Useful hints and tips for cloning, PCR and site-directed mutagenesis Kirsten Jensen Division of...

14
eful hints and tips for cloning, PCR a site-directed mutagenesis Kirsten Jensen Division of Molecular Biosciences

Transcript of Useful hints and tips for cloning, PCR and site-directed mutagenesis Kirsten Jensen Division of...

Page 1: Useful hints and tips for cloning, PCR and site-directed mutagenesis Kirsten Jensen Division of Molecular Biosciences.

Useful hints and tips for cloning, PCR and site-directed mutagenesis

Kirsten JensenDivision of Molecular Biosciences

Page 2: Useful hints and tips for cloning, PCR and site-directed mutagenesis Kirsten Jensen Division of Molecular Biosciences.

Overview

• Cloning (of PCR products)

• Polymerase chain reaction (PCR)

• Site-directed mutagenesis

Page 3: Useful hints and tips for cloning, PCR and site-directed mutagenesis Kirsten Jensen Division of Molecular Biosciences.

Cloning of a region of interestinto a plasmid

• Choose the right vector (+/- tag, and if tagged, a C- or N-terminal tag).

• Blunt end or sticky end cloning.

• Check that the enzymes chosen in the MCS for the cloning don’t cutin the region of interest.

• Check that there is enough “space” in-between the two enzymes in the MCS.

Sticky ends

Blunt ends

Plasmid Region of interest

MCS

Page 4: Useful hints and tips for cloning, PCR and site-directed mutagenesis Kirsten Jensen Division of Molecular Biosciences.

Primers

• Check the reading frame.• C-terminal tag: Add a Kozak consensus sequence (ANNATGG) if it is a C-terminal tag, and again remember to clone the gene in frame with the C-terminal tag. Don’t forget to take the STOP codon out.• Choose enzymes in the MCS to add to the primer that do not cutin the insert.• Primers should be 15-30 nucleotides long and have a GC content of 40-60 %.• The forward and reverse primer should have similar melting temperatures (Tm’s).• Try to avoid primer dimer and hairpin formation.• For sticky end ligation remember to add additional nucleotides to the 5’ side of the restriction site. The restriction site sequences should be followed by 15 bases that are homologous to the template DNA.• The 3’-end of the primer has to end on an C or a G.

Page 5: Useful hints and tips for cloning, PCR and site-directed mutagenesis Kirsten Jensen Division of Molecular Biosciences.

Restriction enzymes (NEB)

oligo % cleavage sequence 2h20h

BamHI CGGATCCG 10 25 CGGGATCCCG >90>90

CGCGGATCCGCG >90 >90

EcoRI GGAATTCC >90 >90 CGGAATTCCG >90 >90 CCGGAATTCCGG >90 >90

HindIII CAAGCTTG 0 0 CCAAGCTTGG 0 0 CCCAAGCTTGGG 10 75

NcoI CCCATGGG 0 0 CATGCCATGGCATG 50 75

NdeI GGGTTTCATATGAAACCC 0 0 GGAATTCCATATGGAATTCC 75 >90

Page 6: Useful hints and tips for cloning, PCR and site-directed mutagenesis Kirsten Jensen Division of Molecular Biosciences.

The principle of the PCR (Roche)

The purpose of the PCR is to make a huge number of

copies of a gene of interest

3 steps in a PCR repeated for 30-40 cycles.

• Denaturation at 95˚C: the double stranded DNA melts open to single stranded DNA.

• Annealing/hybridisation: The primers anneal to the DNA.

• Extension 68˚C or 72˚C: The polymerase copies the template adding the dNTPs from 5’ to 3’.

Page 7: Useful hints and tips for cloning, PCR and site-directed mutagenesis Kirsten Jensen Division of Molecular Biosciences.

PCR

• 0.1-5 ng plasmid DNA and 0.1-1 ug for genomic DNA• 200 µM dNTPs (final concentration)• 1-1.5 U Taq polymerase and Pfu Turbo polymerase 1.25-2.5U• 0.1-1 µM of each primer fwd/rev• 1-4 mM MgCl2 Taq polymerase (MgSO4 for Pfu polymerase)• DMSO up to 10% (has been shown to facilitate DNA separation)

• Initial denaturation: 1 Cycle: 1 min. 95˚C is usually enough for plasmid DNA. For genomic DNA it will have to be longer.

• 30-40 cycles PCR.

• If using primers with restriction sites use a lower annealing temperature for the first 10 cycles of the PCR.

• Final extension step: Incubate samples at 68˚C /72˚C for 5-15min to fill in the protruding ends of the PCR products. Taq DNA Polymerase adds extra A nucleotides to the 3'-ends of PCR products. If PCR fragments are cloned into T/A vectors, this step can be prolonged to up to 30min.

5’

5’3’

3’

Page 8: Useful hints and tips for cloning, PCR and site-directed mutagenesis Kirsten Jensen Division of Molecular Biosciences.

Cloning

• Digest the vector and the amplified DNA for 2h or O.N. depending on the enzymes used.• Clean up the digested vector and fragment.• Check the concentration of the vector and the fragment on a gel.

For Blunt end ligation (ratio vector : fragment; 1pmol : 10pmol)For sticky end ligation (ratio vector : fragment; 1pmol : 3pmol)• Negative control with vector only.

Page 9: Useful hints and tips for cloning, PCR and site-directed mutagenesis Kirsten Jensen Division of Molecular Biosciences.

Colonies on the negative control.• Poor cutting of the vector by the restriction enzymes. De-phosphorylation of the vector (also if using two different enzymes).• Colony screening using PCR.

No colonies: • Poor cutting of the PCR product by the restriction enzyme because of inefficient extension by the polymerase.• Poor cutting due to insufficient number of extra nucleotides at the 5’ side of the restriction site. Clone the fragment blunt end and then cut it out.• Blunt end ligation: Use PfuTurbo polymerase.Taq DNA Polymerase adds extra A nucleotides to the 3'-ends of PCR products. Clone the PCR product into a A/T cloning vector or treat it with Klenow and dNTPs and then ligate.

Problems after ligation

Page 10: Useful hints and tips for cloning, PCR and site-directed mutagenesis Kirsten Jensen Division of Molecular Biosciences.

Site-directed mutagenesisWorkflow (Stratagene)

Gene in plasmid with target site mutation

Denature the plasmid and anneal the oligonucleotideprimers containing the desired mutation

Using the non-strand-displacing action of PfuTurbopolymerase, extend and incorporate the mutagenic primers resulting in nicked circular strands

Digest the methylated, nonmutated parental DNAtemplate with Dpn I

Transform the circular, nicked dsDNA into super-competent cells

After transformation the supercompetent cellsrepair the nicks in the mutated plasmid

Page 11: Useful hints and tips for cloning, PCR and site-directed mutagenesis Kirsten Jensen Division of Molecular Biosciences.

Primer design for site-directed mutagenesis

Stratagene:

• Both primers must contain the mutation.• The mutation should be in the middle of the primer.• Primers should be 25-45 nucleotides long and have a GC content of at least 40%.• The melting temperature (Tm) should be ≥ 78˚C.• The 3’-end of the primer has to end on an C or a G.

5’5’3’

3’*

*

Page 12: Useful hints and tips for cloning, PCR and site-directed mutagenesis Kirsten Jensen Division of Molecular Biosciences.

Primer design for site-directed mutagenesis

Invitrogen:

• Only one primer contains the mutation.• Both primers should be ~ 30 nucleotides long.• Primers should have an overlapping region at the 5’ end of 15-20 nucleotides.• On the mutagenic primer, there should be at least 10 nucleotidesdownstream of the mutation.

Literature:(Zheng et al. An efficient one-step site-directed and site-saturation mutagenesis protocol. Nucleic Acids Res. 2004 Aug 10;32(14):e115).

• Both primers must contain the mutation.• At least 8 non-overlapping bases at the 3’ end.• The 3’-end of the primer has to end on an C or a G.

5’5’3’

3’*

5’5’3’

3’*

*

Page 13: Useful hints and tips for cloning, PCR and site-directed mutagenesis Kirsten Jensen Division of Molecular Biosciences.

Site-directed mutagenesis

• 5-50 ng/50 µl reactions of dsDNA plasmid DNA from a dam+ E.coli strain• 125-250ng/50 µl reactions of forward and reverse primer (PAGE or HPLC purified)• 200 µM dNTPs• 2 mM MgSO4

• 2.5 U of PfuTurbo polymerase• DMSO up to 10% (has been shown to facilitate DNA separation)

Problems:• No product: Don’t continue.• When using DMSO add more PfuTurbo polymerase.• If the oligo anneals several times, extend the oligo and increase the annealing temperature.• Primer dimer and hairpin: Use asymmetric oligos.• Repeats on either site of the mutation: Try shorter oligos and increasethe annealing temperature

Page 14: Useful hints and tips for cloning, PCR and site-directed mutagenesis Kirsten Jensen Division of Molecular Biosciences.

PCR

• Barnes WM. PCR amplification of up to 35-kb DNA with high fidelity and high yield from lambda bacteriophage templates. Proc Natl Acad Sci U S A. 1994 Mar 15;91(6):2216-20.

• http://www.fermentas.com/

Site-directed mutagenesis

• http://www.stratagene.com/

• http://www.invitrogen.com/

• Zheng et al. An efficient one-step site-directed and site-saturation mutagenesis protocol. Nucleic Acids Res. 2004 Aug 10;32(14):e115.

Papers and useful websites