Using molecular markers to distinguish between vegetative and generative long-distance dispersal in river plants 1 Tomas Fer & 2 Martin Pfosser 1 Department of Botany, Charles University, Benatska 2, CZ , Prague, Czech Republic 2 Institute of Botany, Department of Systematics and Evolution of Higher Plants, Rennweg 14, A-1030, Vienna, Austria Rivers in landscape corridors linear structure explicitly defined migration ways one-directional dispersal stream flow safe-sites easily accessible riverbanks disturbance of riverbanks Sparganium erectum in the Cidlina and Mrlina river system (Czech Republic) Sparganium erectum build dense populations along riverbanks Sparganium erectum generative dispersal - long-floating fruits vegetative dispersal pieces of rhizomes ? whole plants ? thin-walled cells sclerenchymatous endokarp seed exocarp Aims and questions 1.How far is the pattern of (genetic) variability spatially influenced by topology of river systems? 2.Is it possible to distinguish between generative and vegetative dispersal? 3.What is the clonal structure of large populations like? Occurrence and sampling sites of Sparganium erectum 50 populations 216 individuals 1-6 indiv./popul. 3 transects (9-13m) Approaches used to find variability AFLP of total DNA dominant marker, high variability presence x absence of bands sequence of trnL-F spacer cpDNA maternall (seed) inheritance non-recombinant AFLP data 3 primer combinations 85 polymorphic sites 0-1 matrix genetic similarity (Nei) PCoA to find differences 5 groups genetically related individuals possible seed dispersal 5 groups of genotypes based on AFLP markers blue, orange - shared by both basins red, brown, green in the Cidlina only Identified clonal propagation 5 genotypes found in more than 1 population putative direction of dispersal shown assuming downstream dispersal blue across-landscape transfer cpDNA haplotypes chloroplast DNA transmitted through the seeds only sequencing of trnL-F spacer only 3 distinct haplotypes found ++++ ATATATATA--GGCAAGGAATCTCTATTATTAAATCATTTAGAATCCATA ++++ ATATATATATAGGCAAGGAATCTCTATTATTAAATCATTTAGAATCCATA ++++ ATATATATATAGGCAAGGAATCTCTATTATTAAATCATTTAGAATCCCTA cpDNA haplotypes green specific for the Cidlina red common in both basins blue rare in the Mrlina basin cpDNA haplotypes cpDNA haplotype redbluegreen AFLP group green11213 red017 brown900 blue1400 orange2260 AFLP types Clonal structure of large stands 3 transects throughout large populations along the river sampled each meter AFLP analysis S-S-S-S-S-S-S-S-S-S S-S-S-S-S-S-S-S-S-S-S ? S-S-S-S-S-S-S-S-S-S-S-S-S Conclusions large stands contain more than one clone (clones can overgrowth each other) vegetative as well as generative long-distance dispersal possible generative reproduction and seed dispersal plays an important role in colonization of new sites rivers serve as dispersal corridors (but across-landscape transport also detected) Acknowledgements Chang-Gee Yang, Zuzana Mnzbergov, Tom Herben, Andreas Tribsch, Peter Schnswetter Supported by: Grant Agency of the Charles University, Prague, CR Grant Agency of the Czech Academy of Sciences, Prague, CR