Veterinaria Italiana, Volume 51 (1), January-March 2015

ISSN 0505-401X

Volume 51 (1)Gennaio-MarzoJanuary-March2015

Rivista trimestrale di Sanità Pubblica Veterinaria,edita dall’Istituto Zooprofilattico Sperimentale

dell’Abruzzo e del Molise “G. Caporale”

A quarterly journal devoted to veterinary public health,veterinary science and medicine,

published by the Istituto Zooprofilattico Sperimentale dell’Abruzzo e del Molise ‘G. Caporale’ in Teramo, Italy

Volume 51 (1), 2015

Giovanni Agostino Cassana è un pittore attivo nel periodo tardo Barocco tra Venezia, Firenze e Genova. In assenza quasi totale di dati certi risulta difficile ricostruirne la biografia e il catalogo. Figlio di Francesco e fratello di Nicolò, anch’essi pittori, iniziò come ritrattista per poi dedicarsi al genere animalistico, per lo più soggetti raffiguranti animali da cortile, e alla natura morta. L’attribuzione della coppia di tele della Pinacoteca Civica, raffiguranti due galli, si basa sul confronto non solo con il Combattimento di galli del Museo Civico di Padova ma anche con il Galletto conservato nei depositi di Palazzo Pitti a Firenze.

Giovanni Agostino Cassana was a late Baroque painter active in between Venice, Florence and Genoa. Given the almost total absence of reliable data is difficult to reconstruct his biography and his catalogue. Son of Francis and brother of Nicholas, also painters, he began as a portraitist and to focus later to the animalistic genre, mostly depicting barnyard animals and still life. The attribution of the pair of paintings from the Pinacoteca Civica, representing two roosters, rests on the comparison with the Cockfight hosted at the Museo Civico of Padua (Italy) and with the Cockerel stored in the warehouses of the Pitti Palace in Florence, Italy.

A cura di/By Polo Museale Città di Teramo

Giovanni Agostino Cassana(Venezia, c. 1658 - Genova, 1720)Gallo. Olio su tela/Oil on canvas, cm 55x70.Pinacoteca Civica, Teramo, Italy

Comitato direttivo Managing Scientific Board

Romano MarabelliFernando Arnolfo

Direttore Editor-in-Chief

Giovanni Savini

Membri onorari Honorary Members

Comitato di redazione Editorial Board

Comitato scientifico Scientific Advisory Board

Hassan Abdel Aziz Aidaros – EgyptAyayi Justin Akakpo – SenegalNicola T. Belev – BulgariaLouis Blajan – FranceStuart C. MacDiarmid – New ZealandJ. Gardner Murray – AustraliaYoshihiro Ozawa – JapanAlexander N. Panin – Russia

Victor E. Saraiva – BrazilAristarhos M. Seimenis – GreeceArnon Shimshony – IsraelSamba Sidibé – MaliJames H. Steele – United States of AmericaGavin R. Thomson – South AfricaCarlo Turilli – ItalyNorman G. Willis – Canada

L. Garry Adams – United States of AmericaMenachem Banai – IsraelElie K. Barbour – LebanonA.C. David Bayvel – New ZealandGiorgio Battelli – ItalyRoy G. Bengis – South AfricaIngrid E. Bergmann – ArgentinaPeter F. Billingsley – United States of AmericaSilvio Borrello – ItalyCanio Buonavoglia – ItalyMike Brown – United KingdomGideon Brücknerr – South AfricaGiovanni Cattoli – ItalyBernadette Connolly – United KingdomJulio De Freitas – BrazilPiergiuseppe Facelli – ItalyGianluca Fiore – ItalyCesidio Flammini – ItalyRiccardo Forletta – ItalyBruno Garin-Bastuji – FranceGiorgio Giorgetti – ItalyRob Gregory – New Zealand

Anwar Hassan – MalaysiaBarry J. Hill – United KingdomKatsuyuki Kadoi – JapanBruce Kaplan – United States of AmericaR. Paul Kitching – CanadaCorinne I. Lasmézas – FranceSalvatore Magazzù – ItalyFranco Mutinelli – ItalyKlaus Nielsen – CanadaLisa Oakley – New ZealandMassimo Palmarini – United KingdomAttilio Pini – ItalySantino Prosperi – ItalyFranco M. Ruggeri – ItalyDomenico Rutili – ItalyPaul Sutmoller – The NetherlandsPeter M. Thornber – AustraliaSilvio Arruda Vasconcellos – BrazilPatrick Wall – IrelandAlexander I. Wandeler – CanadaKazuya Yamanouchi – JapanCristóbal Zepeda – United States of America

Segreteria di redazione Associate EditorsMonica Bucciarelli, Guido Mosca,Mariarosaria Taddeo

Recensioni Book reviewsManuel Graziani

Progetto grafico e webGraphic and web designPaola Di Giuseppe

Amministrazione AdministrationIstituto Zooprofilattico Sperimentaledell’Abruzzo e del Molise “G. Caporale”Campo Boario, 64100 Teramo, [email protected]

Stampa PrinterGiservice srl, Teramo, Italia

http://www.izs.it/vet_italiana/index.html

© 2015 Istituto Zooprofilattico Sperimentaledell’Abruzzo e del Molise “G. Caporale”Campo Boario, 64100 Teramo, Italia

ISSN 0505-401XFormato elettronico Electronic formatISSN 1828-1427

Stampato su carta ecologica TCFPrinted on 50% recycled, 100% chlorine- andacid-free environmentally friendly paper

Aut. Trib. Teramo n. 299 del 16/05/1990 -Sped. in Abb. Post. Art. 2 comma 20/c -L. 66/96 DCB/DC Abruzzo Pescara

Istituto Zooprofilattico Sperimentale dell’Abruzzo e del Molise “G. Caporale”Campo Boario, 64100 TERAMO, Italiatelefono +39 0861 3321, fax +39 0861 332251www.izs.it

Questa rivistaè nata nel 1950 con il

nome di Croce Azzurra.Dal 1954 si chiamerà

Veterinaria Italiana.

Maria Cesarina Abete – ItalyMarina Bagni – ItalyGioia Capelli – ItalyPierfrancesco Catarci – ItalyGiovanni Cattoli – ItalyAnnamaria Conte – ItalyPaolo Cordioli† – ItalyEsterina De Carlo – ItalyAntonio Fasanella – ItalyRosario Fico – ItalyAdriana Ianieri – Italy

Valerio Giaccone – ItalyCiriaco Ligios – ItalyN. James MacLachlan – United States of AmericaPaola Nicolussi – ItalyJanusz Paweska – South AfricaGiovanni Pezzotti – ItalyRoberto Piro – ItalyGiuseppe Ru – ItalyFabrizio Vitale – ItalyStéphan Zientara – France

Thomson Reuters Science Journal Citation Reports® database (JCR/Science Edition®)Journal impact factor 2013: 0.675

• National Library of Medicine’s MEDLINE/PubMed system

• Thomson Reuters Science Citation Index Expanded™ (SciSearch®)

• CABI’s Full-Text Repository

• Directory of Open Access Journals (DOAJ)

• Elsevier’s SciVerse Scopus

Le pubblicazioni dell’Istituto Zooprofilattico Sperimentale dell’Abruzzo e del Molise “G. Caporale” (IZSAM) sono protette dalla legge internazionale sul copyright. Gli estratti possono essere letti, scaricati, copiati, distribuiti, stampati, recuperati; è consentito inoltre il collegamento ai file pdf di Veterinaria Italiana. Informazioni per fini commerciali devono essere richieste all’IZSAM. Le traduzioni a stampa e gli adattamenti sono consentiti previa autorizzazione scritta da parte dell’IZSAM.Le opinioni espresse negli articoli pubblicati sono esclusivamente sotto la responsabilità degli autori. L’eventuale citazione di specifiche Ditte o prodotti, siano essi brevettati o meno, non implica che essi siano stati consigliati dall’IZSAM e vengano preferiti ad altri di simile natura non menzionati nei testi.

Publications of the Istituto Zooprofilattico Sperimentale dell’Abruzzo e del Molise ‘G. Caporale’ (IZSAM) are protected by international copyright law. Users are permitted to read, download, copy, distribute, print, search abstracts; besides they can link to Veterinaria Italiana full pdf files. Should information be required for commercial purposes, prior written permission must be sought from the IZSAM. Published translations and adaptations also require prior written approval from the IZSAM.The views expressed in signed articles are solely the responsibility of the authors. The mention of specific companies or products of manufacturers, whether or not patented, does not imply that these have been endorsed or recommended by the IZSAM in preference to others of a similar nature that are not mentioned.

Volume 51 (1), 2015

Federica Monaco, Maria Goffredo, Paolo Briguglio, Chiara Pinoni,Andrea Polci, Simona Iannetti, Stefano Pinto, Giuseppe Marruchella,Gabriella Di Francesco, Annapia Di Gennaro, Monica Pais, Liana Teodori, Rossana Bruno, Monica Catalani, Angelo Ruiu, Rossella Lelli & Giovanni SaviniThe 2011 West Nile disease outbreakin Sardinia region, Italy .............................................................................5-16Descrizione dei focolai di West Nile disease nel 2011nella regione Sardegna, Italia (riassunto) ...........................................................................................5

Maria Goffredo, Giovanni Savini, Michela Quaglia, Umberto Molini, Valentina Federici, Monica Catalani, Ottavio Portanti, Valeria Marini,Maseke Adrianus Florentius, Attilio Pini & Massimo ScacchiaOrbivirus detection from Culicoides collectedon African horse sickness outbreaks in Namibia ................................ 17-23Indagini virologiche in Culicoides catturatiin focolai di Peste equina in Namibia (riassunto) ............................................................................17

Abdelali Benkirane, Soukaina Essamkaoui, Ahmed El Idrissi,Laura Lucchese & Alda NataleA sero-survey of major infectious causes of abortionin small ruminants in Morocco .............................................................. 25-30Indagine sierologica sulle più comuni cause di aborto infettivonei piccoli ruminanti in Marocco (riassunto) ....................................................................................25

Yuvaraj Shanmugam, Madhanmohan Muthukrishnan,Nagendrakumar Balasubramanian Singanallur& Srinivasan Alwar VilluppanoorPhylogenetic analysis of the leader proteinase (Lpro) regionof Indian foot and mouth disease serotype O isolates ....................... 31-37Studio filogenetico di ceppi indiani del virus dell’Afta epizootica Sierotipo Omediante analisi della regione proteinasi leader (Lpro) (riassunto) ..............................................31

Mehmet Özkan Timurkan & Tuba Çiğdem OğuzoğluMolecular characterization of canine parvovirus (CPV)infection in dogs in Turkey..................................................................... 39-44Caratterizzazione molecolare dell’infezione da parvovirus caninoin cani in Turchia (riassunto).................................................................................................................39

Simona Forcella, Nasr El-din El Tantawy, Jobre Yilma,Amira AbdelNabi, Filip Claes, Gwenaelle Dauphin & Elizabeth MumfordThe development of a four-way linking framework in Egypt:an example of the FAO, OIE and WHO joint activitiesto facilitate national risk assessment ................................................... 45-50

Volume 51 (1), 2015

Lo sviluppo di una struttura di collegamento a quattro vieper facilitare il processo di valutazione dei rischi a livello nazionale, in Egitto:un esempio di attività congiunta tra FAO, OIE e OMS (riassunto) ...............................................46

Biagio Bianchi, Ingrid Papajova, Rosanna Tamborrino,Domenico Ventrella & Carolina VittiCharacterization of composting mixtures and compostof rabbit by-products to obtain a quality productand plant proposal for industrial production ..................................... 51-61Caratterizzazione delle matrici e del compost da deiezioni e sottoprodottidella macellazione cunicoli finalizzata ad una produzione industrialedi qualità con soluzioni meccanico-impiantistiche specifiche (riassunto)................................51

Paolo Albonetti, Antonio Marletta, Ivano Repetto & Emanuela SassoEfficacy of nicarbazin (Ovistop®) in the containment andreduction of the populations of feral pigeons(Columba livia var. domestica)in the city of Genoa, Italy: a retrospective evaluation ........................ 63-72Valutazione retrospettiva dell’efficacia della nicarbazina (Ovistop®)per il contenimento e la riduzione delle popolazioni diColumba livia var. domestica nella città di Genova (riassunto) .................................................63

SHORT COMMUNICATIONDonato Antonio Raele, Giuliano Garofolo, Domenico Galante& Maria Assunta Cafiero Molecular detection of Coxiella burnetiiusing an alternative loop-mediated isothermalamplification assay (LAMP).................................................................... 73-78Sviluppo di un saggio alternativo di Amplificazione isotermica mediatada loop (LAMP) per la diagnosi di Coxiella burnetii (riassunto) .................................................73

LIBRI/Book reviewsPadre AdamAlla ricerca delle migliori varietà di api ................................................................... 79Carla De Benedictis, Francesca Pisseri, Pietro VeneziaCon-vivere, l’allevamento del futuro ......................................................................... 80

5

RiassuntoNel 2011, ceppi di lignaggio 1 del virus della West Nile (WNV) sono stati identificati per la prima volta in Sardegna. A differenza di quanto osservato in altre regioni italiane, il virus è stato rinvenuto in esemplari di Culex modestus ed è stato in grado di evocare sintomatologia clinica negli uccelli infettati. L’analisi filogenetica basata su un frammento del gene codificante la proteina NS3 ha svelato un elevato grado di similitudine tra i ceppi sardi ed i ceppi di WNV che hanno circolato recentemente nei paesi del Bacino Mediterraneo. Tuttavia, le sequenze ottenute dagli isolati sardi del 2011 sono raggruppate in un subcluster distinto. L’analisi delle sequenze ha confermato la presenza di differenti genotipi virali del WNV, in particolare NS3-249P e NS3-249T, a conferma della contemporanea circolazione di diverse popolazioni virali nel corso del focolaio. Tali differenze genotipiche, tuttavia, non sono risultate associate a variazioni della patogenicità.

Parole chiaveGene codificante NS3,Italia,Lignaggio 1,Sardegna,Uccelli selvatici,Virus della West Nile.

Descrizione dei focolai di West Nile disease nel 2011nella regione Sardegna, Italia

SummaryIn 2011, strains of West Nile Virus (WNV) belonging to lineage 1 spread for the first time in Sardinia region (Italy). In contrast to previous WNV Italian incursion, the strains were found in Culex modestus and, more surprisingly, they were able to cause severe clinical signs in the affected birds. Based on the partial sequence of the NS3 encoding gene, the Sardinian WNV strains demonstrated a high similarity with the other WNV strains recently detected in the Mediterranean Basin. Nonetheless, the 2011 Sardinian sequences were grouped in a distinct sub-cluster. Both the NS3-249P and NS3-249T genotypes were detected in the Sardinian outbreaks confirming that the co-circulation of different genotypes in the affected population might be common for WNV as for many RNA viruses. No association, however, was observed between virulence and viral genotype.

KeywordsItaly,Lineage 1,NS3 encoding gene,Sardinia,West Nile virus,Wild birds.

Veterinaria Italiana 2015, 51 (1), 5-16. doi: 10.12834/VetIt.260.2386.2Accepted: 21.08.2014 | Available on line: 23.01.2015

1 Istituto Zooprofilattico Sperimentale dell’Abruzzo e del Molise ‘G. Caporale’, Campo Boario, 64100 Teramo, Italy.2 Clinica Veterinaria ‘Duemari’, Via Cagliari 313, 09170 Oristano, Italy.

3 Istituto Zooprofilattico Sperimentale della Sardegna, Dipartimento di Oristano, Via Atene ZI, 09170 Oristano, Italy.

* Corresponding author at: Istituto Zooprofilattico Sperimentale dell’Abruzzo e del Molise ‘G. Caporale’,Campo Boario, 64100 Teramo, Italy.

Tel: + 39 0861 332446, Fax: +39 0861 332251, e-mail: [email protected].

Federica Monaco1*, Maria Goffredo1, Paolo Briguglio2, Chiara Pinoni1, Andrea Polci1,Simona Iannetti1, Stefano Pinto2, Giuseppe Marruchella1, Gabriella Di Francesco1,

Annapia Di Gennaro1, Monica Pais2, Liana Teodori1, Rossana Bruno1,Monica Catalani1, Angelo Ruiu3, Rossella Lelli1 & Giovanni Savini1

The 2011 West Nile disease outbreakin Sardinia region, Italy

reading frame that encodes 4 structural proteins (the nucleocapsid, the pre-membrane, the membrane, the envelope) and 7 non-structural proteins (NS1, NS2A, NS2B, NS3, NS4A, NS4B and NS5).

Based on phylogenetic analysis the worldwide circulating WN strains are clustered in 8 lineages (Mackenzie and Williams 2009, Vazquez et al. 2010),

IntroductionWest Nile virus (WNV) is a mosquito-borne zoonotic flavivirus member of the Japanese encephalitis serogroup, which includes other important neuro-invasive viruses such as the Japanese encephalitis virus, the Murray Valley virus and St Louis virus. The WNV genome is composed of a single open

6 Veterinaria Italiana 2015, 51 (1), 5-16. doi: 10.12834/VetIt.260.2386.2

West Nile virus in Sardinia region Monaco et al.

Materials and methods

National surveillance programIn Italy, a WNV National surveillance plan is in place since 2002 (Calistri et al. 2010). Although continuously revised according to the new epidemiological scenarios, the plan selected 10 risky areas within the entire Italian territory. Such areas are characterized by the presence of a significant number of wild birds including species of migratory birds. In these areas, WNV circulation is monitored each year, between March and November, the monitoring encompasses sentinel animals (chicken and horses), wild bird carcasses, and mosquitoes caught by specific traps. In Sardinia, the sentinel chickens were housed in Arborea (39°81’ N - 08°56’ E) and Santa Giusta, (39°83’ N - 08°60’ E), 2 municipalities of the Oristano province, which are close to humid areas with great abundance of wild birds. The mosquito traps were located in the wetland of S’Ena Arrubia (39°49’ N - 08°34’ E), in the Arborea municipality, where Culex pipiens resulted to be the most abundant species collected since 2002. Sentinel horses, 28 animals, were located in Arborea (39°79’ N - 08°55’ E). Serum samples were collected from sentinel animals 3 times per year (April - August - October) (Figure 1).

Clinical and neurological investigations were conducted on all horses of the affected farms. Blood and serum samples were also collected from all animals and sent to the OIE and National reference laboratory for WND, CESME, Istituto Zooprofilattico Sperimentale dell’Abruzzo e del Molise, Italy (IZSAM).

After the first WNV confirmed cases, the routine monitoring was extended on horses with WND-like symptoms living within 4 km of radius from the infected premises.

Mosquito surveyBetween September the 14th and 18th 2011, 10 mosquito collections were performed, using Centers for Disease Control (CDC) light traps, BG Sentinel traps (CDC, Atlanta, USA) and manual aspiration. The collected insects were identified at species level (Severini et al. 2009) and divided in pools to be tested for WNV by real time RT-PCR (TaqvetTM West Nile WNV; LSI, Lissieu, France). Within each collection and species, males, engorged and non-engorged females were tested separately.

Birds monitoringDuring the Sardinian 2011 WND epidemic, an unusual number of wild birds showing neurologic illness was noted in the field. Some of them were

with the strains belonging to lineage 1 and 2 being the most widely disseminated.

Strains of lineage 2 are endemic in Southern African Countries and were first detected in Europe in 2004 in a goshawk (Accipiter gentilis) of a national park in South-east Hungary (Bakonyi et al. 2006, Erdélyi et al. 2007) and then in Austria (Wodak et al. 2012). Other WND outbreaks caused by lineage 2 strains were reported in Russia (Platonov et al. 2012) and in Romania (Sirbu et al. 2011). A strain of lineage 2 has recently circulated in Greece (Danis et al. 2011) and Balcan countries (WAHID 2014, Petrovic T. et al. 2013).

In Italy, WNV first appeared in 1998 in the Padule di Fucecchio mash area, in Tuscany, (Autorino et al. 2002); and then it was detected in the North-Eastern part of Italy in 2008 (Calistri et al. 2010b, Monaco et al. 2010) where it became endemic (Monaco et al. 2009). Unrelated new foci were also reported in Central and Southern Italy (Calistri et al. 2010a) and, more recently, lineage 2 strains were detected in Central (Bagnarelli et al. 2011) and Northern-eastern parts of Italy, as well as in Sardinia (Savini et al. 2012, Capelli et al. 2013).

As for the pathogenicity, strains of lineages 1 and 2 have been associated to severe disease in birds, horses, and/or humans (Kutasi et al. 2011). In humans and horses, disease is a spill over event emerging from the enzootic cycle, which involves vertebrates, mainly birds and mosquitoes, Culex mosquitoes and passerine birds being, respectively, the main vectors and vertebrate hosts for virus spread.

In Italy, clinical cases have been reported both in human and in horses but never in birds, at least before 2011, even if birds have been found in the past to be infected by WNV (Lelli et al. 2012). Magpies (Pica pica), carrion crows (Corvus corone) and rock pigeons (Columba livia) are the species most commonly found infected by WNV. Ochlerotatus caspius and Culex pipiens are, instead, the most abundant mosquitos found in Italy (Thompson et al. 1994) and those in which WNV has been detected (Monaco et al. 2010, Capelli et al. 2013).

In September 2011, a severe WND epidemic was first reported in Sardinia. During this epidemic, numerous horses became infected, some of them died or were euthanized because of the severity of the clinical signs, others recovered after showing classical nervous symptoms. Interestingly, in the same area and in the same period, an unusual number of wild birds dying after showing neurologic illness was also noted. This paper describes the Sardinian outbreak with special emphasis on the clinical signs and virological findings due to WNV infection observed in several birds admitted to a rehabilitation clinic or collected in the field.

7

Monaco et al. West Nile virus in Sardinia region

Veterinaria Italiana 2015, 51 (1), 5-16. doi: 10.12834/VetIt.260.2386.2

WNV antibodies by IgG-ELISA (ID Screen® West Nile Competition ID.Vet Innovative Diagnostics, Montpellier, France) and positive results confirmed by plaque reduction neutralisation (PRNT) and Virus Neutralization (VN) assays (OIE, 2012). Horse sera were also tested for WNV IgM by ID Screen® West Nile IgM Capture ELISA kit (ID.Vet Innovative Diagnostics, Montpellier, France).

All collected samples (mosquito pools, blood and tissue samples from domestic and wild birds and horses) were tested for the presence of WNV.

Two real time RT-PCR methods were used to detect presence of WNV RNA in the samples. A commercial kit (TaqvetTM West Nile WNV; LSI, Lissieu, France) capable of detecting WNV RNA of lineage 1 and 2 strains and the method described by Lanciotti and colleagues (Lanciotti et al. 2000), which allows for detecting only WNV strains belonging to lineage 1.

Bird tissues including brain, heart, liver, kidney, and spleen, were also collected for histopathologic examination. Sections of formalin-fixed paraffin embedded tissues (3-5 mm thick) were stained with hematoxylin and eosin. Bird tissues with minimal autolysis were chosen for microscopic evaluation, since autolysis can obscure subtle lesions.

rescued and admitted in the local rehabilitation clinic. Wild bird carcasses found in the WND affected areas were also collected and sent to the Centro di Referenza Nazionale per le Malattie Esotiche (CESME, Italy) for analyses.

Carcasses from the rehabilitation clinicFifty-two wild birds were admitted to the Clinica Veterinaria ‘Duemari’, a rehabilitation clinic located in the province of Oristano (Sardinia, Italy) between September and November 2011, all animals were found within a range of 30 km2. Number and details of the admitted birds are listed in Table I, 26 animals died during the rehabilitative care and 15 of them died after showing nervous clinical signs (Table I). Carcasses were sent to CESME for analyses.

Laboratory testing and diagnostic protocolEach bird carcass underwent gross and microscopic evaluation and routine testing for viral, bacterial and fungal infection(s).

Serum samples were tested for the presence of

Figure 1. The map represents the 3 epidemiological areas identified in the Italian territories with WNV circulation in 2010. Orange: area with virus circulation (AVC); yellow: surveillance zone (SZ); pink: areas at risk (AR). In the map of the Sardinia region the distribution of the WN cases in the different susceptible species has also been reported.

WND outbreaks 2011

MosquitoesEquidaeBirdsPoultry

Area with virus circulation (AVC) 2010Surveillance zone (SZ) 2010Area at risk (AR) 2010



Table I. Birds admitted to the Clinica Veterinaria ‘Duemari’ (Oristano, Sardinia, Italy), between September and November 2011, and included in the study.

Common name Species Family No. deaths/admitted birds

WND+/nervous symptoms

Grey heron Ardea cinerea Ardeidae 1/2 0/1

Mallard Anas platyrhynchos Anatidae 4/4 1/4

European herring gull Larus argentatus Laridae 2/2 0/2

Barbary partridge Alectoris barbara Fasianidae 1/3 0/0

Eurasian stone curlew Burhinus oedicnemus Burhinidae 0/1 n.d.

Greater flamingo Phoenicopterus roseus Fenicotteridae 1/1 0/0

House sparrow Passer domesticus Passeridae 1/1 0/0

Purple swamphen Poprhyrio porphyrio Rallidae 0/1 n.d.

Little grebe Tachybaptus ruficollis Podicipedidae 1/1 0/0

Common buzzard Buteo buteo Accipitridae 5/13 2/3

Eurasian jay Garrulus glandarius

Corvidae 5/6

2/2

Hooded crow Corvus corone cornix 0/0

Carrion crow Corvus corone 0/0

Little owl Athena noctua Strigidae 2/4 1/2

Western barn owl Tyto alba Tytonidae 0/4 n.d.

Turtle dove Streptopelia turtur Columbidae 0/3 n.d.

Common starling Sturnus vugaris Sturnidae 1/1 0/0

Peregrine falcon Falco peregrinusFalconidae 2/5

0/0

Common kestrel Falco tinnunculus 0/1

Total 26/52 6/15n.d. = data not available.

using the amplifying primers and 4 additional internal primers (data not shown). Sequencing was performed using the BigDye Version 3.1 Dye Terminator Cycle Sequencing Kit (Applied Biosystems, Foster City, CA, USA) on ABI PRISM 3130xl automated capillary sequencer after a cleaning step with Cleanseq (Beckman Coulter, Brea, California, USA).

Raw sequence data were assembled using Contig Express (Vector NTI suite 9.1; Invitrogen, Carlsbad, California, USA) and consensus sequences aligned with the homologous sequences deposited in the Genbank database with Clustal-W (Thompson et al. 1994). Both, the nucleic and the deduced amino acid sequences were compared using Vector NTI suite 9.1 (Invitrogen, Carlsbad, California, USA).

The phylogenetic analysis was conducted on 975bp in the NS3 region from the viral strains listed in Table II. Sequence dataset was analysed using BioEdit version 7.0.9.0 and nucleotide alignment was performed with Clustal-W. Aligned sequences were compared and dendrogram generated using maximum likelihood technique in PHYLIP (the PHYlogeny Inference Package) program version 3.67. The tree obtained was rooted with Eg101 strain (AF260968). Statistical support at the internodes on the tree was assessed by 1000 bootstrap replications.

Molecular characterizationIn order to characterize the viral strain, WNV positive samples were partially sequenced. Briefly: total RNA was extracted from collected samples by the automated BioSprint 96 One-For-All Vet kit (Qiagen, Leipzig, Germany ) according to manufacturer's instructions and collected in 100μl of elution buffer. A 1099bp fragment of the NS3 gene (genomic position 5216-6190 on AF404757 ITA98) was amplified by using the primer pair WN_7_5199F: 5’-CGGTGCCGGTAAAACAAG-3’ and WN_7_6297R: 5’-CCTCCGATCGTGGTATGACA-3’. The gel based RT-PCR was performed using Transcriptor One-Step RT-PCR kit (Roche Applied Science, Madison, Wisconsin, USA). The kit contains a blend consisting of Taq DNA polymerase and a proofreading polymerase, which minimizes the possibility of mutations offering high yield and fidelity in PCR.

RT-PCR cycling conditions for the amplification of WNV partial NS3 gene were 50°C 15 minutes, 94°C 7 minutes followed by 35 cycles of denaturation at 94°C for 10 seconds, annealing at 58°C for 30 seconds and extension at 68°C for 2 minutes.

Gel based RT-PCR amplicons were purified with the Qiaquick PCR Purification kit (Qiagen, Leipzig, Germany) and directly sequenced in both directions

9



C.I. = 15.00-37.6%) died. West Nile virus infection was confirmed in all dead animals by serology and/or molecular tests. The temporal progression of the infection is detailed in the on-line bulletin edited by CESME1. Virus circulation involved a restricted area extended for about 2720 square kilometres of the Sardinia territories, 94 equine cases (Monaco et al. 2010) were reported from 4 provinces (Oristano, Cagliari, Nuoro and Medio Campidano). Thirty-eight different stables were involved, 33 of which located in the Oristano province, 2 in the Medio Campidano and Cagliari provinces and 1 in the Nuoro province (Table III). Four WNV cases of encephalitis have been reported in humans in the provinces of Oristano and Olbia (Rizzo et al. 2012).

Mosquito surveyA total of 310 mosquitoes were collected on the affected area. They belonged to 5 genera and 8 species: Anopheles maculipennis, Culex pipiens, Culex modestus, Culex theileri, Ochlerotatus caspius, Culiseta annulata, Culiseta longiareolata, Coquillettidia

Results

National Surveillance ProgramSeroconversion was first detected by ELISA in a sentinel chickens in Arborea on the 6th of July 2011. The VN assay however was not able to confirm it. A second ELISA seroconversion occurred on the 18th of July in a sentinel chicken located in Santa Giusta, but again the VN test was not able to confirm the positive reaction. Neutralising antibodies were first detected on the 7th of September in 2 chicken sera from Santa Giusta, whereas on the 8th of October 3 sentinel chickens were found viraemic. Four sentinel horses first seroconverted (IgG-ELISA, IgM-ELISA, PRNT and VN assays) were detected on the 4th of October.

Case reportClinical cases were first observed on the 14th

of September in 5 horses located in 2 different stables within the Oristano province. By the end of the season, clinical signs ranging from fever to muscle fasciculation, paralysis/paresis of the limbs, proprioceptive deficits or inability to maintain the standing station were reported in 53 horses (56.38% of the confirmed cases), 13 of them (24.53%, 95%

Table II. Details of the WNV strains included in the phylogenetic analysis. For each viral strain, the GenBank identification code of the sequences included in the analysis is provided. The strains were obtained from samples collected in the Oristano province between September and November 2011.

Strain Location Year Lineage Host GenBank20608 Sardinia 2011 1 Equine KJ562347

21412 Sardinia 2011 1 Little owl KJ562350

20875 Sardinia 2011 1 Eurasian jay KJ562349

23237 Sardinia 2011 1 Sentinel chickens KJ562351

9492 Sardinia 2011 1 Mosquito pool KJ562353

23954 Sardinia 2011 1 Carrion crow KJ562352

23941 Sardinia 2011 1 Carrion crow KJ562348

WN Italy 1998 equine Italy 1998 1 Equine AF404757

15217 Italy 2008 1 Magpie FJ483548

15803 Italy 2008 1 Magpie FJ483549

Italy/2008/J-242853 Italy 2008 1 Eurasian jay JF719065

Italy/2008/M-203204 Italy 2008 1 Magpie JF719066

12010 09 Italy 2009 1 Magpie KJ562354

Ita09 Italy 2009 1 Human (bood donor) GU011992

Italy/2009/G-223184 Italy 2009 1 Gull JF719067

Italy/2009/J-225677 Italy 2009 1 Jay JF719068

Spain/2010/H-1b Spain 2010 1 Equine JF719069

HU6365/08 Spain 2008 1 Culex perexiguus JF707789

Nea Santa-Greece-2010 Italy 2010 2 Culex pipiens mosquito pool HQ537483

Italy/2011/AN-2 Italy 2011 2 Human JN858070

Eg101 Egypt 1951 1 Human AF260968

1 Istituto Zooprofilattico Sperimentale dell’Abruzzo e del Molise 2011. West Nile virus bulletin http://sorveglianza.izs.it/emergenze/west_nile/emergenze.htm.



Birds monitoringA total of 132 wild birds were examined for the presence of West Nile virus, 106 were found dead in the field and 26 were from the rehabilitation clinic. Out of the 132 wild birds examined, 10 resulted positive to WNV RT-PCR (Table V). Of these, 4 (3 hooded crows and 1 Eurasian jay) were from the field and 6 from the clinic collections. All 6 birds from the rehabilitation facility suffered from nervous clinical signs before dying (Table I). In 4 occasions it was also possible to isolate the virus in cell culture. Neither traumatic lesions nor routine viral, fungal and bacterial infections were detected in the birds showing clinical signs. Because of autolysis, only few tissues could be processed, the most consistent histopathologic finding was the myocarditis (Figure 3).

Clinical casesTwo adult Eurasian jays (Garrulus glandarius) were admitted to the clinic the 5th of September 2011. They showed aspecific clinical signs characterised by drowsy, incapability of flying or walking properly, ruffle feathers, pectoral atrophy, and absence of the flight instinct. Both birds died within 24 hours from

richiardii (Figure 2). The mosquitoes were divided in 41 pools (Table IV) and only 1, consisting of 3 non-engorged females of Culex modestus collected by a BG-Sentinel trap, was positive when tested for WNV. Within the overall collected mosquitoes, the minimum infection rate (number of positive pools/total number of tested insects) was 0.32%.

Table III. Equine cases. The case fatality rate was calculated as the number of fatalities due to the WNV infection on the number of confirmed clinical cases. For each proportion obtained in this study 95% confidence intervals were calculated using the Bayesian approach through the beta distribution.

Province N. outbreaks

N. outbreaks with clinical symptoms

Equids in the outbreaksPrevalence total cases

Prevalence clinical cases

Case fatality

rateFarmed equids Total cases Clinical

symptomsDead/

euthanized273 89 48 9

Cagliari 2 2 36 2 2 2 5.56% 5.56% 100.00%

Medio Campidano 2 2 10 2 2 2 20.00% 20.00% 100.00%

Nuoro 1 1 2 1 1 0 50.00% 50.00% 0.00%

Total 38 36 321 94 53 13 29.28% 16.51% 24.53%Source: West Nile virus bulletin, available at: http://sorveglianza.izs.it/emergenze/west_nile/emergenze.htm.

Culex theileriCulex

modestus

Coquillettidia richiardii

Anopheles maculipennis

Culex pipiens

Culiseta annulata

Culiseta longiareolata

Ochlerotatus caspius

Figure 2. Relative abundance of mosquito species collected in Oristano province (Sardinia, Italy), between September the 14th-18th 2011 (total mosquitoes 310).

Table IV. West Nile virus in mosquitoes collected in Oristano province (Sardinia, Italy) between the 14th and 18th of September 2011.

SpeciesEngorged females (pools)

Non-engorged females (pools)

Males (pools)

Total (pools)

Implicated in WNV

transmission elsewhere

Possible bridge vector (biting both humans

and birds

Human biting

Bird biting

Anopheles maculipennis 105 (5) 3 (3) 9 (3) 117 (11) x x

Coquillettidia richiardii 1 (1) 1 (1) 0 2 (2) x x x x

Culex modestus 4 (2) 0 4 (2) x x x x

Culex pipiens 5 (2) 79 (7) 8 (2) 92 (11) x x x x

Culex theileri 14 (4) 0 14 (4) x x

Culiseta annulata 5 (2) 0 5 (2) x x x

Culiseta longiareolata 7 (2) 7 (2) x

Ochlerotatus caspius 68 (6) 1 (1) 69 (7) x x

Total 118 (10) 174 (25) 18 (6) 310 (41)

11



up by using the tail feather and the wings. Both, the pupillary and corneal reflexes, were present. In the second day clinical signs became more severe. The corneal reflex was lost and the animal was not anymore capable of standing up although it still tried to fly when encouraged (Figure 4). It died at the end of the second day. On the 29th of September 2011, an adult male mallard (Anas plathyrynchos) was rescued at the Marrubiu (OR) periphery. The bird showed a complete flaccid paralysis of the legs and even if still present, the instinct to escape was precluded by the leg paralysis. Neck and wing movements were still under control and the sensorium was still awake. In the following day, the bird progressively lost the wing muscle contractile capability and the instinct of escape. In the third day, the animal died without

the admission. On the 21st of September 2011, an adult common buzzard originating from the town of Oristano was admitted to the clinic. It showed lethargy, head tremors, drooping wings and inability to fly due to the flaccid paralysis of the wing muscles. The legs were kept flexed and the bird was not able to stand up. The podal reflex was lost whereas both, the pupillary and corneal reflexes were still present. The animal died few hours after the admission. A little owl (Athene noctua) found close by Santa Giusta (OR), was bought to the rehabilitation centre on the 24th of September 2011. The first day it showed ataxia, incoordination, reluctance or inability to fly properly, head tilt and anisocoria. It was able to stand

Table V. West Nile virus in wild birds collected in Oristano province (Sardinia, Italy) between September and November 2011.

Family Species Common name WNV+/Total % of positiveAccipitridae Buteo buteo Common buzzard 2/5 40%

Anatidae Anas platyrhynchos Mallard 1/5 20%

Ardeide Ardea cinerea Grey heron 0/1 0%

Corvidae

Corvus corone Carrion crow 0/2 0%

Corvus corone cornix Hooded crow 3/93 3.2%

Garrulus glandarius Eurasian jay 3/11 27.3%

FalconidaeFalco peregrinus Peregrine falcon 0/1 0%

Falcus tinnunculus Common kestrel 0/2 0%

Fasanidae Alectoris barbara Barbary partridge 0/1 0%

Laride Larus argentatus European herring gull 0/3 0%

Passeridae Passer domesticus House sparrow 0/1 0%

Phoenicocpteridae Phoenicopterus roseus Greater flamingo 0/1 0%

Podicepidae Tachybaptus ruficollis Little grebe 0/1 0%

Strigidae Athena noctua Little owl 1/2 50%

Sturnidae Sturnus vugaris Common starling 0/1 0%

Columbidae Streptopelia turtur Turtle dove 0/1 0%

Columbidae Columba livia Rock pigeon 0/1 0%

Total 10/132 7.6%

Figure 3. Little owl (Athena noctua), heart. Foci of interstitial myocarditis. Hematoxylin & eosin. Final magnification = x 400.

Figure 4. Little owl (Athena noctua) with nervous clinical symptoms. The animal was admitted to the Clinica Veterinaria ‘Duemari’ (Oristano, Sardinia, Italy) on the 24th of September 2011.



all the Italian strains circulating from 2008 to 2009 clustered in a monophyletic group while the 2011 Sardinian sequences were in a distinct sub-cluster.

Separated from the cited strains were the first isolate from Italy (1998) and the 2008 isolate from Spain. As expected, the strains belonging to lineage 2 (Greece 2010 and Italy 2011) were segregated in a distinct subclade.

Comparison of the deduced amino acid sequences (from position 203 to 526 referred to FJ483548) from the Mediterranean isolates showed 4 variable amino acid residues among the different WNV strains. West Nile virus strains AF404757 (Italy 1998), JF719065 (Italy 2008), 20608 (Italy 2011, horse) and 21412 (Italy 2011, owl) were characterized by a threonine residue in position 249, while the other strains exhibited a proline in the same position. All the Sardinian strains displayed an alanine residue in position 436, substituted by a threonine in the other WNV strains. Residue 476 was represented by arginine in the WNV detected in the Sardinian owl, while glicine was in the same position of the other sequences.

DiscussionWest Nile virus represents one of the pathogens that best adapted to the new scenarios imposed by globalization and climatic changes. It was able to adjust its epidemiology, virulence and range of host species. It went from being considered a virus of minor significance capable of determining only mild, sporadic and self-limiting outbreaks, to be the most widespread arbovirus in the world, able to determine severe outbreaks involving humans, birds and horses (Brault 2009, Hayes et al. 2005, Kramer et al. 2008). Changes that were clearly evident in the North American epidemics at the end of the century have now become clear also in Europe, where new virulence patterns of recent WNV strains have been observed. Although more numerous and severe cases have been recently described in humans and horses infected by WNV European strains, only in few occasion the disease has been associated to wild birds. This is in contrast with the North America situation, where native wild birds are largely affected by WNV. Different strain virulence or different WNV susceptibility between Palearctic and Nearctic bird species were considered as possible causes of this discrepancy. In Italy, in years of outbreaks and WNV circulation, no bird cases have ever been reported. For this reason the year 2011 could be regarded as critical. Strains of WNV belonging to lineage 1 continued to circulate in the North-Eastern regions for the fourth consecutive year affecting humans, horses, and wild birds. In the same area a newly introduced lineage 2 strain was detected in pools of Cx. pipiens

showing the flaccid paralysis of the neck muscles, characteristic sign of the avian botulism, which is commonly detected in the Oristano lagoon area in that period of the year. An ataxic adult common buzzard (Buteo buteo), found in the periphery of Oristano, was brought to the rehabilitation centre on the 10th of October 2011. The bird showed irregular head tremors and had trouble in maintaining the upright position even if using the tail feather and the wings. The instinct of escape was lost and the podal reflex as well as the proprioception response on the left leg was slow. The droppings were of a fluid-like consistency and the feathers around the vent were matted with faeces. When recumbent in a sternal position, the bird was not able to stand up properly and, similarly, it was not able to open its wings even if it was able to flex them back at the elbow joint when forcedly opened. In the second day, the lethargy became more severe and the animal died.

Partial NS3 sequencingAll detected strains belonged to WNV lineage 1. A 975bp fragment of the NS3 encoding gene of the WNV Sardinian samples shared high nt similarity with the other WNV strains which have recently circulated in the Mediterranean Basin (Figure 5). Particularly,

1000

562

653

512

547

492

883

631

472

139

69

74

80421412

20608

9492

20875

23954

23237

23941

GU011992

2011Sardiniansequences

JF719068

1201009

FJ483548

FJ483549

JF719066

JF719067

JF719065

JF719069

JF707789

AF404757

JN858070

HQ537483

AF260968

510

815 690

1000

1000

Figure 5. Phylogenetic tree based on 975bp in the NS3 region. Sequence dataset was analysed using BioEdit version 7.0.9.0 and nucleotide alignment was performed with Clustal-W. The dendrogram was generated using maximum likelihood technique in PHYLIP (the PHYlogeny Inference Package) program version 3.67. The strain Eg101 strain (AF260968) was used to root the tree. Statistical support at the internodes on the tree was assessed by 1000 bootstrap replications.

13



The Italian strains belong to the ‘Western Mediterranean group’, regardless their year and place of isolation. Nevertheless the Italian strains seemed to evolve independently, as demonstrated by their distance from the most recent Spanish strains isolated in 2008 and 2010.

As a consequence, it is likely that the strains which have circulated in the Sardinia region during 2011, do not represent a new introduction from other Mediterranean countries with viral circulation but from the endemic areas of Northern Italy, likely through some short distance migratory Passeriformes birds (Spina and Volponi 2009). These species became infected in the Italian mainland and then spread the infection in Sardinia region where favourable environmental conditions permitted the establishment of the infection through local mosquitoes and resident bird species. In the latter, the Sardinian WNV strains were capable of causing clinical signs and death. It was the first time that an Italian strain of WNV showed virulence for birds. The WNV strain isolated in New York in 1999 (NY99) is regarded as the prototype of the pathogenic strain due to the fast spread, the high neurovirulence and the high fatality rate in birds, humans and animals, (Ceccaldi et al., 2004, Ciota and Kramer 2010). The NS3 gene sequence (Genbank accession number AF196835) is characterised by the substitution of a threonin-to-proline in the position 249 (NS3-T249P) when compared with other lineage 1 isolates (Lanciotti et al. 1999, Lanciotti et al. 2002). Brault and colleagues (Brault et al. 2007) showed, with a site-directed mutagenesis experiment, a strict correlation between the NS3-T249P and the increased avian virulence: this point mutation is claimed to be responsible of the increased efficiency of viral replication in avian hosts, due to the generation of temperature resistant phenotype and improving the ability in delaying innate antiviral response (Fredericksen et al. 2004, Kinney et al. 2006). All these factors could facilitate mosquito transmission, which in turn might affect the incidence of human and horse infections. Both, the NS3-249P and NS3-249T genotypes were detected in the Sardinian outbreaks confirming that co-circulation of different genotypes in the affected population might be common for WNV as for many RNA viruses. No association, however, was observed between virulence and the NS3 proline strains. Neurological clinical signs were seen in birds affected, by the putative ‘mild’ NS3-249T genotype. Furthermore the case-fatality rate evidenced in horses in the 2011 Sardinian outbreaks (24.53%, I.C. 95%: 15-37.6%) does not significantly differ from that found in northern Italian outbreaks (15.6% I.C. 95%: 7.0-31.9%). These data confirmed what observed in studies on mice (Sotelo et al. 2009) and redleg partridge (Sotelo et al. 2011) and clearly indicates that the role of NS3-249

and in the organs of a dead wild bird (Savini et al. 2012). Another lineage 2 strain was also detected in a human patient in the eastern coast of central Italy (Bagnarelli et al. 2011). In Sardinia, as reported in this study, an unusual increase of the wild bird mortality was observed in the area where WNV was circulating and the presence of WNV was confirmed in nearly 8% of the carcasses. In some birds characteristic clinical nervous signs were also observed. The virus was found in the brain and other organs of the affected birds. It was the first time that the presence of severe and lethal acute nervous clinical signs could be associated to WNV infection in Italy indicating that at least some Italian WNV strains are pathogenic in native wild bird species. In line with other WND associated cases described in European or US wild birds (Bakonyi et al. 2006, Höfle et al. 2008, Jiménez-Clavero et al. 2008, Jourdain et al. 2008, Ludwig et al. 2010, Saito et al. 2007), also in this epidemic Accipitridae and Corvidae were the bird families more often involved. Even if some authors sustained that, as predators, these species could then become infected by feeding on WNV infected prey (Garmendia et al. 2000), it is still difficult to understand whether these higher susceptibility might be determined by host related factors or ecological factors. Oral transmission of WNV through the ingestion of experimentally infected prey and mosquitoes has already been documented in great horned owls, crows, and other passerines (Komar et al. 2003). Equally, it has been shown that, if exposed at high WNV infection rates, small mammals could serve as reservoirs (Root et al. 2006). Although numerous studies have been tackled this topic, the real impact of WNV on the predatory bird population is still unknown.

In a similar complex scenario, beside the classical epidemiological approach, the analysis of the viral genome provided a powerful tool to infer the geographical and temporal correlations between the circulating WNV strains. Among the WNV genes, the NS3 encoding gene revealed a high capability to retain a strong phylogenetic signal (Gray et al. 2010) and the NS3 helicase domain is also 1 of the putative sites of the virulence determinants. For this reason it was the selected target for the molecular characterisation of the Sardinian samples.

Previous phylogenetic studies clustered the WNV lineage 1 strains circulating in the Mediterranean countries in the so called ‘Western Mediterranean group’ which has been traced back to a single introduction in the Mediterranean area before 1996 (Sotelo et al. 2009). More recently, the virus has been probably able to establish an endemic cycle of transmission between resident birds and local mosquitoes, showing its ability to overwinter in temperate areas (Monaco et al. 2009).

14



IV). In this survey, however, Culex pipiens and Ochlerotatus caspius, which are the most abundant WNV vectors in Italy (Toma et al. 2008), tested negative for WNV. Whether this was because of the small size of the sample tested or because of the minor capability of Sardinian strain adaptation for these species is hard to say. Surprisingly, the Sardinian WNV strains were detected in Cx. modestus, which is known to be a competent vector of WNV, both in the field and under laboratory conditions (Hannoun et al. 1964, Balenghien et al. 2006, Balenghien et al. 2007, Balenghien et al. 2008). This is a Mediterranean species, one of the most aggressive against humans, able to bite also during daytime and to overwinter as adult by diapause. Culex modestus feeds also on birds and horses, thus it can also act as bridge vector for WNV (Medlock et al. 2005, Severini et al. 2009).

In conclusion, this investigation confirms that Italian WNV lineage 1 strains might have a severe effect on native wild birds, especially on free-ranging raptors. Whether it depends on a particular virulence of the strains involved or on other factors related to the host susceptibility and vectors, is not clear and requires further investigations.

residue as virulence determinant is far from being elucidated in the Mediterranean ecosystem at least. It is likely that the WNV pathogenicity is the result of a complex series of events, which involve the virus, the vectors and the hosts.

Thus, although the term ‘vector’ implies a lack of significant biological interaction between arthropods and the pathogens they carry, it has become clear in recent years that such interactions are complex and are likely dominant forces shaping the evolution of arboviruses including their virulence (Ciota and Kramer 2010). Interestingly, NS3 helicase has also been shown to determine the WNV natural host fitness (mosquitoes and birds) (Ebel et al. 2011). In the WNV transmission cycle, different host types differentially influence the virus population. Whereas infection of mosquitoes leads to high levels of population variation and consequent adaptive plasticity, vertebrate infection maintains high fitness through strong purifying selection. All mosquito species collected in this survey can be considered capable to sustain the virus circulation, since they have been implicated in WNV transmission elsewhere, and/or possible bridge vectors between birds and mammals (Table

Autorino G.L., Battisti A., Deubel V., Ferrari G., Forletta R., Giovannini A., Lelli R., Murri S. & Scicluna M.T. 2002. West Nile virus epidemic in horses, Tuscany region, Italy. Emerging Infec Dis, 8, 1372-1378.

Bagnarelli P., Marinelli K., Trotta D., Monachetti A., Tavio M., Del Gobbo R., Capobianchi M., Menzo S., Nicoletti L., Magurano F. & Varaldo P. 2011. Human case of autochthonous West Nile virus lineage 2 infection in Italy, September 2011. Euro Surveill, 16 (43), pii=20002. http://www.eurosur vei l lance.org/ViewAr ticle.aspx?ArticleId=20002.

Balenghien T., Fouque F., Sabatier P. & Bicout D.J. 2006. Horse-, bird-, and human-seeking behaviour and seasonal abundance of mosquitoes in a West Virus Focus of Southern France. J Med Entomol, 43 (5), 937-946.

Balenghien T., Vazeille M., Reiter P., Schaffner F., Zeller H. & Bicout D.J. 2007. Evidence of laboratory vector competence of Culex modestus for West Nile virus. J Am Mosq Control Assoc, 23 (2), 233-236.

Balenghien T., Vazeille M., Grandadam M., Schaffner F., Zeller H., Reiter P., Sabatier P., Fouque F. & Bicout D.J. 2008. Vector competence of some French Culex and Ades mosquitoes for West Nile Virus. Vector Borne Zoonotic Dis, 8 (5), 589-595.

Bakonyi T., Ivanics E., Erdelyi K., Ursu K., Ferenczi E., Weissenbock H. & Nowotny N. 2006. Lineage 1 and 2 strains of encephalitic West Nile Virus, Central Europe. Emerging Infec Dis, 12, 618-623.

References

Brault A.C., Huang C.Y., Langevin S.A., Kinney R.M., Bowen R.A., Ramey W.N., Panella N.A., Holmes E.C., Powers A.M. & Miller B.R. 2007. A single positively selected West Nile viral mutation confers increased virogenesis in American crows. Nat Genet, 39 (9), 1162-1166.

Brault A.C. 2009. Changing patterns of West Nile virus transmission: altered vector competence and host susceptibility. Vet Res, 40, 43-62.

Calistri P., Monaco F., Savini G., Guercio A., Purpari G., Vicari D., Cascio S. & Lelli R. 2010a. Further spread of West Nile virus in Italy. Vet Ital, 46 (4), 467-470.

Calistri, P., Giovannini A., Savini G. Monaco F., Bonfanti L., Ceolin C., Terregino C., Tamba M., Cordioli P. & Lelli R. 2010b. West Nile virus transmission in 2008 in North-Eastern Italy. Zoonoses Public Health, 57, 211-219.

Capelli G., Ravagnan S., Montarsi F., Ciocchetta S., Cazzin S., Bonfanti L., Di Gennaro A., Portanti O., Mulatti P., Monne I., Cattoli G., Cester G., Russo F., Savini G. & Marangon S. 2013. Further evidence of lineage 2 West Nile Virus in Culex pipiens of North-Eastern Italy. Vet Ital, 49 (3), 263-268.

Ceccaldi P.E., M. Lucas & Depres P. 2004. New insights on neuropathogenicity of West Nile virus. FEMS Microbiology Letters, 233, 1-6.

Ciota A.T. & Kramer L.D. 2010. Insights into arbovirus evolution and adaptation from experimental studies. Viruses, 2, 2594-2617.

15



Kutasi O., Bakonyi T., Lecollinet S., Biksi I., Ferenczi E., Bahuon C., Sardi S., Zientara S. & Szenci O. 2011. Equine encephalomyelitis caused by a genetic lineage 2 West Nile virus in Hungary. J Vet Intern Med, 25, 586-591.

Lanciotti R.S., Roehring J.T, Deubel V., Smith J., Parker M., Steele K., Crise B., Volpe K.E., Crabtree M.B., Scherret J.H., Hall R.A., MacKenzie J.S., Cropp C.B., Panigrahy B., Ostlund E., Schmitt B., Malkinson M., Banet C., Weissman J., Komar N., Savage H.M., Stone W., McNamara T. & Gubler D.J. 1999. Origin of the West Nile virus responsible for an outbreak of encephalitis in the northeastern United States. Science, 286, 2333-2337.

Lanciotti R.S., Kerst A.J., Nasci R.S., Godsey M.S., Mitchell C.J., Savage H.M., Komar N., Panella N.A., Allen B.C., Volpe K.E., Davis B.S. & Roehrig J.T. 2000. Rapid detection of West Nile virus from human clinical specimens, field-collected mosquitoes, and avian samples by a TaqMan reverse transcriptase-PCR assay. J Clin Microbiol, 38, 4066-4071.

Lanciotti R.S., Ebel G.D., Deubel V., Kerst A.J., Murri S., Meyer R., Bowen M., McKinney N., Morrill W.E., Crabtree M.B., Kramer L.D. & Roehring J.T. 2002. Complete genome sequencing and phylogenetic analysis of West Nile virus strains isolated from the United States, Europe, and the Middle East. Virology, 298, 96-105.

Lelli R., Calistri P., Bruno R., Monaco F., Savini G., Di Sabatino D., Corsi I. & Pascucci I. 2012. West Nile transmission in resident birds in Italy. Transbound Emerg Dis, 59 (5), 421-428.

Ludwig A., Bigras-Poulin M., Michel P. & Bélanger D. 2010. Risk factors associated with West Nile virus mortality in American Crow populations in Southern Quebec. J Wild Dis, 46( 1), 195-208.

Mackenzie J.S. & Williams D.T. 2009. The zoonotic flaviviruses of southern, south-eastern and eastern Asia, and Australasia: the potential for emergent viruses. Zoonoses Public Health, 56, 338-356.

Medlock J.M., Snow K.R. & Leach S. 2005. Potential transmission of West Nile virus in the British Isles: an ecological review of candidate mosquito bridge vectors. Med Vet Entomol, 19 (1), 2-21.

Monaco F., Lelli R., Teodori L., Pinoni C., Di Gennaro A., Polci A., Calistri P. & Savini G. 2010. Re-emergence of West Nile virus in Italy. Zoonoses Public Health, 57 (7-8), 476-486.

Monaco F., Savini G., Calistri P., Polci A., Pinoni C., Bruno R. & Lelli R. 2011. 2009 West Nile disease epidemic in Italy: first evidence of overwintering in Western Europe? Res Vet Sci, 91 (2), 321-326.

Petrovic T., Blazquez A.B., Lupulovic D., Lazić G., Escribano-Romero E., Fabijan D., Kapetanov M., Lazić S. & Saiz J. 2013. Monitoring West Nile virus (WNV) infection in wild birds in Serbia during 2012: first isolation and characterisation of WNV strains from Serbia. Euro Surveill, 18 (44), pii: 20622. http://www.eurosurveillance.org/ViewArticle.aspx?ArticleId=20622.

Platonov A.E., Karan' L.S., Shopenskaia T.A., Fedorova M.V., Koliasnikova N.M., Rusakova N.M., Shishkina L.V., Arshba T.E., Zhuravlev V.I., Govorukhina M.V., Valentseva A.A. & Shipulin G.A. 2011. Genotyping of West Nile fever virus strains circulating in southern Russia as an

Danis K., Papa A., Papanikolaou E., Dougas G. , Terzaki I., Baka A., Vrioni G., Kapsimali V., Tsakris A., Kansouzidou A., Tsiodras S., Vakalis N., Bonovas S. & Kremastinou J. 2011. Ongoing outbreak of West Nile virus infection in humans, Greece, July to August 2011. Euro Surveill,16 34), pii=19951.http://www.eurosurveillance.org/ViewArticle.aspx?ArticleId=19762

Ebel G.D., Fitzpatrick K.A., Lim P.Y., Bennett C.J., Deardorff E.R., Jerzak G.V., Kramer L.D., Zhou Y., Shi P.Y. & Bernard K.A. 2011. Nonconsensus West Nile virus genomes arising during mosquito infection suppress pathogenesis and modulate virus fitness in vivo. J Virol, 85, 12605-12613.

Erdélyi K., Ursu K., Ferenczi E., Szeredi L., Rátz F., Skáre J. & Bakonyi T. 2007. Clinical and pathologic features of lineage 2 West Nile virus infections in birds of prey in Hungary. Vector Borne Zoonotic Dis, 7 (2), 181-188.

Fredericksen B.L., Smith M., Katze M.G, Shi P.Y. & Gale M.Jr. 2004. The host response to West Nile virus infection limits viral spread through the activation of the interferon regulatory factor 3 pathway. J Virol, 78, 7737-7747.

Garmendia A.E., Van Kruiningen H.J., French R.A., Anderson J.F., Andreadis T.G., Kumar A. & West A.B. 2000. Recovery and identification of West Nile virus from a hawk in winter. J Clin Microbiol, 38 (8), 3110-3111.

Gray R.R., Veras N.M., Santos L.A. & Salemi M. 2010. Evolutionary characterization of the West Nile Virus complete genome. Mol Phylogenet Evol, 56 (1), 195-200.

Hannoun C., Panthier R., Mouchet J. & Eouzan J.P. 1964. Isolement en France du virus West Nile à partir de malades et du vecteur Culex modestus Ficalbi. CR Acad Sci Paris, 259, 4170-4172.

Hayes E.B., Komar N., Nasci R.S., Montgomery S.P., O'Leary D.R. & Campbell G.L., 2005. Epidemiology and transmission dynamics of West Nile virus disease. Emerg Infect Dis, 11, 1167-1173.

Höfle U., Blanco J.M., Crespo E., Naranjo V., Jiménez-Clavero M.A., Sanchez A., de la Fuente J. & Gortazar C. 2008. West Nile virus in the endangered Spanish imperial eagle. Vet Microbiol, 129 (1-2), 171-178.

Jiménez-Clavero M.A., Sotelo E., Fernandez-Pinero J., Llorente F., Blanco J.M., Rodriguez-Ramos J., Perez-Ramirez E. & Höfle U. 2008. West Nile virus in golden eagles, Spain, 2007. Emerg Infect Dis, 14 (9), 1489-1491.

Jourdain E., Gauthier-Clerc M., Sabatier P., Grège O., Greenland T., Leblond A., Lafaye M. & Zeller H.G. 2008. Magpies as hosts for West Nile virus, southern France. Emerg Infect Dis, 14 (1), 158-160.

Kinney R.B., Huang. C.Y.H., Whiteman M.C., Bowen R.A., Langevin S.A. & Miller B.R. 2006. Avian virulence and thermostable replication of the North American strain of West Nile virus. J Gen Virol, 87, 3611-3622.

Kramer L.D., Styer L.M. & Ebel G.D. 2008. A global perspective on the epidemiology of West Nile virus. Annu Rev Entomol, 53, 61-81.

Komar N., Langevin S., Hinten S., Nemeth N., Edwards E., Hettler D., Davis B., Bowen R. & Bunning M. 2003. Experimental Infection of North American Birds with the New York 1999 Strain of West Nile Virus. Emerg Infect Dis, 9 (3), 311-322.

16


Sotelo E., Gutierrez-Guzmán A.V., Del Amo J., Llorente F., El-Harrak M., Pérez-Ramírez E., Blanco J.M., Höfle U. & Jiménez-Clavero M.A. 2011. Pathogenicity of two recent Western Mediterranean West Nile virus isolates in a wild bird species indigenous to Southern Europe: the red-legged partridge. Vet Res, 42 (1), 11.

Spina F. & Volponi S. 2009. Atlante della Migrazione degli Uccelli in Italia. Vol. 2 - Passeriformi. ISPRA, Roma, 631 pp.

Thompson J.D., Higgins D.G. & Gibson T.J. 1994. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res, 22, 4673-4680.

Toma L., Cipriani M., Goffredo M., Romi R. & Lelli R. 2008. First report on entomological field activities for the surveillance of West Nile disease in Italy. Vet Ital, 44 (3), 499-512.

Vazquez A., Sanchez-Seco M.P., Ruiz S., Molero F., Hernandez L., Moreno J., Magallanes A., Tejedor C.G. & A. Tenorio. 2010. Putative new lineage of West Nile virus, Spain. Emerg Infect Dis, 16, 549-552.

Wodak E., Richter S., Bagó Z., Revilla-Fernández S., Weissenböck H., Nowotny N. & Winter P. 2011. Detection and molecular analysis of West Nile virus infections in birds of prey in the eastern part of Austria in 2008 and 2009. Vet Microbiol, 149 (3-4), 358-366.

World Animal Health Information Disease Database (WAHID). 2014. West Nile fever, Turkey. World Organisation for Animal Health, Paris. www.oie.int/wahis_2/public/wahid.php/Reviewreport/Review/viewsummary?reportid=16002 accessed on 20th

January 2015.

World Organization for Animal Health (OIE) Terrestrial Manual 2014, Chapter 2.1.20. West Nile fever. (http://www.oie.int/fileadmin/Home/eng/Health_standards/tahm/2.01.20_WEST_NILE.pdf, accessed on 12/01/2015).

epidemiological investigation method: principles and results. Zh Mikrobiol Epidemiol Immunobiol, 2, 29-37.

Rizzo C., Salcuni P., Nicoletti L., Ciufolini M.G., Russo F., Masala R., Frongia O., Finarelli A.C., Gramegna M., Gallo L., Pompa M.G., Rezza G., Salmaso S. & Declich S. 2012. Epidemiological surveillance of West Nile neuroinvasive diseases in Italy, 2008 to 2011. Euro Surveill, 17 (20), pii=20172. http://www.eurosurveillance.org/View Article.aspx?ArticleId=20172.

Root J.J., Oesterle P.T., Nemeth N.M., Klenk K., Gould D.H., McLean R.G., Clark L. & Hall J.S. 2006. Experimental infection of fox squirrels (Sciurus niger) with West Nile virus. Am J Trop Med Hyg, 75(4), 697-701.

Saito E.K., Sileo L., Green D.E., Meteyer C.U., McLaughlin G.S., Converse K.A. & Docherty D.E. 2007. Raptor mortality due to West Nile virus in the United States, 2002. J Wild Dis, 43(2), 206-213.

Savini G., Capelli G., Monaco F., Polci A., Russo F., Di Gennaro A., Marini V., Teodori L., Montarsi F., Pinoni C., Pisciella M., Terregino C., Marangon S., Capua I. & Lelli R. 2012. Evidence of West Nile virus lineage 2 circulation in Northern Italy. Vet Microbiol, 158 (3-4), 267-273.

Severini F., Toma L., Di Luca M. & Romi R. 2009. Le zanzare italiane: generalità e identificazione degli adulti (Diptera, Culicidae). Fragmenta Entomologica, 41 (2), 213-372.

Sirbu A., Ceianu C.S., Panculescu-Gatej R.I., Vazquez A., Tenorio A., Rebreanu R., Niedrig M., Nicolescu G. & Pistol A. 2011. Outbreak of West Nile virus infection in humans, Romania, July to October 2010. Euro Surveill, 16 (2), pii=19762. http://www.eurosurveillance.org/ViewArticle.aspx?ArticleId=19762.

Sotelo E., Fernandez-Pinero J., Llorente F., Agüero M., Hoefle U., Blanco J.M. & Jiménez-Clavero M.A. 2009. Characterization of West Nile virus isolates from Spain: new insights into the distinct West Nile virus eco-epidemiology in the Western Mediterranean. Virology, 395 (2), 289-297.


17

RiassuntoLa Peste equina (PE) è una malattia infettiva non contagiosa degli Equidi. È causata da Orbivirus e trasmessa da vettori del genere Culicoides. Nel 2011 è stata svolta un’indagine entomologica in sei allevamenti sede di focolaio di PE, situati in quattro regioni della Namibia, nel raggio di circa 400 km dalla capitale Windhoek: Khomas (Windhoek e Steinhausen), Erongo (Karibib e Omaruru), Otjozondjupa (Okahandja) e Omaheke (Gobabis). Sono stati catturati e identificati 194.211 Culicoides. In tutti gli allevamenti, la specie Culicoides imicola è risultata quella più abbondante (99,4%). In totale 18.687 Culicoides, divisi in 248 pool, sono stati analizzati per PE tramite real time RT-PCR: 227 pool composti da C. imicola, 13 da C. pycnostictus, 5 da Schultzei complex, 1 da C. nivosus, 1 da C. leucostictus e 1 da C. tropicalis. Tra questi, 81 pool sono risultati positivi (tasso d'infezione 0,91%), tutti composti da C. imicola e tutti provenienti dal sito di Omaruru. L’isolamento virale è stato tentato su 88 pool (n=1.463) con esito negativo. Tuttavia sono stati isolati due sierotipi del virus della Bluetongue (BTV 1 e BTV 10) da tre pool, composti ognuno da 100 esemplari di C. imicola provenienti dal sito di Windhoek.

Parole chiaveBluetongue,Culicoides imicola,Namibia,Peste equina (PE).

Indagini virologiche in Culicoides catturatiin focolai di Peste equina in Namibia

SummaryAfrican horse sickness (AHS), a non-contagious infectious disease caused by a RNA virus in the Orbivirus genus within the Reoviridae family affecting all equids, is endemic in sub-Saharan Africa. The virus is transmitted by some species of biting midges in the genus Culicoides (Diptera: Ceratopogonidae). In April 2011, 8 Culicoides collections were performed in 6 districts of 4 regions of the Republic of Namibia (Africa), all within a 400 km radious from the capital Windhoek. Six farms - Khomas (Windhoek and Steinhausen), Erongo (Karibib and Omaruru), Otjozondjupa (Okahandja), and Omaheke (Gobabis) involved in the AHS outbreaks, were sampled. Overall 194,211 Culicoides were collected and identified. Culicoides imicola was largely the most abundant species at all farms (99.4%). A total of 18,687 parous and gravid Culicoides females were assayed for AHS virus (AHSV) by real time RT-PCR. Of the 248 assayed pools, 227 consisted of C. imicola, 13 of Culicoides pycnostictus and 5 of Schultzei complex. Only 1 pool each of Culicoides nivosus, Culicoides leucostictus, and Culicoides tropicalis was assayed. Of the 248 pools examined by real time RT-PCR, 81 tested positive for AHSV, all consisting of C. imicola collected at Omaruru, resulting in a field vector infection rate of 0.91%. No viable AHSV could be isolated from 88 of the tested pools (n = 1,463). However, bluetongue virus (BTV) serotype-1 and 10 were isolated from 3 of these pools, each consisting of 100 C. imicola collected at Windhoek. The present study confirms the relative low infection prevalence in field collected Culicoides and the strict relationship between the high abundance of C. imicola and outbreaks of AHSV.

KeywordsAfrican horse sickness,Bluetongue,Culicoides imicola,Namibia.


1 Istituto Zooprofilattico Sperimentale dell’Abruzzo e del Molise ‘G. Caporale’, Campo Boario, 64100 Teramo, Italy.2 Central Veterinary Laboratory, 24 Goethe Street, Windhoek, Namibia.

* Corresponding author at: National Reference Centre for Exotic Diseases (CESME),Istituto Zooprofilattico Sperimentale dell’Abruzzo e del Molise ‘G. Caporale’, Campo Boario, 64100 Teramo, Italy.

Tel: + 39 0861 332416, Fax: +39 0861 332251, e-mail: [email protected].

Maria Goffredo1, Giovanni Savini1, Michela Quaglia1*, Umberto Molini2, Valentina Federici1,Monica Catalani1, Ottavio Portanti1, Valeria Marini1,

Maseke Adrianus Florentius2, Attilio Pini1 & Massimo Scacchia1

Orbivirus detection from Culicoides collected on African horse sickness outbreaks in Namibia


Orbivirus detection in Culicoides in Namibia Goffredo et al.

African horse sickness is endemic in sub-Saharan Africa (Howell 1963, Coetzer et al. 2004), however epizootic events have occurred outside this area, such as in Asia, North Africa, Spain, and Portugal (MacLachlan and Guthrie 2010). A limited serological study in the Windhoek district (Namibia, Africa), revealed the presence of antibodies against AHSV in 50% of the tested donkeys (Venter et al. 1999). In addition, the 1987 AHS outbreak in, Spain, was ascribed to zebras imported from Namibia (Lubroth 1988, Hamblin et al. 1991).

In the AHS outbreaks investigated between 2006 and 2011, 7 (1, 2, 4, 6, 7, 8 and 9) of the 9 AHSV serotypes were detected in the affected horses (Scacchia et al. 2009, Scacchia personal communication, 2011).

Even though the first 2 described species of sub-Saharan Culicoides (Culicoides shultzei and Culicoides herero) originated from Namibia (Enderlein 1908), there is a relatively scanty literature surveying the presence of Culicoides in this region (Becker et al. 2012, Becker et al. 2013), thus leaving the Culicoides species composition at farm level still greatly unknown. In April 2011, an entomological survey was performed on 6 farms in the AHSV infected area surrounding Windhoek (Namibia), with the goal of defining the species composition of the Culicoides population and to detect AHSV in the insects. It is noteworthy that outbreaks of AHS were occurring in the sampled farms during the survey.

Materials and methodsThe study included 6 farms located in the regions of Khomas (Windhoek and Steinhausen), Erongo (Karibib and Omaruru), Otjozondjupa (Okahandja) and Omaheke (Gobabis) (Namibia, Africa). All the farms are located within a radius of about 400 km around Windhoek (Figure 1). In 4 of the surveyed farms, along with horses, other domestic and/or wild animal species were also present (Table I). Apart from Gobabis, the horses of the other farms were regularly vaccinated for AHS with a live attenuated polyvalent vaccine. Despite this, AHS cases had been detected in 6 farms, during the sample period (Molini personal communication, 2014).

Onderstepoort-type blacklight traps, particularly attractive for Culicoides, were used (Wieser-Schimpf et al. 1990, Goffredo and Meiswinkel 2004, Venter and Hermanides 2006). In each farm, the trap was positioned close to the horses. The field activities and the analysis of the collected samples were performed as described by Goffredo and Meiswinkel (Goffredo and Meiswinkel 2004). Eight light trap collections were conducted in April 2011 (Table I). The collected insects were stored refrigerated in phosphate-buffered saline (PBS) as medium, before being pooled for virus isolation. The remaining

IntroductionAfrican horse sickness (AHS) is a non-contagious infectious vector borne viral disease affecting all equids. It is caused by AHS virus (AHSV), a RNA virus in the Orbivirus genus within the Reoviridae family, transmitted by certain species of blood feeding Culicoides midges (Diptera: Ceratopogonidae). In addition to AHSV, Culicoides midges are able to transmit veterinary important viral diseases such as Bluetongue, Epizootic haemorrhagic disease, Equine encephalosis, Bovine ephemeral fever, Schmallenberg (Meiswinkel et al. 2004, EFSA 2014).

African horse sickness has already been isolated in Africa in several Culicoides species, among which Culicoides bolitinos in South Africa, Culicoides imicola in South Africa and Zimbabwe, Culicoides spp. (not identified at species level) in Kenya and South Africa, and mixed pools of Culicoides nivosus/Culicoides leucostictus/C. bolitinos in South Africa (Blackburn et al. 1985, Davies et al. 1979, Meiswinkel and Paweska 2003, Nevill et al. 1992a, Scheffer et al. 2012, Venter et al. 2006).

In Spain AHSV has been isolated from C. imicola and from mixed pools of Culicoides obsoletus/Culicoides pulicaris (Mellor et al. 1990).

Figure 1. Location of Culicoides collection sites in the Windhoek, Steinhausen, Karibib, Omaruru, Okahandja and Gobabis districts (Namibia 2011).

19Veterinaria Italiana 2015, 51 (1), 17-23. doi: 10.12834/VetIt.275.1016.2

Goffredo et al. Orbivirus detection in Culicoides in Namibia

were considered positive (Aguero et al. 2008). The infection rate in vector population was calculated using a maximum likelihood estimation method, which takes into account the size of each tested pool (Biggerstaff 2009).

Results During the 8 light trap collections conducted on the 6 Namibian farms, 194,211 Culicoides were collected. Culicoides imicola was largely the most abundant species, representing 99.39% of total midge population, followed by Culicoides pycnostictus (0.35%), Schultzei complex (C. schultzei and Culicoides subschultzei) (0.09%), Culicoides tropicalis (0.06%), C. leucostictus (0.06%), C. nivosus (0.02%) and other species, such as Culicoides ravus and Culicoides macintoshi (0.03%). The largest collection was the one conducted at the Omaruru

insects were then put in 70% ethanol and stored at room temperature.

The species were identified using the wing morphology according to the atlas of African species (Meiswinkel 1996) (Afrotropical Culicoides, unpublished data). Based on abdominal pigmentation (Dyce 1969), Culicoides classified as parous or gravid females were sorted out and divided in pools (max 100 individuals).

From midges collected and stored in PBS, virus isolation was attempted on African green monkey kidney (VERO) cell lines, according to the method described in the Manual of diagnostic tests and vaccines for terrestrial animals (OIE 2012). Virus neutralization test using type specific antisera was used to identify and determine the serotype (OIE 2012).

The pools in ethanol were tested for AHSV by real time RT-PCR, samples with Ct-values less than 40

Table I. Location and description of the Culicoides collection sites in the Windhoek, Steinhausen, Karibib, Omaruru, Okahandja and Gobabis districts (Namibia 2011).

Region District Geographical coordinates

Mammal species (number) Type of farming Collection

Khomas Windhoek S 22,575816°E 17,126126° Horses (40) Manège and riding school 11 April 2011

20 April 2011

Khomas Steinhausen S 22.06°E 18.19° Horses (154) Breeding horse farm 29 April 2011

Erongo Karibib S 21,94479722°E 15,84054444°

Horses (39)

Commercial animal farm and manège 27 April 2011

Cattle (130)Sheep (120)Goats (80)AntelopesWarthogs

Erongo Omaruru S 21,46821111°E 15,92056111°

Horses (16)

Commercial animal farm 27 April 2011Zebras

AntelopesWarthogsBaboons

Otjozondjupa Okahandja S 21,967883°E 16,94561°

Horses (32)

Hunting farm 13 April 2011

Donkeys(1)Cattle (90)

ZebrasAntelopesWarthogs

Omaheke Gobabis S 21,72331667°E 19,34855°

Horses (25)

Commercial animal farm and wild animal reserve

7 April 201129 April 2011

Cattle (250)Sheep (124)Goats (32)Zebras (2)AntelopesWarthogs

HyenasLions

Leopards

20



Table II. Abundance of Culicoides species collected at 6 farms in the Windhoek, Steinhausen, Karibib, Omaruru, Okahandja and Gobabis districts (Namibia 2011).

SpeciesCollection site

Windhoek (%) Steinhausen (%) Karabib (%) Omaruru (%) Okahandja (%) Gobabis (%) Total (%)C. imicola 13,439(98.54) 7,788 (99.99) 604 (98.53) 167,793 (99.87) 1,571 (96.9) 1839 (72.40) 193,034 (99.39)

C. pycnostictus 19 (0.16) 1 (0.01) 1 (0.16) 0 35 (2.2) 621 (24.45) 677 (0.35)

Schultzei complex 11(0.08) 0 8 (1.31) 145 (0.09) 5 (0.3) 2 (0.08) 171 (0.09)

C. tropicalis 48(0.37) 0 0 72 (0.04) 0 0 120 (0.06)

C. leucostictus 108(0.75) 0 0 0 0 1 (0.04) 109 (0.06)

C. nivosus 1(0.01) 0 0 0 1 (0.1) 44 (1.731) 46 (0.02)

Other species 12(0.09) 0 0 0 9 (0.6) 33 (1.30) 54 (0.03)

Total Culicoides 13,638 7,789 613 168,010 1,621 2,540 194,211

tested by RT-PCR were positive for AHSV. The positive samples consisted of C. imicola pools collected at Omaruru. Of these pools, 46 were composed of 100 C. imicola and 35 pools by 50 C. imicola (Table III). The Ct-values ranged from 29 to 39 (mean 35.6).

No AHSV could be isolated from the 88 assayed pools (1,463 midges). However, in 3 pools, each consisting of 100 C. imicola collected at the Windhoek farm, bluetongue virus (BTV) serotype-1 and -10 were isolated (Table IV). Virus neutralization test using type specific antisera was used to identify and determine the serotype.

Within C. imicola population, the AHSV infection rate at Omaruru was 0.91%. At Windhoek farm, where BTV was also isolated, the infection rate was 0.15%. In particular, the infection rate was 0.05% for BTV-1 and 0.1% for BTV-10.

DiscussionDespite the sampling being run only once or twice on the farms, this survey allowed to collect a huge

site, where in the span of 1 night 168,010 Culicoides midges (99.87% C. imicola) were collected (Table II).

Culicoides imicola was found on all the 6 collection sites, with a relative abundance ranging from 72.40% (Gobabis) to 99.99% (Steinhausen). The second most common species, C. pycnostictus, was collected at 5 sites. Its relative abundance ranged from 24.5%, at Gobabis, to 2.2%, at Okahandjia, to <0.3% at further 3 sites, Windhoek, Steinhausen and Karibib (Table II).

A total of 18,687 parous/gravid females were divided in 248 pools and tested by RT-PCR. Two hundred and twenty-seven of the considered specimens consisted of C. imicola (n = 18,037), 13 of C. pycnostictus (n = 589), 5 of Schultzei complex (n = 14) and only 1 each of C. nivosus (n = 39), C. leucostictus (n = 7) and C. tropicalis (n = 1). Eighty-one of the 248 pools

Table III. Culicoides tested for AHSV by RT-PCR in Namibia in 2011.

Collection site Species Number of

midgesNumber of

positive/tested pools

Windhoek

C. imicola 3,537 0/36

Schultzei complex 5 0/1

C. pycnostictus 4 0/1

C. leucostictus 7 0/1

OmaruruC. imicola 12,449 81*/152


C. tropicalis 1 0/1

OkahandjaC. imicola 873 0/9



Gobabis

C. imicola 1,178 0/30


C. nivosus 39 0/1


Total 18,687 81/248* 46 pools of 100 and 35 pools of 50 midges.

Table IV. Culicoides tested for AHSV by virus isolation in Namibia in 2011.

Collection site Species Number

of midgesNumber of pools

Virus isolation

Windhoek C. imicola 511 22

BTV1(1 pool)BTV10

(2 pools)

GobabisC. imicola 209 5 -

C. pycnostictus 13 1 -

KarabibC. imicola 291 8 -Schultzei complex 8 1 -

Stheinhausen C. imicola 247 9 -

Omaruru C. imicola 184 42 -

Total 1,463 88 -

21



birds and, occasionally, on mammals and BTV was isolated from field-collected specimens in South Africa (Nevill et al. 1992a, Nevill et al. 1992b). None of the 589 C. pycnostictus was positive for AHSV.

Similarly, AHSV was not detected in pools of C. schultzei and C. subschultzei, which belong to the Schultzei complex. In Africa, this complex includes also Culicoides nevilli, Culicoides enderleini and Culicoides kingi. Species of this complex are considered potential vectors of arboviruses. In Kenya, species of the Schultzei group are considered potential vectors of BTV and Ephemeral Fever virus (BEF) (Davies and Walker 1974, Walker and Boreham 1976, Davies et al. 1979). In Sudan, Epizootic Haemorrhagic Disease virus (EHDV) was isolated from C. kingi (Mellor et al. 1984). More recently, BTV (in India), and other arboviruses (in Japan) have been isolated from Culicoides oxystoma, an Asian species belonging to the Schultzei complex (Dadawala et al. 2012, Yanase et al. 2005).

Other species not abundant in the study area, and from which AHSV was not detected, include C. nivosus, C. leucostictus, and C. tropicalis. These species are mainly birdfeeders, although they also feed on livestock (Nevill et al. 1992b). In South Africa, a mixed pool of Culicoides species, including C. bolitinos, C. nivosus, and C. leucostictus was found positive for AHSV (Scheffer et al. 2012). This finding can probably be ascribed to the presence of C. bolitinos in the pool, however the possibility that C. nivosus and C. leucostictus might be involved in the transmission of AHSV cannot be discarded.

In previous surveys in the Khomas region, C. bolitinos, a species morphological closely related to C. imicola belonging to the Imicola complex, was reported in Namibia (Becker et al. 2013). It breeds in cattle manure and plays a potential role as AHS vector in South Africa (Meiswinkel and Paweska 1998, Meiswinkel and Paweska 2003, Meiswinkel et al. 2004). In the present survey, even though cattle were present at some of the sites, C. bolitinos was not collected in any of the AHSV affected farms and it probably does not play a significant role as a vector of AHSV in the surveyed areas.

Clinical cases of AHS occurred in all selected farms despite vaccination, involving in 2 regions (Otjozondjupa and Khomas) the majority (90%) of horses. Live attenuated polyvalent vaccine was the product used and animals were vaccinated between August and November. Therefore, it seems unlikely that the AHSV RNA fragments found in C. imicola pools collected at Omaruru in April derived from the vaccine administration.

Interestingly, BTV was isolated at Windhoek during an outbreak of AHSV. This might suggest that the same vector population is able to sustain

number of Culicoides and provided a clear picture of the Culicoides species composition in the livestock populating the study area.

This study clearly showed that C. imicola is the most widespread and abundant species in Namibia or at least in the selected and investigated areas. It accounted for more than 99% of the collected Culicoides midges. The trap sites, in close proximity to animal nocturnal shelters, and the collection period, the Summer, when C. imicola becomes abundant and the peak AHS season occurs, might have affected these results.

However, a study performed from July to September 2009 (Winter season) in the Khomas area, reported a relative abundance of C. imicola of 93.9% in the Windhoek region (Becker et al. 2012), which is in agreement with the abundance of C. imicola collected in the same region in the present study. These authors attributed this high value to a combined effect of breeding sites availability and host density. Culicoides imicola is known to be closely associated with livestock (large mammals) and to breed at farm level, in man-made larval sites, partially muddy areas near watering or irrigation points, whereas the species does not breed in sandy soil where water drains quickly (Braverman et al. 1974, Meiswinkel et al. 2004). In the South-Western Khomas Region, anthropogenic impacted/homestead sites have been shown more favorable for C. imicola than veld sites (Becker et al. 2013). In this study, the most abundant collection, with nearly 170 thousands Culicoides, mostly C. imicola, was carried out at Omaruru, where only 16 horses were hosted. It is, however, worth noticing that at this site, wild animals, such as zebras and various species of antelopes, used to approach the farm at dusk in search for water. Apart from enhancing the availability of vertebrate for blood meals, the presence of zebras might be epidemiologically relevant as these animals act as reservoirs for AHSV (Binepal et al. 1992).

The AHSV infection rate in C. imicola (0.91%) was comparable with that recently reported in South Africa (0.98%) (Scheffer et al. 2012). The low infection rate in vector populations is typical of arbovirus infections (Venter et al. 2006), this rate could be even lower if determined by virus isolation whose sensitivity is much lower than RT-PCR. The field AHSV prevalence in vectors, obtained in other studies using virus isolation during outbreaks of AHSV, does not exceed 0.005% (Venter et al. 2006).

The second most abundant species, C. pycnostictus, was found at 5 of the 6 sites. Compared to C. imicola abundance, the presence of C. pycnostictus was relatively low, with the exception of the Gobabis district, where it represented 24.45% of the collected midges. Culicoides pycnostictus feeds mainly on

22



In conclusion, this study confirms the relative low infection prevalence in field collected Culicoides and the strict relationship between the high abundance of C. imicola and outbreaks of AHSV (Venter et al. 2006) in Namibia. According to these results, C. imicola is likely to play a crucial role in spreading AHSV and BTV in Namibia or at least in the investigated areas. In Khomas region this role could be played all year round, as indicated by this and previous studies (Becker et al. 2012).

contemporaneously the circulation of at least 2 arboviruses. Clinical cases of BT were not reported in the area, where all the sheep of commercial farms are annually vaccinated with a polyvalent vaccine containing live attenuated bluetongue virus strains (Molini, personal communication 2014). Forty horses were kept at the Windhoek farm, however numerous domestic and wild ruminants, considered as reservoir hosts for BTV, were also present in the surrounding area and this might have accounted for the presence of BTV in the Culicoides collected on this farm.

Aguero M., Gomez-Tejedor C., Cubillo M.A., Rubio C., Romero E. & Jimenez-Clavero M.A. 2008. Real-time fluorogenic reverse transcription polymerase chain reaction assay for detection of African horse sickness virus. J Vet Diagn Invest, 20, 325-328.

Becker E., Venter G.J., Labuschagne K., Greyling T. & van Hamburg H. 2012. Occurrence of Culicoides species (Diptera: Ceratopogonidae) in the Khomas region of Namibia during the winter months. Vet Ital, 48 (1), 45-54.

Becker E., Venter G.J., Labuschagne K., Greyling T.& van HamburgH. 2013. The effect of anthropogenic activity on the occurrence of Culicoides species in the South-Western Khomas Region, Namibia. Vet Ital, 49 (3), 277-284.

Biggerstaff B.J. 2009. Pooled Inf Rate, Version 4.0: a Microsoft® Office Excel© Add-In to compute prevalence estimates from pooled samples. Centers for Disease Control and Prevention, Fort Collins, CO, U.S.A. www.cdc.gov/ncidod/dvbid/westnile/software.htm.

Binepal V.S., Wariru B.N., Davies F.G., Soi R. & Olubayo R. 1992. An attempt to define the host range for African horse sickness virus (Orbivirus, Reoviridae) in East Africa, by a serological survey in some Equidae, Camelidae, Loxodontidae and Carnivore. Vet Microbiol, 31 (1), 19-23.

Blackburn N.K., Searle L. & Phelps R.J. 1985. Viruses isolated from Culicoides (Diptera: Ceratopogonidae) caught at the veterinary research farm, Mazowe, Zimbabwe. J Entomol Soc Afr, 48, 331-336.

Braverman Y., Galun R. & Ziv M. 1974. Breeding sites of some Culicoides species (Diptera: Ceratopogonidae) in Israel. Mosq News, 34, 303-308.

Coetzer J.A.W. & Guthrie A.J. 2004. African horse sickness. In Infectious diseases of livestock, 2nd Ed. (J.A.W. Coetzer & R.C. Tustin, eds). Oxford University Press, Cape Town, Vol. 2, 1231-1246.

Dadawala A.I., Biswas S.K., Rehman W., Chand K., De A., Mathapati B.S., Kumar P., Chauhan H.C., Chandel B.S. & Mondal B. 2012. Isolation of Bluetongue virus serotype 1 from Culicoides vector captured in livestock farms and sequence analysis of the viral genome segment‐2. Transbound Emerg Dis, 59 (4), 361-368.

Davies F.G., Walker A.R., Ochieng P. & Shaw T. 1979.

References

Arboviruses isolated from Culicoides midges in Kenya. J Comp Pathol, 89, 587-595.

Davies F.G. & Walker A.R. 1974. The isolation of ephemeral fever virus from cattle and Culicoides midges in Kenya. Vet Rec, 95 (3), 63-64.

Davies F.G., Walker A.R., Ochieng P. & Shaw T. 1979. Arboviruses isolated from Culicoides midges in Kenya. J Comp Pathol, 89 (4), 587-595.

EFSA (European Food Safety Authority) 2014. Schmallenberg virus: State of Art. EFSA Journal, 12(5), 3681. doi:10.2903/j.efsa.2014.3681.

Dyce A.L. 1969. The recognition of nulliparous and parous Culicoides (Diptera: Ceratopogonidae) without dissection. J Aust Entomol Soc, 1, 11-15.

Enderlein G. 1908. Ceratopogonidae. Neue Ceratopogoninen aus Sudafrika. In: Zoologische und anthropologische Ergebnisse einer Forschungsreise im Westlichen unde zentralen Sudafrika ausgefuhrt in dem Jahren 1903-1905. Erster Band: Systematik und Tiergeographie, zweite Lieferung. Insecte E. Diptera. Denkschriften der Medizinisch - Naturwissenschaftlichen Gesellschaft zu Jena, 13, 459-461.

Goffredo M. & Meiswinkel R. 2004. Entomological surveillance of bluetongue in Italy: methods of capture, catch analysis and identification of Culicoides biting midges. Vet Ital, 40, 260-265.

Hamblin C., Mellor P.S., Graham S.D., Hooghuis H. & Montejano R.C. 1991. Antibodies in horses, mules and donkeys following monovalent vaccination against African horse sickness. Epidemiol Infect, 106, 365-371.

Howell P.G. 1963. African horse sickness. In Emerging diseases of animals. Food and Agriculture Organization of the United Nations, Rome, 71-108.

Lubroth J. 1988. African horse sickness and the epizootic in Spain 1987. Equine Practice, 10, 26-33.

MacLachlan N.J. & Guthrie A.J. 2010. Re-emergence of bluetongue, African horse sickness, and other Orbivirus diseases. Vet Res, 41 (6), 35.

Meiswinkel R. & Paweska J.T. 1998. The 1998 outbreak of African horse sickness in South Africa: A new Culicoides Latreille (Ceratopogonidae) vector? Fourth International congress of Dipterology, Keble College,

23



Culicoides biting midges and determination of African horse sickness virus prevalence in midge populations at Onderstepoort, South Africa. Vet Parasitol, 185, 265-273.

Venter G.J. & Hermanides K.G. 2006. Comparison of black and white light for collecting Culicoides imicola and other livestock-associated Culicoides species in South Africa. Vet Parasitol,142, 383-385.

Venter G.J., Koekemoer J.J.O. & Paweska J.T. 2006. Investigations on outbreaks of African horse sickness in the surveillance zone in South Africa. Rev Sci Tec, 25 (3), 1097-1109.

Venter G.J., Paweska J.T., Williams R. & Nevill E.M. 1999. Prevalence of antibodies against African horse sickness (AHS) and equine encephalosis (EE) viruses in donkeys in southern Africa. In Proc. Eighth international conference on equine infectious diseases (U. Werney, J.F. Wade, J.A. Mumford & O.R. Kaaden, eds). R & W Publication (Newmarket) Limited, Newmarket, 299-302.

Walker A.R. & Boreham P.F.L. 1976. Blood feeding of Culicoides (Diptera, Ceratopogonidae) in Kenya in relation to the epidemiology of bluetongue and ephemeral fever. Bull Entomol Res, 66, 181-188.

Wieser-Schimpf L., Foil L.D. & Holbrook R.F. 1990. Comparison of New Jersey light traps for collection of adult Culicoides variipennis (Diptera: Ceratopogonidae). J Am Mosq Control Assoc, 6, 537-538.

World Organisation for Animal Health (OIE). 2012. African Horse Sickness. Manual of diagnostic tests and vaccine for terrestrial animals, seventh edition, Chapter 2.1.5, 819-830.

Yanase T., Kato T., Kubo K., Yoshida S., Ohashi M., Yamakaka Y., Miura T. & Tsuda T. 2005. Isolation of bovine arboviruses from Culicoides biting midges (Diptera: Ceratopogonidae) in southern Japan: 1985-2002. J Med Entomol, 42, 63-67.

Oxford, UK, 6-13 September 1998, 145-146.

Meiswinkel R. & Paweska J.T. 2003. Evidence for a new field Culicoides vector of African horse sickness in South Africa. Prev Vet Med, 60(3), 243-253.

Meiswinkel R., Venter G.J. & Nevill E.M. 2004. Vectors: Culicoides spp. In Infectious Diseases of Livestock. 2nd

Ed. (J.A.W Coetzer & R.C. Tustin, eds) Oxford University Press, Cape Town, 2004, 93-136.

Mellor P.S., Boned J., Hamblin C. & Graham S. 1990. Isolations of African horse sickness virus from vector insects made during the 1988 epizootic in Spain. Epidemiol Infect, 105, 447-454.

Mellor P.S., Osborne R. & Jennings D. M. 1984. Isolation of bluetongue and related viruses from Culicoides spp. in the Sudan. J Hyg, 93, 621-628.

Nevill E.M., Erasmus B.J. & Venter G.J. 1992a. A six-year survey of viruses associated with Culicoides biting midges throughout South Africa (Diptera: Ceratopogonidae). In Bluetongue, African Horse Sickness and Related Orbiviruses (T.E. Walton & B.I.Osburn, eds) Proc. Second International Symposium, Paris, 17-21 June 1991. CRC Press, Boca Raton, 314-319.

Nevill E.M., Venter G.J. & Edwardes M. 1992b. Potential Culicoides vectors of livestock orbiviruses in South Africa. In In Bluetongue, African Horse Sickness and Related Orbiviruses (T.E. Walton & B.I.Osburn, eds) Proc. Second International Symposium, Paris, 17-21 June 1991. CRC Press, Boca Raton, 306-313.

Scacchia M., Lelli R., Peccio A., Di Mattia T., Mbulu R.S., Hager A.L., Monaco F., Savini G. & Pini A. 2009. African horse sickness: a description of outbreaks in Namibia. Vet Ital, 45, 265-274.

Scheffer E.G., Venter G.J., Labuschagne K., Page P.C., Mullens B.A., MacLachlan N.J., Osterrieder N. & Guthrie A.J. 2012. Comparison of two trapping methods for

25

Parole chiaveAborto,Brucellosi,Clamidiosi,Febbre Q,Leptospirosi,Marocco,Piccoli ruminanti,Toxoplasmosi.

RiassuntoPer indagare la sieroprevalenza in Marocco di cinque delle più diffuse cause di aborto infettivo nei piccoli ruminanti è stato condotto uno studio sierologico campionando 13 greggi di pecore e 10 di capre in due regioni del Paese. In totale sono stati prelevati 308 sieri (202 pecore, 106 capre) da 9 femmine con anamnesi di aborto e sono stati testati per brucellosi, clamidiosi, febbre Q e toxoplasmosi. Di questi, 197 sieri (97 pecore, 99 capre) sono stati testati anche nei confronti di nove delle principali sierovarianti di Leptospira. Il tasso medio di aborti è risultato essere del 12,10% nelle pecore e del 10,26% nelle capre. La sierologia ha identificato la circolazione di tutti e cinque gli agenti infettivi indagati in entrambe le specie. Dieci greggi (43%) sono risultati positivi alla brucellosi, 21 (91%) alla clamidiosi, 17 (74%) alla toxoplasmosi, 13 (57%) alla febbre Q e 5 (22%) alla leptospirosi. Per Leptospira sono state trovate positività verso le sierovarianti Copenhageni e Grippothyphosa in un gregge di pecore, mentre positività verso Tarassovi e Copenhageni sono state rilevate in quattro greggi di capre. Dei 23 greggi indagati, 22 (96%) hanno mostrato la presenza di infezioni miste. I risultati di questo studio confermano il possibile coinvolgimento dei cinque agenti infettivi indagati nei casi di aborto che si verificano nelle regioni oggetto di studio. Ulteriori studi sono tuttavia necessari per meglio comprendere l’eziologia degli aborti infettivi nei piccoli ruminanti in Marocco.

Indagine sierologica sulle più comuni cause di aborto infettivonei piccoli ruminanti in Marocco

KeywordsAbortion,Brucellosis,Chlamydiosis,Leptospirosis,Morocco,Q fever,Small ruminants,Toxoplasmosis.

SummaryA serological survey was conducted to estimate the seroprevalence of 5 major abortive infections in 13 sheep flocks and 10 goat herds in 2 regions of Morocco. A total of 308 from aborted females (202 ewes and 106 does) and 197 sera (97 ewes and 99 does), were tested for brucellosis, chlamydiosis, Q fever, toxoplasmosis, and for 9 major serovars of Leptospira. An average abortion rate of 12.10% was found in ewes and 10.26% in does. The serological analyses revealed the presence of all 5 abortive infections, both in sheep and in goats. Ten (43%) herds/flocks were positive to brucellosis, 21 (91%) to chlamydiosis, 17 (74%) to toxoplasmosis, 13 (57%) to Q fever, and 5 (22%) to leptospirosis. Leptospira spp. serovars Copenhageni and Grypothyphosa were found in a single sheep flock, while Tarassovi and Copenhageni were detected in 4 goat herds. Of the 23 investigated herds/flocks, 22 (96%) showed mixed infections. The findings of this study confirmed the possible involvement of the 5 selected abortive infections in abortion outbreaks occurring in the investigated regions. Further investigations are needed to better understand the aetiology of infectious abortions in herds and flocks within investigated regions.


1 Institut Agronomique et Vétérinaire Hassan II, Rabat, Morocco.2 FAO, Rome, Italy.

3 Istituto Zooprofilattico Sperimentale delle Venezie, Padua, Italy.

* Corresponding author at: Istituto Zooprofilattico Sperimentale delle Venezie, Padua, Italy.Tel.: +39 049 8084354, e-mail: [email protected].

Abdelali Benkirane1, Soukaina Essamkaoui1, Ahmed El Idrissi2,Laura Lucchese3 & Alda Natale3*

A sero-survey of major infectious causes of abortion in small ruminants in Morocco



Samples selection, processing, and conservationThe investigation was performed during Spring (February – April) of 2013 in 2 regions, namely Tetouan and Chaouen, located respectively in Northern Morocco and the Middle Atlas. The 2 regions are known to have vocation for breeding of goats and sheep. At the time of the survey lambing/kidding season was coming to an end and all farms of origin had experienced abortions. Prior to sampling, a questionnaire was completed inquiring, among others, about the size and structure of the flock/herd and the history of the abortive syndrome as well as the stage of pregnancy at which abortions occur and the aspect of aborted foetuses. All 308 serum samples (202 from ewes and 106 from does) were taken from aborting animals originating from 13 sheep flocks (totalling 2,513 ewes), and 10 goat herds (totalling 1,150 does). A convenience sampling method was adopted through which up to 20 sera were taken from each flock/herd including sera from all primiparous females. Blood was obtained aseptically from a jugular vein, allowed to clump for about 1 hour at room temperature, then sera were separated and transported to the laboratory, centrifuged (15 min at 3,000 rpm) and each serum despatched in 3 aliquots and stored at -20°C until analysis.

Laboratory examinationSerum samples were tested for Brucella spp., Chlamydia spp., Coxiella burnetii, Toxoplasma gondii and for 9 serovars of Leptospira interrogans.

The Rose Bengal Test (Veterinary Laboratory Agency – VLA, UK) modified as to use 25 μl Antigen to react with 75 μl serum (Blasco et al. 1994) was used to test for Brucella antibodies. A positive reaction showed a moderate to intense agglutination.

The CHEKIT Chlamydia ELISA Test Kit (Idexx Laboratories, Westbrook, Maine, USA) was used for the detection of antibodies against Chlamydia abortus. Following the manufacturers’ instructions, a sample having an S/P % value equal or over 40% was considered as positive.

The CHEKIT Q-Fever ELISA Test Kit (Idexx Laboratories, Westbrook, Maine, USA) was used for the detection of antibodies against C. burnetii. Following the manufacturers’ instructions, a sample having an S/P % value equal or over 80% was considered positive.

Antibodies to T. gondii were also detected through an indirect ELISA kit (LSI, Lissieu, France). Samples with OD of 50% and above were considered positive.

The MAT was used to test for Leptospirosis and was

IntroductionAbortion in livestocks is the cause of considerable economic losses for farmers and farming communities. In addition, abortion may be of great importance to public health, if it prompted by microorganisms that may cause diseases to humans. Brucella, Listeria, Coxiella, Chlamydia, Leptospira, and Toxoplasma are some of the microorganisms of public health importance causing abortion in small ruminants (Jonker 2004). These infectious agents easily spread among animals and humans in all farming systems. At the same time they are of increased importance where communal grazing is practised and farms are family holdings (Gwaze Rumosa 2009). Communal grazing is common in North Africa, with the exception of Morocco, and Middle Eastern countries (Spickler and Roth 2008). Brucella spp. is a frequent cause of severe human illness, thus it is the first suspected pathogen when small ruminant abortions are investigated (Blancou and Lefévre 2006). In Morocco several investigations conducted on small ruminants have repeatedly shown that Brucellosis was rare and geographically limited to the Eastern part of the country (El Idrissi et al. 1995, Laghzaoui et al. 1996, El Jay et al. 2003). Conversely other causes of abortions, such as Coxiella, Salmonella, Toxoplasma or Chlamydia, have been frequently reported (Benkirane et al. 1990, El Idrissi et al. 1995, El Jay et al. 2003).

Leptospira spp. infection as a possible cause of abortion among sheep and goats is rarely investigated, because it is thought to rarely cause clinical disorders in small ruminants as compared to large ruminants, pigs and dogs (Ellis 1994). Furthermore, testing of leptospirosis is difficult because the Microscopic Agglutination Test (MAT), which is the internationally recognized method for investigating leptospirosis, requires specific equipment and the ability to grow Leptospira antigens.

Over the past years, livestock owners in several regions in Morocco have reported unusual abortion rates, causing significant economic losses in sheep and goats. The causes of these abortions remained undiagnosed. The present investigation attempted to explore, through a serological survey, the relative importance of the most frequently investigated small ruminant abortion causes in 2 regions of Morocco during Spring of 2013. These include Brucella spp., Chlamydia abortus, Coxiella burnetii, Toxoplasma gondii as well as various Leptospira serovars of widespread distribution in the Mediterranean Basin: Icterohaemorrhagiae, Copenhageni, Bratislava, Canicola, Grippotyphosa, Pomona, Tarassovi, Ballum, and Hardjo (Cerri et al. 2003).

Abortion in small ruminants in Morocco Benkirane et al.


the shepherds believe this would be in connection with the presence of some toxic plants in the field. However, it was reported that part of the cases consisted of stillbirths or births of weak lambs/kids with lameness and respiratory disorders that usually die within a couple of days. The causes of abortion were rarely investigated and never confirmed. There is no history of vaccination against any of the abortive agents investigated in this study. In Spring 2013 (February – April), the average abortion rate was quite similar in sheep (3.52% to 19.39%) and goats (5.16% to 28.88%) (Table I).

The distribution of abortion cases seems to be similar in both primiparous and multiparous ewes, showing rates of 10.43% and 11.14% of the total number of females, respectively (Table II).

Seroprevalence of the five investigated infections The seroprevalence of the 5 investigated abortive infections by sampled animals and herd/flock are shown in Table III and IV and Figures 1 and 2.

The highest number of positive samples (n=55) was to C. abortus for ewes and to C. burnetii (n=29) for does. Brucella spp. was third among does and fourth among ewes. Forty-two ewe samples (20,8%) showed high antibody titers to T. gondii, this was higher than the results concerning does, only 9 (8,5%) positive samples were recorded.

For leptospirosis, only 98 and 99 sera were examined from sheep and goats, respectively. Only 2 ewes from the same flock (O9) were found positive to serovar Copenhageni and 1 of them was also positive to serovar Gripothyphosa. Copenhageni was also detected in 1 doe in 1 herd (C3), while Tarassovi was present in 4 animals originating from 3 herds (C1, C2, C6). The MAT titers of all positive sera did not exceed 1:400.

Distribution of abortive infections by pregnancy rankThe distribution of the various infections according to the pregnancy rank (primiparous vs multiparous) is shown in Table V. There is no statistically significant

performed according to the OIE Manual (OIE 2008) and using as antigen 9 live serovars of Leptospira spp. belonging to 8 serogroups, considered as the most significant serivars for the Mediterranean region (Cerri et al. 2003), namely: Icterohaemorrhagiae, Copenhageni, Bratislava, Canicola, Grippotyphosa, Pomona, Tarassovi, Ballum, and Hardjo. A positive sample shows 50% or more of antigen agglutination in a titre of 1/100 or higher.

Results

Abortion featuresThe analysis of the questionnaire revealed that past abortion rates varied measurably from year to year (between 5% and 20%, approximately) and

Benkirane et al. Abortion in small ruminants in Morocco

Table I. Abortion rates in sheep (data collected in Tizitine, Ain Leuh and Azrou districts, Middle Atlas) and goats (data collected in Chaouen and Tetouan districts, Northen Morocco) during Spring 2013 (February – April).

Regi

on

(spec

ies)

Dist

rict

Floc

k/he

rd

Num

ber

fem

ales

Abor

ting

(%)

Sam

pled

(%)

Middle Atlas

(sheep)

Tizitine

O1 165 32 (19.39%) 20 (12.12%)

O2 278 26 (09.35%) 20 (07.19%)

O3 33 06 (18.18%) 06 (18.18%)

O4 284 10 (03.52%) 10 (03.52%)

O5 212 26 (12.26%) 20 (09.43%)

O6 185 12 (06.48%) 12 (06.48%)

O7 232 20 (08.62%) 18 (07.75%)

Ain Leuh

O8 210 22 (10.47%) 15 (07.14%)

O9 212 18 (08.49%) 18 (08.49%)

O10 186 19 (10.21%) 19 (10,21%)

O11 36 04 (11.11%) 04 (11.11%)

AzrouO12 230 39 (16.95%) 20 (08.69%)

O13 250 36 (14.40%) 20 (08.00%)

Total 13 2513 270 (10.74%) 202 (08.03%)

North (goats)

Chaouen

C1 143 11 (07.69%) 11 (07.69%)

C2 120 22 (18.33%) 16 (13.33%)

C3 188 16 (08.51%) 11 (05.85%)

C4 70 11 (15.71%) 11 (15.71%)

C5 123 09 (07.31%) 09 (07.31%)

C6 95 10 (10.52%) 10 (10.52%)

Tetouan

C7 213 11 (05.16%) 11 (05.16%)

C8 74 05 (06.75%) 05 (06.75%)

C9 90 26 (28.88%) 16 (17.77%)

C10 34 06 (17.64%) 06 (17.64%)

Total 10 1150 127 (11.04%) 106 (09.21%)

Total 23 3663 397 (10.83%) 308 (08.40%)

Table II. Breakdown of abortion cases by pregnancy rank in sheep and goats during Spring 2013 (February – April) in Tetouan and Chaouen districts (Northen of Morocco) and in the Middle Atlas.

Pregnancy Rank Number of females Number of abortions

Primiparous 1572 164 (10,43%)

Multiparous 2091 233 (11.14%)

Total 3663 397 (10,83%)

28



herds) tested positive to 3 causes, and 11 farms had animals positive to 4 of the 5 investigated abortion causes. All sheep flocks and 80% of goat herds were positive to C. abortus.

DiscussionThe present serological study showed that all 5 investigated abortion causes are widely distributed both in sheep and goats, in the 2 regions where the

difference in the comparative prevalence of the 3 major abortive infections (brucellosis, chlamydiosis, and Q fever) between primiparous and multiparous ewes and does. The chi square calculation shows, in turn, highly significant differences of the prevalence of both Leptospira and Toxoplasma infections, in favour of older individuals.

Twenty-two farms out of 23 were serologically positive to 2 or more of the investigated possible causes: 6 (4 sheep flocks and 2 goat herds) tested positive to 2 causes, 4 (2 sheep flocks and 2 goat

Table III. Seropositivity of sheep and goats flocks/herds to 5 abortive infections. The serological survey was carried out on 23 flocks/herds of Northen Morocco and Middle Atlas during Spring 2013 (February – April).

Animal Species Brucellosis Chlamydiosis Q fever Toxoplasmosis Leptospirosis

Sheep (n=13) 05 (38%) 13 (100%) 07 (54%) 11 (85%) 01 (08%)

Goats (n=10) 05 (50%) 08 (80%) 06 (60%) 06 (60%) 04 (40%)

Total (n=23) 10 (43%) 21 (91%) 13 (57%) 17 (74%) 05 (22%)

Table IV. Seropositivity of sheep and goats to 5 abortive infections. Animals were sampled during Spring 2013 (February – April) in the Northen Morocco and Middle Atlas.

Animal Species Brucellosis Chlamydiosis Q fever Toxoplasmosis Leptospirosis

Sheep (n=202) 27 (13.4%) 55 (27.2%) 31 (15.3%) 42 (20.8%) 01/98 (1%)

Goats (n=106) 14 (13.2%) 16 (15.1%) 29 (27.3%) 09 (8.5%) 05/99 (5%)

Total (n=308) 41 (13.3%) 71 (23.1%) 60 (19.5%) 51 (16.5%) 06 (3%)

Table V. Distribution of the 5 abortive infections in relation with pregnancy rank. Data collected during a serological survey on sheep and goats performed during Spring 2013 (February – April) in Tetouan and Chaouen districts (Northen Morocco) and in the Middle Atlas.

Nb females Brucellosis Chlamydiosis Q fever Toxoplasmosis Leptospirosis

Primi- parous 87 9 (10.3%) 18 (20.7%) 14 (16.1%) 11 (12.6%) 0/41

Multi-parous 221 32 (14.5%) 53 (24%) 46 (20.8%) 40 (18.1%) 6/156 (3.8%)

Total 308 41 (13.3%) 71 (23%) 60 (19.5%) 51 (16.6%) 6 (3%)

Total (n=23) Goats (n=10) Sheep (n=13)

5

A

B

C

D

E

10 15 20 25

Figure 1. Seropositivity to the 5 investigated abortive infections by herd/flock during Spring 2013 (February – April) in Northen Morocco and Middle Atlas. (A=Leptospirosis; B=Toxoplasmosis; C=Q Fever; D=Chlamidiosis; E=Brucellosis).

Total (n=308) Goats (n=106) Sheep (n=202)

10

A

B

C

D

E

20 30 40 50 60 70 80

Figure 2. Individual seropositivity to the 5 investigated abortive infections during Spring 2013 (February – April) in Northen Morocco and Middle Atlas. (A=Leptospirosis; B=Toxoplasmosis; C=Q Fever; D=Chlamidiosis; E=Brucellosis). For Leptospira interrogans only 197 sera were investigated.

29

Benkirane et al. Abortion in small ruminants in Morocco

It was not possible, in any case, to establish with certainty a causal relationship between the observed abortions in a given flock/herd and the cause/s that was/were serologically detected. Although as mentioned above, the high prevalence of Chlamydia and Coxiella infections would indicate a possible role played by these 2 agents in causing abortion in the flocks/herds tested. Chlamydia and Coxiella could be separately or jointly involved in these cases, possibly together with other causes: Brucella, Leptospira or Toxoplasma.

Probably all these infections have been present for a long time in both regions and will remain endemic as long as no control measures are enforced and transhumance remains a common practice, enabling the exchange of infectious agents among farms and districts/regions (Rodolakis 1997).

These results are supported by the fact that no significant differences were found neither in the comparative overall abortion rates nor with regard to the seroprevalences for Brucellosis, Chlamydiosis, and Q fever occurring among primiparous and multiparous ewes and does. In an endemic situation, the great part of young animals do enter in contact with the agents during the first year of life and the increasing seroprevalence by age-class becomes less evident (Rodolakis 1997, Benkirane 2006).

With regard to Q fever, it is known that goats may shed C. burnetii for up to 2 pregnancies (Hatchette et al. 2003), and can abort twice following infection (Berri et al. 2007), while ewes do abort only once (Berri et al. 2007) and do not shed the organism in vaginal mucus at subsequent lambing.

Mixed infections prevailed in more than 90% flocks/herds. This situation is not unique but rather common in many parts of the world (Rekiki et al. 2005, Bisias 2010). The absence of predominance of a particular infection, especially among primiparous females, and the use of serological tests unable to discriminate between recent and old infections. In addition, the fact that infections were not repeated in time and so it was not possible to evidence changes in the kinetics of antibodies makes difficult to establish causal relationship in most cases.

Thus, it can be concluded that serodiagnosis of infectious abortions, although commonly used in veterinary medicine, is difficult to interpret. However, to confirm a strong serological suspicion, it is essential to use a direct diagnosis such as bacteriological isolation and identification or Polymerase Chain Reaction. Furthermore, veterinarians must be aware of abortive history within the herds/flocks under their supervision to be able to detect any new introduction of a given infection in herds through the systematic resort to a diagnostic laboratory for the search of abortive infections.

study was conducted. Infection rates of chlamydiosis, Q fever, and Toxoplasmosis are similar to those previously reported in various parts of the country and at different periods (Benkirane et al. 1990, El Idrissi et al. 1995, El Jai et al. 2003). Furthermore, Chlamydia abortus and C. burnetii have been concurrently associated with abortions of small ruminants as it was the case in different regions in Morocco and elsewhere (El Jay et al., 2003, Rekiki et al. 2005, Bisias et al. 2010). The high percentage of positivity to both Chlamydia and Coxiella infections found at both flock/herd and animal level, along with the occurrence of late abortion and the aspect of the aborted foetuses, would suggest that these 2 pathogens are actively circulating in both regions (Rodolakis 1997). With regard to the kit for C. abortus, it is important to note that CHEKIT is based on an inactivated antigen thus can show some possible cross-reactions against the LPS of other Chlamydiae (Vretou et al. 2007).

The situation is different for Brucellosis, which was previously considered nearly absent, with the exception of the Eastern Moroccan region (Laghzaoui, 1996), and now proves to be rather widespread both in the North and in the Middle Atlas. Vaccination campaigns were stopped in the Eastern region of Morocco in 20031 and this would explain the spread of the infection to the rest of the country through transhumance and commercial movements of small ruminants.

A higher number of ewe samples, 42 (20.8%), had high antibody titres to T. gondii as compared to doe samples, 9 (8.5%). Whether this is related to a variation of the geographical distribution of infected cats, the usual source of infection between regions (North vs Middle Atlas), or to the type of husbandry (extensive in ewes, semi-intensive in goats) remains to be assessed. The overall proportion of seropositive animals to T. gondii observed in this study was lower than the one reported from other parts of the world using different testing techniques (Filho et al. 2008, Reis et al., 2007, Diakoua et al. 2013).

The role of Leptospira interrogans in the epidemiology of abortion in small ruminants is poorly investigated in Morocco and this is only the second study following an investigation conducted in Meknes and Middle Atlas almost 3 decades ago (Chaarani 1987). Of interest was the predominance of serovar Tarassovi among goat samples, although not showing high antibody titres. In contrast, serovar Hardjo, known to be associated with abortions in cattle and possibly in small ruminants (Ellis 1994), was not found in this study. While serovar Gripothyphosa was associated with Copenhageni in the same ewe. Such situation was never documented and its significance is unclear.


1 Office National de Sécurité Sanitarie des Produits Alimentaire Royaume du Maroc (ONSSA) website: http://onssa.gov.ma/fr/index.php.

30



Benkirane A., Jabli N. & Rodolakis A. 1990. Fréquence des avortements et séroprévalence des principales maladies infectieuses abortives dans la région de Rabat (Maroc). Ann Rech Vét, 21, 267-273.

Benkirane A. 2006. Ovine and caprine brucellosis: World distribution and control/ eradication strategies in West Asia/North Africa region. Small ruminant research, 62, 19-25.

Berri M., Rousset E., Champion J.L., Russo P. & Rodolakis A. 2007. Goats may experience reproductive failures and shed Coxiella burnetii at two successive parturitions after a Q fever infection. Res Vet Sci, 83, 47-52.

Bisias G., Burriel A.R., Boutsini S., Kritas S.K. & Leontides L.S. 2010. A serological investigation of some abortion causes among small ruminant flocks in Greece. The Internet Journal of Veterinary Medicine, 8 (2), 13510. https://ispub.com/IJVM/8/2/13510.

Blancou J. & Lefévre P.C. 2006. Diseases that threaten livestock. In Encyclopedia of Infectious Diseases: Modern Methodologies (M. Tibayrenc, ed). John Wiley & Sons Inc., Hoboken, NJ, USA.

Blasco J.M., Garin-Bastuji B., Marin C.M., Gerbier G., Fanlo J., Jimenez De Bagues M.P. & Cau C. 1994. Efficacy of different rose bengal and complement fixation antigens for the diagnosis of Brucella melitensis infection in sheep and goats. Vet Rec, 134, 415-420.

Cerri D., Ebani V.V., Fratini F., Pinzauti P. & Andreani E. 2003. Epidemiology of leptospirosis: observations on serological data obtained by a “diagnostic laboratory for leptospirosis” from 1995 to 2001. New Microbiol, 26, 383-389.

Chaarani B. 1987. Management and productivity of sheep floks in Meknes province, Morocco, with especial reference to abortion and lamb mortality. Thèse de Doctorat en Sciences agronomiques. IAV. Hassan II, Rabat, Maroc.

Diakoua A., Papadopoulos E., Panousis N., Karatzias C. & Giadinis N. 2013. Toxoplasma gondii and Neospora caninum seroprevalence in dairy sheep and goats mixed stock farming. Vet Parasitol, 198, 387-390.

El Idrissi A.H., Manyari A. & Benkirane A. 1995. Fréquence des avortements infectieux des ovins au Maroc (Région de Zaer et du Moyen Atlas). Actes Inst Agron Vét (Maroc), 15, 11-14.

References

El Jay S., Bouslikhane M. & El Idrissi A.H. 2003. Suivi épidémiologique des avortements de petits ruminants dans les zones pastorales du Maroc. Actes Inst Agron Vet (Maroc), 23, 95-100.

Ellis WA. 1994. Leptospirosis as a cause of reproductive failure. Vet Clin North Am Food Anim Pract, 10, 463-478.

Filho M.F.S., Erzinger E., da Cunha I.A.L. & Bungi F.M. 2008. Toxoplasma gondii: abortion outbreak in a goatherd from Southern Brazil. Semina: Ciências Agrárias, Londrina, 29, 887-894.

Gwaze Rumosa F., Chimonyo M. & Dzama K. 2009. Communal goat production in Southern Africa: a review. Trop Anim Health Prod, 41, 1157-1168.

Hatchette T., Campbell N., Hudson R., Rault D. & Marrie T.J. 2003. Natural history of Q fever in goats. Vector Borne Zoonotic Dis, 3, 11-16.

Jonker H.F. 2004. Fetal death: comparative aspects in large domestic animals. Anim Rep Sci, 82-83, 415-430.

Laghzaoui K., El Idrissi A.H., El Moudni Y. & Benkirane A. 1996. Contrôle de la brucellose des petits ruminants dans les provinces du Maroc Oriental. Proceedings Journée Brucellose FAO, Rabat.

World Health Organisation for Animal Health (OIE). 2008. Leptospirosis. In Manual of diagnostic tests and vaccines for terrestrial animals, Chapter 2.1.9. OIE, Bruxelles.

Reis C.R., Lopes F.M.R., Freire R.L. & Goncalves D.D. 2007. Occurrence of anti-Toxoplasma gondii antibodies in caprines from Pitanga city, Parana State Brazil. Braz J Vet Res Anim Sci, São Paulo, 44 (5), 358-363.

Rekiki F., Thabti I., Dlissi P., Russo R., Sanchis M., Pepin A., Rodolakis A. & Hammami S. 2005. Enquête sérologique sur les principales causes d’avortements infectieux chez les petits ruminants en Tunisie. Revue Méd Vét, 156, 7, 395-401.

Rodolakis A. 1997. La chlamydiose abortive des petits ruminants. Le point Vétérinaire, 28, 1215-1216.

Spickler R.A. & Roth A.J. 2008. Brucellosis. In Emerging and Exotic diseases of animals. 3rd ed., Iowa State University, Ames Iowa, USA, pp 141-143.

Vretou E., Radouani F., Psarrou E., Kritikos I., Xylouri E. & Mangana O. 2007. Evaluation of two commercial assays for the detection of Chlamydophila abortus antibodies. Vet Microbiol, 123, 153-161.

31

RiassuntoIn questo studio è stato effettuato il sequenziamento completo della regione proteinasi leader (Lpro) di 21 ceppi del virus dell’afta epizootica, sierotipo O, isolati in India nel corso di diversi focolai. Le sequenze nucleotidiche della regione Lpro sono state confrontate con le sequenze omologhe dei ceppi vaccinali. L’analisi filogenetica condotta sulle sequenze Lpro ha rivelato una differente distribuzione dei ceppi nei cluster rispetto a quella ottenuta dall’analisi della sequenza nucleotidica codificante la proteina del capside VP1. Il confronto fra le sequenze amminoacidiche della porzione N terminale della regione Lpro ha mostrato un’elevata variabilità con la sola presenza di due codoni AUG conservati in posizione 1 e 29. È importante notare che tutti i residui amminoacidici che formano il sito attivo di taglio delle sequenze Lpro analizzate in questo studio risultano conservati. I risultati ottenuti suggeriscono che la sequenza Lpro potrebbe essere utilizzata per effettuare studi filogenetici sugli isolati del virus dell’Afta epizootica.

Parole chiaveAnalisi filogenetica,Regione proteinasi leader (Lpro),Sierotipo O,Virus dell’afta epizootica.

Studio filogenetico di ceppi indiani del virus dell’Afta epizootica Sierotipo Omediante analisi della regione proteinasi leader (Lpro)

SummaryIn this study, the nucleotide sequences of the complete leader proteinase (Lpro) region of 21 isolates of foot-and-mouth disease virus (FMDV) serotype O collected during various outbreaks in India were sequenced and compared with vaccine strains. The phylogenetic analysis of these Lpro sequences showed a difference in the clustering of the isolates based on the VP1 capsid coding region sequences. The comparison of amino acid sequences at the N terminus end of the Lpro region showed very high variability, although 2 conserved start codons (AUG) at 1st and 29th sites. Furthermore, all the amino acid residues that formed the active cleft site of the Lpro sequences of this study were conserved. These results suggest that Lpro sequences could also be used for phylogenetic comparison of FMDV isolates.

KeywordsFoot-and-mouth disease virus,Leader proteinase (Lpro),Phylogenetic analysis,Serotype O.


1 Foot-and-Mouth disease Virus laboratory, Research and Development Centre,Indian Immunologicals Limited, Gachibowli, Hyderabad 500 032, India.

2 Australian Animal Health Laboratory, CSIRO-Biosecurity Flagship,Portarlington Road, Geelong, Victoria 3220, Australia.

3 National Dairy Development Board, 33 Telecom Nagar, Gachibowli, Hyderabad 500 032, India.

* Corresponding author at: Advisor Animal Health, National Dairy Development Board,33 Telecom Nagar, Gachibowli, Hyderabad 500 032, India.

Tel.: +91 40 23000446, e-mail: [email protected].

Yuvaraj Shanmugam1, Madhanmohan Muthukrishnan1,Nagendrakumar Balasubramanian Singanallur2 & Srinivasan Alwar Villuppanoor3*

Phylogenetic analysis of theleader proteinase (Lpro) region of

Indian foot and mouth disease serotype O isolates

and inter-digital spaces. This disease is economically important as its incidence causes severe financial losses due to the national and international trade restrictions (Depa et al. 2012). There exist 7 serotypes of FMDV: O, A, C, Asia1, Southern African Territories (SAT) 1, SAT2 and SAT3. Among these serotypes, serotype O has been reported in all the FMDV prevalent

IntroductionFoot-and-mouth disease (FMD) is a highly contagious disease of cloven foot animals caused by FMD virus (FMDV) belonging to the genus Aphthovirus in the family Picornaviridae. The disease is characterized by vesicular lesions on the mouth, tongue, teats,


Phylogeny of FMDV leader proteinase Shanmugam et al.

between 2002-2010 and maintained as master banks in the virus repository of FMDV Laboratory, Research and Development Centre, Indian Immunologicals Limited (IIL), Hyderabad, Telengana. Details of the field viruses used in this study are shown in Table I. For analysis, some of the VP1 and Lpro sequences available in GenBank were included in the study (Nagendrakumar et al. 2009, Yuvaraj et al. 2013).

RNA extraction and PCRThe RNA was extracted from the master bank stock with RNeasy kit (Qiagen, Hilden, Germany) as per the manufacturer’s instructions. The primer pair L01F (GTGCCCCAGTTTAAAAAGCTT) and DH6 (TTGTTCTGAGTGTTGGTTGTGTG) was used for the amplification of Lpro region of the FMDV genome (Piccone et al. 1995, Sabarinath 2001) using OneStep RT-PCT kit (Qiagen, Hilden, Germany). The extraction process was conducted following the same conditions of the RT-PCR reaction, 1 cycle of reverse transcription conditions of 50 °C for 30 minutes, and 95 °C for 15 minutes followed by 30 cycles of 94 °C for 1 minute, 50 °C for 1 minute and extension of 72 °C for 2 minutes and finally 1 cycle of final extension of 72 °C for 10 minutes.

Sequencing and analysis of genomeAmplified PCR products were used in direct DNA sequencing using BigDye Terminator Cycle Sequencing Ready Reaction kit v3.1 (Applied Biosystems, Grand Island, NY, USA) as per the manufacturer’s instruction. The PCR products were purified with Qiaquick PCR Purification Kit (Qiagen, Hilden, Germany) and sequencing was carried out in automatic cycle sequencer (ABI Prism, Applied Biosystems, Grand Island, NY, USA). These sequences were aligned with Clustal X 1.8 programs (Thompson et al. 1994) with a few reference sequences like O/IND/R2/75, O1/Manisa/Turkey/69, O5/India/1/62 (GenBank Accession numbers AF207523, AF283435 and AF283435, respectively). The Mega 5.05 program (Tamura et al. 2011) was used for construction of the neighbour-joining (NJ) tree with Kimura 2-parameter model with uniform rates and bootstrap of 1000 replicates. The Lpro sequences of this study were compared with a few serotype A viruses available in GenBank (Nagendrakumar et al. 2009). Furthermore, VP1 sequences of the corresponding serotype A viruses were also used to construct a phylogenetic tree for comparison.

Results and discussionTwenty-one isolates of FMDV serotype O collected from various outbreaks in India were used in this study for the phylogenetic analysis of Lpro region

continents, along with serotype A (Rweyemamu et al. 2008); whereas, the other serotypes are restricted to certain geographical boundaries at least until recently. Since 2000, occasional spillovers of SAT1 and SAT2 viruses have been found in Egypt, Libya and other countries in the Middle East (Ahmed et al. 2012, Valdazo-González et al. 2012).

The genome of FMD consists of a positive sense RNA (8.2 kb) that codes for a single polyprotein, which undergoes sequential cleavage to yield 4 structural proteins, i.e.: viral protein1 (VP1), VP2, VP3, and VP4 along with 8 non-structural proteins: (NSPs), L(a)b, 2A, 2B, 2C, 3A, 3B, 3C, and 3D. The structural proteins assemble to form an icosahedral capsid of the virion enclosing the positive sense RNA. Antigenic variants arise during replication, due to its error prone viral replication cycle (Domingo and Holland 1977), inside the host cell.

The processing of the polyprotein starts with the self-cleavage of leader proteinase (Lpro) and 3Cpro

from the FMDV polyprotein (Strebel and Beck 1986). The Lpro plays a significant role in the cleavage of host protein initiation factors and evasion of the host innate immune response (Medina et al. 1993, Piccone et al. 2010, Piccone et al. 1995, et al. 2011); Lpro is known to exist in 2 forms, Lab and Lb (Sangar et al. 1987), which were both found to be active with indistinguishable deeds. Both forms of proteins are identical except at the N terminus end with a difference in the start codons used to initiate translation (Medina et al. 1993). The FMDV Lpro is structurally and functionally related to papain-like cysteine proteinase, with catalytic cysteine and histidine residues (Skern et al. 1998, Guarneet al. 2000, Guarne et al. 1998). Lpro region has also shown high variability in the nucleotide sequences as comparable to that of the structural proteins (Carrillo et al. 2005, George et al. 2001).

Epidemiological characterization of the FMDV isolates is frequently reported by the sequencing of complete or partial capsid coding regions of the genome (Jamal et al. 2011, Waheedet al. 2011, Yuvarajet al. 2013). Use of the NSP region, Lpro for epidemiological studies had been reported earlier in the literature, as well as phylogenetic analysis of the Lpro region in Indian serotype A and Asia1 isolates (Mohapatra et al. 2009, Mohapatra et al. 2008, Mohapatra et al. 2002). This paper describes the genetic characterization of Indian type O isolates with the Lpro region sequences.


VirusesThis study focused on serotype O FMD field strains (n = 21) that were isolated from various outbreaks in India


Shanmugam et al. Phylogeny of FMDV leader proteinase

Two initiation codonsAll the sequences compared in this study showed 2 initiation codons at 1st and 29th amino acid sites, which is a characteristic feature found in all the 7 serotypes of FMDV (Sangar et al. 1987). Hinton and Crabb (Hinton and Crabb 2000) reported about an existence of hairpin like structure between the 2 initiation codons that plays an important role in internal ribosome entry site (IRES) activity. A high amount of amino acid sequence variability was noticed (Figure 2) in the N terminus end between the 2 initiation codons with more than 70% of residues showing changes (George et al. 2001, Mohapatra et al. 2009). In this study, it was observed that more than 75% of the amino acid residues between the 2 initiation codons showed variations among themselves. Zhu and colleagues (Zhu et al. 2010) reported that both the forms of Lpro showed amino acid variability with high mutation rates. However, the Lb form was relatively less variable than the Lab form of Lpro (George et al. 2001, Sangar et al. 1987).

sequences. All Lpro sequences generated in this study are available at GenBank under accession number KF297682 - KF297701 (Table I). The NJ tree of these Lpro sequences showed that the viruses did not group strictly according to the serotypes. There was a dissimilarity in clustering isolates (Figure 1b) based on the VP1 sequences (Nagendrakumar et al. 2009, Yuvaraj et al. 2013). Five isolates that were grouped under the Ind 2001 lineage in VP1 sequence analysis clustered together along with few other serotype A Lpro sequences. However, all the 6 PanAsia-2 lineage isolates clustered into a distinct branch as seen in VP1 sequence analysis. Three PanAsia isolates clustered together along with the O/PUL/88/2005 isolate. O/GOA/120/2002 isolate clustered along with the O1/Manisa/Turkey/69 and O5/India/1/62 as noticed in VP1 analysis. Conversely, the O/IND/R2/75 Lpro sequence could be grouped with a serotype A virus sequence. Thus, phylogenetic analysis of the Lpro sequence showed a difference in clustering isolates from that of the structural protein as observed by few other authors (Chitray et al. 2013, Mohapatra et al. 2009, van Rensburg et al. 2002).

Table I. Details of the field viruses analysed in the study.

S. No VirusSource

Village District State Animal Tissue Vaccination Lpro Accession Number

1 O/MER/57/2001 Eleven Miles Rihboi Meghalaya Cattle TE(a) UV(b) KF297682

2 O/MAA/28/2002 Hungaewadi Ahmednagar Maharashtra Cross Bred TE V(c) KF297683

3 O/GOA/120/2002 Neteavali Sanguemsouth Goa Cattle TE V KF297684

4 O/GUK/142/2002 Bidaj Bidaj Gujarat Cross Bred TE V KF297685

5 O/POP/144/2002 Thevankudy Karikal Pondicherry Cross Bred TE V KF297686

6 O/RAJ/47/2003 Bassi Jaipur Rajasthan Cattle TE V KF297687

7 O/APMb/78/2004 Macharam Mahaboobnagar Andhra Pradesh Cattle TE UV KF297688

8 O/APV/86/2004 Rellivalasa Vijiyanagaram Andhra Pradesh Cross Bred FE(d) NA(e) KF297689

9 O/APV/93/2004 Kondakarakam Vijiyanagaram Andhra Pradesh Goat FE UV KF297690

10 O/HAS/34/2005 Daulpriya Sirsa Haryana Buffalo TE UV KF297691

11 O/PUL/88/2005 Ludhiana Ludhiana Punjab Cross Bred TE V NA(e)

12 O/TNS/03/2006 Manivilundhy colony Salem Tamil Nadu Crossbred TE UV KF297692

13 O/APR/20/2006 NA Rangareddy Andhra Pradesh Crossbred TE V KF297693

14 O/TNKr/57/2007 Jumpukuttapaty Krishnakiri Tamil Nadu Crossbred TE UV KF297694

15 O/KETr/24/2008 NA Thiruvananthapuram Kerala NA NA NA KF297695

16 O/CHRn/05/2009 Godmara Rajnandgaon Chattisgarh Crossbred TE V KF297696

17 O/APR/19/2009 Kokapet Ranga Reddy Andhra Pradesh Crossbred TE UV KF297697

18 O/ORB/21/2009 Sambalpur Bardhwan Odisha Crossbred TE V KF297698

19 O/GUK/29/2009 Kheda Kheda Gujarat NA NA NA KF297699

20 O/KEKm/06/2010 Kurichy Kottayam Kerala Cross Bred TE V KF297700

21 O/KEPt/07/2010 Peringara Patahnamthitta Kerala Cross Bred TE V KF297701

(a) = Tongue epithelium; (b) = unvaccinated; (c) = vaccinated; (d) = foot epithelium; (e) = not available.



et al. 1999). Any mutation of amino acid at these residues was shown to result in the loss of Lpro activity (Roberts and Belsham 1995). Both these amino acid residues were conserved in all the isolates analysed in this study. Crystallographic structural studies by Guarne and colleagues (Guarne et al. 1998) had showed that the orientation of H148 with respect to C51 was maintained by the hydrogen bonds of amino acid aspartate at the 163rd site. Furthermore, they had reported that the presence of asparagine (at the 46th site, 5 amino acids upstream to C51) along with D49, N54 and D164 were also essential for the structural stability and activity of the Lpro enzyme. All these amino acid residues (N46, D49, N54, D163 and D164) were found to be conserved in the Lpro sequences compared in this study.

Cysteine and histidine residues at sites C6, C125, C133 & C153 and H109, H138 & H148, respectively, were conserved among all the isolates in this study as noticed in O1Kaufbeuren isolate (Roberts and Belsham 1995). Few other amino acid residues at T55 and E147 that were reported to be related to cleavage and activity (George at al. 2001, Mohapatra et al. 2002) of the Lpro enzyme were also conserved in all the sequences except one isolate (T55A in O/

Cleavage site amino acid residuesThe Lpro/VP4 cleavage site at C terminus end of Lpro showed amino acid sequences of KRL(K/R)GAG in all the isolates used in this study. An identical amino acid sequence at this site had been observed previously by Seipelt and colleagues (Seipelt et al. 1999) among serotype O isolates. Mayer and colleagues (Mayer et al. 2008), using the molecular modelling and energy optimization studies, had found that the 143rd amino acid residue was critical for the restricted specificity of Lpro at Lpro/VP4 cleavage site. They also noticed the existence of exclusively either lysine or methionine amino acids at this site in all the FMDV serotypes. All the isolates sequenced in this study had either Lysine or methionine as the 143rd amino acid residue.

Active site cleftThe catalytic dyad formed by cysteine and histidine residues at the 51st (top of the central α helix region) and at the 148th amino acid sites (found in the turn between β sheets), respectively, were reported to be critical for the Lpro activity (Piccone et al. 1995, Seipelt

Figure 1. a) Neighbour joining (NJ) tree of complete Lpro sequences (603 nt) of 21 Indian serotype O FMDV isolates along with other reference sequences. Kimura 2-parameter model with uniform rates and bootstrap of 1000 replicates was used for construction of NJ tree with MEGA 5.05. Only bootstrap values P50% are shown. b) Neighbour joining (NJ) tree of complete VP1 sequences (639 nt) of Indian serotype O and A FMDV isolates with GenBank Accession Number. Only bootstrap values P50% are shown.Scale bar indicates nucleotide substitutions per site. = current Indian vaccine strain; = older Indian strain; = exotic vaccine strain; * = sequences generated in this study.

a b



be useful for the phylogenetic comparison of the FMDV isolates as the Lpro phylogeny resembles that of the capsid regions.

The phylogenetic analysis of the Lpro region sequences of 21 Indian serotype O isolates showed a difference in clustering of isolates as observed with the VP1 capsid coding region sequencing. The N terminus end of the Lpro sequences showed increased amino acid variations with 2 conserved start codons at 1st and 29th site. Among the sequences of 2 forms of leader proteinases (Lpro), the Lab showed a high variability than the Lb form. All the critical amino acid residues of the active cleft site were conserved. Thus, the Lpro region phylogeny could be used for the comparison of the FMDV isolates.

APV/78/2004). However, a similar mutation (T55A) was observed in 1 of the reference sequence O/IND/R2/75, the Indian vaccine strain.

George and colleagues (George et al. 2001) reported that 80 amino acid residues out of total 201 were tolerant to amino acid replacements. At the nucleotide level these Lpro sequences showed >85 % identity with the vaccine strains O/IND/R2/75 and O1/Manisa/Turkey/69. As this NSP was not under the influence of immune pressure of selection, the nucleotide variations are selected mainly considering the loss of Lpro activity. While, the random variations were fixed in the genome as they might not interfere with the viability of the virus particles (George et al. 2001). The study of this highly variable non-structural protein could

Figure 2. Comparison of the amino acid sequences of the Lpro region of the FMDV Indian strains.



Ahmed H.A., Salem S.A., Habashi A.R., Arafa A.A., Aggour M.G., Salem G.H., Gaber A.S., Selem O., Abdelkader S.H., Knowles N.J., Madi M., Valdazo-González B., Wadsworth J., Hutchings G.H., Mioulet V., Hammond J.M. & King D.P. 2012. Emergence of foot-and-mouth disease virus SAT 2 in Egypt during 2012. Transbound Emerg Dis, 59, 476-481.

Carrillo C., Tulman E.R., Delhon G., Lu Z., Carreno A., Vagnozzi A., Kutish G.F. & Rock D.L. 2005. Comparative genomics of foot-and-mouth disease virus. J Virol, 79, 6487-6504.

Chitray M., de Beer T.A.P., Vosloo W. & Maree F.F. 2013. Genetic heterogeneity in the leader and P1-coding regions of foot-and-mouth disease virus serotypes A and O in Africa. Arch Virol, 159 (5), 947-961. doi 10.1007/s00705-013-1838-9.

Depa P.M., Dimri U., Sharma M.C. & Tiwari R. 2012. Update on epidemiology and control of Foot and Mouth Disease - A menace to international trade and global animal enterprise. Vet World, 5, 694-697.

Domingo E. & Holland J.J. 1997. RNA virus mutations and fitness for survival. Annu Rev Microbiol, 51, 151-178.

George M., Venkataramanan R., Gurumurthy C.B. & Hemadri D. 2001. The nonstructural leader protein gene of foot-and-mouth disease virus is highly variable between serotypes. Virus Genes, 22, 271-278.

Guarne A., Hampoelz B., Glaser W., Carpena X., Tormo J.Â., Fita I. & Skern T. 2000. Structural and biochemical features distinguish the foot-and-mouth disease virus leader proteinase from other papain-like enzymes. J Mol Biol, 302, 1227-1240.

Guarne A., Tormo J., Kirchweger R., Pfistermueller D., Fita I. & Skern T. 1998. Structure of the foot-and-mouth disease virus leader protease: a papain-like fold adapted for self-processing and eIF4G recognition. EMBO J, 17, 7469-7479.

Hinton T.M., Li F. & Crabb B.S. 2000. Internal ribosomal entry site-mediated translation initiation in equine rhinitis A virus: similarities to and differences from that of foot-and-mouth disease virus. J Virol, 74, 11708-11716.

Jamal S.M., Ferrari G., Ahmed S., Normann P. & Belsham G.J. 2011. Genetic diversity of foot-and-mouth disease virus serotype O in Pakistan and Afghanistan, 1997-2009. Infect Genet Evol, 11, 1229-1238.

Mayer C., Neubauer D., Nchinda A.T., Cencic R., Trompf K. & Skern T. 2008. Residue L143 of the foot-and-mouth disease virus leader proteinase is a determinant of cleavage specificity. J Virol, 81, 4656-4659.

Medina M., Domingo E., Brangwyn J.K. & Belsham G.J. 1993. The species of the foot-and-mouth disease virus leader protein, expressed individually, exhibit the same activities. Virology, 194, 355-359.

Mohapatra J.K., Priyadarshini P., Pandey L., Subramaniam S., Sanyal A., Hemadri D. & Pattnaik B. 2009. Analysis of the leader proteinase (Lpro) region of type A foot-and-mouth disease virus with due emphasis on phylogeny and evolution of the emerging VP359-deletion lineage from India. Virus Res, 141, 34-46.

References

Mohapatra J.K., Sanyal A., Hemadri D., Tosh C., Sabarinath G.P. & Venkataramanan R. 2002. Sequence and phylogenetic analysis of the L and VP1 genes of foot-and- mouth disease virus serotype Asia1. Virus Res, 87, 107-118.

Mohapatra J.K., Sanyal A., Hemadri D., Tosh C., Biswas S., Knowles N.J., Rasool T.J., Bandyopadhyay S.K. & Pattnaik B. 2008. Comparative genomics of serotype Asia 1 foot-and-mouth disease virus isolates from India sampled over the last two decades. Virus Res, 136, 16-29.

Nagendrakumar S.B., Madhanmohan M., Rangarajan P.N. & Srinivasan V.A. 2009. Genetic analysis of foot-and-mouth disease virus serotype A of Indian origin and detection of positive selection and recombination in leader protease and capsid-coding regions. J Biosci, 34 (1), 85-101.

Piccone M.E., Pacheco J.M., Pauszek S.J., Kramer E.d., Rieder E., Borca M.V. & Rodriguez L.L. 2010. The region between the two polyprotein initiation codons of foot-and-mouth disease virus is critical for virulence in cattle. Virology, 396, 152-159.

Piccone M.E., Zellner M., Kumosinski T.F., Mason P.W. & Grubman M.J. 1995. Identification of the active-site residues of the L proteinase of foot-and-mouth disease virus. J Virol, 69, 4950-4956.

Roberts P.J. & Belsham G.J. 1995. Identification of critical amino acids within the foot and mouth disease virus leader protein, a cysteine protease. Virology, 213, 140-146.

Rweyemamu M., Roeder P., Mackay D., Sumption K., Brownlie J., Leforban Y., Valarcher J.F., Knowles N.J. & Saraiva V. 2008. Epidemiological patterns of foot-and- mouth disease worldwide. Transbound Emerg Dis, 55, 57-72.

Sabarinath G.P. 2001. Comparison of nucleotide sequence of structural protein encoding (P1) region of foot-and-mouth disease virus serotype O isolates. M.V.Sc. Thesis. Deemed University, Indian Veterinary Research Institute, Izatanagar, Uttar Pradesh, India.

Sangar D.V., Newton S.E., Rowlands D.J. & Clarke B.E. 1987. All foot and mouth disease virus serotypes initiate protein synthesis at two separate AUGs. Nucleic Acids Res, 15, 3305-3315.

Seipelt J., Guarné A., Bergmann E., James M., Sommergruber W., Fita I. & Skern T. 1999. The structures of picornaviral proteinases. Virus Res, 62, 159-168.

Skern T., Fita I. & Guarné A. 1998. A structural model of picornavirus leader proteinases based on papain and bleomycin hydrolase. J Gen Virol, 79, 301-307.

Strebel K. & Beck E.1986. A second protease of foot-and mouth disease virus. J Virol, 58, 893-899.

Tamura K., Peterson D., Peterson N., Stecher G., Nei M. & Kumar S. 2011. MEGA5: Molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol Biol Evol, 28, 2731-2739.

Thompson J.D., Higgins D.G. & Gibson T.J. 1994. Clustal W: improving the sensitivity of progressive multiple



Wang D., Fang L., Liu L., Zhong H., Chen Q., Luo R., Liu X., Zhang Z., Chen H. & Xiao S. 2011. Foot-and-mouth disease virus (FMDV) leader proteinase negatively regulates the porcine interferon-λ1 pathway. Mol Immunol, 49, 407-412.

Yuvaraj S., Madhanmohan M., Nagendrakumar S.B., Kumar R., Mohana Subramanian B., Mohapatra J.K., Sanyal A., Pattnaik B. & Srinivasan V.A. 2013. Genetic and antigenic characterization of Indian foot-and-mouth disease virus serotype O isolates collected during the period 2001 to 2012. Infect Genet Evol, 13, 109-115.

Zhu J., Weiss M., Grubman M.J. & de los Santos T. 2010. Differential gene expression in bovine cells infected with wild type and leaderless foot-and-mouth disease virus. Virology, 404, 32-40.

sequence alignment through sequence weighting positions-specific gap penalties and weight matrix choice. Nucleic Acids Res, 22, 4673-4680.

Valdazo-González B., Knowles N.J., Hammond J. & King D.P. 2012. Genome sequences of SAT 2 foot-and-mouth disease viruses from Egypt and Palestinian Autonomous Territories (Gaza Strip). J Virol, 86, 8901-8902.

van Rensburg H., Haydon D., Joubert F., Bastos A., Heath L. & Nel L. 2002. Genetic heterogeneity in the foot-and-mouth disease virus Leader and 3C proteinase. Gene, 289, 19-29.

Waheed U., Parida S., Khan Q.M., Hussain M., Ebert K., Wadsworth J., Reid S.M., Hutchings, G.H., Mahapatra M., King D.P., Paton D.J. & Knowles N.J. 2011. Molecular characterization of foot-and-mouth disease viruses from Pakistan, 2005-2008. Transbound Emerg Dis, 58, 166-172.

39

RiassuntoQuesto studio ha avuto l’obiettivo di raccogliere i dati relativi ai tipi di parvovirus canino (PVC) presenti in cani in Turchia. Sessantacinque campioni sono stati prelevati nel periodo aprile 2009-febbraio 2010. Lo studio ha coinvolto cani con segni clinici di infezione da parvovirus ed esemplari sani. I campioni raccolti sono stati testati per PCV usando la prova della reazione a catena della polimerasi. I 25 campioni (38,4%) risultati positivi sono stati successivamente caratterizzati con analisi di sequenza. I risultati hanno mostrato come entrambi i ceppi PVC-2a (17/25, 68%) e PVC-2b (8/25, 32%) circolassero in Turchia nel periodo del campionamento. Il presente è il primo studio sviluppato in Turchia concernente la caratterizzazione molecolare di ceppi di PVC, condotto su campioni prelevati da cani e basato sul sequenziamento parziale del gene VP2.

Parole chiaveCane,Parvovirus canino 2,Reazione a catena della polimerasi,Sequenziamento,Turchia.

Caratterizzazione molecolare dell’infezione da parvovirus caninoin cani in Turchia

SummaryThis study provides data about canine parvovirus (CPV) types circulating among dogs in Turkey. Sixty-five samples from dogs with and without clinical signs of parvovirus infection were collected between April 2009 and February 2010. The samples were subsequently tested for CPV using polymerase chain reaction (PCR). Twenty-five samples (38.4%) were positive; when positive samples were characterized by sequence analysis, results showed that both CPV-2a (17/25, 68%) and CPV-2b (8/25, 32%) strains are circulating among domestic dogs in Turkey. This is the first molecular characterization study of CPVs from dogs based on partial VP2 gene sequences in Turkey.

KeywordsCanine parvovirus 2,Polymerase chain reaction (PCR),Sequence Analysis,Turkey.


1 Department of Virology, Faculty of Veterinary Medicine, University of Atatürk, 25240, Yakutiye, Erzurum, Turkey.2 Department of Virology, Faculty of Veterinary Medicine, University of Ankara, 06110, Dışkapı, Ankara, Turkey.

* Corresponding author at: Department of Virology, Faculty of Veterinary Medicine, University of Atatürk,25240, Yakutiye, Erzurum, Turkey.

Tel.: + 90 442 2315547, e-mail: [email protected].

Mehmet Özkan Timurkan1* & Tuba Çiğdem Oğuzoğlu2

Molecular characterization of canine parvovirus (CPV)infection in dogs in Turkey

Within a few years from its emergence, 2 antigenic variants were detected and designated as CPV-2a (426Asn) and CPV-2b (426Asp) on the basis of the reactivity of monoclonal antibodies and amino acid conformation on the capsid protein (Decaro et al. 2008, Parrish et al. 1991). Both variants have completely replaced the original type 2, and they currently occur worldwide among the canine population (Calderon et al. 2009, Decaro et al. 2006, Decaro et al. 2007, Steinel et al. 1998). A third variant, first detected in Italy, was named CPV-2c (426Glu) (Buonavoglia et al. 2001).

The first goal of this study was to determine the distribution of CPV infection among dog populations

Introduction1 Canine parvovirus (CPV) (carnivore protoparvovirus), a significant worldwide canine pathogen belonging to the family Parvoviridae, was first described in 1978 (Carmichael 2005). The highly contagious and principal etiological agent of hemorrhagic enteritis in dogs has been identified as canine parvovirus type 2 (CPV-2). Because CPV-2 is very similar to feline panleukopenia virus (FPLV), it has been argued that FPLV had mutated into CPV-2 (Decaro and Buonavoglia 2012).

1 The GenBank accession numbers for the sequences reported in this paper are KF500484–KF500508.


CPV infection in Turkey Timurkan & Oğuzoğlu

in Turkey; while the second objective was to describe CPV molecular differentiation by sequence analysis of the VP2 gene region of the Turkish CPV-2 strains. These strains have then been compared to vaccine strains currently in use in Turkey.


SamplesWe investigated faecal (n = 35) and buffy coat (n = 30) samples from 65 dogs. The samples were submitted to our laboratory (Department of Virology, Faculty of Veterinary Medicine, Ankara University, Turkey) by clinicians for routine processing between April 2009 and February 2010. The presence (n = 25) or absence (n = 10) of clinical symptoms characteristic of CPV infection were evaluated to determine the health status of each animal. However, follow-up information was not available. Clinical symptoms in the dogs included fever, anorexia, depression, gastrointestinal problems, and vomiting. In 4 cases, there were no data concerning the dog age. We also lacked data about the vaccination status of 13 dogs, and the breed of 11 of the tested animals; finally data regarding sex were also missing.

MethodsThe faecal samples were homogenized in phosphate buffered saline (PBS) and centrifuged at 3,000 rpm for 15 minutes. After centrifugation, the supernatant was collected for DNA extraction. Blood samples were centrifuged at 380 g for 10 minutes. For the buffy coat samples, 200 µl of the supernatant were collected and mixed with an equal volume of PBS. The DNA of each sample was extracted using the phenol-chloroform-isoamyl alcohol method described by Sambrok and colleagues (Sambrok et al. 1989).

Extracted faecal DNA was used as a template for PCR, which was in turn conducted with primers that recognize all known CPV and FPV strains. The PCR was also performed with primer pairs for amplification of the partial VP2 gene, as reported in literature (Buonavoglia et al. 2001, Pereira et al. 2000). The primers used in this study were designated Pabs-Pabas (680 bp) and Hfor-Hrev (629 bp). For both primer pairs, the temperature profile included an initial denaturing at 94 °C for 6 minutes, 35 cycles of denaturing at 94 °C for 1 minute, annealing at 52 °C for 1 minute, extension at 72 °C for 2 minutes, and a final extension at 72 °C for 10 minutes. Annealing temperatures were the same in both primers.

The amplicons from 680 bp (n = 10) PCR products and 629 bp (n = 15) PCR products were purified

Figure 1. Phylogenetic tree of partial VP2 nucleotide sequences of canine parvovirus strains obtained from the GenBank database and and turkish CPV strains. Bar number of base substitutions per site. The following sequences were added in the GenBank database: Turkish CPV 2b Strains: 33-MC (KF500491), 51-S (KF500492), K4-SU (KF500495), K10-YA (KF500496), K20-KM (KF500499), mK25-AC (KF500500), K33-NT (KF500504), K37-A (KF500505), Turkish CPV 2a Strains: 1-MT (KF500484), 3-R (KF500485), 5-MS (KF500486), 10-HK (KF500487), 14-NA (KF500488), 17-HD (KF500489), 25-HD (KF500490), 59-I (KF500493), K3-O (KF500494), K12-A (KF500497), K19-OD (KF500498), K26-J (KF500501), K27-MK (KF500502), K31-KA (KF500503), K41-P (KF500506), KUT3 (KF500507), KUT6 (KF500508). The Turkish CPV strains were indicated by round for CPV-2a, by square for CPV-2b. Also the CPV-2b subgroup formation (A927G) are diamond shaped marked.


Timurkan & Oğuzoğlu CPV infection in Turkey

and sequenced. The sequencing was performed with a Beckman Coulter CEQ 8000 genetic analyzer (Beckman Coulter, Istanbul, Turkey) using the GenomeLab™ Methods Development Kit. Sequences were compared with other sequences available from the GenBank database (http://www.ncbi.nlm.nih.gov) and aligned with BioEdit software (version 7.0.5.3) using the ClustalW method (Hall 1999). The MEGA software program, version 5.1 (Tamura et al. 2011), was used to construct a phylogenetic tree using the maximum likelihood method, with bootstrap values calculated with 1,000 replicates (Figure 1).

ResultsAmplicons were detected in 38.4% (25/64) of the samples with Pabs-Pabas primer sets. Table I shows the age, vaccine status, sex, and breed information of the positive sampled animals. Among the positive samples, 57.1% (12/21) of the dogs were 1-3 months old and 23.8% (5/21) were 4-6 months old; 52.1%

Table I. Age, breed, sex, immunization status of Turkish dogs found positive to Canine parvovirus.

Sample No Sample ID Age Vaccinated Breed Sample Type Sex Genotype1 1-MT 3 m NDA NDA L Male 2a

2 3-R 4 m NDA NDA L Female 2a

3 5-MS 1 m NDA Kangal RS Male 2a

4 10-HK 2 m No Terrier L Male 2a

5 14-NA 1 m No NDA RS Female 2a

6 17-HD 2.5 m NDA Rottweiler L Male 2a

7 25-HD 8 m Yes Mix L Female 2a

8 33-MC 5 m NDA G. Retriever L Female 2b

9 51-S 2 m No NDA RS Male 2b

10 59-I 1 m NDA NDA L Female 2a

11 K3-O 1 m NDA NDA RS Female 2a

12 K4-SU 3 m NDA cocker RS Female 2b

13 K10-YA 7.5 m No Mix RS Male 2b

14 K12-A 8 m No Mix RS Male 2a

15 K19-OD 3 m No NDA L NDA 2a

16 K20-KM NDA NDA Mix L Male 2b

17 K25-AC 2 m NDA NDA L NDA 2b

18 K26-J NDA NDA Mix L Male 2a

19 K27-MK NDA NDA NDA RS Female 2a

20 K31-KA NDA NDA NDA RS Female 2a

21 K33-NT 5 m Yes NDA RS Female 2b

22 K37-A 5 m Yes Mix RS Female 2b

23 K41-P 8 m Yes G. Retriever RS Male 2a

24 KUT3 3 m No Mix RS Male 2a

25 KUT6 6 m No Mix RS Male 2aL = Leucocyte; RS = Rectal Swab; NDA = No data available; m = month.

(12/23) were male and 47.8% (11/23) were female. According to the data collected during the study by pet owners, 66.6% (8/12) of the dogs were not vaccinated and 33.3% (4/12) were vaccinated. Known breeds were kangal, terrier, rottweiler, golden retriever, and cocker spaniel (n = 6); 57.1% (8/14) of the dogs were of mixed breed, and there was no breed information regarding 11 other dogs.

The PCR fragments of the partial VP2 gene were successfully amplified with both primers from the faeces (n = 14) and buffy coat (n = 11) samples of different dogs. After analysis, the obtained sequences were compared with other reference CPV and FPLV strains stored in the GenBank database and with sequences of 4 canine (Vanguard, Pfizer; Nobivac, Intervet; Parvodog, Merial; Quantum, Schering) and 2 feline (Felocell, Pfizer and Purevax, Merial) vaccine strains. These vaccines, which are also included in the phylogenetic tree, are commonly used in Turkey. From 25 CPV-2 positive samples, 17 were identified as CPV-2a and 8 as CPV-2b. No CPV-2c variants were found. Table II shows the targeted segment of the



CPV-2a and CPV-2b strains were placed in different branches. Most of the Turkish CPV-2a sequences were placed as a separate group within reference CPV-2a sequences; on the other hand, all the Turkish CPV-2b strains were located in a completely different branch of the phylogenetic tree than the reference 2b strains.

DiscussionThere have been few studies on CPV infections in dogs in Turkey (Yılmaz et al. 2005, Yeşilbağ et al. 2007), and no study describing CPV molecular characteristics has been provided so far. In a previous study (Muz et al. 2012), which investigated the 426th amino acid for detection of CPV-2 types in cats, CPV-2a and CPV-2c were detected as variants.

VP2 protein and the 8 variable positions that were detected when compared to reference sequences.

As shown in Table II, some substitutions were observed in all of our CPV-2a strains, specifically, 297 (SerAla), 300 (AlaGly), 305 (AspTyr), and 375 (AsnAsp). We also found a substitution at 426 (AsnAsp), which is known as an indicator of the CPV-2 variant CPV-2b. Similar nucleotide variation (A927G) was detected in all Turkish CPV-2b strains. A mutation in residue 440 (ThrAla) was detected in 5 samples (Table II). The nucleotide identities of our strains were 98.3-99.8%, with each other, and 97.8-99.7% with vaccine strains (data not shown).

The phylogenetic tree (Figure 1) was constructed using partial VP2 nucleotide sequences of canine parvovirus strains obtained from the GenBank database and Turkish CPV strains. The Turkish

Table II. Variable nucleotides in the VP2 gene partial sequences of the Canine parvovirus strains found in Turkish dogs.

Nt. positiona

aa residue3675

aa2973685

aa3003699

aa3053869

aa3613912

aa3754062

aa4264105

aa4404494

aa571M38245 T C G G A A A A

1-MT G G T A G - G -

3-R G G T A G - G -

5-MS G G T - G - - -

10-HK G G T A G - - -

14-NA G G T A G - - G

17-HD G G T A G - - -

25-HD G G T A G - - -

33-MC G G T - G G - C

51-S G G T - G G - C

59-I G G T A G - G -

K3-O G G T A G - G -

K4-SU G G T - G G - -

K10-YA G G T - G G - -

K12-A G G T - G - - -

K19-OD G G T A G - - -

K20-KM G G T - G G - -

K25-AC G G T - G G - -

K26-J G G T - G - - -

K27-MK G G T A G - - -

K31-KA G G T A G - G -

K33-NT G G T - G G - -

K37-A G G T - G G - -

K41-P G G T - G - - G

KUT3 G G T - G - - -

KUT6 G G T A G - - -

aa. change

TCTGCT

SA

GCTGGT

AG

GATTAT

DY

CGGCGA

RR

AATGAT

ND

AATGAT

ND

ACAGCA

TA

GTAGTG/CVV

a = Nucleotide positions are referred to the sequences of CPV-2 strain CPV-b (accession no. M38245).


Timurkan & Oğuzoğlu CPV infection in Turkey

CPV-2a and CPV-2b were also detected in this study as variants in dogs for the same amino acid.

We studied partial-length VP2 gene sequences of CPV to determine the distribution of CPV infection and investigate the genetic variability of CPV strains circulating in Turkey and their correspondence with currently used vaccine strains. Our sequence analysis indicated that CPV-2a is the most common variant, although CPV-2b variant is also detected sporadically. It is noteworthy that the variant 2c was not detected in our samples.

The amino acid residues determined in our study were variable. We detected residue 440 (Thr440Ala) in some (5/17, 29.4%) CPV-2a strains (1-MT, 3-R, 59-I, K3-O, and K31-KA); residue 440 is known to be an important factor for antigenicity (Decaro et al. 2009). Severe diarrhoea was noted as clinical findings in those 5 samples. Therefore, we suggest further studies in order to better understand the relationship between these residues and the severity of clinical symptoms. The other altered amino acid residues in circulating strains in Turkey were found at the VP2 gene (positions 297, 300, 305, and 375) according to the M38245 strain. In addition, the A927G nucleotide variation may

cause subgroup formation in CPV-2b; therefore, this variation should also be investigated.

According to Turkish veterinary policy, dogs are vaccinated at 2 months of age; the vaccines routinely used include variants of CPV 2 and 2b.

The strains of canine parvovirus obtained from cats in Turkey occupy a completely different branch in the phylogenetic tree from the ones that we obtained from dog. In this study, Turkish CPV-2a and 2b strains from dogs grouped together in a completely different branch of the phylogenetic tree than the vaccine strains. Although CPV-2a variant was determined in field strains, it is not present in commercial vaccine strains. This finding can be used for molecular comparisons of vaccine and field strains, and it may be helpful in further vaccine development studies (Decaro et al. 2007, Nandi et al. 2010). In addition, the usual variants of strains in a region or a country should be clarified before choosing a vaccine.

The control strategies for CPV infections in Turkey can be improved by means of further molecular studies using additional samples from different subgroups. It is also necessary to continue the periodic investigation of CPV strains from dogs.



Buonavoglia C., Martella V., Pratelli A., Tempesta M., Cavalli A., Buonavoglia D., Bozzo G., Elia G., Decaro N. & Carmichael L. 2001. Evidence for evolution of canine parvovirus type-2 in Italy. J Gen Virol, 82, 1555-1560.

Calderon M.G., Mattion N., Bucafusco D., Fogel F., Remorini P. & La Torre J. 2009. Molecular characterization of canine parvovirus strains in Argentina: detection of the pathogenic variant CPV2c in vaccinated dogs. J Virol Methods, 159, 141-145.

Carmichael LE. 2005. An annotated historical account of canine parvovirus. J Vet Med B Infect Dis Vet Public Health, 52, 303-311.

Decaro N., Elia G., Desario C., Roperto S., Martella V., Campolo M., Lorusso A., Cavalli A. & Buonavoglia C. 2006. A minor Groove binder probe real-time PCR assay for discrimination between type 2-based vaccines and field strains of canine parvovirus. J Virol Methods, 136, 65-70.

Decaro N., Desario C., Addie D.D., Martella V., Vieira M.J., Elia G., Zicola A., Davis C., Thompson G., Thiry E., Truyen U. & Buonavoglia C. 2007. Molecular epidemiology of canine parvovirus in Europe. Emerg Infect Dis, 13, 1222-1224.

Decaro N., Desario C., Elia G., Martella V., Mari V., Lavazza A., Nardi M. & Buonavoglia C. 2008. Evidence for immunisation failure in vaccinated adult dogs infected with canine parvovirus type 2c. New Microbiol, 31, 125-130.

Decaro N., Desario C., Parisi A., Martella V., Lorusso A., Miccolupo A., Mari V., Colaianni M.L., Cavalli A., Di Trani L. & Buonavoglia C. 2009. Genetic analysis of canine parvovirus type 2c. Virology, 385 (1), 5-10.

Decaro N. & Buonavoglia C. 2012. Canine parvovirus - a review of epidemiological and diagnostic aspects, with emphasis on type 2c. Vet Microbiol, 155 (1), 1-12.

Hall T.A. 1999. BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symp Ser, 41, 95-98.

References

Muz D., Oğuzoğlu T.C., Timurkan M.O. & Akın H. 2012. Characterization of the partial VP2 gene region of canine parvoviruses in domestic cats from Turkey. Virus Genes, 44, 301-308.

Nandi S., Anbazhagan R. & Kumar M. 2010. Molecular characterisation and nucleotide sequence analysis of canine parvovirus strains in vaccines in India. Vet Ital, 46, 69-81.

Parrish C.R., Aquadro C.F., Strassheim M.L., Evermann J.F., Sgro J.Y. & Mohammed H.O. 1991. Rapid antigenic-type replacement and DNA sequence evolution of canine parvovirus. J Virol, 65, 6544-6552.

Pereira C.A., Monezi T.A., Mehnert D.U., D’Angelo M. & Durigon E.L. 2000. Molecular characterization of canine parvovirus in Brazil by polymerase chain reaction assay. Vet Microbiol, 75, 127-133.

Steinel A., Venter E.H., van Vuuren M. & Truyen U. 1998. Antigenic and genetic analysis of canine parvoviruses in southern Africa. J Vet Res, 65, 239-242.

Sambrook J., Fritsch E.F. & Maniatis T. 1989. Molecular Cloning: a laboratory manual. 2nd ed. N.Y., Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press.

Tamura K., Peterson D., Peterson N., Stecher G., Nei M. & Kumar S. 2011. MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol Biol Evol, 28, 2731-2739.

Yılmaz Z., Pratelli A. & Torun S. 2005. Distribution of antigen types of canine parvovirus type 2 in dogs with hemorrhagic enteritis in Turkey. Turk J Vet Anim Sci, 29, 1073-1076.

Yeşilbağ K., Yilmaz Z., Ozkul A. & Pratelli A. 2007. Aetiological role of viruses in puppies with diarrhoea. Vet Rec, 161, 169-170.

45

SummaryCross-sectoral assessment of health risks arising or existing at the human-animal interface is crucial to identifying and implementing effective national disease control measures. This requires availability of information from 4 functional information ‘streams’ – epidemiological, laboratory, animal, and human health. The Food and Agriculture Organization of the United Nations (FAO)/ World Organisation for Animal Health (OIE)/ World Health Organization (WHO) Four-Way Linking (4WL) project promotes the establishing of a national-level joint framework for data sharing, risk assessment, and risk communication, in order to both improve communications within and among governmental public health and animal health influenza laboratories, epidemiology offices, national partners, with the aim of strengthening the national capacity to detect, report and assess risks arising from emerging influenza viruses. The project is currently being implemented in countries where H5N1 avian influenza is endemic and where human cases have been reported. The project is comprised of two main activities at country level: a ‘review mission’, which is the project launch in the country and has the objective to assess the existing situation; and a ‘scenario based workshop’, with the scope to bring together key national partners and build relationships among people working in the 4 information streams and to improve understanding of national strengths and gaps. During the workshop the delegates engaged in interactive sessions on basic risk assessment and devoted to specify the needs and roles of the 4 different streams. The participants work through a mock influenza outbreak scenario, which practically illustrates how risk assessment and communication of an emergency at the animal-human interface is more effective when there is linking of the 4 streams, collaboration, communication, and coordinated action. In 2010, Egypt was the first country where the project was successfully implemented, followed by Vietnam and Indonesia.

KeywordsCross-sectoral,Four-way linking project,Four-way linking framework,H5N1 - Highly Pathogenic Avian Influenza (HPAI),Human-animal interface,Influenza viruses,Risk assessment.


1 Scientific and Technical Department, World Organisation for Animal Health (OIE), Paris, France.2 Food and Agriculture Organization of the United Nations (FAO), Rome, Italy .

3 World Health Organization (WHO), Geneva, Switzerland.

* Corresponding author at: World Organisation for Animal Health (OIE), 12 Rue de Prony, 75017 Paris, France.Tel.: +33-1 44 15 18 72, e-mail: [email protected].

Simona Forcella1*, Nasr El-din El Tantawy3, Jobre Yilma2, Amira AbdelNabi2,Filip Claes2, Gwenaelle Dauphin2 & Elizabeth Mumford3

The development of a four-way linking framework in Egypt: an example of the FAO, OIE and WHO joint

activities to facilitate national risk assessment

Conference 2013 on Risk analysis in the Mediterranean Basin, Risk Analysis as a tool for the control of Animal Diseasesand Zoonoses in the Mediterranean Basin. November 5-7, 2013 - Teramo, Italy - Selected papers


FAO, OIE and WHO joint activities in Egypt Forcella et al.

national disease control measures. Such an assessment requires the availability of information from at least 4 information ‘streams’ concerning epidemiological, laboratory, animal, and human health related data. The relevant information must also be organised on the basis of the area and the moment in time where the relevant events occured. The four-way linking project (4WLP) (Claes and Dauphin 2011, World Health Organisation 2013) promotes the establishment of a national-level framework for data sharing, risk assessment, and risk communication. The project aims at building capacity and improve communications within and among governmental public health and animal health laboratories working on influenza, epidemiology offices, and other national partners so to strengthen the national capacity to detect, report, and assess risk from emerging or endemic influenza viruses of public health concern. Availability and linking of information and joint risk assessment are essential to understand health threats at the human-animal interface at country level. The 4WLP framework may be used to support internationally-mandated influenza capacity building such as through the International Health Regulations (IHR) provided by WHO (WHO 2014), FAO global, regional and national capacity building

Background In the last 10 years different influenza events, such as human infection with avian influenza viruses subtypes H5N1 and H7N9, emphasized the need to consider a variety of data when assessing the public health risk of influenza at the human-animal interface nationally, regionally, and globally.

Influenza viruses type A (H5N1) are a group of avian viruses that are highly infectious for a number of bird species, including most poultry species kept domestically. The viruses also cause severe disease in infected humans, with a case fatality rate among reported cases over 50% (World Health Organisation 2013). The H5N1 also remains a pandemic threat and continues to prompt huge economic losses in affected countries, particularly where the disease is endemic, given its impact on trade and animal production.

Controlling influenza at its animal source is not only essential to protecting animal health and maintaining livelihoods in affected countries, it is also the best strategy to prevent exposure and disease in humans.

Cross-sectoral assessment of health risks arising or existing at the human-animal interface is crucial to identifying and implementing effective

RiassuntoPer l’individuazione e l’attuazione di misure efficaci per il controllo delle malattie a livello nazionale è cruciale una valutazione intersettoriale dei rischi per la salute, derivanti o esistenti, a livello dell’interfaccia uomo-animale. Questa valutazione richiede l’accesso ad informazioni provenienti da quattro flussi funzionali – informazioni epidemiologiche e di laboratorio generate dai settori della sanità umana e animale. Il progetto per lo sviluppo di una struttura di collegamento a quattro vie (4WLP), elaborato in collaborazione da FAO, OIE e OMS, ha due principali obiettivi a livello nazionale: promuove l’istituzione di una piattaforma per la condivisione di dati e per la valutazione e comunicazione dei rischi in maniera da migliorare la comunicazione all’interno e tra i laboratori e i centri epidemiologici che si occupano di influenza sia nel settore della sanità umana che animale, inclusi altri partner; rinforzare la capacità di individuare, valutare e comunicare i rischi derivanti da virus influenzali emergenti. Il progetto è in corso di realizzazione nei paesi in cui l’influenza aviaria di tipo H5N1 è endemica negli animali e dove sono stati notificati casi nell’uomo. Due attività, una missione per analizzare la situazione esistente nel Paese e un workshop, hanno lo scopo di promuovere nei paesi destinatari all’interno di strutture governamentali già esistenti un mecchanismo di collegamento a quattro vie. Durante il workshop i partecipanti sono impegnati in sessioni interattive finalizzate alla comprensione degli strumenti di base per realizzare una valutazione dei rischi e ad una maggiore conoscenza dei bisogni e dei ruoli dei quattro flussi. I partecipanti lavorano su di un finto scenario che riproduce un focolaio di influenza, lo scenario serve per illustrare in maniera pratica come la valutazione e comunicazione dei rischi emergenti a livello dell’interfccia uomo-animale, sia piu efficace quando c’è un collegamento dei quattro flussi funzionali e quando le azioni e la comunicazione sono coordinate. L’Egitto, nel 2010, è stato il primo paese in cui il progetto è stato realizzato con successo, seguito da Vietnam ed Indonesia.

Parole chiaveInter settoriale,Progetto di collegamento a quattro vie, Influenza aviaria ad alta patogenicità H5N1, Interfaccia uomo-animale, Valutazione dei rischi,Virus influenzali.

Lo sviluppo di una struttura di collegamento a quattro vie per facilitare il processo di valutazione dei rischi a livello nazionale, in Egitto: un esempio

di attività congiunta tra FAO, OIE e OMS


Forcella et al. FAO, OIE and WHO joint activities in Egypt

syntheses produced in the institution, and onward transmission and dissemination of information and materials. Where appropriate, questions about control and policy were also addressed. From this information, a flow chart of the organisations and their linkages was produced, along with a summary of good practices, constraints, and gaps.

Stakeholders visited during the mission were invited to a meeting on the last day, during which the findings were presented and feedback was sought. In particular, participants were asked for feedback and validation of the information flow as mapped during the review mission; for suggesting any additional perceived gaps; as well for suggesting topics for the planned workshop.

A schematic overview of where virological ( ) and epidemiological ( ) data were present in the animal health ( ) and the public health sectors ( ) was designed after on the basis of the stakeholders’ feedback (Figure 1). Bearing in mind that not all data must be necessarily present in each sector, the overview showed that both animal and public health national/central laboratories, NLQP and CHPL, harboured all the virological information ( ), from animal and human side, respectively. Both NLQP and CHPL received epidemiological data from their own sector. The epidemiological units at GOVS had animal epidemiological data ( ) and only partial animal virological and human epidemiological data; the MoH-epidemiology and surveillance unit had human epidemiological data ( ), and part of the animal epidemiological data.

Major outcomes of the review mission

Opportunities were identified for strengthening some aspects of national diagnostic capacity, implementing mechanisms for cross-sectoral data sharing, and for combining and linking information from the sectors, strengthening surveillance and improving implementation of joint investigations at governorate and local levels (including solving human resource issues). Also key strengths were identified such as good communication within sectors generally, and among sectors.

(FAO 2014) and OIE Evaluation of Performance of Veterinary Services (PVS) pathway (OIE 2014). The project is currently being implemented in avian influenza H5N1-endemic countries that have reported human cases, the training is being fostered through the organisations of scenario-based training workshops. The first country where the project was successfully implemented is Egypt, followed by Vietnam, and Indonesia. This article describes implementation of the 4WLP, between December 2010 and October 2011 in Egypt as pilot country and the estabilishment of a 4WL framework for data sharing, risk assessment, and risk communication.

MethodsThe project is country focused and directed. It is comprised of 2 main in-country activities, a review mission and a scenario based workshop, followed by an expected establishment of a four-way linking mechanism at national level.

The review missionIn November 2010, a review mission was conducted by FAO and WHO experts in Egypt. The mission was thus supported by the Egyptian Ministry of Health and Population (MOHP), the General Organization of Veterinary Services (GOVS), the Central Public Health Laboratory (CPHL) of MOHP, and the National Laboratory for Quality Control on Poultry Production (NLQP) of GOVS. Other key partners included the United States (US) Naval Medical Research Unit, No. 3 (NAMRU-3) and the USA Centers for Disease Control (CDC). The experts visited all institutions listed as main stakeholders in the 4WL framework (Table 1).

Information gathering

Each stakeholder was asked to describe their sources of epidemiological and virological information on influenza H5N1 in animals and/or people, the types of information received and its form, any analyses or

Table I. List of Stakeholders at national level.

Institution AffiliationCentral Public Health Laboratory (CPHL) Ministry of Health (MoH) (Now called Ministry of Health & Population (MoH&P)

National Laboratory for Quality in Poultry Production (NLQP) Ministry of Agriculture and Land Reclamation (MOALR)

General Organization of Veterinary Services (GOVS) Ministry of Agriculture and Land Reclamation (MOALR)

Avian Influenza Emergency Management Unit (AIEMU) Ministry of Agriculture and Land Reclamation (MOALR)

United States (US) Naval Medical Research Unit, No. 3 (NAMRU-3) N.A.

Cairo University, Faculty of Veterinary Medicine N.A.



proposed solutions; and (vi) to identify an action plan with timeline and practical key next steps.

Activities and outcomes of the workshop

The FAO, OIE, and WHO project staff, from the national representation and from headquarters, chaired and facilitated the workshop. For a full day, participants played the role of their own

The workshopTo address the needs identified during the review mission, a scenario-based workshop was organised. A variety of small group activities and plenary discussions were conducted, including a scenario of an influenza outbreak. The workshop was held between the 26 and 28 September 2011, in Ain El-Sukhna, Suez Governorate (Figure 2). The approximately 30 participants were representatives of the 4 sectors: 4 representative of NLQP, 4 of CPHL, 7 of GOVS and 5 of MoHP. Four professors, 2 from the faculty of Human medicine and 2 from the Faculty of Veterinary medicine, also participated in the event.

Objectives of the workshop

The specific objectives of the workshop were: to gain understanding (i) of risk assessment and how it is used; (ii) other functional sectors; (iii) of the reasons that made data collection, the linking of data, and joint risk assessment so important to the work of single institutions as well as to the overall national work. The workshop also had the objectives (iv) of drafting a template for national H5 technical committee report; (v) to develop a list of gaps related to data collection, sharing, linking, and

Figure 1. Mapping of the data distribution. The coloured blocks represent the relative amount of data available to institutions of each functional stream: when data are available the block is filled, when data are absent the block is empty, the amount of filling represents the proportion of total data that are thought to be available.

Figure 2. Participants at the workshop held in September 2011 in Ain El-Sukhna, Suez Governorate.

NLQP CPHL

GOVS MoH- epi


Forcella et al. FAO, OIE and WHO joint activities in Egypt

• changing the animal specimen coding system so that test results can lead to identification of disease foci;

• defining important data sets and mechanisms of information flow and communication among all parties at national and sub-national levels to identify and open sectors;

• developing a plan to facilitate cooperation between human and animal health offices centrally and at governorate and district levels;

• enhancing internal communications within the task force and creating a loop for information sharing;

• exploring the possibility of provision of H9 primers and upgrading the gene sequencing machine;

• discussion on the institutionalization of the 4WLTF in order to enable it to serve as an official technical branch of the policy-making processes for zoonotic influenza in Egypt, especially as previous structures such as the ‘national supreme council’ have stopped functioning since 2011.

The 4WLTF meeting on 11 April 2013 was dedicated to joint planning for the preparedness in Egypt as response to the emergence of avian influenza A(H7N9) virus in China including integrating H7N9 with on-going H5N1 influenza surveillance programs and ensuring diagnostic capacity for this specific strain. At this meeting, the Minister of Agriculture and Land Reclamation (MoLR) and Minister of Health and Population (MoHP) presented information together for the first time indicating strong trust and data sharing. This Four-Way Linking Task Force, originally convened via the FAO/OIE/WHO (also addressed as the tripartite partners) project is now self-sustaining, and is well placed to become the technical advisory body to governmental decision makers, to ensure that science-based information is available to support national policy decisions to reduce H5N1 risks – and risks of other zoonotic influenza as put in evidence by their proactive joint H7N9 response - to animal and public health in Egypt.

organisation in a scenario based on an outbreak of Highly Pathogenic Avian Influenza (HPAI) H5N1 with human and animal cases.

All participants from the 4 sectors were guided through working to gather epidemiological and virological information, analyse laboratory result reports, use this information to run a cross-sectorial risk assessment and prepare a report for high-level decision makers within a given time frame, communicating the results of the risk assessment in order for them to take informed and timely decisions. Part of the exercise was done in 4 small groups, each representing a single sector, and part was done in mixed sector groups. The aim of the playrole was for participants to appreciate the positive impact that a coordinate sharing of information and of action planning has on the risk assessment and risk communication of an health emergency at the animal-human interface.

ConclusionsDuring the workshop, animal and human health sectors in Egypt acknowledged the gaps in data sharing and limited communications and agreed on the importance of a four-way linking and flow of information for an informed national risk assessment. They developed an action plan and next steps, including: (a) convening a national joint task-force (members from each stream were already identified during the meeting), (b) establishing a mechanism for joint risk assessment and reporting, and (c) solving data sharing and communication issues.

In 2012, despite political instability subsequent to the change in the political situation in Egypt, the Four-Way Linking Task Force (4WLTF) established at the workshop met 5 times (in February, March, May, September, and October) and twice in 2013 (April and June) to share information and technical expertise, and conduct joint risk assessments.

In particular the 4WLTF discussed, implemented or facilitated the following activities:

• training of CPHL staff on genomic sequencing at NLQP;

• building laboratory capacities particularly on gene sequencing and linkages between animal and human virus strains;



Claes F. & Dauphin G. 2011. Four-way linking of epidemiological and virological nformation on human and animal influenza. EMPRES Transboundary Animal Disease Bulletin, 39, 36-39. http://www.fao.org/docrep/015/i2530e/i2530e00.pdf.

Food and Agriculture Organisation of the United Nations (FAO). 2014. Capacity Development. http://www.fao.org/oek/capacitydevelopment0/en/.

World Health Organisation (WHO). 2013a. Cumulative number of confirmed human cases for avian influenza A(H5N1) reported to WHO, 2003-2013. http://www.who.int/influenza/human_animal_interface/EN_GIP_20131210CumulativeNumberH5N1cases.pdf.

World Health Organisation (WHO). 2013b. Influenza at the Human-Animal interface (HAI) http://www.who.

References

int/influenza/human_animal_interface/EN_GIP_FourWay_HAI_2013.pdf.

World Health Organisation (WHO). 2014. Alert, response, and capacity building under the International Health Regulations (IHR). http://www.who.int/ihr/about/en/.

World Organisation for Animal Health (OIE). 2013. One health, OIE’s involvement and Activities. http://www.oie.int/fileadmin/Home/eng/Media_Center/docs/pdf/13_08_web_summary_4-way_linking_v7_fin_for_clearance__3_.pdf.

World Organisation for Animal Health (OIE). 2014. The OIE Tool for the Evaluation of Performance of Veterinary Services (OIE PVS Tool). http://www.oie.int/en/support-to-oie-members/pvs-evaluations/.

51

RiassuntoIn un impianto sperimentale realizzato, in scala industriale, per la stabilizzazione delle deiezioni e degli scarti di macellazione di un’azienda cunicola è stato predisposto un capitolato di prove di compostaggio che ha previsto la formazione di n. 3 cumuli, di massa pari a 4700 kg, ottenuti secondo diversi rapporti C/N. Il ciclo di processo è stato lo stesso per tutti i cumuli e cioè: preparazione miscela; avanzamento della biomassa pari a circa 1,0 m/giorno mediante prototipo di macchina rivoltatrice opportunamente progettato; rilievo di temperatura ambiente e in vari punti della biomassa ogni 2 giorni; periodico campionamento (ogni 20-30 giorni) della biomassa (miscela iniziale, prodotto intermedio, prodotto finale) per la valutazione dei parametri chimico-fisici che caratterizzano il processo biossidativo e le qualità del compost; ultimazione della prova dopo 85 giorni. Sono stati condotti 2 cicli sperimentali: una in inverno e una in estate. Nella prova invernale, la reazione mesofila si è verificata solo nella miscela di controllo (concime animale + macellazione sottoprodotti senza paglia). Dalle 3 matrici studiate sono stati ottenuti compost con buone potenzialità agronomiche, ma con parametri prossimi ai limiti di legge. Nel test estivo, vi è stata fermentazione termofila in tutte le miscele ed è stato ottenuto un compost di migliore di qualità, rispettando tutti i vincoli agronomici e legislativi. I risultati ottenuti in questo studio sono utili per la definizione di miscele appropriate, dei controlli analitici sulle stesse, di macchine e soluzioni impiantistiche per assicurare continuità ed affidabilità nella produzione industriale di compost da biomasse provenienti dall’allevamento e dalla macellazione del coniglio.

Parole chiaveCompostaggio scarti cunicoli,Miscele a diverso rapporto C/N,Prototipo in scala industriale.

Caratterizzazione delle matrici e del compost da deiezioni e sottoprodotti della macellazione cunicoli finalizzata ad una produzione industriale di

qualità con soluzioni meccanico-impiantistiche specifiche

SummaryIn this study we have observed the effects of using rabbit manure and slaughtering by-products in a composting process. Three piles of this material, 4700 kg each, with different amount and C/N ratio, have been investigated and experimental tests were carried out in an industrial horizontal axe reactor using a prototype of turning machine. The composting time lasted 85 days; 2 experimental cycles were conducted: one in Winter and one in Summer. In the Winter test, mesophilic reaction started only in the control mixture (animal manure + slaughtering by-products without straw). It is noteworthy that, the 3 investigated mixtures produced soil amendment by compost with good agronomical potential but with parameters close to the extreme limits of the law. In the Summer test, there was thermophilic fermentation in all mixtures and a better quality compost was obtained, meeting all the agronomic and legislative constraints. For each pile, we examined the progression of fermentation process and thus the plant limitations that did not allow a correct composting process. The results obtained in this study are useful for the development of appropriate mixtures, machines, and plants assuring continuance and reliability in the composting of the biomass coming from rabbit industry.

KeywordsIndustrial scale composting plant,Piles with several C/N,Rabbit by-products.


1 Departement of Agricultural and Environmental Sciences, University of Bari, Italy.2 Institute of Parasitoly of the Slovak Academy of Sciences, Košice, Slovak Republic.

3 Consiglio per la Ricerca in Agricoltura e l’analisi dell’economia agraria,Unità di ricerca per i sistemi colturali degli ambienti caldo-aridi (CRA-SCA), Bari, Italy.

* Corresponding author at: Departement of Agricultural and Environmental Sciences, University of Bari,Via Amendola 165/A, 70126 Bari, Italy.

Tel.: + 39 080 5442940, Fax: + 39 080 5443080, e-mail: [email protected].

Biagio Bianchi1*, Ingrid Papajova2, Rosanna Tamborrino3, Domenico Ventrella3 & Carolina Vitti3

Characterization of composting mixtures and compost of rabbit by-products to obtain a quality

product and plant proposal for industrial production


Composting mixtures and compost of rabbit by-products for industrial production Bianchi et al.

processing the on-site-bred animals, located in Martina Franca area, province of Taranto (Southern Italy), in order to investigate the process of complete stabilization and humification of the waste and by-products of the farm breeding. In the present paper results will be shown about chemical-physical biomass characterization and designing for specialised composting plants.

Materials and methodsThe experimental tests were carried out from February the 2nd 2009 to April the 19th 2009 (Winter test) and from July the 11th 2009 to September the 31st 2009 (Summer test). The breeding farm consisted of 20,000 heads and 2,000 breeding rabbits; the annexed slaughtering plant had the European Commission Licence and 1,500 heads/week were slaughtered. The average manure production was 3,000 kg/day, while the slaughtering by-products corresponded to 1,500 kg/week. Before mixing with the manure, slaughtering by-products underwent to a treatment in an autoclave at 133 °C and 3 bar per 20 minutes. The slaughtering waste-water was treated in an active sludge purifying plant, then it was distributed on the land. The sludge was almost completely re-used in the purifying process. An industrial scale plant with simplified design criteria was developed, based on a plant adapted for other mixtures, in a previous research study (Figure 1). Three piles with a width of 2.0 m were designed on the plant’s assembly chain. The starting mixtures were each one with a mass of approximately 4.7 t, but with different compositions:

1. Mixture 1 (M1): manure (92.5%), purifying sludge (0.5%), and slaughtering by-products (7%), with C/N=15.90. In previous researches, this composition was the most suitable for composting the farm by-products and has been used as a control mixture (Bianchi et al., 2009);

2. Mixture 2 (M2): manure (91.1%), purifying sludge (0.5%), and slaughtering by-products (6.8%) + straw (1.6%), with C/N = 16.20;

3. Mixture 3 (M3): manure (89.5%), purifying sludge (0.5%), and slaughtering by-products (7%) + straw (3%) with C/N = 18.15.

A common agronomic straw shredder was used to chop the straw, which had a width of 5 cm; while all components of each mixture were mixed together with a rototiller. This is the most realistic option to be adopted on farms that cannot have specific machines for shredding straw and mixing components, which is why it was not possible to obtain a higher percentage of straw in the mixture 3, and consequently, a higher C/N ratio. It is necessary

IntroductionThe production cycle of rabbit should produce a commercial meat cut of approximately 2.5 kg in approximately 70 days. During this period, the animals have a diet based on the following: products and by-products of oil-rich seeds, dry forage, grains, by-products of the sugar processing, with the addition of dietary protein supplements, alpha-tocopherol, iron sulfate pentahydrate. In the first 25 days of the growing period, the diet is also supplemented with iron, zinc, organic selenium, vitamin A and D3. The average feed intake is approximately 120 g/day per head with a production of manure approximately 195 g/head per day (King 1984).

The scientific research carried out in the rabbit industry investigates primarily all the production aspects. However, many breeders point out the need to study the environmental aspects concerning the intensive production and processing of rabbit meat. This is due to the fact that on many industrial farms the costs of the waste management, have become very high in comparison to the company’s turn-over, reaching even 3% of the total costs (Associazione Scientifica Italiana di Coniglicoltura 2008, not published data).

From a scientific and technical viewpoint, in the livestock sector, economic investment in primary production (milk or meat) can be supported (Amirante et al. 2005, Bellomo et al. 2005) if breeding cycles are closed with recovery of by-products and the disposal reduction costs of manure and waste.

Besides, the compost application can be considered as supply of nutrient and source of organic matter (humus content) for agricultural soil and, according to chemical and physical characteristics of soil and compost and to other agronomic practices, by contributing to maintain or improve the soil fertility. On the other words, the compost utilization, improving the sustainable use of the soil, allows for using the available and limited resources in a sustainable way.

Extensive data can be found concerning the research into composting process, but the available data refer to manure of fowls (Tiquia and Tam 2000), hogs (Larney et al. 2000, Larney et al. 2002, Larney et al. 2006), bovines (Saludes et al. 2007), and other domestic animal species. Similar studies have not been carried out until now on rabbit manure. However, laboratory tests have been conducted on the composting of organic mixtures, which also contain chicken and rabbit carcasses, in order to monitor the development of the process (Barrena et al. 2009).

A research study is in progress at an industrial farm breeding rabbits, with an annexed slaughterhouse


Bianchi et al. Composting mixtures and compost of rabbit by-products for industrial production

approximately 1 m/day, for a period of 80 days. During this period the temperature of the environment, outside and inside the plant, was monitored as well as the temperature inside the mass, at a distance of 10 cm from the bottom of the pit and 10 cm at the top of the pile. At variable intervals, between 20 and 30 days, the following analytical determinations were carried out both during Winter and Summer composting heaps: total nitrogen, total organic carbon (TOC), humidity (%), pH in H2O, electrical conductivity. On the final sample taken from each heap the following parameters were measured: iron, nickel, lead, zinc, and other components affecting soil fertility. The determinations were effected as the official protocols of fertilizers analysis listed by the Ministry of the Agricultural and Forest Politics. These assessments were executed as the official methods and according to the law1, repeating each analytical measurement 3 times. In order to analyse organic and inorganic nitrogen, an automatic steam flowing distiller was used, the UDK 130 D-Velp scientific (Velp Scientifica s.r.l. Usmate, MI, Italy), integrated with a DK 6 Heating D digester. EC and pH were measured in 1:10 (w/v) water-soluble extraction at 24 ± 1 °C. The conductivimeter and the pH-meter were a CRISON 524 and a CRISON microTT2050 (Crison Instruments, S.A. Alella, Barcelona, Spain), respectively. The moisture content was determined by drying a sample at 105 °C. Total nitrogen (N) was determined by the Kjeldahl method; TOC, total extracted carbon (TEC) and humified organic carbon (HA+FA)-C were determined according to the Springer and Klee

to take into account that in the case of an industrial plant, a final product characterised by high amounts of straw of considerable size was of little interest to buyers (Figure 2).

Using the turning-over and aerating machine, each of these piles was turned and aerobic conditions were maintained by way of advancement of the mass of

Figure 1. Diagram of the prototype turning-over and aerating machine. Image is drawn approximately to scale and measurements are in millimeters.

Width of the turn-over machine 4,200 mm

Advancing passage 1,200 mm

Volume turned for each passage 2,880 mm3

Advancing speed (go) 2,500 mm/h

Fit power 15.0 kW

Figure 2. Views of the advancing passage of the plant and details of the mixtures studied: it showed the high amount of straw and the considerable size of fragments in M3 mixture.

Control

M1

M2

1 European Commission (EC) 2003. Regulation (EC) No 2003/2003 of the European Parliament and of the Council of 13 October 2003 relating to fertilisers (Text with EEA relevance). Off J, L 304, 21/11/2003.

Italian Legislation. 2006. Decreto Legislativo No 217 of 29 April 2006. Revisione della disciplina in materia di fertilizzanti. Off J, 141, 20/06/2006 (Suppl, 152).

54



The Control mixture is the only heap where a bio-oxidation process takes place (Figure 3). In the first 30 days the temperature rised from 12 to 39 °C, then it did not vary appreciably for a week. In the following 10 days, the temperature decreased, while it increased again from 36 to 40 °C in the next 10 days (Figure 3). Finally, it decreased in the last 20 days of the trial (Figure 3). The final mixture temperature was the same as the environmental temperature, which, due to the fact that the seasons changed, resulted in being higher compared to the temperature at the beginning of the trial.

In comparison, M2 and M3 did not show a temperature increase in relation to the environmental temperature. The pile temperature profile followed that of the environmental temperature with deviations between 2 and 4 °C (Figure 3). It also does not show any significant microbial activity. Instead, in the control mixture the process reaches an incomplete fermentation, limited only to the mesophilic phase, with a maximum temperature much inferior to 60 °C. The process is influenced by the environment temperature and when the temperature remains under 15 °C it tends to stop the metabolism of the micro-organisms. However, when there is an increase from 13 to 22 °C, the increase leads to a re-activation of the bio-oxidation activity, despite the mass being in a phase of cooling-down. This also points out that on the 15th day of the trial there is a not completed stabilisation of the product, as showed also by undercomposed organic substances that are oxidized later.

During the whole process, including the phase of maturation, the humidity level of Control mixture remains higher than 55% (Figure 4); these values can be considered compatible with the evolution of biological reactions. Despite periodic irrigation, M2 and M3 dried out excessively after approximately 50 days of processing (Figure 4). At the moisture level of 30-35% (Figure 4), the microbial activity proceeded with difficulty or very slowly (EPA 1995, Kaneko and Fujita 1985, Suler and Finstein 1977). The differences among the final means of the 3 mixture proved to be statistically significant (Table I).

The C/N ratio of the studied biomasses (Figure 4) were not at all at such levels in order for the process of stabilisation to slow down; in fact, even though they were low at starting of composting process and the differences were not statistically significant (Table I), these values perfectly corresponded with the limits determined by Italian regulation3 (i.e.: C/N ≤ 25 for mixed compost amendment).

method. Total Zn, Cu, Pb and Ni were determined by Inductively Coupled Plasma-Optical Emission spectrometry (ICP-OES) after digestion in HNO3 65% in a pressurized microwave.

According to Sequi and colleagues (Sequi et al. (1986), the humification rate (HR) was calculated as:

HR = 100 x (HA+FA) - C/(TOC)

statistical analysis was carried out using GLM procedures2. The differences between average values were analysed with a probability level of P ≤ 0.05, using the Tukey test.

Results and discussionControl mixture (Figure 3 and Figure 4) has a very high level of nitrogen and a relatively low level of carbon; the humidity is slightly higher than the optimal limits reported by researchers in the range of 50-60% for different compost mixtures. In fact, humidity above 65% hinder the diffusion of oxygen in the biomass, in contrast to aerobic activity of microorganisms, and can facilitate the onset of anoxic conditions (EPA 1995, Kaneko and Fujita 1985, Suler and Finstein 1977). Therefore, these by-products may not be used in mixtures for the recovery of biomass with high humidity (e.g. sludge from other purifying processes or pomace too wet); on the contrary, these by-products provide quality mixtures with low humidity and high carbon content biomass, such as green and lignocellulosic waste.

Winter testDuring the Winter test, an increase of the temperature profile along the cross-section, starting from the lowest layer of the pile, points out that the fermentation starts more rapidly in the upper layers and that inadequate mixing takes place as well. In the control mixture the difference in temperature between the upper and the lower layers reaches 7 °C, while in the other mixtures the difference does not exceed 3 °C (Figure 3).

During the Winter trials (Figure 3), the temperature remains for a long period of time rather low. Anyway, the building that shelters the pile from the outside environment does not offer adequate thermal insulation, considering that the temperature in the building is at the most 2 °C higher than the outside environmental temperature (Figure 3). On the contrary, in the specific case, the used perimetral and covering materials must be able to retain the heat produced by the biomass.

2 SAS Institute Inc. 2010. SAS/STAT Software Release 9.2, Cary, NC, USA. Sustainable Compost Application in Agriculture, Completion April 2008. Landwirtschaftliches Technologie-Zentrum Augustenberg (LTZ), European Compost Network ECN e.V., p. 2.

3 Italian Legislation. 2006. Decreto Legislativo No 217 of 29 April 2006. Revisione della disciplina in materia di fertilizzanti. Off J, 141, 20/06/2006 (Suppl, 152).

55



matter, they release organic acids. In the early stages of composting, these acids often accumulate. The resulting drop in pH encourages the growth of fungi and the breakdown of lignin and cellulose. As composting proceeds, the organic acids become neutralized and mature compost generally has a pH between 6 and 8.

In this research, the pH stability in Control mixture did not only confirm that the complete thermophilic phase had not been reached, it also showed that during the maturation phase there had not been any significant activity of the nitrificant bacteria which transform the ammoniac subsequently into

From the chemical point of view, the composts generally have pH ranging from neutral to sub-alkalinity with values higher than peats. However, this particular characteristic does not affect the use of compost in agriculture in open fields, for environmental restoration or for ornamental plant cultivations. In the nursery, an ideal growing media should provide pH values between 4.5 and 6. Since the compost pH were between 7.8 and 8.1, a small mixing with other materials proved to be enough to have materials with pH closer to the ideal values.

A pH between 5.5 and 8.5 is optimal for compost microorganisms. As bacteria and fungi digest organic

Tem

pera

ture

(°C)

0

T outT inT topT bottom


1 11 21 31 41 51 63 73 83 90

10

20

30

40

50

60

Mixture 1 - Winter Mixture 1 - Summer

Composting days

Tem

pera

ture

(°C)

01 11 21 31 41 51 63 73 83 90

10

20

30

40

50

60

Composting days

Tem

pera

ture

(°C)

0



1 11 21 31 41 51 63 73 83 90

10

20

30

40

50

60


Composting days

Tem

pera

ture

(°C)

01 11 21 31 41 51 63 73 83 90

10

20

30

40

50

60

Composting days

Tem

pera

ture

(°C)

0



1 11 21 31 41 51 63 73 83 90

10

20

30

40

50

60


Composting days

Tem

pera

ture

(°C)

01 11 21 31 41 51 63 73 83 90

10

20

30

40

50

60

Composting days

Figure 3. Winter and summer test: temperature profiles registered during composting test. Mixture 1 (C/N = 15.90), Mixture 2 (C/N = 16.2), Mixture 3 (C/N = 18.15). The Control mixture is referred to as Mixture 1.

56



nitrous and nitric acid (Saludes et al. 2007), with a decrease of pH level. In any case, the pH values can be considered optimal, for M1 and M2, as it was consistent with the national regulation which puts the limits between 6 and 8.5 (Table I).

The investigated mixtures presented average values of electrical conductivity from 3.56 to 4.06 dS/m with a tendency to assume maximum values towards the end of the process when the moisture level diminishes, although the differences were not statistically

Moi

stur

e (%

)

0

M1M2M3

1 9045

10

20

30

40

50

60

70

80

Winter - Moisture Summer - Moisture

Composting days

Moi

stur

e (%

)0

1 9045

10

20

30

40

50

60

70

80

Composting days

M1M2M3

pH

5

M1M2M3

1 9045

6

7

8

9

10

5

6

7

8

9

10

Winter - pH Summer - pH

Composting days

pH

1 9045Composting days

M1M2M3

C/N

0

M1M2M3

1 9045

5

10

15

20

0

5

10

15

20

Winter - C/N Summer - C/N

Composting days

C/N


M1M2M3

EC (d

S/m

)

0

M1M2M3

1 9045

1

2

3

4

0

1

2

3

4

5 5

6 6

Winter - EC Summer - EC

Composting days

EC (d

S/m

)


M1M2M3

Figure 4. Mixture PH, EC, C/N performance during winter and summer tests. The Control mixture is referred to as Mixture 1.

57



was a considerable quantity of organic substances which has the potential of being composted, eventually the compost processes did not proceed as expected (Table I). Moreover humified fractions of the 3 mixtures were very proximal to limit value.

As for the evolution of composting process, in Control mixture the temperature did not exceed 40 °C, due to excessive compressing of the biomass and therefore insufficient aeration. Also in the M2 and M3 poor microbiological activity occured inhibiting the active phase of the process. Nevertheless, the chemical parameters showed levels of TOC only slightly inferior to the minimum values allowed by D.L. 217/06. Also the C/N ratios were inferior to the allowed maximum values (Table I). The percentage of humic and fulvic acids is just below 7% for the Control and M2 mixtures and more than 7% for

significant (Table II). The Italian D.L. 217/06 does not set limits for this parameter that, in the compost, can vary considerably, depending of feed-stock and processing. Compost may therefore contribute to or dilute the accumulative soluble salt content in the amended soil. Knowledge of soil salinity, compost salinity, and plant tolerance to salinity is necessary for a sustainable use of compost for agricultural purposes. For most turf and landscape plantings the final salinity (EC) of the amended soil should be less than 4.0 dS/m (Darlington 2010). Higher soluble salt levels would likely require leaching irrigations or other agronomical practices to reduce the negative effects of soil salinity.

The research carried out on the other chemical parameters present in the composted material shows that, even if in the starting mixtures there

Table I. Winter test: final characteristics of mixtures. The Control mixture is referred to as Mixture 1.

Parameters Limit(D.L. 217/06)

Mixture 1C/N = 15.90



Moisture % 48.89 a 25.93 c 31.00 b

pH 6-8.5 8.90 a 8.31 b 7.80 c

Total Organic Carbon (%) > 25 33.40 a 20.90 c 23.80 b

Ntot (%) 2.70 a 1.50 b 1.70 b

C/N < 25 12.37 a 13.90 a 14.00 a

Electrical conductivity (dS/m) 4.06 a 4.06 a 3.56 a 3.81 a

(HA +FA)-C (%) > 7 6.64 b 6.23 c 7.17 a

HR (%) 16 21 22

Cu (mg/kg) 150.0 82.20 a 55.59 b 55.90 b

Ni (mg/kg) 100.0 3.21 a 2.33 b 2.21 b

Pb (mg/kg) 140.0 < 0.1 a < 0.1 a < 0.1 a

Zn (mg/kg) 500.0 459.30 a 290.5 b 291.10 bMeans with the same letter are not significantly different for P≤0.05

Table II. Summer test: final characteristics of mixtures. The Control mixture is referred to as Mixture 1.

Parameters Limit(D.L. 217/06)




Moisture % 33.56 a 24.75 c 27.18 b

pH 6-8.5 8.43 a 7.68 b 7.73 b

Total Organic Carbon (%) > 25 34.70 a 27.79 c 29.72 b

Ntot (%) / 2.47 b 2.90 ab 2.63 a

C/N < 25 14.04 a 9.58 c 11.30 b

Electrical conductivity (dS/m) 4.9 a 4.68 a 5.25 a

(HA +FA)-C (%) > 7 13.34 a 13 a 12.3 b

HR (%) 38 46.8 41.4

Cu (mg/kg) 150.0 93.21 a 101.55 a 91.74 a

Ni (mg/kg) 100.0 6.68a 6.90 a 7.17 a

Pb (mg/kg) 140.0 < 0.1 a < 0.1 a < 0.1 a

Zn (mg/kg) 500.0 403.72 b 553.45 a 514.68 aMeans with the same letter are not significantly different for P≤0.05

58



The composts obtained at the end of the process have C/N values within limits determined by D.L. 217/06 (Table II). Although the differences were not statistically significant (Table II). In fact, C/N ratios of the composts obtained during the Summer test are quite similar to those obtained during the Winter test (Tables I and II). M2 and M3 reached ratios close to the same values into the soil at the end of the process (Table II). The values of the C/N ratios recorded during the Summer test both in M2 and in M3 were lower than the corresponding values recorded during the Winter test (Tables I and II).

The pH values (Table II) can be considered optimal with regards to the national regulations and the variation of pH recorded in mixtures confirmed an acceptable thermophilic phase.

The mixtures showed average values of electrical conductivity (from 2.98 to 5.48 dS/m): the minimum value is observed in control mixture after 60 days from the beginning of the process; while in the M2 and M3 EC maximum values were recorded during the last 20 days. However, also in this case, the differences were not statistically significant (Table II). Also these results show that mixed composted amendments experimentally obtained can be considered for agronomic utilization purposes. However, they cannot be suggested as substrate for horticultural purposes as indicated by Italian legislation that limits this use for material with EC lower than 1 dS/m.

According to Ko and colleagues, generally the EC of animal composts are higher than those that characterize the other organic waste composts (Ko et al. 2008). Such high values are often linked to high salt levels. Therefore, these results suggest that these composts have to be tested thoroughly in field researches before their use as soil amendment can be recommended. At the same time, appropriate agronomic measures should be identified so to limit potential negative effects on agronomic crops. Casado-Vela and colleagues monitored the effect of application of 3 increasing amounts of composted sewage sludge with EC > 5 dS/m on the soil subjected to cultivation of sweet pepper (Casado-Vela et al. 2007). Their results showed that the application of 9 kg/m2 increased significantly the soil EC beyond the threshold value recommended for the cultivation of sweet pepper.

Montemurro et al. (2009) investigated the composting process of olive oil pomace with other organic wastes comparing four different types of composts. They concluded that the high EC (7 dS m-1) of one of these led to excluding it for agronomical utilization, even if it had high N content. The organic and humification parameters of composted material are very similar both in Winter and in Summer product (Table II), and the straw adding in the M2 and

the M3; therefore the results for winter test can be considered not negative.

For the above reasons the humification rate (HR) showed to be very low (Table I) with values ranging from 6.2 to 7.2%. It can be hypothesized that by modifying the process parameters and the operative conditions, this index could increase; in fact, the corresponding values of humic and fulvic acids were approaching the allowed limits defined by law, exceeding the limit in the heap with the added straw (Table I).

No excessive values of heavy metals were registered, for they were within the limits fixed by Italian low (D.L. 217/06). However, the amount of zinc should be monitored, given that the during the tests, only for the control mixture, the level of zinc approached the maximum threshold values (Table I).

Summer testThe results of the experimental test carried out in the Summer are reported in Figure 3 and Figure 4. The temperature profiles show a much better composting evolution when the environmental temperature is favourable. In fact, in control mixture the thermophilic phase was reached (Figure 3) while in M2 and M3 the mesophilic phase was in an advanced state (Figure3). Also in this experimental test, the temperatures in the top of the biomass were higher than the lower layers (Figure 3).

The moisture content of piles subjected to composting processes is essential for microbial growth. In fact, excess moisture can cause a total occlusion of biomass pores from the water and create anaerobic conditions of the system; at the same time, when recording a water deficit almost complete, an interruption of degradation processes could be generated.

The starting material should present relatively high humidity to enhance the thermoregulation functions related to water evaporation and temperature control while avoiding early desiccation. With the progress of the aerobic processes and consequently with the decreasing biological activity, the moisture optimal values tended to decrease.

The moisture variations recorded during the composting process carried out in the Summer, as reported in Figure 4, show a decreasing trend during the whole process and the statistical analysis on the final means led to a statistically significant differences (Table II).

The observed decrease, however, did not affect the evolution of biological activity. In fact moisture contents less than 35% were observed only at the end of the curing phase, when composted material should have been almost stable (Figure 4 and Table II).

59



Moreover, a specialized machine would be more suitable, in order to obtain straw residues with dimensions inferior to 50 mm, so higher C/N ratios in the starting mixtures.

The high temperature measured at the top of the mass, both during the Winter and Summer tests, is due to an increased bacterial activity in this more ventilated layer, so ∆T grows proportionally with the process approximation to complete fermentation. This is a limit of the turning machine that does not allow an adequate ventilation of the deepest layers. Therefore, it is clear that the turning elements do not adequately penetrate into the biomass and they are of an excessive length, as regards the product to be treated. In fact, the progress of the biomass of 1 m/day is achieved with only 1 daily passing of the machine while, on the studied biomass, the same progress should have been obtained with more daily passings, so to make more frequently the turning over and the mixing of the layers of biomass.

Therefore to improve aeration system and other performances, the following mechanical adjustments to the prototype of the turn-over/moving machine, have been programmed:

• reducing of the length of the turnover elements (Figures 1 and 5), which have been welded to the traversal reel and a lowering of the above relative to the ground in order to allow for a better penetration into the mass and to obtain a better turn-over over a shorter distance; in this way, besides a reduction in energy consumption, it is also possible to effect more trips compared to the covered distance, thereby mixing better the upper layers as well as the lower layers;

• modifying the shape and the profile of the turn-over elements (Figure 5) in order to improve the mixing and to aerate the mass still further when the machine is returning, therefore effecting a rotation in the opposite direction of the reel without moving back the material that has been pushed forward, therefore simply lifting it up.

ConclusionsComposting of by-products must be supported by a physical-chemical study of the starting raw materials and by the formulation of balanced mixtures, to activate the metabolism of thermophilic bacteria and to obtain soil composted amendment of high quality in terms of law.

The study of the chemical and physical evolution of mixtures and of obtained products is essential to assess the progress of the composting process, as well as to determine any mechanical and plant

M3 allows for improving the compost quality. The 3 TOC averages are higher than the minimum values allowed by law and the C/N ratios correspond to the legislative requirements; the values for samples with straw are much better, for they are quite close to the soil C/N ratio (Table II). The percentage of humic and fulvic acids are more than 7% for the 3 heaps, confirming high quality of the compost (Table II).

On the contrary, the amount of zinc in the carried out tests approached the maximum limits in the control mixture and exceeded this limit in M2 and M3, this happened mostly during the Summer test. Probably it is necessary a dietary check at farming scale during rabbit weaning (Tables I and II).

Technical modifications on the plant and prototype of turn-over/aerating machineThe monitoring of temperatures and chemical-physical parameters of the mixtures show limits in the composting process that can be corrected with appropriate mechanical - plant engineering solutions. In fact, with low outside temperatures (Winter test), the composting plant failed in ensuring microclimatic conditions suitable to promote bacterial growth. Besides, in the same test, the growth failure of pH and the production of compost not fully stabilized, show insufficient ventilation and homogenization of the mass during the whole process, confirmed by an insufficient increase in temperature. To this, it must be added that the C/N ratio of the control mixture has not been adequately corrected with the addition of straw in mixtures M2 and M3, and this further affected the development of the process and the chemical and physical properties of final products (Tables I and II).

Therefore, according to the results reported above, in the trials conducted during the Winter, the composting process could be improved considering the following technical/operative parameters:

1. temperature;

2. particles of organic matrix;

3. aeration.

On the contrary, when the process was carried out during the Summer, the size of organic material seems less important.

Regarding the temperature control, in the specific case, the used perimeter and covering materials must be able to retain the heat produced by the biomass, especially in Winter. Moreover when the ambient temperature is too low, the possibility to heat the entering mass by way of pipes with circulating warm water on the bottom of the trough, could be considered. The adaptation would be limited to only 1/3-1/4 of the total length.

60



the mixture and a proper homogenization - aeration of biomass. This experimental research defines plant solutions and modification of the turner machine, because of high humidity that characterizes the mixtures, and to ensure the realization of the complete process of aerobic stabilization that was only partially realized, especially at low outsider temperatures.

engineering solutions that may improve it or allowed it to run optimally.

This study has identified the high potential to obtain high quality compost from manure and slaughterhouse waste rabbit. In addition, the results underlines that specific mechanical and plant solutions are necessary to allow for proper C/N ratio in

Figure 5. Technical modifications on the prototype of turn-over/aerating machine. Image is drawn approximately to scale and measurements are in millimeters.

Original turn over element

New sections of the shofts

New sections of the blodes

Different designed versions of the turn-over elements

462.

0

300.

0

370.

0

500.0

262.0 262.0 241.0

61



Amirante P., Bianchi B. & Montel G. L. 2005. Dynamic tests during cow milking with different types of milk meters. Vet Ital, 41 (1), 56-78.

Bellomo F., Bianchi B. & D’Emilio F. 2005. Experimental milking tests on Murgese mares for the design of ad hoc milking plants. Vet Ital, 41 (3), 199-221.

Barrena R., Artola A., Vàzquez F. & Sanches A. 2009. The use of composting for the treatment of animal by-products: experiments at lab scale. Journal of Hazardous Materials, 161, 380-386.

Bianchi B., Debiase G., Ferri D., Tamborrino A. & Tarantino D. 2009. Prove sperimentali per la produzione di compost da deiezioni e sottoprodotti della macellazione cunicola. In Ricerca e innovazione nell’ingegneria dei biosistemi e agro-territoriali. Atti del IX Convegno Nazionale dell’Associazione Italiana di Ingegneria Agraria, Ischia Porto, 12-16 September 2009.

Bianchi B., De Biase G., Ferri D., Tamborrino A. & Tarantino D. 2009. Composting of rabbit breeding and slaughtering by-products: experimental tests and design criteria for a turning over and aerating machine. In New Fertilizers and Fertilization Management. Proc. 18th Symposium of the International Scientific Centre of Fertilizers More Sustainability in Agriculture, 8-12 November 2009, Rome, Italy.

Casado-Vela J., Sellés S., Díaz-Crespo C., Navarro-Pedreño J., Mataix-Beneyto J. & Gómez I. 2007. Effect of composted sewage sludge application to soil on sweet pepper crop (Capsicum annuum var. annuum) grown under two exploitation regimes. Waste Management, 28, 1509-1518.

Darlington W. 2010. Compost A guide for evaluating and using compost materials as soil amendments. Form 415 - Soil and Plant Laboratory 714-282-8777. http://www.soilandplantlaboratory.com/pdf/articles/CompostAGuideForUsing.pdf.

EPA. 1995. Composting: decision maker's guide to solid waste management. Volume II (EPA 530-R-95-023), USA. http://www.bvsde.paho.org/bvsacd/cd48/chapter5.pdf.

References

Kaneko H. & Fujita K. 1986. The moisture limit for optimum composting. In Proc Japan Society of Civil Engineering, Japan, 369, 303-309.

King J.O.L.1984. Crude fibre in rabbit diets. Commercial rabbit, 12, ll-19.

Ko H.J., Kim K.Y., Kim H.T., Kim C.N. & Umeda M. 2008. Evaluation of maturity parameters and heavy metal contents in composts made from animal manure. Waste Management, 28, 813-820.

Larney F.J., Olson A.F., Carcamo A.A. & Chang C. 2000. Physical changes during active and passive composting of beef feedlot manure in winter and summer. Bioresour Technol, 75, 139-148.

Larney F.J., Hao X., Miller J.J. & Olson A.F. 2002. Phosphorus dynamics during composting of feedlot manure. In Proc Int Symp Composting and Compost Utilization (Michel F.C., ed), Columbus, OH, 6-8 May 2002. The JG Press Inc., Emmaus, PA.

Larney F.J., Buckley K.E., Hao X. & McCaughey W.P. 2006. Fresh, stockpiled and composted beef cattle feedlot manure: nutrient levels and mass balance estimates in Alberta and Manitoba. J Environ Qual, 35, 1844-1854.

Montemurro F., Diacono M., Vitti C. & Debiase G. 2009. Biodegradation of olive husk mixed other agricultural wastes. Bioresour Technol, 100, 2969-2974.

Sequi P., De Nobili M., Leita L. & Cercignani G. 1986. A new index of humification. Agrochimica, 30, 175-179.

Tiquia S.M. & Tam N.F.Y. 2000. Fate of nitrogen during composting of chicken litter. Environmental Pollution, 110, 535-541.

Suler DJ. & Finstein M.S. 1977. Effect of temperature, aeration and moisture on CO formation in bench-scale, continuously thermophilic composting of solid waste. Appl Environ Microbiol, 33, 345-350.

Saludes R.B., Iwabuchi K., Kayanuma A. & Shiga T. 2007. Composting of dairy cattle manure using a thermophilic-mesophilic sequence. Biosystems Engineering, 98, 198-205.

63

SummaryThis study describes the results of a retrospective evaluation (8 years: 2005-2012) of the efficacy of the anti-fertility drug, Ovistop® nicarbazin (800 ppm) added to corn kernels used to feed non-migratory feral pigeon colonies, Columba livia var. domestica, in the city of Genoa, Italy. The observation interested 4 non-migratory feral pigeon colonies located into well-defined areas of the city of Genoa, Italy. Three of these colonies were treated for 12 months, with 10 g of drug (Ovistop®) provided per bird per day for 5 days each week; the other colony was treated in the same way but with a placebo (control station). Each colony and the relative area where the colony was located were both monitored with the same daily examination. Statistical analysis techniques were applied to the findings recorded - both descriptive (indices of central and dispersion trends) and comparative (one-way variance analysis). In the colonies treated with the drug, following an initial increase in the population (‘magnet effect’), a reduction was observed over the following 4 years (-35%>x> -45%) and a further decrease (-65%>x> -70%) was observed over the subsequent 4 years (statistically significant one-way ANOVA p<0.01). This phenomenon was recorded across the board in the 3 treated stations, compared to the overall unstable trend observed for the control station. As no external or exceptional anthropic or natural factors were observed, it can be stated that, given the results observed, the drug seemed effective in reducing the treated bird populations.

KeywordsColumba livia var. domestica,Control,Genoa,Italy,Management, Nicarbazin,Pigeon,Reduction.


1 Department of Earth Sciences, Environment and live sciences, University of Genoa, Corso Europa 26, 16132 Genoa, Italy.2 Bio-Statistician, Via Ausonia 23, 16136 Genova, Italy.

3 Department of Mathematics, University of Genoa, Corso Europa 26, 16132 Genoa, Italy.

* Corresponding author at: Via Ausonia 23,16136 Genova, Italy. Tel.: +39 338 9696802, e-mail: [email protected].

Paolo Albonetti1, Antonio Marletta2*, Ivano Repetto3 & Emanuela Sasso3

Efficacy of nicarbazin (Ovistop®) in the containment and reduction of the populations of feral pigeons

(Columba livia var. domestica)in the city of Genoa, Italy: a retrospective evaluation

RiassuntoQuesto studio di coorte caso-controllo ha avuto l’obiettivo di valutare retrospettivamente i risultati di 8 anni (2005-2012) di somministrazione di nicarbazina (Ovistop®), addizionata a granella di mais nel rapporto di 800 ppm, come antifecondativo in colonie stanziali di Columba livia var. domestica nella città di Genova al fine di verificarne l'efficacia. Lo studio ha interessato 4 colonie stanziali, 3 delle quali trattate per 12 mesi, somministrando 10 g di prodotto, a capo, al giorno, per 5 giorni alla settimana e la rimanente colonia è stata trattata con le stesse modalità ma sottoposta alla somministrazione di un placebo (stazione di controllo). I dati raccolti sono stati elaborati con tecniche statistiche descrittive (indici di tendenza centrale e di dispersione) e di confronto (analisi della varianza ad una via). Nelle colonie trattate con il farmaco, dopo un iniziale aumento della popolazione (effetto calamita) si è osservata una prima riduzione nei primi 4 anni (-35%>x>-45%) e un’ulteriore diminuzione (-65%>x>-70%) nei 4 anni successivi, anch’essa statisticamente significativa (one-way ANOVA p<0,01). Il fenomeno registrato nelle 3 colonie trattate con il farmaco ha mostrato un andamento omogeneo a differenza dell'andamento complessivamente instabile della colonia di controllo. In assenza di altri fattori esterni o eccezionali, sia naturali sia antropici, è possibile affermare che nel caso osservato durante questo studio il prodotto impiegato ha dimostrato efficacia nella riduzione della popolazione aviaria trattata.

Parole chiaveColumba livia var. domestica,Controllo,Gestione,Genova,Italia,Nicarbazina,Riduzione.

Valutazione retrospettiva dell’efficacia della nicarbazina (Ovistop®)per il contenimento e la riduzione delle popolazioni di

Columba livia var. domestica nella città di Genova


Control of feral pigeon population by nicarbazin Albonetti et al.

environmental conditions of the ecosystem and the demographic dynamics (births/deaths, immigration and emigration of a few individuals) concur to maintain the stability of the colony’s demographics until external factors intervene.

In many cities, the experts and the local council administrators have discussed these factors, identifying and experimenting interventions affecting exclusively the animal colonies. Generally speaking, the proposed solutions aiming at a demographic reduction focus on 3 types of interventions:

• invasive interventions: surgical sterilization, capture of the birds and controlled elimination, removal of the eggs, etc.;

• physical interventions (dissuaders: nets, spikes, etc.);

• chemical interventions (drugs).

In relation to the invasive interventions, the field experience has demonstrated that euthanasia of the animals is ineffective and so is vasectomy, simply because of the poor cost/benefit ratio and the logistic difficulties associated with the intervention itself (identification and management of a large number of animals) (Baldaccini 1998, Baldaccini 1999a, Baldaccini 1999b). Removal of the eggs has not been successful either, considering the speed with which the clutch of eggs is replaced (Johnston and Johnson 1990).

A special procedure could be developed in the form of dovecotes to attract and concentrate the birds and control their laying habits (Haag-Wackernagel 2000). However, the installation and maintenance costs of such systems must be taken into consideration. Moreover, these facilities may simply become an additional location where pigeons aggregate.

The physical interventions to contain colony sizes have not always produced satisfactory results; partly because of the ancestral reproduction adaptability of pigeons, i.e. the extension of their fertile period (Janiga and Kocian 1985, Johnston and Johnson 1990), and partly because of the difficulty associated with reducing the roosting and nesting places.

These problems can be solved with integrated interventions that produce positive results thanks to the combination of different management techniques.

The application of chemical-pharmacological measures is particularly important and exploits products that have been available on the market for a considerable length of time. In the case of this study, the treatment involves administering corn kernels coated with nicarbazin, a product commercially known as Ovistop®.

The goal of this study was to evaluate the efficacy of this drug, using a trial model for cohorts of colonies

IntroductionFeral pigeon, Columba livia var. domestica, is a bird that lives freely in the squares of the historical cities around the world (Lever 1987) and in particular, in cities with important architectonic and urban heritage. The urban environment proves to be favourable to this species and contributes to an excessive presence of pigeons, which in turn creates problems associated to normal anthropic activities and to the difficult relationship between human beings and animals (Haag-Wachernagel 2000) in urban environments.

The risk posed to public health and hygiene consequences, the damage to the architecture and the buildings, the deterioration of the urban decorum (Sbragia et al. 2001), the damage to agriculture (Soldatini et al. 2006) and, last but not least, the economic cost related to the maintenance of the urban areas in which these birds live (Nomisma 2003) are the direct consequences of excessive proliferation of the pigeon populations.

The overcrowding that results from the high reproduction rate (Janiga and Kocian 1985) induces stress in the birds and encourages the diffusion of microorganisms and parasites within the bird populations, which can then weaken and undermine the structure of the pigeon colonies.

In urban areas the reproduction cycle of pigeons is almost continuous (Johnson and Janiga 1995), with the exception of a brief drop from November to January.

The superimposition and the ‘demographic explosion’ of pigeons in cities are due to the combination of a number of factors that encourage the settlement and their multiplication (i.e. the urban layout of the towns and cities, the presence of ecological corridors and free terrain, a lack of predators, availability of food, artificial lighting, the favourable climate, etc.).

Nevertheless, for a number of different reasons – including those based on pathology and parasitology – it has been observed that mechanisms of self-regulation come into play. Such mechanisms act predominantly among fledglings and pullets and can sometimes reduce the size of the population, although such mechanisms do not act as effective natural limitation to the presence of this species in urban area (Haag 1993, Baldaccini 1998).

Pigeons that steadily occupy a well-defined territory, which involves the nesting locations, egg-laying and food-supply, are considered to be a non-migratory population. A colony that persists on a territory and is not subjected to significant modification of the environmental conditions, can provide a long-term source of comparable findings. The homogeneous


Albonetti et al. Control of feral pigeon population by nicarbazin

• active ingredient: nicarbazin, 800 mg per kg of finished product;

• support: corn kernel;

• excipients: stearic acid, BHT (butylated hydroxytoluene) and dimethicone;

• trade name: OVISTOP®.

The quantity of administered drug per bird was defined at the beginning of treatment and updated on the basis of findings on the population while maintaining the recommended doses of 10gr of corn per day for each bird intercepted. The total dose was calculated and periodically updated in relation to the dimensions of the colony. The treatment period was 12 months; ‘corn’ (Ovistop® or placebo) was distributed on the ground 5 days per week at dawn. The distribution points were selected on the basis of the degree of socialization and habituation of the birds in presence of human beings. Before the start of the trial activity, the staff was trained to guarantee sharing of the project and to define the roles of each individual in the group (Martelli et al. 1993).

Observational trial of a cohort with a control group

To evaluate the efficacy of the anti-fertility/contraceptive formulation on the urbanized population of feral pigeons, Columba livia var. domestica, the experimental model selected 4 feeding stations, 3 feeding stations treated for 8 years with nicarbazin and 1 station treated for the same period of time but with a placebo.

treated with an anti-fertility/contraceptive drug and compare the findings with those observed for a control group with similar characteristics but treated with a placebo. The researcher operators processed the findings relative to the period of administration 2005-2012 of Ovistop® to well-defined and stable pigeon colonies in the city of Genoa, Italy (Figure 1). The results are based on the statistical analysis of the collected data.


Product Nicarbazin is an active ingredient with minimal toxicity and free from modifying effects on the main vital organs and parenchyma (Martelli et al. 1993), it is also a coccidiostatic drug that is widely-used in poultry production. The pharmacokinetic and toxicity characteristics of this molecule are well-known and have been widely-reported in the international literature (Hurwitz et al. 1975, Polin 1978, Hughes et al. 1991, Martelli et al. 1992).

At appropriate dosages for anti-fertility treatment, nicarbazin exclusively affects the processes associated with the maturation of the egg, as opposed to the fertility; consequently, the product does not interfere with physiological processes including those relative to the reproductive apparatus (hormone balances, etc.) (Bursi et al. 1996).

The product used in the protocol for the containment of pigeon populations is a veterinary medicinal specialty formulated as follows:

Figure 1. The homogeneous urban district of Genoa, Italy, inside of which the researchers have identified sub-areas occupied by non-migratory colonies.

66



These data, acquired in the same way, with the same schedule and with the same actions, constitute the homogeneous substrate of a reliable statistic analysis.

Counting method

To quantify the population of the specific colony identified for treatment (and for the successive measurements during administration) and to guarantee the correct distribution of the product in the amount indicated, the research operators used a detailed direct counting method. Considering that the biggest problem faced in the planning and completion of this kind of estimate consists in the inaccurate spotting of birds perched on inaccessible roofs, courtyards or gardens and the birds that are incubating the eggs, the counts are performed in conditions determined to maximize the sightings. The measurements were taken in Spring, Summer, Fall and Winter. The counts were performed early in the morning when bird numbers were highest (Ballarini et al. 1989).

Results

The statistical methodsThe data were grouped on the basis of the colony and time, re-processed statistically with descriptive techniques [mean parametric, mobile average, index of dispersion, standard deviation and non parametric quartile and median, Interval of Confidence (IC) 95% and Index Number], and a comparison technique (one-way ANOVA) with a probability significance threshold of p = 0.05 .

Findings – such as Index Number with a base of 100 – were also processed; this transformation consents the description of a phenomenon using figures that are immediately comparable as they are expressed on the same numerical scale.

The results relative to the years of treatment are presented in summary tables showing the mean number of pigeons sighted, a box-plot, trend analysis graph, table of the ANOVA results, table of the Index Number with a base of 100, graphs for each year, each feeding station, and for the control station.

Station 1 - Casaregis Street

In this station (Figure 2), research operators observed a reduction in the population of the animals from an initial mean value of approximately 100 pigeons; following an obvious reduction of approximately 45% in the first 4 years of treatment,

The findings relative to the 4 stable colonies in the city of Genoa are related to the retrospective experimental model ‘study of cohort-control’; with the absence of other elements or detectable and demonstrable causes, the administration of the drug represents the exposure (or lack of ) to the active ingredient and its effect.

The numerical measurements were obtained homogeneously across the years according to a shared protocol and in correspondence to the administration that involved counting the number of birds by spotting them in the areas of ‘corn’ (Ovistop® or placebo) distribution. The findings were initially registered on specific hard copy forms and subsequently transferred onto a digital support to be processed with the descriptive parametric statistic techniques (mean, moving average, index numbers), indices of dispersion and comparison techniques (one-way-ANOVA con p=0.05).

Description of the colonies

Urban bird colonies socialise in artificial environment that have been shaped by a number of different anthropic activities. It stands to reason that in urban areas there are no natural situations. Consequently, the colonies of feral pigeons cannot be compared with the wild colonies, nor can they be compared to populations that are kept in confined spaces and controlled inside enclosures such as aviaries. The urban colonies are a hybrid between the wild and domestic populations, which permanently occupy well-defined and easily identifiable areas in the cities and are encouraged by several factors among which, the abundant availability of food, the numerous locations for mating, nesting and egg-laying, the extension of the photoperiod and the increase in the seasonal temperatures.

Method and time schedule for the administrationThe treatment and the placebo were administered at dawn for a 12-month period over the solar year for a total of 8 years (2005-2012). In parallel with the distribution, the researchers recorded the findings relative to the sightings of the bird colonies: ‘daily contacted birds’.

All the research operators had been given the same training; they recorded the information defined by the protocol on specific forms, 1 for each colony treated. In particular, there was the explicit request to report anomalies in the colony (diseases, migrations, etc.) or in the territory (opening of building sites, any elements that could interfere with or affect the birds’ life).

67



there was a further decrease (approximately 65%) with stabilisation after 5 years (Figure 3a). This phenomenon was confirmed by the examination of the transformations into Index Numbers (Figure 3c) and is statistically significant, as shown by the ANOVA (Table I; p<0.001). The obtained results dispute the hypothesis that the mean of the recorded figures during the years of observation are the same, and confirm the trend (Figure 3b).

Station 2 - Tommaseo Square

In Station 2 (Figure 4), a decreasing trend was also observed; in the first 4 years, there was a decrease of approximately 45% and this trend continued to 65% in the following years when it then stabilized (Figure 5a). This trend has been described more directly by the series transformed into Index Numbers (Figure 5c), the trend has also been confirmed by the comparison test (Table II; ANOVA p<0.01) and the trend analysis (Figure 5b).

Figure 2. Casaregis Street, Genoa, Italy. This is a main road that runs inland from the seafront, in an area with a mixture of commercial and residential properties, with wide, tree-lined avenues. There are 2 parallel rows of sycamore trees and tangentially, numerous private gardens with medium-height plants and shrubs.

Figure 3. Casaregis Street, Genoa, Italy. a) Box-plot of number of pigeon by year; b) Trend line of observations in the period 2005-2012; c) Number Index with a base of 100 and approximation Fourier series of the trend in the period 2005-2012 referred to yearly means of pigeon population during 7 years of nourishment (2005-2012).

Table I. ANOVA results referred to pigeon populations during 7 years of drug distribution (2005-2012) in Casaregis Street, Genoa, Italy.

Source DF Sum of Squares

Mean Square F Value Pr > F

Model 7 320031,489 45718,784 371,693 < 0,0001

Error 774 95203,178 123,002

Corrected total 781 415234,667

2005 2006 2007 2008 2009 2010 2011 20120

20

40

60

80

100

120

140

160

Casa

regi

s St

reet

Year

Casa

regi

s St

reet

Year

0

20

40

60

80

100

120

14/01/2

004

28/05/2

005

10/10/2

006

22/02/2

008

06/07/2

009

18/11/2

010

01/04/2

012

14/08/2

013

0

20

40

60

80

100

120

140

14/01/2

004

28/05/2

005

10/10/2

006

22/02/2

008

06/07/2

009

18/11/2

010

01/04/2

012

14/08/2

013

N. I

ndex

Cas

areg

is S

tree

t

YearN. Index Fourier (p = 0.5)

a

b

c

68



Station 3 - Cecchi Street

In Station 3 (Figure 6), the research operators observed a population trend that could be superimposed on the findings recorded for Stations 1 and 2, though there were differences in the variations. For the first 3 years, the researchers observed a mean reduction of 40%, compared to the range of 35-45% recorded for stations 1 and 2 (Figure 7a). From 2009 onwards, the variation tended to stabilise with a percentage of approximately 70% that corresponds to the variations observed at the other stations (Figure 7b and 7c). In this case also, Variance Analysis rejected the hypothesis (Table III; p<0.001) that no differences exist between the years under examination.

Control station 4 - Scio Square

Observations recorded for the Control Station 4 (Figure 8) (relative to the pigeon colony treated with placebo) produced results that could not be linked to any previously described model or trend apart from the initial ‘magnet effect’. During the years in which the colony was observed (Table IV), the research operators actually recorded an increase in the population and a successive stabilisation of the numbers for similar populations (Figure 9a and 9b).

Figure 4. Tommaseo Square, Genoa, Italy. This is a large square with heavy traffic flow; the tall trees are planted in a large garden completed with decorative fountains.

Figure 5. Tommaseo Square, Genoa, Italy. a) Box-plot of number of pigeon by year; b) Trend line of observations in the period 2005-2012; c) Number Index with a base of 100 and approximation Fourier series of the trend in the period 2005-2012 referred to yearly means of pigeon population during 7 years of nourishment (2005-2012).

Year2005 2006 2007 2008 2009 2010 2011 2012

0

100

200

300

400

500

600

Tom

mas

eo S

quar

eTo

mm

aseo

Squ

are

Year14/0

1/2004

28/05/2

005

10/10/2

006

22/02/2

008

06/07/2

009

18/11/2

010

01/04/2

012

14/08/2

0130

50

100

150

200

250

300

350

400

14/01/2

004

28/05/2

005

10/10/2

006

22/02/2

008

06/07/2

009

18/11/2

010

01/04/2

012

14/08/2

013

N. I

ndex

Tom

mas

eo S

quar

e


0

20

40

60

80

100

120

a

b

c

Table II. ANOVA results referred to pigeon populations during 7 years of drug distribution (2005-2012) in Tommaseo Square, Genoa, Italy.



Model 7 2090218,632 298602,662 214,847 < 0,0001

Error 774 1075733,388 1389,836


69



Figure 6. Cecchi Street, Genoa, Italy. This road is wide and runs parallel to the seafront, which lies just a few hundred meters away. There is two-way circulation along the road that is interrupted by traffic islands and lined by double rows of sycamore trees.

The differences – despite them being in the opposite direction of stations 1, 2 and 3 – are not statistically different (p>0.001), with large variations in the 1st and 3rd percentiles (Figure 9a) and an elevated index of dispersion.

Index Number

The findings were subsequently compared in a single table (Table V) with the Index Numbers relative to the period analysed. In this way, it was possible to precisely evaluate the trend of the populations.

Using the Index Numbers with a fixed base (2005=100), the trend observed is superimposable for the 3 stations treated (Casaregis Street, Cecchi Street, and Tommaseo Square) and differs from the results recorded for the control station (Scio Square) (Figure 10).

Records for the first and second year of observation showed that the findings from the 4 stations in 2005 highlighted an initial and stable increase in the population called the ‘magnet effect’ caused by a greater availability of food; this effect was observed in the following year (2006) in Cecchi Street, Tommaseo and Scio Squares, with a drop in the phenomenon observed at the Casaregis station.

Figure 7. Cecchi Street, Genoa, Italy. a) Box-plot of number of pigeon by year; b) Trend line of observations in the period 2005-2012; c) Number Index with a base of 100 and approximation Fourier series of the trend in the period 2005-2012 referred to yearly means of pigeon population during 7 years of nourishment (2005-2012).

Year2005 2006 2007 2008 2009 2010 2011 2012

0

50

100

150

200

250

Cecc

hi S

tree

tCe

cchi

Str

eet

Year14/0

1/2004

28/05/2

005

10/10/2

006

22/02/2

008

06/07/2

009

18/11/2

010

01/04/2

012

14/08/2

0130

20

40

60

80

100

120

140

160

180

14/01/2

004

28/05/2

005

10/10/2

006

22/02/2

008

06/07/2

009

18/11/2

010

01/04/2

012

14/08/2

013

N. I

ndex

Cec

chi S

tree

t


0

20

40

60

80

100

120

140

160

a

b

c

Table III. ANOVA results referred to pigeon populations during 7 years of drug distribution (2005-2012) in Cecchi Street, Genoa, Italy.



Model 7 660464,181 94352,026 217,174 < 0,0001

Error 774 336267,052 434,454


70



From 2006 onwards, a decreasing trend was also observed for the Cecchi and Tommaseo stations; in 2009, these 3 stations returned a value below the threshold (Index Number on 02.05.2005 was based on 100) and this contrasted with the values recorded in Scio Square, which returned values that persisted at levels above the threshold, with high fluctuations throughout the year.

Overall, a reduction of between 40% and 70% was observed in the populations for stations 1, 2 and 3; in all 3 cases, the differences were statistically significant. In the control station, Scio Square (number 4), no superimposable variation or trend in the results was observed; on the contrary, the overall trend observed was unstable.

Discussion and conclusionThe findings of this study clearly describe a downward trend for stations 1, 2 and 3, which is different from the one observed at the control station number 4. As such the results of this study leave no doubt about the efficacy of nicarbazin for the control and the reduction of the number of birds in the treated pigeon colonies. This drug had been indicated from the outset for being able to negatively interfere with birds’ reproductive function and this defined its

Figure 8. Scio Square (Control station), Genoa, Italy. This rectangular square is adjacent to a 5-road intersection interrupted by traffic islands and public gardens with plenty of trees.

Table IV. ANOVA results referred to pigeon populations during 7 years of drug distribution (2005-2012) in Scio Square, Genoa, Italy.



Model 7 105698,266 15099,752 40,727 < 0,0001

Error 774 286967,070 370,758


Figure 9. Scio Square (Control station), Genoa, Italy. a) Box-plot of number of pigeon by year; b) Trend line of observations in the period 2005-2012; c) Number Index with a base of 100 and approximation Fourier series of the trend in the period 2005-2012 referred to yearly means of pigeon population during 7 years of nourishment (2005-2012).

Year2005 2006 2007 2008 2009 2010 2011 2012

0

20

40

60

80

100

120

140

Scio

Squ

are

Scio

Squ

are

Year14/0

1/2004

28/05/2

005

10/10/2

006

22/02/2

008

06/07/2

009

18/11/2

010

01/04/2

012

14/08/2

01320

30

40

50

60

70

80

90

100

110

14/01/2

004

28/05/2

005

10/10/2

006

22/02/2

008

06/07/2

009

18/11/2

010

01/04/2

012

14/08/2

013

N. I

ndex

Sci

o Sq

uare


50

100

150

200

250

300

350

a

b

c

71



exclusive use in birds not destined for reproduction activity (Martelli et al. 1993).

From the analysis of the superimposable trend over the years, 2 reduction phases were observed during the treatment period. The first one was observed in the first 2 or 3 years and led to a significant reduction of about 40%; the second phase was observed in subsequent years with a further reduction of up to 65% with respect to the original dimension of the population.

The repeatability and the reproducibility of the model and the results obtained from the retrospective examination of the case-control cohorts confirm that the shrinking of the pigeon colonies in Genoa for 8 consecutive years is likely a consequence of the nicarbazin treatment.

020406080

100120140

17/02/2005 02/07/2006 14/11/2007 28/03/2009 10/08/2010 23/12/2011

N. I

ndex

Station 1. Casaregis Street

Station 2. Tommaseo Square

Station 3. Cecchi Street

Station 4. Scio Square

020406080

100120140

17/02/2005 02/07/2006 14/11/2007 28/03/2009 10/08/2010 23/12/2011

N. I

ndex

020406080

100120140

17/02/2005 02/07/2006 14/11/2007 28/03/2009 10/08/2010 23/12/2011

N. I

ndex

50

100

150

200

250

300

350

17/02/2005 02/07/2006 14/11/2007 28/03/2009 10/08/2010 23/12/2011

N. I

ndex

Date

Date

Date

Date

Figure 10. Graphic representation of the standardised values to 100 (Index Number - I.N.) that shows a costant and strong I.N. reduction for all stations except for Scio Square (Station 4).

Table V. Synoptic table of the Index Numbers (I.N.) related to eight years of sperimentation for each station. Station 1, 2 and 3, reduce the I.N. heavily between second and fourth year.

YearStation 1.Casaregis

Street

Station 2.Tommaseo

Square

Station 3.Cecchi Street

Control station 4.

Scio Square

2005 107.8 199.4 148.9 155.0

2006 59.0 143.7 120.0 196.6

2007 65.5 146.5 123.2 258.8

2008 58.2 103.4 93.1 239.7

2009 23.9 53.6 64.0 216.6

2010 28.5 56.0 56.7 220.2

2011 25.9 62.0 40.9 259.6

2012 26.9 59.5 45.3 173.8

72



Baldaccini N.E. 1998. Il controllo dei colombi nelle città. In Atti del 1° Convegno Nazionale sulla Fauna Urbana (Bologna M.A., Carpaneto G.M. & Cignini B., eds). Fratelli Palombi Editori, Roma, 47-50.

Baldaccini N.E. 1999. Avifauna urbana: un problema?. In Atti del seminario di studi “I biologi e l’ambiente... Oltre il Duemila” (Baldaccini G.N. & Sansoni G. eds). Venezia, 23 Novembre. CISBA, Reggio Emilia, 209-216.

Baldaccini N.E. 1999. La sterilizzazione come metodo di controllo delle popolazioni urbane di colombo: una strada da perseguire? Igiene alimenti, disinfestazione & igiene ambientale, 16, 13-17.

Bursi E., Gelati A., Ferraresi M. & Zanetti G. 2001. Impiego della Nicarbazina nel controllo della riproduzione del colombo randagio di città. Annali della Facoltà di Medicina Veterinaria di Parma, 21, 97-115.

Ferraresi M., Gelati A., Ferri M. & Zannetti G. 1997. Effetti della nicarbazina sull’attività riproduttiva del colombo: nota preliminare su esperienze di campo. Atti 1° Convegno Nazionale della Fauna Urbana. Fratelli Palombi Editori, Roma, 189-192.

Haag-Wackernagel D. 1991. Population density as a regulator of mortality among eggs and nestlings of feral pigeons (Columba livia domestica) in Basel, Switzerland. In Nestling mortality of granivorous birds due to microorganisms and toxic substances (Pinowski J., Kavanagh B.P. & Gorski W., eds). PWN-Polish scientific publishers, Warsaw, 21-31.

Haag-Wackernagel D. 2000. Behavioural responses of the feral pigeon (Columbidae) to deterring systems. Folia Zoologica, 49, 101-114.

Hughes B.L., Jones J.E., Toler J.E., Solis J. & Castaldo D.J. 1991. Effects of exposing broiler breeders to Nicarbazin contaminated feed. Poult Sci, 70 (3), 476-482.

References

Hurwitz S., Bornstein S. & Lev Y. 1975. Some responses of laying hens to induced arrest of egg production. Poult Sci, 54 (2), 415-422.

Janiga M. & Kocian L. 1985. Some aspect of nidobiology of the pigeon (Colomba livia f. domestica) in Bratislava. Folia Zoologica, 34, 133-147.

Johnston R.F. & Janiga M. 1995. The Feral Pigeons. Oxford University Press, London, 336 pp.

Johnston R.F. & Johnson S.G. 1990. Reproductive ecology of feral pigeons. In Granivorous birds in the agricultural landscape (Pinowski J. & Summer Smith J.D., eds). Polish Scientific Publisher, Warszawa, 237-252.

Lever C. 1987. Naturalized Birds of the World. Longman Higher Education, New York, 644 pp.

Martelli P., Bonati L., Gelati A., Ferraresi M., Montella L., Corradi A. & Zannetti G. 1993. Il controllo farmacologico delle nascite nel colombo: contributo sperimentale. Annali della Facoltà di Medicina Veterinaria di Parma, 13, 249-257.

Nomisma. 2003. Valutazione dei costi economici e sociali dei colombi in ambiente urbano. Nomisma, Bologna, 165 pp. http://www.disinfestazione.org/files/AttiConvegni/04_Valutazione_costi_colombi_ambiente_urbano_Nomisma.pdf.

Sbragia G., Romagnoli S., Giunchi D. & Baldaccini N.E. 2001. Esplosione demografica del colombo di città: ruolo del veterinario nei piani di controllo delle popolazioni di uccelli sinantropi. Praxis veterinaria, 22 (4), 15-21.

Soldatini C., Mainardi D., Baldaccini N.E. & Giunchi D. 2006. A temporal analysis of the foraging flights of feral pigeons (Columba livia f. domestica) from three Italian cities. Italian Journal of Zoology, 73(1), 83-92.

73

Parole chiaveAborti infettivi,Coxiella burnetii,Febbre Q,LAMP.

RiassuntoCoxiella burnetii, agente eziologico della Febbre Q è una zoonosi ubiquitaria causata da un batterio Gram negativo, pleomorfo, appartenente alla suddivisione dei γ-Proteobacteria. Per l’elevata resistenza e il grado di infettività nei confronti dell’uomo viene annoverato come potenziale agente di bioterrorismo. Ad ampia diffusione ambientale, il microrganismo può infettare una grande varietà di ospiti tra cui diverse specie di mammiferi domestici e selvatici. I ruminanti infetti, specie se giovani, manifestano sintomatologia clinica a carico della sfera riproduttiva con aborti tardivi e natimortalità rappresentando un pericoloso serbatoio di Febbre Q anche per l’uomo. L’inalazione di polveri contaminate e la manipolazione di organi infetti, costituiscono la più comune via di contagio. Una diagnosi rapida nei principali serbatoi animali della malattia resta una pratica fondamentale anche per ridurre i casi di Febbre Q nell’uomo. Le tecniche di diagnosi molecolare hanno permesso, negli ultimi anni, lo sviluppo di metodiche alternative alla PCR convenzionale. Tra queste, l’Amplificazione isotermica mediata da loop (LAMP) permette di evidenziare rapidamente la presenza di numerosi microorganismi patogeni utilizzando apparecchiature poco costose. Il lavoro ha avuto l’obiettivo di descrivere un nuovo saggio LAMP, disegnato sul gene com1 presente in singola copia all’interno del genoma di C. burnetii, per la diagnosi di Febbre Q. La metodica ha permesso di rilevare la presenza del batterio in 10 campioni clinici appartenenti a diverse specie di ruminanti domestici. Il nuovo saggio LAMP rappresenta un’alternativa utile per la diagnosi di Febbre Q su invogli fetali, sia in alternativa che in associazione ai metodi convenzionali, e in tutti i casi in cui si richieda una diagnosi rapida della malattia.

Sviluppo di un saggio alternativo di Amplificazione isotermica mediatada loop (LAMP) per la diagnosi di Coxiella burnetii

KeywordsContagious abortions,Coxiella burnetii,LAMP,Q fever.

SummaryQ fever, caused by Coxiella burnetii, is a worldwide zoonosis with important consequences for human and animal health. In livestock, the diagnosis, using direct and indirect techniques, is challenging even if to tackle coxiellosis in domesticated animals a rapid diagnosis is crucial. In the recent years, new molecular methods have been developed to overcome these issues. Several polymerase chain reaction (PCR) assays have been studied, but loop mediated isothermal amplification (LAMP) has not been fully developed. This new methodology is emerging due to simplicity and speed in diagnosis of microbial diseases. In this study, we design a new LAMP assay against C. burnetii targeting the com1 gene as an actual alternative to conventional PCR. The assay was specific to C. burnetii reactive with sensitivity comparable to standard PCR. The application of the com1 LAMP on 10 clinical samples from water buffalo, sheep, and goats, previously tested positive, confirmed the presence of C. burnetii. To our knowledge, this study is the first report of LAMP targeting C. burnetii in Europe and the results also suggest that it may be an useful and cost-effective tool for the clinical and epidemiological surveillance of Q Fever.


1 Istituto Zooprofilattico Sperimentale della Puglia e della Basilicata, via Manfredonia 20, 71121 Foggia, Italy. 2 Istituto Zooprofilattico Sperimentale dell’Abruzzo e del Molise ‘G. Caporale’, Campo Boario, 64100 Teramo, Italy.

* Corresponding author at: Istituto Zooprofilattico Sperimentale della Puglia e della Basilicata, via Manfredonia 20, 71121 Foggia, Italy.Tel.: +39 +39 0881786326, e-mail: [email protected].

Donato Antonio Raele1*, Giuliano Garofolo2, Domenico Galante1 & Maria Assunta Cafiero1

Molecular detection of Coxiella burnetiiusing an alternative loop-mediated isothermal

amplification assay (LAMP)

SHORT COMMUNICATION


LAMP assay for detecting Coxiella burnetii Raele et al.

The strand-displacing Bst polymerase creates amplification products that are stem-loop DNA structures with inverted repeats of the target and cauliflower-like structures with multiple loops (Notomi et al. 2000). The LAMP technique is an alternative diagnostic tool to conventional PCR that is now routinely used for the detection of many human and animal infectious agents.

The aim of this study was to prove the effectiveness of this methodology in the diagnosis of coxiellosis by testing abortion materials from domestic ruminants. In addition, we also compared the LAMP technique with traditional PCR designed on the same gene target.


Analysis of tissue samplesTen specimens previously found positive for C. burnetii using conventional PCR according to Berri and colleagues (Berri et al. 2009), were tested to evaluate the diagnostic efficiency of LAMP for detecting the bacteria. The material consisted of abortive products from domestic ruminants (7 from goats, 2 from sheep, and 1 from water buffalo) located in 10 animal farms between Apulia and Basilicata Regions. Samples were collected between March 1995 and September 2010 and stored at -80°C. DNA was extracted following the protocol of the DNeasy Blood and Tissue Kit (QIAGEN, Hilden, Germany).

LAMP assayTo develop the LAMP assay, 4 novel primers, FIP, BIP, F3, and B3 (Table I) were designed using Primer Explorer Software1.

The primers were based on the com1 gene, which is present as 1 copy only in all known C. burnetii genomes (Zhang et al. 1997) and encodes a 27-kDa outer membrane protein of C. burnetii (Genbank accession no. AB004712.1). This protein is the first outer membrane-associated immune reactive protein found in both acute and chronic Q fever disease (Hendrix et al. 1993). The LAMP reaction mixture (final volume, 25 µL) contained the following: 10 µL of isothermal amplification buffer 1X (20 mM Tris-HCl, 10 mM [NH4]2SO4, 50 mM KCl, 2 mM MgSO4, 0.1% Tween 20, pH 8.8), 5.2 µL nuclease free water, 2.5 µL of dNTPs (1.5 mM), 1.6 µM each of the FIP and BIP primers, 0.3 µM each of the F3 and B3 primers, 2.5 µL of extracted DNA, and 1 µL (8 U) of Bst 2.0 Warm Start DNA Polymerase (New England

IntroductionThe proteobacterium Coxiella burnetii, a Gram-negative, pleomorphic, obligate intracellular pathogen, is the causative agent of both Q fever in humans and coxiellosis in animals. Coxiella burnetii is also a cause of abortion and stillbirth in goats, sheep, cattle, dogs, and cats, although the infection is usually asymptomatic in non-pregnant animals.

Small domestic ruminants are the primary animal reservoirs of the infection, and they shed these bacteria in milk, urine, and feces (Angelakis and Raoult 2010). Infected amniotic fluid and placental materials also are the usual vehicles of C. burnetii infection, with more than 109 bacteria/g of placental tissue at the time of delivery (Maurin and Raoult 1999) that can be released into the environment, and transmitted by inhalation of aerosols. Transmission is also possible through ingestion of contaminated food (Angelakis and Raoult 2010).

Coxiella burnetii can survive in the environment for long periods of time because of the strong resistance of the organism to physical and chemical agents (Maurin and Raoult 1999). Furthermore, C. burnetii is listed as a bioterrorism agent by the Centers for Disease Control, because it has a low infectious dose, and infections occur primarily through inhalation of contaminated soil, dust, or animal waste (Dorko et al. 2004).

Q fever in humans is a self-limited febrile illness, with the most frequent clinical manifestations being headache, myalgia, arthralgia, and cough (Raoult 2012). However, severe clinical complications have been reported (Fenollar et al. 2004). Outbreaks occur most frequently in areas that have a warm and windy climate (Dorko et al. 2004). In several regions of Italy, serological and molecular investigations have confirmed the presence of C. burnetii in various samples from water buffaloes (Bubalus bubalis) and in the milk of domestic animals, including cattle, sheep, goats, and dogs (Capuano et al. 2004, Monno et al. 2009, Parisi et al. 2006, Perugini et al. 2009, Vicari et al. 2013). A Q fever outbreak in US soldiers on duty in Grottaglie (Apulia Region) occurred in 1945 (Feinstein et al. 1946). Interestingly enough, the exact prevalence of C. burnetii in livestock from the Apulia Region remains unknown, probably because many cases of Q fever go unrecorded or are subclinical.

Loop-mediated isothermal amplification (LAMP) is an increasingly used molecular diagnostic technique that has shown high sensitivity and specificity for the diagnosis of Q fever (Pan et al. 2013). LAMP was introduced in 2000 by Notomi and colleagues (Notomi et al. 2000); it employs a unique constant temperature, a DNA polymerase, and 4 or 6 different primers, which increase the specificity of the assay. 1 Lamp Primer designing Software. PrimerExplorer. http://primerexplorer.jp/e/.


Raele et al. LAMP assay for detecting Coxiella burnetii

performed using the heating block T100 Thermal Cycler (Bio-Rad, Hercules, CA, USA). Three DNAs, extracted from uninfected human, sheep, and bovine blood samples respectively, were randomly used as negative controls.

Determination of specificity of the LAMP assayThe specificity of the C. burnetii LAMP assay was evaluated by testing 33 bacterial DNAs (Table II): 10 DNA samples from the family Rickettsiaceae and phylogenetic related pathogens, 8 DNA samples from potential bacterial agents of bioterrorism, and 15 other DNA of common pathogens. The NanoDrop spectrophotometer (Thermo Scientific, Wilmington, DE, USA) was used to determine the DNA concentrations of all the samples. DNA concentrations ranged from 88 to 120 ng/μL. The DNA of every sample was diluted using nuclease-free water (QIAGEN, Hilden, Germany) to achieve a final concentration of 80 ng/μL before testing.

Determination of sensitivity of the LAMP assayTo test analytic sensitivity, 10-fold serial dilutions of C. burnetii DNA (Nine Mile strain) from 100 ng to 100 fg were subjected to LAMP.

The LAMP products were analyzed directly using UV illumination after the addition of propidium iodide to each tube (1:10 dilution of 10 mg/mL stock solution) (Hill et al. 2008).

PCR assayA novel PCR assay based on the same gene target of the LAMP was performed. The aim of this new PCR was to compare the sensitivity between the 2 molecular methods designed on the sequence of the com1 gene. The PCR assay employed the LAMP ‘outer’ primers F3 and B3 and amplified a 208-bp fragment of the C. burnetii com1 gene (Raele, unpublished data). This PCR assay was carried out in a 25 µL reaction mixture containing the following: 12.5 µL RED Taq Ready Mix 1x (Sigma-Aldrich, St. Louis, MO, USA), 9.5 µL nuclease free water, 0.5 µM each of F3 and B3 primers, and 2.5 µL of extracted DNA. The reaction mixture was first subjected to 94°C for 7 minutes and then 35 cycles with the following conditions: denaturation (94°C for 30 seconds), annealing (60°C for 30 seconds), and extension (72°C for 30 seconds). A final extension at 72°C for 5 minutes was performed. All products were electrophoresed on a 2% agarose gel, which was stained using a SYBR Safe DNA solution (Invitrogen, Carlsbad, CA, USA).

Biolabs Inc., Ipswich, MA, USA). The reaction mixture was incubated in a heating block at 65°C for 45 minutes and, subsequently, at 80°C for 5 minutes to terminate the reaction. The LAMP reaction was

Table I. LAMP primer set.

Primer type Positions Sequence 5’-3’

FIP 715-738/670-688 TCCTTGTTTAGCGGCTGCTAATGA-GAACTGCCCATTTTTGGCG

BIP 744-765/795-814 TTATGCTTTCCACGACGCGCTG-CTGCGGTTTGAAGGGTGATT

F3 649-666 AACCTCCGCGTTGTCTTC

B3 835-856 CCATGTCTTTTTTGAGCTGAGCGene target C. burnetii com1 gene codifying for 27-kDa outer membrane protein (AB004712.1).

Table II. Samples tested by com1 LAMP.

A

Sample id Type of sample Animal species Com1

LAMP5467 Placenta Goat (Capra hircus) Positive

5644 Placenta Water buffalo(Bubalus bubalis) Positive

3759 Placenta Sheep (Ovis aries) Positive 833 Placenta Goat (Capra hircus) Positive 440 Placenta Goat (Capra hircus) Positive

1892 Placenta Sheep (Ovis aries) Positive 1898 Placenta Goat (Capra hircus) Positive 830 Placenta Goat (Capra hircus) Positive

X023 Placenta Goat (Capra hircus) Positive X024 Placenta Goat (Capra hircus) Positive CHB1 Blood Human (Homo sapiens) Negative COB2 Blood Sheep (Ovis aries) Negative CCB1 Blood Goat (Capra hircus) Negative

B

Classification Name of pathogen Com1 LAMP

Members of the order Rickettsiales

Rickettsia helvetica, Rickettsia aeschlimannii, Rickettsia conorii, Rickettsia

felis, Rickettsia monacensis, Rickettsia prowazekii, Rickettsia siberica, Rickettsia

slovaca, Rickettsia typhi, Orientia tsutsugamushi

Negative

Potential bioterrorism

agents

Brucella abortus, Brucella canis, Brucella melitensis, Bacillus anthracis, Yersinia

pestis, Burkholderia mallei, Burkholderia pseudomallei, Francisella tularensis

Negative

Other common pathogenic

microorganisms

Bartonella henselae, Bartonella quintana, Brucella neotomae, Brucella ovis, Yersinia

pseudotuberculosis, Staphylococcus aureus, Streptococcus equi, Escherichia coli VTEC, Chlamydophila abortus, Chlamydophila

psittaci, Salmonella spp., Anaplasma phagocytophilum, Borrelia burgdorferi,

Ehrlichia chaffeensis, Babesia ovis

Negative

A = Clinical samples;B = Laboratory strains for determining the specificity of LAMP assay.



the negative controls were negative (Table II); UV illumination of the reaction tubes containing the positive controls produced brilliant fluorescence, whereas the tubes containing the negative controls did not show any fluorescent signal (Figure 1). Both our LAMP assay and our PCR assay detected C. burnetii DNA to the same limit of detection equal

Results The LAMP assay correctly identified all the clinical specimens containing C. burnetii (Table II) and its products showed a characteristic ladder pattern on a 2% agarose gel (Figure 1). LAMP assays of genomic DNA from the microorganisms and from

Figure 1. Presence of representative DNA products: LAMP amplicons detected on a 2% agarose gel (upper panel) and after addition of 1 µl of 1:10-diluted propidium iodide to the mixture (lower panel). Lane M, DL 2000 bp ladder marker; lane/tube 1: positive goat placenta; lane/tube 2: negative sheep blood; lane/tube 3: Rickettsia helvetica; lane/tube 4: Chlamydophila abortus; lane/tube 5: positive buffalo cotyledons; lane/tube 6: C. burnetii positive control (Nine Mile strain); lane/tube 7: negative sample (nuclease free water). Positive samples (1, 5, 6) showed a characteristic ladder pattern (upper panel) or a brilliant fluorescence (lower panel), while negative samples showed no fluorescence.

M 1

1

2

2

3

3

4

4

5

5

6

6

7

7

2000 bp1500 bp1000 bp

800 bp

700 bp600 bp500 bp300 bp200 bp100 bp

Figure 2. Comparison of the detection limit of our PCR targeting com1 gene (on left side) and LAMP (on right side): Lanes M, DL 2000 bp ladder marker, lanes 1: 100ng, lanes 2: 10ng, lanes 3: 1ng, lanes 4: 100pg, lanes 5: 10pg, lanes 6: 1pg and lanes 7: 100fg indicate DNA concentration/ml.

M 1 2 3 4 5 6 7

2000 bp1500 bp1000 bp

800 bp700 bp600 bp500 bp300 bp200 bp100 bp

M 1 2 3 4 5 6 7


Raele et al. LAMP assay for detecting Coxiella burnetii

assay was both sensitive and specific. We did not detect any cross-amplifications in the negative tissue controls. Similarly, cross-amplifications were not detected in the large bacteria collection analysed for the most prevalent abortion agents such us Brucella melitensis, B. abortus, Chlamydophila abortus and Salmonella. The differential diagnosis of contagious abortions is essential in Italy, where for example, brucellosis still remains prevalent and responsible of superimposable clinical outcomes (Garofolo et al. 2013).

The insertion element IS1111 is the most commonly used target sequence for the molecular detection of C. burnetii likely due to its high copy number enhancing detection. However, other different targets have been used such as icd, com1, and sod (de Bruin et al. 2011, Klee et al. 2006). The LAMP assay was developed with com1, because this gene is considered highly conserved in C. burnetii; and being it present in a single copy, it permits a more accurate quantification of the pathogen load in the samples. The use of com1 gene instead of the IS1111 should be considered as a reliable alternative and further examinations of performance parameters such as efficiency, reproducibility, and repeatability warrant additional study.

In conclusion, com1 LAMP assay is another rapid, specific, economic, and simple method for the identification of C. burnetii DNA. It has the sensitivity comparable to a standard PCR assay. Practicing veterinarians may use this technology in the field to investigate any suspicious abortion to better address the management of coxiellosis.

AcknowledgementsWe thank Professor Raoult and Dr Socolovshi (WHO Collaborating Centre for Rickettsial Reference and Research - Marseille, France) as well as Dr Fasanella (Anthrax Reference Institute of Italy), for providing DNA controls.

to 10 pg DNA/µL (Figure 2), although the LAMP gel pattern was stronger than the PCR pattern.

DiscussionThe epidemiological situation of Q fever differs considerably across Europe, and to date it is poorly known in Italy. The disease often spreads unsuspected areas, as it was the case in the Netherlands in the 2007 (Roest et al. 2011). Domestic ruminants are considered the main reservoir of human Q fever, thus diagnosis is crucial in the animals to hopefully prevent human outbreaks. Q fever is usually diagnosed by serological testing, which is not suitable for early diagnosis, because of the delay in appearance of diagnostic antibodies (Wegdam-Blans et al. 2012). In this study, we developed a molecular assay able to rapidly detect C. burnetii DNA directly from clinical samples of abortive material without attempting any microbiological isolation, which requires a well-equipped biosafety level 3 laboratory. In contrast, LAMP can be performed in a conventional diagnostic laboratory and even in the field using portable instruments. This test does not require any specific or expensive equipment. It only requires a heating block, which is readily available in most research and diagnostic laboratories. Furthermore, products are easily visualized using UV light and even by naked eye with either turbidity or colour changes. These features enable testing in a large variety of laboratories and make LAMP a promising platform for the molecular detection of important zoonotic infections in developing countries.

Based on levels of 109 C. burnetii/g in abortion products reported by Maurin and Raoult (1999), the limit of detection of 10 pg revealed by com1 LAMP is appropriate for such testing. The total time required for the LAMP assay, which included amplification and detection, was about 60 minutes, whereas conventional PCR required 3 hours.

Although relatively few clinical samples were tested, these preliminary data suggest that the com1 LAMP



Angelakis E. & Raoult D. 2010. Q Fever. Vet Microbiol, 140, 297-309.

Berri M., Rekiki A., Boumedine K.S. & Rodolakis A. 2009. Simultaneous differential detection of Chlamydophila abortus, Chlamydophila pecorum and Coxiella burnetii from aborted ruminant's clinical samples using multiplex PCR. BMC Microbiol, 9, 130.

Capuano F., Parisi A., Cafiero M.A., Pitaro L. & Fenizia D. 2004. Coxiella burnetii: what is the reality? Parassitologia, 46, 131-134.

Dorko E., Rimárová K. & Pilipčinec E. 2012. Influence of the environment and occupational exposure on the occurrence of Q fever. Cent Eur J Public Health, 20, 208-214.

de Bruin A., de Groot A., de Heer L., Bok J., Wielinga P.R., Hamans M., van Rotterdam B.J. & Janse I. 2011. Detection of Coxiella burnetii in complex matrices by using multiplex quantitative PCR during a major Q Fever outbreak in the Netherlands. Appl Environ Microbiol, 77, 6516-6523.

Feinstein M., Yesner R. & Marks J.L. 1946. Epidemics of Q fever among troops returning from Italy in the spring of 1945. Am J Hyg, 44, 72-121.

Fenollar F., Fournier P.E. & Raoult D. 2004. Molecular detection of Coxiella burnetii in the sera of patients with Q fever endocarditis or vascular infection. J Clin Microbiol, 42, 4919-4924.

Garofolo G., Di Giannatale E., De Massis F., Zilli K., Ancora M., Cammà C., Calistri P. & Foster J.T. 2013. Investigating genetic diversity of Brucella abortus and Brucella melitensis in Italy with MLVA-16. Infect Genet Evol, 19, 59-70.

Hendrix L.R., Mallavia L.P. & Samuel J.E. 1993. Cloning and sequencing of Coxiella burnetii outer membrane protein gene com1. Infect Immun, 61, 470-477.

Hill J., Beriwal S., Chandra I., Vinod K.P., Aarti K., Tripti S., Wadowsky R.M., Singh V., Goyal A., Jahnukainen T., Johnson J.R., Tarrand P.I. & Vats A. 2008. Loop-mediated isothermal amplification assay for rapid detection of common strains of Escherichia coli. J Clin Microbiol, 46, 2800-2804.

Klee S.R., Tyczka J., Ellerbrok H., Franz T., Linke S., Baljer G. & Appel B. 2006. Highly sensitive real-time PCR for specific detection and quantification of Coxiella burnetii. BMC Microbiol, 6, 2. doi: 10.1186/1471-2180-6-2. http://www.ncbi.nlm.nih.gov/pmc/articles/PMC1360083/pdf/1471-2180-6-2.pdf.

References

Maurin M. & Raoult D. 1999. Q Fever. Clin Microbiol Rev, 12, 518-553.

Monno R., Fumarola L., Trerotoli P., Cavone D., Giannelli G., Rizzo C., Ciceroni L. & Musti M. 2009. Seroprevalence of Q fever, brucellosis and leptospirosis in farmers and agricultural workers in Bari, Southern Italy. Ann Agric Environ Med, 16, 205-209.

Notomi T., Okayama H., Masubuchi H., Yonekawa T. & Watanabe K. 2000. Loop-mediated isothermal amplification of DNA. Nucleic Acids Res, 28 (12) e63.

Pan L., Lijuan Z., Desheng F., Xiuchun Z., Hong L., Qunying L. & Qiyi X. 2013. Rapid, simple and sensitive detection of Q Fever by loop-mediated isothermal amplification of the htpAB gene. PLoS Negl Trop Dis, 7 (5), e2231.

Parisi A., Fraccalvieri R., Cafiero M.A., Miccolupo A., Padalino I., Montagna C., Capuano F. & Sottili R. 2006. Diagnosis of Coxiella burnetii-related abortion in Italian domestic ruminants using single-tube nested PCR. Vet Microbiol, 118, 101-106.

Perugini A.G., Capuano F., Esposito A., Marianelli C., Martucciello A., Iovane G. & Galiero G. 2009. Detection of Coxiella burnetii in buffaloes aborted fetuses by IS111 DNA amplification: a preliminary report. Res Vet Sci, 87, 189-191.

Raoult D. 2012. Chronic Q fever: expert opinion versus literature analysis and consensus. J Infect, 65, 102-108.

Roest H.I.J., Tilburg J.J.H.C., Van der Hoek W., Vellema P., Van Zijderveld F.G., Klaassen C.H.W. & Raoult D. 2011. The Q fever epidemic in The Netherlands: history, onset, response and reflection. Epidemiol infect, 139, 1-12.

Vicari N., Faccini S., Ricchi M., Garbarino C., Decastelli L., Boldini M., Rosignoli C., Dalmasso A., Bronzo V. & Fabbi M. 2013. Occurrence of Coxiella burnetii in bulk tank milk from north western Italy. Vet Rec, 172 (26), 687. doi: 10.1136/vr.101423.

Wegdam-Blans M.C.A., Wielders C.C.H., Meekelenkamp J., Korbeeck J.M., Herremans T., Tjhie H.T., Bijlmer H.A., Koopmans M.P.G. & Schneebergerb P.M. 2012. Evaluation of commonly used serological tests for detection of Coxiella burnetii antibodies in well-defined acute and follow-up Sera. Clin Vaccine Immunol, 19, 1110-1115.

Zhang G.Q., To H., Yamaguchi T., Fukushi H. & Katsuya H. 1997. Differentiation of Coxiella burnetii by sequence analysis of the gene (com1) encoding a 27-kDa outer membrane protein. Microbiol Immunol, 41, 871-877.

79

LIBRI/Book reviewsa cura di Manuel Graziani

Pubblicato originariamente nel 1983, Alla ricerca delle migliori varietà di api completa la trilogia delle opere maggiori di Karl Kehle, più noto come Padre Adam: un monaco benedettino tedesco che per più di 60 anni è stato responsabile dell’apicoltura all’Abbazia di Buckfast, nel Devon (In-ghilterra), dove morì nel 1996 alla veneranda età di 98 anni. Con un intenso lavoro di selezione della specie nel 1917 Padre Adam creò l’ibrido ape di Buckfast, grazie alla quale riuscì a vincere l’epidemia di acariosi che dal 1916 aveva provocato grandi morie in tutta l’Inghilterra, portando alla scomparsa pressoché totale dell’ape nera britannica. Ancora oggi l’ape di Buckfast è diffusa e impiegata in tutto il mondo per le sue eccellenti caratteristiche di docilità e operosità.

Il volume, ben curato a livello grafico-editoriale da Luca Vitali delle Edizioni Montaonda, è il diario del viaggio appassionato del monaco seguendo la direttrice di un ambizioso progetto mai affron-tato prima da scienziati o istituzioni, effettuato con il fine di realizzare una mappatura delle razze e delle varietà di api nei loro luoghi di provenienza. Anno dopo anno, dal 1950 al 1972, ripercorria-mo tra le pagine del libro un viaggio affascinante in una geografia perduta con paesaggi e stili di vita dall’aspetto arcaico prima dei grandi cambiamenti che li hanno trasformati nel tempo: il Nilo pre-diga di Assuan, il Libano e la Jugoslavia prima delle guerre, l’Antalya e Creta senza il turismo di massa. Un Mediterraneo privo di comodità, senza autostrade, frontiere armate e campi profughi, popolato soltanto di fiori, piante mellifere, api e apicoltori sorridenti.

Nei suoi viaggi Padre Adam individuò e scelse di persona le regine dei ceppi più puri di ogni razza, introducendole quindi negli apiari dell’Abbazia di Buckfast e studiandole poi per decenni, alle-vandole in purezza e in incroci, come documentano i suoi famosi test comparativi. Padre Adam racconta le fioriture di valli alpine e deserti africani, foreste e montagne, sempre pensando alle api e alla loro vita in habitat diversi. Tutto questo senza perdere di vista lo scopo e l’obiettivo pratico, ovvero la ricerca della “migliore varietà di api”. Oltre all’accurata descrizione delle api, emergono scenari di Paesi diversissimi, come diverso è il momento storico che stanno vivendo. Gli incontri con api, apicoltori e istituzioni ci trascinano in tempi scomparsi, anche quando si tratta dell’Italia. Documentati dalle fotografie del tempo, i resoconti di questo bel libro costituiscono un’opera di grande valore storico per la geografia apistica.

(Edizioni Montaonda, pp. 234, € 18,00)www.edizionimontaonda.it

Padre Adam

Alla ricerca delle migliori varietà di api

80

a cura di Manuel GrazianiLIBRI/Book reviews

Un libro ricco di foto, nell’elegante formato quadrato 19x19 cm, scritto da tre medici veterinari che hanno unito le loro esperienze e i diversi cammini professionali grazie a un obiettivo comune: lasciare ai loro figli la speranza di un mondo che sappia con-vivere con la natura e gli animali. Una visione “ecologica” della pratica dell’allevamento animale entro lo scenario più ampio e complesso dei rapporti tra agricoltura, ambiente e società umana, in un quadro sinergico di convivenza.

La tesi, o meglio il j’accuse, di fondo è che agricoltura e allevamento negli ultimi decenni hanno subi-to drastici interventi secondo il modello produttivo industriale che ha strappato l’uomo e l’animale dalla relazione con l’ambiente naturale. Interventi che hanno sottoposto gli animali a mutamenti che in alcuni casi hanno causato danni irreversibili, costringendoli a vivere in condizioni artificiali e dolorose. Le monocolture e gli allevamenti intensivi sono concepiti per produrre tanto e subito, ma i costi a livello ambientale, economico, di salute pubblica e di tossicità li paga tutta la comunità umana.

Il libro parla degli animali da allevamento e della loro cura in un modo inedito: parte dalla cono-scenza dell’etologia di specie, della relazione uomo/animale e degli ambienti rurali per costruire, tramite una chiave ecologica ed etica, un modello di allevamento non basato sullo sfruttamento ma sul rispetto. Il recupero dei metodi di allevamento tradizionale, insieme alle innovazioni legate alla gestione agroecologica, porta a disegnare un modello a basso consumo energetico, a basso impatto ambientale e ad alti contenuti di benessere animale e umano, insieme alla valorizzazione del territorio e del paesaggio.

Nella “parte generale” le tematiche affrontate sono quelle del benessere animale, agroecologia e allevamento, le relazioni tra allevamento e ambiente, salute e medicina preventiva, per finire con l’omeopatia veterinaria. Nella “parte speciale” viene approfondito il discorso sull’allevamento delle diverse specie animali (suini, bovini, ovini e caprini) e sul pascolo dei ruminanti.

Con-vivere, l’allevamento del futuro prende una posizione netta su certi temi, che si può sintetizzare con le parole spese dal prof. Fabio Caporali in prefazione: “Per mitigare gli effetti deleteri dell’inqui-namento e del consumo delle risorse naturali del pianeta, occorre reimpostare le attività umane nella direzione della sostenibilità, secondo i principi di ecosviluppo propri del paradigma ecologico che prescrivono l’uso integrale della radiazione solare, il riciclo della materia e la valorizzazione della biodiversità.”

(Arianna Editrice, pp. 248, € 14,50)www.ariannaeditrice.it

Carla De Benedictis, Francesca Pisseri,Pietro Venezia

Con-vivere,l’allevamento del futuro

Veterinaria Italiana, Volume 51 (1), January-March 2015

Documents

Transcript of Veterinaria Italiana, Volume 51 (1), January-March 2015