Virus replicon particle based Chikungunya virus

neutralization assay using Gaussia luciferase as readout

Sabine Glasker, Aleksei Lulla, Valeria Lulla, Therese Couderc, Jan Drexler,

Peter Liljestrom, Marc Lecuit, Christian Drosten, Andres Merits, Beate

Kummerer

To cite this version:

Sabine Glasker, Aleksei Lulla, Valeria Lulla, Therese Couderc, Jan Drexler, et al.. Virus repli-con particle based Chikungunya virus neutralization assay using Gaussia luciferase as read-out. Virology Journal, BioMed Central, 2013, 10 (1), pp.235. <10.1186/1743-422X-10-235>.<pasteur-00846927>

HAL Id: pasteur-00846927

https://hal-pasteur.archives-ouvertes.fr/pasteur-00846927

Submitted on 22 Jul 2013

HAL is a multi-disciplinary open accessarchive for the deposit and dissemination of sci-entific research documents, whether they are pub-lished or not. The documents may come fromteaching and research institutions in France orabroad, or from public or private research centers.

L’archive ouverte pluridisciplinaire HAL, estdestinee au depot et a la diffusion de documentsscientifiques de niveau recherche, publies ou non,emanant des etablissements d’enseignement et derecherche francais ou etrangers, des laboratoirespublics ou prives.

METHODOLOGY Open Access

Virus replicon particle based Chikungunya virusneutralization assay using Gaussia luciferase asreadoutSabine Gläsker1, Aleksei Lulla2, Valeria Lulla2, Therese Couderc3,4, Jan Felix Drexler1, Peter Liljeström5,

Marc Lecuit3,4,6, Christian Drosten1, Andres Merits2 and Beate Mareike Kümmerer1*

Abstract

Background: Chikungunya virus (CHIKV) has been responsible for large epidemic outbreaks causing fever,

headache, rash and severe arthralgia. So far, no specific treatment or vaccine is available. As nucleic acid

amplification can only be used during the viremic phase of the disease, serological tests like neutralization assays

are necessary for CHIKV diagnosis and for determination of the immune status of a patient. Furthermore,

neutralization assays represent a useful tool to validate the efficacy of potential vaccines. As CHIKV is a BSL3 agent,

neutralization assays with infectious virus need to be performed under BSL3 conditions. Our aim was to develop a

neutralization assay based on non-infectious virus replicon particles (VRPs).

Methods: VRPs were produced by cotransfecting baby hamster kidney-21 cells with a CHIKV replicon expressing

Gaussia luciferase (Gluc) and two helper RNAs expressing the CHIKV capsid protein or the remaining structural

proteins, respectively. The resulting single round infectious particles were used in CHIKV neutralization assays using

secreted Gluc as readout.

Results: Upon cotransfection of a CHIKV replicon expressing Gluc and the helper RNAs VRPs could be produced

efficiently under optimized conditions at 32°C. Infection with VRPs could be measured via Gluc secreted into the

supernatant. The successful use of VRPs in CHIKV neutralization assays was demonstrated using a CHIKV neutralizing

monoclonal antibody or sera from CHIKV infected patients. Comparison of VRP based neutralization assays in

24- versus 96-well format using different amounts of VRPs revealed that in the 96-well format a high multiplicity of

infection is favored, while in the 24-well format reliable results are also obtained using lower infection rates.

Comparison of different readout times revealed that evaluation of the neutralization assay is already possible at the

same day of infection.

Conclusions: A VRP based CHIKV neutralization assay using Gluc as readout represents a fast and useful method to

determine CHIKV neutralizing antibodies without the need of using infectious CHIKV.

Keywords: Chikungunya virus, Virus replicon particles, Neutralization assay, Gaussia luciferase

* Correspondence: kuemmerer@virology-bonn.de1Institute of Virology, University of Bonn Medical Centre, Bonn, Germany

Full list of author information is available at the end of the article

© 2013 Gläsker et al.; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the CreativeCommons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, andreproduction in any medium, provided the original work is properly cited.

Gläsker et al. Virology Journal 2013, 10:235

http://www.virologyj.com/content/10/1/235

BackgroundChikungunya virus (CHIKV) is an arthropod-borne, enve-

loped virus of the genus Alphavirus, family Togaviridae [1].

The single-stranded RNA genome of positive polarity is

capped at the 5’ end and polyadenylated at the 3’ end. It is

12 kilobases (kb) in length and contains two open reading

frames. The 5’ two-thirds of the genome are directly trans-

lated into the nonstructural proteins (nsP1-4) whereas the

structural proteins (capsid, E1 and E2) and two small cleav-

age products (E3 and 6k) are translated from a subgenomic

RNA, which corresponds to the last third of the genome

[1]. Due to the fact that alphaviruses exhibit a broad host

range (including avian, insect and mammalian cells), high

levels of protein expression and a small genome that is easy

to manipulate, they have been exploited as vectors for for-

eign gene expression or vaccination [2]. This is especially

the case for Sindbis virus (SINV), Semliki Forest virus

(SFV), and Venezuelan equine encephalitis virus (VEEV)

[3-5]. In this context, production of virus replicon particles

(VRPs) has been described, which allows the expression of

foreign genes via so called single round infectious particles.

Besides VRP systems, which are composed of an alphavirus

replicon and one helper RNA that encodes all structural

genes, VRP systems have been established in which the

capsid and envelope helper regions are encoded by two

separate helper RNAs [4,6,7]. This reduces the likelihood of

recombination and renders the production of replication-

proficient viruses (RPVs) negligible, thereby increasing bio-

safety [6,7].

CHIKV was first described in 1953 during an outbreak

in Tanzania, East Africa [8,9]. It came into focus again due

to large-scale epidemics in the Indian Ocean region

starting 2005/2006 [10,11]. Since then further recurring

epidemics have been observed from time to time in Africa,

Indian Ocean Islands, and many parts of South-East Asia

and virus emergence also occurred in European countries,

like Italy and France [12-16]. CHIKV is transmitted to

humans by culicids of the genus Aedes including Aedes

aegypti and Aedes albopictus [17-19]. Infection with the

virus results in Chikungunya fever (CHIKF), which is

characterized by high fever, fatigue, headache, nausea,

vomiting, rash, myalgia and severe arthralgia [8,20,21]. To

date, there is no specific treatment and no licensed vac-

cine available against infection with CHIKV.

To determine the immune status of a patient, a neutra-

lization (NT) assay is necessary. Furthermore, NT assays

represent an important method to validate the efficiency

of potential vaccines during vaccine development. Most

neutralization assays described so far for CHIKV involve

the use of infectious CHIKV particles. Besides plaque re-

duction neutralization assay, NT assays using immu-

nofluorescence or inhibition of the cytopathogenic effect

(CPE) as readouts have been described [22-26]. Recently,

a CHIKV pseudotyped lentiviral vector-based NT assay

was established [27]. The latter circumvents the use of

infectious CHIKV particles and readout was performed

several days after transduction by measuring luciferase

activity in the cells transduced with the CHIKV-

pseudotyped lentiviral vector [27]. The aim of our studies

was to also develop an NT assay for CHIKV infection,

which is independent of infectious particles but in

addition allows a very fast and easy readout. Several re-

porter proteins have been described, which allow to follow

up viral infection or replication. Besides fluorescent pro-

teins reporter proteins based on bioluminescent reactions

are widely used. The latter include for example Renilla (R)

or Firefly (F) luciferase (luc) but also Gaussia luciferase

(Gluc), which in contrast to Rluc and Fluc is secreted into

the supernatant thereby facilitating analyses [28,29].

Hence, we aimed to establish a CHIKVVRP basedNTassay

using the oxidative decarboxylation of coelenterazine cata-

lyzed by secreted Gluc leading to emission of blue light as

readout.

Results

Establishment of CHIKV replicon and helper constructs

For the production of CHIKV replicon particles a split

helper system should be applied since it has been de-

scribed that providing the structural proteins via two

separate helper constructs did not result in detectable

incidental production of infectious particles due to re-

combination [6,7].

A CHIKV replicon was established, in which the struc-

tural genes were replaced by a reporter gene (Figure 1A).

For easy readout, Gluc was chosen as reporter protein,

since it is secreted into the supernatant and therefore

allows easy readout without the need of preparing cell

lysates. Furthermore, two helper plasmids were esta-

blished expressing either the CHIKV capsid protein C

(pChikHelper-C) or the CHIKV envelope proteins p62-

6K-E1 (pChikHelper-E). The helper RNAs contain the 5’

and 3’ CHIKV replication signals and a subgenomic pro-

moter followed by either the capsid gene or the remaining

structural proteins, respectively (Figure 1A). The helper

RNAs as well as the CHIKV replicon RNA can be pro-

duced in vitro from plasmids, which contain these se-

quences under control of an SP6 promoter.

To prove efficient secretion of Gluc from the replicon

in vitro transcribed replicon RNA was electroporated into

baby hamster kidney-21 (BHK-21) cells. After electropo-

ration, increasing amounts of Gluc could be detected over

time in the supernatant demonstrating the efficient repli-

cation and secretion of Gluc of the established CHIKV

replicon (Figure 1B).

Conditions for optimized VRP production

For production of VRPs the CHIKV Gluc replicon was

coelectroporated with the two helper RNAs into BHK-

Gläsker et al. Virology Journal 2013, 10:235 Page 2 of 10

http://www.virologyj.com/content/10/1/235

21 cells. It has been observed that VRP production is

more efficient at temperatures lower than 37°C. Hence, to

compare VRP production at different temperatures, co-

electroporated cells were incubated at either 37°C or 32°C

and the activity of secreted Gluc was measured in Relative

Light Units (RLUs). Whereas at 37°C Gluc secretion in-

creased over time until 48 h post electroporation before

dropping down again, Gluc levels remained lower and

more constant at lower temperature (Figure 2A). Interest-

ingly, when the supernatants were passaged once on BHK

cells to analyze for produced VRPs it turned out that VRPs

had been released to higher and more constant levels for

the experiment performed at 32°C (Figure 2B). This sug-

gests that although Gluc was more efficiently secreted at

37°C the VRP production was indeed more stable at lower

temperature. Hence, for optimized VRP production, the

coelectroporated cells were incubated at 32°C and VRPs

were harvested at 36 h post electroporation. Harvested

VRPs were purified via a sucrose cushion. As determined

by CHIKV real-time PCR, the 30-fold concentrated VRP

stocks contained around 1 × 109 viral RNA copies/ml.

Comparison of test conditions with regard to VRP

infection rate, plate format and readout time

For comparable analyses same test conditions need to be

applied. These include among others parameters like the

amount of VRPs used in the NT assay as well as the read-

out time or the plate format used. Even though the VRP

concentration in established stocks can be determined via

real-time PCR to calculate defined infection rates it might

be desirable to use the same VRP batch for as many NT

assays as possible. NT assays using different amounts of

VRPs corresponding to multiplicities of infection (MOIs)

of 5, 0.5 and 0.05 calculated based on the determined

0 6 12 24 30 36 48

Hours post electroporation

B

A

1.0

0.0

2.0

3.0

RL

Us

x 1

08

Figure 1 CHIKV VRP system. (A) Schematic presentation of the

CHIKV replicon expressing Gluc marker and the CHIKV helper-C and

helper-E RNAs. Lines represent non-translated regions and boxes

represent translated regions, whereas white boxes indicate

nonstructural proteins and gray boxes indicate structural proteins.

The Gluc reporter is represented as black box. In the helper

constructs 5’ terminal nucleotides of the nsP1 gene important for

RNA replication were retained. Arrows indicate the position of the

subgenomic promoter. The solid black circle at the 5’ end of each

RNA represents the CAP structure; (A)n indicates the poly(A) tail.

(B) Kinetics of Gluc secretion after electroporation of CHIKV replicon

expressing Gluc. In vitro-synthesized replicon RNA was

electroporated into BHK cells and release of Gluc into the

supernatant was measured at the indicated time points.

0 12 24 36 48 60 72

37°C 32°C

Hours of supernatant collection

0 12 24 36 48 60 72

Hours post electroporation

0.5

0.0

1.0

1.5

2.0

RL

Us

x 1

07

3.0

0.0

6.0

9.0

RL

Us

x 1

07

B

A

Figure 2 Optimum of VRP production. (A) In vitro-synthesized

Gluc replicon RNA was coelectroporated with in vitro-synthesized

helper-C and helper-E RNA and cells were either incubated at 32°C

or 37°C. Supernatants were harvested at the indicated time points

after electroporation and Gluc activity was measured in RLUs.

(B) Same volumes of supernatants harvested at different time points

from the different incubation temperatures in (A) were used to

infect fresh BHK cells at 37°C. At 6 h post infection, Gluc activity was

measured in the supernatant.

Gläsker et al. Virology Journal 2013, 10:235 Page 3 of 10

http://www.virologyj.com/content/10/1/235

RNA copies in the VRP stock were evaluated. Another

reason for testing also lower MOIs was that this better re-

flects the conditions used in classical plaque neutralization

assays. There, a low MOI needs to be chosen to be able to

count single plaques for readout. Evaluation of different

MOIs was first carried out using the neutralizing mono-

clonal antibody (mAb) D3.62 directed against CHIKV E2

(T. Couderc and M. Lecuit, unpublished data). The re-

spective experiments were performed in either a 24- or

96-well format and readout was done at 6 and 24 h post

VRP infection (Figure 3). To evaluate the neutralization

activity, the infectivity rates measured via Gluc secretion

retained after VRP incubation with the respective antibody

dilution were determined in percent compared to the VRP

only control.

As shown in Figure 3, stepwise neutralization was ob-

served after applying the monoclonal antibody in different

dilutions. In the 24-well format the most consistent data

were obtained when VRPs were used at MOI 5 or MOI

0.5. Decreasing the MOI to 0.05 increased the deviation

from the mean. For the 96-well plate format MOI 5

yielded the most reliable data whereas the number of out-

liers increased at lower MOI. The least reliable data were

obtained in the 96-well format using an MOI of 0.05.

Comparing the data received after evaluating the NT assay

at 6 h post infection (p.i.) versus 24 h p.i. revealed similar

results indicating that the readout of the Gluc VRP assay

readily can be performed within one day.

Similar results were obtained when the same set of con-

ditions was tested using a human serum from a CHIKV

0

50

100

150

Mock

1:2

000

1:40

00

1:80

00

1:16

000

1:32

000

1:6

4000

1:1

28000

VRP

Neg. m

Ab

0

50

100

150

Mock

1:2

000

1:4

000

1:80

00

1:16

000

1:32

000

1:64

000

1:1

28000

VRP

Neg. m

Ab

0

50

100

150

Mock

1:2

000

1:40

00

1:80

00

1:16

000

1:32

000

1:64

000

VRP

Neg. m

Ab

0

50

100

150

Mock

1:20

00

1:4

000

1:80

00

1:16

000

1:32

000

1:6

4000

VRP

Neg. m

Ab

Infe

cti

vit

y (

%)

Infe

cti

vit

y (

%)

Antibody dilutionAntibody dilution

24 well, 6 h 24 well, 24 h

96 well, 24 h96 well, 6 h

MOI 5 MOI 0.5 MOI 0.05

Figure 3 VRP based NT assay using a monoclonal antibody. Assays were performed in either 24- or 96-well format as indicated. Neutralizing

monoclonal antibody directed against CHIKV E2 protein was serially diluted and preincubated with VRPs corresponding to an MOI of 5, 0.5 or

0.05, respectively. A monoclonal antibody against CHIKV capsid protein was used as control (Neg. mAb). Preincubated samples were used to

infect the BHK cells in the 24- or 96-well plates and readout via Gluc secreted into the supernatant was performed at 6 or 24 h post infection as

indicated. The bar labeled with VRP represents infection with the appropriate amount of VRPs not preincubated with monoclonal antibody. The

bar labeled with Mock represents the background measured in untreated (non-infected) BHK cells. The % infectivity was normalized to VRP

infection without monoclonal antibody incubation. Data represent means and standard deviation of experiments performed in triplicate.

Gläsker et al. Virology Journal 2013, 10:235 Page 4 of 10

http://www.virologyj.com/content/10/1/235

patient (1753/06) (Figure 4). Using immunofluorescence

analysis, the serum was confirmed to be positive against

CHIKV (see also Figure 5A).

Whereas the human CHIKV patient serum resulted in

dose dependent neutralization, a negative serum from a

healthy person did not show any neutralization activity

(Figure 4). Again, MOI 5 and MOI 0.5 turned out to be

the most applicable conditions in the 24-well format and

MOI 5 yielded the most consistent results in the 96-well

format (Figure 4).

Evaluation of VRP based neutralization assay in

comparison to plaque neutralization assay

To further evaluate the applicability of the established

VRP based NT assay comparison to a classical plaque

neutralization assay based on infectious CHIKV was

drawn. The respective analysis was done using again the

neutralizing monoclonal antibody D3.62, the patient

serum 1753/06, as well as two further sera (662/06 and

575/06) from CHIKV patients diseased during the 2006

epidemic in the Indian Ocean region [30]. All sera as

well as the monoclonal antibody were confirmed to be

reactive against CHIKV using indirect immunofluores-

cence (Figure 5A). The plaque neutralization assay was

performed in a 6-well plate format using 100 plaque

forming units (PFU) per well (Figure 5B), whereas for

the VRP based NT assay both the 24-well and 96-well

format was applied using MOI 5 (Figure 5C). The

neutralization activity of a serum is usually judged by de-

termining the serum dilution, which results in 50 or 80%

0

50

100

150

200

Mock

1:5

00

1:1

000

1:2

000

1:4

000

1:8

000

1:16

000

1:32

000

1:64

000

VRP

Neg. s

erum

0

50

100

150

200

Mock

1:5

00

1:1

000

1:2

000

1:4

000

1:8

000

1:16

000

1:32

000

1:64

000

VRP

Neg. s

erum

0

50

100

150

200

Mock

1:5

00

1:1

000

1:2

000

1:4

000

1:8

000

1:16

000

1:32

000

1:64

000

VRP

Neg. s

erum

0

50

100

150

200

Mock

1:5

00

1:1

000

1:2

000

1:4

000

1:8

000

1:16

000

1:32

000

1:64

000

VRP

Neg. s

erum

)%(

ytivit

cef

nI)

%(yti

vitc

efnI

noitulid mureSnoitulid mureS

h 42 ,llew 42h 6 ,llew 42

96 well, 24 h96 well, 6 h

MOI 5 MOI 0.5 MOI 0.05

Figure 4 VRP based NT assay using patient serum. Assays were performed in either 24- or 96-well format as indicated. Human serum from a

CHIKV patient was serially diluted and preincubated with VRPs corresponding to an MOI of 5, 0.5 or 0.05, respectively. Preincubated samples were

used to infect the BHK cells in the 24- or 96-well plates and readout via Gluc secreted into the supernatant was performed at 6 or 24 h post

infection as indicated. The bar labeled with VRP represents infection with the appropriate amount of VRPs not preincubated with patient sera.

The bar labeled with Mock represents the background measured in untreated (non-infected) BHK cells. Negative (Neg.) serum from a person not

infected with CHIKV was used as control. The % infectivity was normalized to VRP infection without serum incubation. Data represent means and

standard deviation of experiments performed in triplicate.

Gläsker et al. Virology Journal 2013, 10:235 Page 5 of 10

http://www.virologyj.com/content/10/1/235

reduction of infectivity (NT50 or NT80 titer, respectively).

When using different methods of NT assays, comparison

of absolute NT50 values is limited due to different test

conditions. However, the order of neutralizing activity

among antisera tested should be the same. Table 1 pro-

vides details on the predicted NT50 values using the data

sets depicted in Figure 5B and 5C. Overall, the NT50 ti-

ters determined via the classical plaque neutralization

assay were lower than those observed in the VRP assays

(Table 1). Nevertheless, the same order with regard to

neutralizing activity of the samples was obtained for all

NT assay types, with the monoclonal antibody neutraliz-

ing the best and serum 575/06 neutralizing the least

(Table 1). This comparison was supported by narrow

95% confidence intervals (CI) determined for each

serum (Table 1). In the 96-well VRP assay format, all

95% CI overlapped partially. In contrast, the 95% CI

overlapped marginally only for two sera in the plaque

assay, and no overlap at all was observed in the 24-well

VRP assay format. Hence, the CHIKV VRP based NT

1:1

000

1:2

000

1:4

000

1:8

000

1:1

6000

1:3

2000

1:6

4000

1:1

28000

Viru

s

1:1

000

1:2

000

1:4

000

1:8

000

1:1

6000

1:3

2000

1:6

4000

1:1

28000

VRP

Neg. s

erum

Infe

cti

vit

y(%

)

D3.62 1753/06 662/06 575/06

Dilution

Infe

cti

vit

y(%

)In

fec

tivit

y(%

)

Dilution

96 well, 6 h

C

B

D3.62 1753/06 662/06 575/06

D3.6

21753/0

6662/0

6575/0

6N

eg

. seru

m

CHIKV mock

A

1:1

000

1:2

000

1:4

000

1:8

000

1:1

6000

1:3

2000

1:6

4000

1:1

28000

VRP

Neg. s

erum

24 well, 6 h

0

50

100

150

0

50

100

150

0

50

100

150

Figure 5 Comparison of plaque neutralization and VRP based NT assays. (A) CHIKV infected and non-infected (mock) BHK cells were used

for indirect immunofluorescence analyses using the indicated monoclonal antibody or human sera. Nuclei were stained with DAPI. The bar

represents 25 μm. (B) For the plaque neutralization assay, serial dilutions of monoclonal antibody D3.62 or three patient sera were preincubated

with infectious CHIKV. NT assays were performed in 6-well format with readout at 48 h p.i. using crystal violet staining. The bar labeled with Virus

represents a non-neutralized infectivity control, which was set 100%. The % infectivity was normalized to the non-neutralized virus infection. The

gray dotted line indicates the 50% infectivity threshold. Data represent the means and ranges of duplicate infection experiments. (C) For the VRP

based NT assay, serial dilutions of monoclonal antibody D3.62 or three patient sera were preincubated with VRPs. NT assays were performed in

either 24-well plates (top panel) or 96-well plates (bottom panel) using VRPs at an MOI of 5. Readout was performed at 6 h p.i. via measurement

of Gluc secreted into the supernatant. The bar labeled with VRP represents infection with the appropriate amount of VRPs not preincubated with

patient sera/antibody. Negative (Neg.) serum from a person not infected with CHIKV was used as control. The % infectivity was normalized to VRP

infection without serum/antibody incubation. The gray dotted line indicates the 50% infectivity threshold. Data represent average and standard

deviation of experiments performed in triplicate.

Gläsker et al. Virology Journal 2013, 10:235 Page 6 of 10

http://www.virologyj.com/content/10/1/235

assay represents a useful alternative to CHIKV NT as-

says involving infectious virus and in addition allows a

fast and easy analysis of neutralizing antibodies in serum

samples that can be performed within one day.

DiscussionThe present study shows that Gluc expressing VRPs rep-

resent a useful tool to determine neutralizing antibodies

without the need of infectious CHIKV particles. VRPs

were produced by cotransfection of a CHIKV replicon ex-

pressing Gluc and two helper RNAs. First studies describ-

ing the production of VRPs involved the cotransfection of

a single helper RNA encoding all structural proteins

[3,31]. However, in this constellation a single RNA recom-

bination event is sufficient to reproduce a full-length gen-

ome resulting in production of infectious particles [31].

Expressing the structural proteins via two helper RNAs

circumvents this problem and it was shown that using this

strategy production of infectious particles due to recom-

bination is negligible [2,6], which is an important aspect

with regard to biosafety issues.

For certain alphaviruses, like SFV and SINV, expres-

sion of the structural proteins was described to be

dependent on an enhancer sequence located in the 5’

terminal part of the sequence encoding the capsid pro-

tein [32,33]. To ensure in these cases efficient translation

of the envelope proteins in a bipartite helper packaging

system, the enhancing sequence of the capsid protein

was fused 5’-terminally to the envelope genes [6,7].

However, for VEEV a split helper system was described

in which the envelope proteins were expressed without a

capsid translation enhancer [4]. The latter implicates

that the enhancer sequence is not necessarily needed in

the VEEV context [4]. This seems to be also the case for

CHIKV, as no stable hairpin structure comparable with

capsid enhancers of SFV and SINV could be predicted in

the corresponding region of the CHIKV genome. Never-

theless, it was also observed that the CHIKV replicon

could be efficiently packed using split helper RNAs of

SFV (A. Merits and A. Lulla, unpublished data). There-

fore the effect of classical SFV capsid enhancer was

tested also in the context of CHIKV helper RNAs. In

this experiment the presence of enhancer sequence not

only failed to increase but reduced the VRP production

(A. Lulla, V. Lulla, unpublished data). Therefore in our

split helper system the helper-E construct used did not

contain any capsid enhancer and still allowed efficient

production of VRPs.

Alphaviruses are known to be transmitted by insect vec-

tors, which exhibit body temperatures below 37°C. Hence,

the VRP production was also tested at lower temperature

and has proven to be more efficient at 32°C than at 37°C.

Reducing the temperature to 28°C even slightly increased

the VRP yield further but simultaneously slowed down the

production process resulting in a prolonged production

time (data not shown).

To facilitate and accelerate the readout of the NT assay

we established a VRP system expressing Gluc, which is se-

creted into the supernatant [28]. Hence, measuring can

directly be performed from the supernatant without the

need of lysing cells. The latter was described to be neces-

sary for the pseudotyped lentiviral vector-based CHIKV

NT assay, which used Fluc as reporter protein [27]. In

addition, the humanized Gluc has been described to be

1000-fold more sensitive compared to humanized Rluc or

Fluc [28,34]. Furthermore, Gluc is very stable (half-life

around 6 days [35]), which allows storage of the super-

natant at 4°C for several days without significantly loosing

activity [28]. On the other hand, due to the high sensitiv-

ity, Gluc reporter assays are likely to be prone to pipetting

errors [28]. Hence, pipetting smaller volumes when work-

ing in the 96-well format at lower MOI might be one

reason for the higher deviations observed in this experi-

mental setup. As already described, it is not recommended

to use a pipetting volume below 10 μl for Gluc assays [28].

Nevertheless, when using an MOI of 5, reliable results

were also obtained in the 96-well format. Using an even

higher MOI is not recommended. Besides consuming ex-

cessive amounts of VRPs, the risk to exhaust the assay ex-

ists. Also, especially at 24 h post infection, the amount of

Gluc released into the supernatant after using an MOI of

50 was so high that samples had to be diluted to allow

Table 1 Neutralizing antibody titers (NT50)

Virus-NTa VRP-NT (24 well)b VRP-NT (96 well)b

mAb/ Serum NT50c (95% CI)e NT50

d (95% CI) NT50d (95% CI)

D3.62 16256 (13465 – 19731) 58306 (45196 – 79754) 26885 (22799 – 32054)

1753/06 5978 (4882 – 7350) 16203 (12911 – 20881) 26314 (21004 – 34401)

662/06 3582 (2581 – 5061) 13437 (11819 – 15382) 18743 (15050 – 24194)

575/06 1375 (615 – 2183) 4511 (3590 – 5662) 10911 (7743–15876)

a Neutralization assay performed with virus particles (plaque assay).

b Neutralization assay performed with virus replicon particles (Gluc assay).

c NT50 values were determined via probit analysis using the data set of Figure 5B.

d NT50 values were determined via probit analysis using the data sets of Figure 5C.

e 95% confidence interval.

Gläsker et al. Virology Journal 2013, 10:235 Page 7 of 10

http://www.virologyj.com/content/10/1/235

measurement of Gluc activity (data not shown). This

could result in an additional source of variation.

The 96-well format might especially be favorable to

use when only small sample volumes are available or

when neutralizing titers have to be determined for an

extensive number of samples. Working in a 96-well for-

mat allows to directly transfer the Gluc containing

supernatant from the NT assay plate to a corresponding

96-well readout plate using a multichannel pipette

thereby avoiding time consuming single pipetting steps.

Furthermore, both the recently described pseudotyped

lentiviral vector-based NT assay [27] and our VRP based

NT assay have the advantage that the use of infectious

CHIKV particles is avoided. However, for the lentiviral

system readout is performed several days after transduc-

tion, whereas our VRP based assay allows carrying out

the NT assay including readout within one day.

Performing different types of NT assays results in fairly

different scales of NT titers. This was also observed

when comparing the lentiviral vector-based NT assay

with a classical plaque neutralization assay [27]. Simi-

larly, the antibody dilutions for which the infectivity was

inhibited by 50% were different for each sample compar-

ing our VRP based assay with a plaque neutralization

assay. Nevertheless, the order of neutralization potency

among the samples was consistent (Table 1) indicating

that the assay is suitable to determine comparative

neutralization activities. Furthermore, the fact that no

infectious CHIKV particles are needed and that readout

can already be performed after 6 h makes the established

Gluc VRP based NT assay a valuable tool to study pa-

tient or animal serum samples. Besides diagnostic pur-

poses, analyses of neutralizing antibodies in human sera

will help to understand immune mechanisms involved in

CHIKV disease and analyses in animals will be useful in

evaluation steps during CHIKV vaccine development.

Conclusions

We have established an NT assay based on CHIKV VRPs

using secreted Gluc as readout. This circumvents the

use of infectious CHIKV and allows an easy readout.

The VRP based assay can be performed in microtiter

plates and readout can be done within a single day mak-

ing it suitable for high-throughput analyses of CHIKV

neutralization antibodies in human or animal sera.

Methods

Cells and viruses

Baby hamster kidney-21 (BHK-21) cells were maintained

in Glasgow´s Minimum Essential Medium (GMEM) sup-

plemented with 5% fetal bovine serum (FBS), 1% L-

glutamine, 10% tryptose phosphate broth, 20 mM HEPES

pH 7.2, 100 U/ml penicillin and 0.1 mg/ml streptomycin

at 37°C and 5% CO2.

A stock of recombinant wild-type CHIKV (CHIKV-

LR2006 OPY1, [36]) was produced on BHK-21 cells. Cells

were infected at an MOI of 0.1 for 1 h and virus harvested

from the supernatant 2 days p.i. was stored at −80°C. Ex-

periments with infectious CHIKV were performed in a

biosafety level 3 laboratory.

Antibodies and antisera

Monoclonal antibody D3.62 (35 mg/ml) is directed against

CHIKV E2 protein (T. Couderc and M. Lecuit, unpublished

data). Human sera containing neutralizing CHIKV anti-

bodies were obtained from patients returning to Europe

from the Indian Ocean region in 2006 and have been de-

scribed previously [30]. Briefly, sera from patient 575/06

returned from the Seychelles, patient 662/06 from La

Réunion and patient 1753/06 from Mauritius. Monoclonal

antibody Z2G2 recognizing CHIKV capsid protein was

kindly provided by Petra Emmerich (Bernhard Nocht

Institute, Hamburg, Germany).

Indirect immunofluorescence

BHK-21 cells were cultured on glass coverslips and

infected with CHIKV-LR2006 OPY1 at an MOI of 0.5. At

24 h after infection, cells were fixed with ice-cold metha-

nol / acetone (1:1) and air-dried. Serum samples or mo-

noclonal antibodies were diluted 1:5000 in PBS and

incubated for 1 h at 37°C on fixed cells. Serum antibodies

were detected by Alexa 488-labeled goat anti-human IgG

(Jackson ImmunoResearch, 1:500) and monoclonal anti-

bodies by cyanine 3-conjugated goat anti-mouse IgG

(Jackson ImmunoResearch, 1:200) using fluorescence mi-

croscopy (Axiovert 40 microscope, Zeiss). Nuclei were

stained with 4',6-diamidino-2-phenylindole (DAPI).

Plasmid constructs

The construction of full-length infectious cDNA of

CHIKV-LR2006 OPY1 is described elsewhere [36]. To ob-

tain plasmid pChikRepl containing the cDNA of a CHIKV

replicon, the region of the infectious cDNA clone corre-

sponding to the coding sequence of CHIKV structural

proteins (nucleotides 7565–11310 of CHIKV-LR2006

OPY1) was replaced with sequence 5’ CCTAGGTAAT

AAGTTTAAAC 3’ (recognition sites of restriction endo-

nucleases AvrII and MssI (PmeI) are underlined) by PCR-

mediated mutagenesis. The coding sequence of Gluc

(optimized for human codon usage, synthesized by

GeneArt (Life Technologies)) was PCR amplified using

primers 5’ TATTCCTAGGCCACCATGGGAGTCAAAG

TTCTGTTTGCC 3’ (start codon is in bold, recognition

site of AvrII restriction enzyme is underlined) and 5’

TGATGTTTAAACTTAGTCACCACCGGCCCCCTTG

ATCTT 3’ (stop codon is in bold, recognition site of

MssI restriction enzyme is underlined); the obtained

fragment was digested with AvrII and MssI enzymes

Gläsker et al. Virology Journal 2013, 10:235 Page 8 of 10

http://www.virologyj.com/content/10/1/235

(Thermo Scientific, USA) and inserted into pChikRepl

vector digested with the same enzymes. The resulting

plasmid was designated as pChikRepl-Gluc. To obtain a

plasmid, containing the cDNA of a packaging construct

for ChikRepl-Gluc, the region of the infectious cDNA

corresponding to nucleotides 308–7419 of CHIKV-

LR2006 OPY1 [36] was replaced by sequence 5’

GTTTAAAC 3’ (recognition site of MssI restriction en-

zyme) using PCR-mediated mutagenesis; the resulting

plasmid was designated pChikHelper. To obtain plas-

mids for a split helper system the following changes

were introduced into pChikHelper using PCR based

mutagenesis. First, to obtain pChikHelper-E the region

corresponding to nucleotides 461–1248 (coding region

for capsid protein) of pChikHelper was replaced by se-

quence 5’ CCTAGGCCACCATG 3’ (recognition site of

AvrII restriction enzyme is underlined). Second, to obtain

pChikHelper-C the region corresponding to nucleotides

1246–4206 (coding region for E3-E2-E1 glycoproteins) of

pChikHelper was replaced by sequence 5’

TAAGTTTAAAC 3’ (recognition site of MssI restriction

enzyme is underlined). All constructs were verified using

Sanger sequencing. Sequences of all plasmid vectors are

available from authors upon request.

Electroporation and VRP production

Replicon and helper DNA templates were linearized with

NotI and in vitro transcribed using the mMESSAGE

mMACHINE SP6 Kit (Ambion). For recovery of VRPs 1

μg of each, the replicon and helper RNAs, were

coelectroporated into 1 × 106 BHK-21 cells using BHK-

21 preset protocol of Gene Pulser Xcell (Bio-Rad). Cells

were seeded into 25 cm2 flasks and incubated at 32°C

for 36 h. For large-scale VRP production supernatants of

six electroporations were pooled for purification. After

removing detached cells and cell debris by clarifying for

30 min at 4000 g and 4°C, the supernatants were passed

through a 0.45 μm filter and applied to a 20% sucrose

cushion followed by centrifugation for 90 min at 25000

rpm and 4°C (SW 32 Ti rotor, Beckman Coulter). Pellets

were resuspended in TNE buffer (50 mM Tris–HCl, pH

7.4, 100 mM NaCl, 0.5 mM EDTA) over night at 4°C be-

fore passing through a 0.22 μm filter. VRPs were stored

at −80°C.

Real-time reverse transcription-PCR

RNA from VRPs in the cell culture supernatant or after su-

crose cushion purification was extracted using NucleoSpin

RNA Virus Kit (Macherey-Nagel). The isolated RNA was

detected by real-time reverse transcription-PCR (RT-PCR)

using the SuperScript III One-Step RT-PCR System with

Platinum Taq DNA polymerase (Invitrogen). For detection

of CHIKV RNA, the 25 μl reaction contained 3 μl of RNA,

1x Reaction Mix, 0.5 μg BSA, 0.5 μl SS III RT / Platinum

Taq Mix, 0.6 μM of primer CHIKSI, 0.6 μM of primer

CHIKASI and 0.2 μM of the CHIKP probe [30]. Thermo-

cycling was performed on a LightCycler 480 (Roche) pro-

grammed for: 30 min at 50°C for reverse transcription, 2

min at 94°C to activate the Taq polymerase and 45 PCR

amplification cycles of 15 sec at 94°C, 30 sec at 58°C and

30 sec at 72°C. Photometrically quantified in vitro-RNA

transcripts of the target regions were used in the PCR to

generate a standard curve for viral RNA quantification.

Luciferase assay

Gluc was measured from the supernatant of infected cells

using Renilla Luciferase Assay System (Promega) according

to the manufacturer’s instructions. Luciferase activity was

measured in RLUs. Measurement was performed auto-

mated in a Synergy 2 microplate reader (BioTek) using

polystyrol microplates (Greiner Bio-one).

VRP neutralization assay

The day before infection, 24- or 96-well plates were

seeded with 1 × 105 or 2 × 104 BHK-21 cells per well, re-

spectively. VRPs were applied in the NT assay at MOI 5,

0.5 or 0.05 (calculated based on VRP RNA copies/ml). All

dilutions were performed using GMEM supplemented

with 1% FBS. VRP dilutions were incubated with serially

diluted antibody or human serum for 1 h at 37°C before

adding the mixture to a monolayer of BHK-21 cells in

either a 24-well plate (total volume per well 200 μl) or a

96-well plate (total volume per well 40 μl). After incuba-

tion for 1 h at 37°C the inoculum was removed, cells were

washed once with PBS and medium was added. Superna-

tants for Gluc measurement were taken at 6 h and 24 h p.

i. Neutralization potency was determined as percentage of

measured Gluc activity compared to Gluc readout after

VRP application without antibody/serum.

Plaque reduction neutralization assay

About 100 PFU of infectious wild-type virus were incu-

bated with serially diluted antibody or human serum for

1 h at 37°C, added to a monolayer of BHK-21 cells in a

6-well plate (total volume per well 600 μl) and incubated

at 37°C for 1 h. Subsequently, the inoculum was replaced

by an overlay containing 0.6% agarose in MEM. At 48 h

p.i. cells were fixed with 7% formaldehyde and plaques

were visualized using crystal violet staining (1% crystal

violet in 50% ethanol). Neutralization potency was deter-

mined as percentage of plaque titers compared to plaque

titers after virus infection without antibody/serum.

Statistics

Probit analysis for determination of NT50 values was done

with the SPSSV21 software package (IBM, Ehningen,

Germany).

Gläsker et al. Virology Journal 2013, 10:235 Page 9 of 10

http://www.virologyj.com/content/10/1/235

Competing interests

The authors declare that they have no competing interests.

Authors’ contributions

SG, BMK conceived and designed experiments; AL, VL, AM designed and

established constructs for VRP production; TC, ML, CD contributed CHIKV

antibody/sera; JFD performed statistical analyses; PL participated in

optimized VRP production; SG, AM, BMK wrote the paper. All authors have

read and approved the manuscript.

Acknowledgments

We thank Janett Wieseler for excellent technical assistance and Ionna

Dimitriou for help with statistical analyses. This work was supported by the

European Union FP7 project “Integrated Chikungunya Research” (ICRES; grant

no. 261202), Institut Pasteur, Inserm, Ville de Paris, Fondation BNP-Paribas,

and LabEx IBEID.

Author details1Institute of Virology, University of Bonn Medical Centre, Bonn, Germany.2Institute of Technology, University of Tartu, Tartu, Estonia. 3Institut Pasteur,

Biology of Infection Unit, Paris, France. 4Inserm U1117, Paris, France.5Department of Microbiology, Tumor and Cell Biology, Karolinska Institutet,

Stockholm, Sweden. 6Sorbonne Paris Cité, Institut Imagine, Paris Descartes

University, Paris, France.

Received: 10 March 2013 Accepted: 3 July 2013

Published: 15 July 2013

References

1. Kuhn RJ: Togaviridae: the viruses and their replicatioon. In Fields Virology,

Volume 1. 5th edition. Edited by Knipe DM, Howley PM. Philadelphia: Lippincott

Williams & Wilkons; 2007:1001–1022.

2. Frolov I, Hoffman TA, Pragai BM, Dryga SA, Huang HV, Schlesinger S,

Rice CM: Alphavirus-based expression vectors: strategies and

applications. Proc Natl Acad Sci USA 1996, 93:11371–11377.

3. LiljeströmP, Garoff H:Anewgeneration of animal cell expression vectors based

on the Semliki Forest virus replicon. Biotechnology (N Y) 1991, 9:1356–1361.

4. Pushko P, Parker M, Ludwig GV, Davis NL, Johnston RE, Smith JF: Replicon-

helper systems from attenuated Venezuelan equine encephalitis virus:

expression of heterologous genes in vitro and immunization against

heterologous pathogens in vivo. Virology 1997, 239:389–401.

5. Xiong C, Levis R, Shen P, Schlesinger S, Rice CM, Huang HV: Sindbis virus:

an efficient, broad host range vector for gene expression in animal cells.

Science 1989, 243:1188–1191.

6. Smerdou C, Liljeström P: Two-helper RNA system for production of

recombinant Semliki forest virus particles. J Virol 1999, 73:1092–1098.

7. Frolov I, Frolova E, Schlesinger S: Sindbis virus replicons and Sindbis virus:

assembly of chimeras and of particles deficient in virus RNA. J Virol 1997,

71:2819–2829.

8. Robinson MC: An epidemic of virus disease in Southern Province,

Tanganyika Territory, in 1952–53. I. Clinical features. Trans R Soc Trop Med

Hyg 1955, 49:28–32.

9. Ross RW: The Newala epidemic. III. The virus: isolation, pathogenic

properties and relationship to the epidemic. J Hyg (Lond) 1956, 54:177–191.

10. Enserink M: Infectious diseases. Massive outbreak draws fresh attention

to little-known virus. Science 2006, 311:1085.

11. Charrel RN, de Lamballerie X, Raoult D: Chikungunya outbreaks–the

globalization of vectorborne diseases. N Engl J Med 2007, 356:769–771.

12. D'Ortenzio E, Grandadam M, Balleydier E, Dehecq JS, Jaffar-Bandjee MC, Michault

A, Andriamandimby SF, Reynes JM, Filleul L: Sporadic cases of chikungunya,

Reunion Island, August 2009. Euro Surveill 2009, 14(35).

13. Paupy C, Kassa Kassa F, Caron M, Nkoghé D, Leroy EM: A chikungunya

outbreak associated with the vector Aedes albopictus in remote villages

of Gabon. Vector Borne Zoonotic Dis 2012, 12:167–169.

14. Renault P, Balleydier E, D'Ortenzio E, Baville M, Filleul L: Epidemiology of

Chikungunya infection on Reunion Island, Mayotte, and neighboring

countries. Med Mal Infect 2012, 42:93–101.

15. Rezza G, Nicoletti L, Angelini R, Romi R, Finarelli AC, Panning M, Cordioli P,

Fortuna C, Boros S, Magurano F, Silvi G, Angelini P, Dottori M, Ciufolini MG,

Majori GC, Cassone A, CHIKV study group: Infection with chikungunya

virus in Italy: an outbreak in a temperate region. Lancet 2007,

370:1840–1846.

16. Grandadam M, Caro V, Plumet S, Thiberge JM, Souares Y, Failloux AB, Tolou

HJ, Budelot M, Cosserat D, Leparc-Goffart I, Despres P: Chikungunya virus,

southeastern France. Emerg Infect Dis 2011, 17:910–913.

17. Diallo M, Thonnon J, Traore-Lamizana M, Fontenille D: Vectors of

Chikungunya virus in Senegal: current data and transmission cycles.

Am J Trop Med Hyg 1999, 60:281–286.

18. Kumar NP, Sabesan S, Krishnamoorthy K, Jambulingam P: Detection of

Chikungunya virus in wild populations of Aedes albopictus in Kerala

State, India. Vector Borne Zoonotic Dis 2012, 12:907–911.

19. Tsetsarkin KA, Vanlandingham DL, McGee CE, Higgs S: A single mutation in

chikungunya virus affects vector specificity and epidemic potential.

PLoS Pathog 2007, 3:e201.

20. Borgherini G, Poubeau P, Staikowsky F, Lory M, Le Moullec N, Becquart JP,

Wengling C, Michault A, Paganin F: Outbreak of chikungunya on Reunion

Island: early clinical and laboratory features in 157 adult patients.

Clin Infect Dis 2007, 44:1401–1407.

21. Brighton SW, Prozesky OW, de la Harpe AL: Chikungunya virus infection. A

retrospective study of 107 cases. S Afr Med J 1983, 63:313–315.

22. Kam YW, Simarmata D, Chow A, Her Z, Teng TS, Ong EK, Renia L, Leo YS,

Ng LF: Early appearance of neutralizing immunoglobulin G3 antibodies is

associated with chikungunya virus clearance and long-term clinical

protection. J Infect Dis 2012, 205:1147–1154.

23. Kumar M, Sudeep AB, Arankalle VA: Evaluation of recombinant E2 protein-

based and whole-virus inactivated candidate vaccines against

chikungunya virus. Vaccine 2012, 30:6142–6149.

24. Kam YW, Lum FM, Teo TH, Lee WW, Simarmata D, Harjanto S, Chua CL, Chan YF,

Wee JK, Chow A, Lin RT, Leo YS, Le Grand R, Sam IC, Tong JC, Roques P,

Wiesmüller KH, Rénia L, Rötzschke O, Ng LF: Early neutralizing IgG response to

Chikungunya virus in infected patients targets a dominant linear epitope on

the E2 glycoprotein. EMBO Mol Med 2012, 4:330–343.

25. Khan M, Dhanwani R, Rao PV, Parida M: Subunit vaccine formulations

based on recombinant envelope proteins of Chikungunya virus elicit

balanced Th1/Th2 response and virus-neutralizing antibodies in mice.

Virus Res 2012, 167:236–246.

26. Wang E, Volkova E, Adams AP, Forrester N, Xiao SY, Frolov I, Weaver SC: Chimeric

alphavirus vaccine candidates for chikungunya. Vaccine 2008, 26:5030–5039.

27. Kishishita N, Takeda N, Anuegoonpipat A, Anantapreecha S: Development

of a Pseudotyped Lentiviral Vector–Based Neutralization Assay for

Chikungunya Virus Infection. J Clin Microbiol 2013, 51:1389–1395.

28. Tannous BA: Gaussia luciferase reporter assay for monitoring biological

processes in culture and in vivo. Nat Protoc 2009, 4:582–591.

29. Verhaegent M, Christopoulos TK: Recombinant Gaussia luciferase.

Overexpression, purification, and analytical application of a bioluminescent

reporter for DNA hybridization. Anal Chem 2002, 74:4378–4385.

30. Panning M, Grywna K, van Esbroeck M, Emmerich P, Drosten C:

Chikungunya fever in travelers returning to Europe from the Indian

Ocean region, 2006. Emerg Infect Dis 2008, 14:416–422.

31. Berglund P, Sjoberg M, Garoff H, Atkins GJ, Sheahan BJ, Liljestrom P: Semliki

Forest virus expression system: production of conditionally infectious

recombinant particles. Biotechnology (N Y) 1993, 11:916–920.

32. Frolov I, Schlesinger S: Translation of Sindbis virus mRNA: effects of

sequences downstream of the initiating codon. J Virol 1994, 68:8111–8117.

33. Sjöberg EM, Suomalainen M, Garoff H: A significantly improved Semliki

Forest virus expression system based on translation enhancer segments

from the viral capsid gene. Biotechnology (N Y) 1994, 12:1127–1131.

34. Tannous BA, Kim DE, Fernandez JL, Weissleder R, Breakefield XO: Codon-

optimized Gaussia luciferase cDNA for mammalian gene expression in

culture and in vivo. Mol Ther 2005, 11:435–443.

35. Wurdinger T, Badr C, Pike L, de Kleine R, Weissleder R, Breakefield XO,

Tannous BA: A secreted luciferase for ex vivo monitoring of in vivo

processes. Nat Methods 2008, 5:171–173.

36. Pohjala L, Utt A, Varjak M, Lulla A, Merits A, Ahola T, Tammela P: Inhibitors

of alphavirus entry and replication identified with a stable Chikungunya

replicon cell line and virus-based assays. PLoS One 2011, 6:e28923.

doi:10.1186/1743-422X-10-235Cite this article as: Gläsker et al.: Virus replicon particle basedChikungunya virus neutralization assay using Gaussia luciferase asreadout. Virology Journal 2013 10:235.

Gläsker et al. Virology Journal 2013, 10:235 Page 10 of 10

http://www.virologyj.com/content/10/1/235