteins projecting from capsid membrane called “Hemagglutinin (HA)”
• These bind sugar molecules on cell surface• Much of the difference between Hong Kong flu, Swine flu,
Bird flu, and other strains, is in the amino acid sequence and conformation of the HA protein.
• These differences control what host cell types the virus can infect.
• Immunization against flu involves your immune system synthesizing antibody proteins that bind the HA protein.
Influenza virus
entry of influenzainto cell
composition of virus
low pH
100 Å displacementof fusion peptide
fusion peptide
Influenza hemagglutinin:a pH induced, conformationally controlled trigger
for membrane fusion
backbone isstructured
disordered loop
Qiao et al. Membrane Fusion Activity of Influenza Hemagglutinin. The Journal of Cell Biology, Volume 141, 1998
Influenza Hemagglutinin
• The HA spikes extend like a spring during infection
http://www.roche.com/pages/facets/10/viruse.htmhttp://hsc.virginia.edu/medicine/basic-sci/cellbio/jgruenke.html
Trimer Structure
• Long alpha helices form coiled coil structure
• In mature trimers of HA0, each monomer is cleaved into HA1 and HA2.
Evolution of dsDNA viruses
• All known viruses, whether infecting bacteria or humans, may have evolved from a single common ancestor, relatively early in the evolution of organisms.
Common steps in the assembly of all dsDNA viruses
• Unique portal ring at one Vertex• Scaffolding proteins• Procapsid assembled empty of DNA• DNA pumped into procapsid through portal
ring• DNA moves back through portal to enter
cell
P22 Pathway
Herpes viruses also have a portal protein
Herpes portal (UL6) tagged with gold-bead labeled antibodiesvisualized by negative stain electron microscopy
portalcomplex
Bill Newcomb and Jay Brown, University of Virginia
Trus BL, Cheng N, Newcomb WW, Homa FL, Brown JC, Steven AC. Structure and polymorphism of the UL6 portal protein of herpes simplex virus type 1. J Virol. 2004 Nov;78(22):12668-71.
Cryo-EM structure of purified Herpes portal protein