V Nikoletopoulou et al. Nature 467 , 59-63 (2010) doi:10.1038/nature09336

1
V Nikoletopoulou et al. Nature 467, 59-63 (2010) doi:10.1038/nature09336 Trk-induced death without kinase activity.

description

Trk-induced death without kinase activity. V Nikoletopoulou et al. Nature 467 , 59-63 (2010) doi:10.1038/nature09336. - PowerPoint PPT Presentation

Transcript of V Nikoletopoulou et al. Nature 467 , 59-63 (2010) doi:10.1038/nature09336

Page 1: V Nikoletopoulou et al. Nature 467 , 59-63 (2010) doi:10.1038/nature09336

V Nikoletopoulou et al. Nature 467, 59-63 (2010) doi:10.1038/nature09336

Trk-induced death without kinase activity.

Nature Structural & Molecular Biology: doi:10.1038/nsmb Structural & Molecular Biology: doi:10.1038/nsmb.3120. reduction in the pocket volume, we combine the volumes from the closed

Nature Structural & Molecular Biology: doi:10.1038/nsmb Structural & Molecular Biology: doi:10.1038/nsmb.3120. reduction in the pocket volume, we combine the volumes from the closed

doi:10.1038/nature05150 LETTERS

doi:10.1038/nature05150 LETTERS

Nature Genetics: doi:10.1038/ng...Nature Genetics: doi:10.1038/ng.3245 Supplementary Figure 6 Effect of shared controls on conditional posterior probability of association with disease

Nature Genetics: doi:10.1038/ng...Nature Genetics: doi:10.1038/ng.3245 Supplementary Figure 6 Effect of shared controls on conditional posterior probability of association with disease

DOI: 10.1038/NMAT4299 Supplementary file for P … · SUPPLEMENTARY INFORMATION. DOI: 10.1038/NMAT4299. NATURE MATERIALS | . 1 1 Supplementary file for Photo-oxidation and quantum

DOI: 10.1038/NMAT4299 Supplementary file for P … · SUPPLEMENTARY INFORMATION. DOI: 10.1038/NMAT4299. NATURE MATERIALS | . 1 1 Supplementary file for Photo-oxidation and quantum

Nature Neuroscience: doi:10.1038/nnNtrk2 TTTTTTTAGTTTTTTTTGTTAGTTAATAAA CACATCTCAATAATCAACCACATC BS Nature Neuroscience: doi:10.1038/nn.3976 Author Andrew Gordon Created Date 2/25/2015

Nature Neuroscience: doi:10.1038/nnNtrk2 TTTTTTTAGTTTTTTTTGTTAGTTAATAAA CACATCTCAATAATCAACCACATC BS Nature Neuroscience: doi:10.1038/nn.3976 Author Andrew Gordon Created Date 2/25/2015

Vol 437 15 September 2005 doi:10.1038/nature03943 LETTERS

Vol 437 15 September 2005 doi:10.1038/nature03943 LETTERS

Nature Biotechnology: doi:10.1038/nbtmanalis-lab.mit.edu/publications/stevens_SI.pdf · Nature Biotechnology: doi:10.1038/nbt.3697. Supplementary Figure 8 MAR or mass can be used

Nature Biotechnology: doi:10.1038/nbtmanalis-lab.mit.edu/publications/stevens_SI.pdf · Nature Biotechnology: doi:10.1038/nbt.3697. Supplementary Figure 8 MAR or mass can be used

Neuropsychopharmacology (2014) 39 , 1603-1613; doi:10.1038/npp.2014.7

Neuropsychopharmacology (2014) 39 , 1603-1613; doi:10.1038/npp.2014.7

DOI: 10.1038/NCHEM - Nature · NATURE CHEMISTRY | 3 DOI: 10.1038/NCHEM.1870 SUPPLEMENTARY INFORMATION S3 1. Syntheses (i) General methods and instrumentation

DOI: 10.1038/NCHEM - Nature · NATURE CHEMISTRY | 3 DOI: 10.1038/NCHEM.1870 SUPPLEMENTARY INFORMATION S3 1. Syntheses (i) General methods and instrumentation

doi: 10.1038/nature09205 SupplementaryInformationfor ...projects.iq.harvard.edu/files/ped/files/nature09205-s1.pdf 2 doi: 10.1038/nature09205 SUPPLEMENTARY INFORMATION 10Asexualreproduction

doi: 10.1038/nature09205 SupplementaryInformationfor ...projects.iq.harvard.edu/files/ped/files/nature09205-s1.pdf 2 doi: 10.1038/nature09205 SUPPLEMENTARY INFORMATION 10Asexualreproduction

Neuropsychopharmacology (2013) 38 , 2150-2159; doi:10.1038/npp.2013.112

Neuropsychopharmacology (2013) 38 , 2150-2159; doi:10.1038/npp.2013.112

GI Motility online (May 2006) | doi:10.1038/gimo31

GI Motility online (May 2006) | doi:10.1038/gimo31

1 November 2007 doi:10.1038/nature06221 LETTERS

1 November 2007 doi:10.1038/nature06221 LETTERS

Calcium modulates force sensing by the von ... - aj-lab.gitlab.io · ARTICLE nATuRE CommunICATIons | DoI: 10.1038/ncomms1385 nATuRE CommunICATIons | 2:385 | DoI: 10.1038/ncomms1385

Calcium modulates force sensing by the von ... - aj-lab.gitlab.io · ARTICLE nATuRE CommunICATIons | DoI: 10.1038/ncomms1385 nATuRE CommunICATIons | 2:385 | DoI: 10.1038/ncomms1385

Nature Photonics 8, 695-700 doi: 10.1038/ (2014). The ...

Nature Photonics 8, 695-700 doi: 10.1038/ (2014). The ...

Neuropsychopharmacology (2011) 36, 2406-2421; doi:10.1038/npp.2011.128

Neuropsychopharmacology (2011) 36, 2406-2421; doi:10.1038/npp.2011.128

DOI: 10.1038/NMAT4801 Metal-Oxide-Semiconductor ...

DOI: 10.1038/NMAT4801 Metal-Oxide-Semiconductor ...

Nature Genetics: doi:10.1038/ng · 2014-10-29 · Nature Genetics: doi:10.1038/ng.3105 Supplementary Figure 3 Manhattan plot showing the statistical significance of the association

Nature Genetics: doi:10.1038/ng · 2014-10-29 · Nature Genetics: doi:10.1038/ng.3105 Supplementary Figure 3 Manhattan plot showing the statistical significance of the association

DOI: 10.1038/NGEO2405 Moist convection in hydrogen ...

DOI: 10.1038/NGEO2405 Moist convection in hydrogen ...

Guo et al ., Nature Materials, DOI:10.1038/ nmat3234 (2012)

Guo et al ., Nature Materials, DOI:10.1038/ nmat3234 (2012)