Vol. 54, No. 5APPLIED AND ENVIRONMENTAL MICROBIOLOGY, May 1988, p. 1079-10840099-2240/88/051079-06$02.00/0Copyright C 1988, American Society for Microbiology

Use of Phylogenetically Based Hybridization Probes for Studies ofRuminal Microbial Ecology

DAVID A. STAHL,'* BERDENA FLESHER,' HOWARD R. MANSFIELD,2t AND LARRY MONTGOMERY2

Department of Veterinary Pathobiology' and Department ofAnimal Sciences,2 University of Illinois,Urbana, Illinois 61801

Received 23 October 1987/Accepted 5 February 1988

To address the long-standing need for more precise descriptions of natural microbial ecosystems, 16S rRNAswere used to track certain species and phylogenetically coherent groups of microorganisms in their naturalsetting without culturing. Species- and group-specific 16S rRNA-targeted oligonucleotide hybridization probeswere developed to enumerate various strains of Bacteroides succinogenes and Lachnospira multiparus-likeorganisms in the bovine rumen before, during, and after perturbation of that ecosystem by the addition of theionophore antibiotic monensin. Based on probe hybridization, relative numbers of L. multiparus-like organismswere depressed about 2-fold during monensin addition and demonstrated a transient 5- to 10-fold increaseimmediately after removal of the antibiotic from the diet. The most pronounced population changes were

observed among different strains of B. succinogenes, as evaluated by three hybridization probes. One probehybridized to all strains, whereas the other two identified genetically distinct groups represented by strainsisolated from the rumen and from the ceca of nonruminants. The rumen-type strains predominated on mostdays (ca. 0.2 to 0.8% of total ribosome numbers). Their proportion transiently increased about fivefoldimmediately after the addition of monensin to the feed and then transiently fell below the average premonensinlevel. During this time (ca. 2 weeks after monensin addition) the cecal type predominated (ca. 0.1 to 0.2%).Cultural enumeration of B. succinogenes on nonselective agar and by observing clearings in cellulose agar

media were largely unsuccessful due to the low number of organisms present and the predominance of othercellulolytic species. The results demonstrate the utility of rRNA-targeted hybridization to monitor complexmicrobial communities and are most consistent with the hypothesis that altered microbial metabolism, ratherthan altered population composition, is primarily responsible for changes in ruminal fermentation patternsresulting from the feeding of monensin.

The need for explicit measures of natural microbial eco-systems has been focused by current concern over thedeliberate release of genetically engineered microorganismsinto the environment (8). Community change must be eval-uated, yet most past studies of microbial ecosystems havebeen sketchy and often anecdotal. Work in microbial ecol-ogy has proceeded with the unusual restriction that themicroorganisms usually remain poorly defined. This ismostly the consequence of two technical limitations: first,the need to culture or have previously cultured the variousmicroorganisms before describing them and, second, thesubjectivity of criteria by which microbial taxa are defined.The greater part of many environmental microbial popula-tions cannot readily be cultured (1), and organisms that canbe grown often do not fit existing determinative classificationschemes. Available phenotypic descriptions frequently donot satisfactorily differentiate various isolates. Thus, de-tailed population descriptions have been nearly impossible,and few unifying themes have linked independent studies inmicrobial ecology. This is changing. Comparative rRNAsequencing now provides a framework for unifying bacterialclassification and in so doing offers absolute criteria forcharacterizing environmental populations of microorganisms(10, 17, 20).Comparative sequencing of the rRNAs, principally the

* Corresponding author.t Present address: Department of Animal Science, University of

Minnesota, St. Paul, MN 55108.

16S-like rRNAs, has yielded the most complete understand-ing of microbial phylogeny (10, 27). Differences in nucleotidesequences among these ubiquitous biopolymers serve notonly to relate microorganisms but also to identify them inenvironmental studies (17). In this study, identification wasbased upon hybridization of synthetic oligonucleotideprobes to diagnostic sequences of the 16S rRNAs. We hereindescribe the application of a phylogenetic characterization,based on comparative 16S rRNA sequencing, to the study ofthe response of selected assemblages of microorganisms inthe bovine rumen to perturbation of that ecosystem byaddition of the ionophore antibiotic monensin.

MATERIALS AND METHODS

Sampling. The experimental animal was a rumen-fistu-lated, nonlactating Holstein cow (ca. 12 years old) fed amaintenance diet of 4 lb. (ca. 1.8 kg) of grain mix and 4 lb ofalfalfa hay at 8 a.m. and 4 p.m. each day. To our knowledge,this animal had not previously been exposed to monensin.Monensin was added at 35 mg/kg of feed from day 16 to day62. The cow was adapted to the diet for 20 days beforesampling and then sampled daily at 2 p.m., via the ruminalfistula, from the mid-ruminal region immediately below themat of plant material. One sample was analyzed for eachday. Approximately 50 ml was collected; 10-ml sampleswere placed in vials, immediately frozen on dry ice, and heldat -85°C until processed.

Nucleic acid extraction and hybridization. Total nucleicacid was recovered from about 1 ml of unfractionated

1079

on March 15, 2020 by guest

http://aem.asm

.org/D

ownloaded from

APPL. ENVIRON. MICROBIOL.

ruminal contents by mechanical disruption for 3 min on areciprocating shaker (Mini-beadbeater; Biospec Products,Bartlesville, Okla.) with glass beads (diameter, 150 to 200p.m). Samples were processed in conical 2.2-ml screw-cappolypropylene vials (Sarstedt, Inc.). Each vial contained 0.8ml of baked glass beads, about 0.8 ml of ruminal fluid, and 50plI of sodium dodecyl sulfate; the remaining volume wasmade up with phenol equilibrated with 50 mM sodiumacetate-10 mM EDTA buffer (pH 5.1). Phenol and sodiumdodecyl sulfate were present to minimize degradation ofnucleic acids. Mechanical disruption insured uniform extrac-tion of nucleic acids from the great variety of microorgan-isms (gram positive, gram negative, and eucaryotic), bothunattached and attached to plant fiber. After two additionalextractions with an equal volume of buffer-equilibratedphenol-CHCl3-isoamyl alcohol (100:24:1) and one extractionwith an equal volume of CHCl3, total nucleic acid (primarilyrRNA) was recovered by ethanol precipitation. The nucleicacid was suspended in water to a final concentration of 1mg/ml (assuming an A260 of 1 for 40 p.g/ml). The recovery ofnucleic acid varied from 84 to 408 jig/ml of ruminal fluid(mean, 233 jig/ml; standard deviation, 67 jig/ml). RNA wasdenatured by addition of 3 volumes of 2% glutaraldehydeimmediately before dilution to 0.05 to 20 ,ug/ml in watermade to 1 ,ug of poly(A) (Sigma) per ml. Samples wereapplied in a total volume of 100 jl to nylon membranes(0.45-jim-pore-size Magnagraph; Micron Separations Inc.)by using a dot-blot device (Shleicher & Schuell Co.) underslight vacuum (2). A 2-jig sample of ruminal nucleic acid wasspotted for hybridization to all probes except the universalprobe, for which 40 ng was spotted. The membrane was airdried and baked for approximately 30 min at 80°C beforehybridization.DNA oligonucleotide probes were labeled with 32P by

using polynucleotide kinase and gamma-labeled ATP to aspecific activity of 108 to 109 cpm/jLg for each probe.Hybridization conditions were optimized by adjusting thefinal wash temperature to provide adequate sensitivity andspecificity relative to nucleic acid isolated from selectedruminal microorganisms. The following oligonucleotides arecomplementary to positions 207 through 226 in the Esche-richia coli 16S rRNA numbering (wash temperature followseach sequence): Lachnospira multiparus, CTTATACCACCGGAGTTTTTCA (520C); Bacteroides succinogenes NR9and DR7, CCGCATCGATGAATCTTTCGT (48°C); and B.succinogenes S85 and A3c, CCATACCGATAAATCTCTAGT (48°C). The B. succinogenes signature probe (AATCGGACGCAAGCTCATCCC, 56°C) is complementary topositions 225 through 245 in the E. coli numbering. Total 16SrRNA was estimated by hybridization to a "universal"oligonucleotide ACGGGCGGTGTGTRC (46°C) comple-mentary to a region (near position 1400, E. coli numbering)of virtually all 16S-like rRNAs so far characterized (17).Baked membranes were prewetted in water and sealed in

plastic bags. Approximately 100 jl of hybridization buffer[0.9 M NaCl, 50 mM NaPO4, 5 mM EDTA, 10x Denhardtsolution (15) and 0.5 mg of poly(A) per ml (pH 7.0)] wasadded per cm2 of membrane. Membranes were incubated(prehybridized) at 40°C for several hours before the additionof labeled oligonucleotide to about 2 x 105 cpm per sampledot. Incubation was continued for 12 to 16 h, and filters werewashed in lx SSC (0.15 M NaCi, 0.015 M sodiumcitrate)-1% sodium dodecyl sulfate at the specified washtemperatures (above) for 30 min (15). Membranes were driedand exposed to preflashed film (Kodak XRP) with intensifierscreens (Cronex Lightning-Plus [Du Pont]) at -85°C. Hy-

bridization to the universal oligonucleotide has varied littleamong virtually all organisms so far examined. Bound probewas quantitated by densitometry relative to reference stan-dards after autoradiography. The film response was linearfrom 0.5 to 10.0 ng for each probe. All hybridization valuesfor the daily ruminal samples fell within this range.

All probes were inspected for cross-hybridization to eachother and to representatives of each primary kingdom (eu-bacterial, L. multiparus strains D32 and 40, Selenomonasruminantium GA192, B. succinogenes strains S85, A3c,NR9, and DR7, E. coli MRE600, Ruminococcus albus 8, andButyrivibrio fibrisolvens 49; archaebacteria, Sulfolobus aci-docaldarius and Methanobrevibacter ruminantium Z-4; eu-caryotes, Dictyostelium discoideum and rat) (22, 25). The B.succinogenes probes specifically detected the addition of B.succinogenes DR7 and S85 (107 to 109 cells per ml) toruminal contents. Hybridization to the nontarget organismswas near background.Abundances of individual and grouped microorganisms

are expressed as the fraction of the total rRNA in thesample. The total amount of 16S rRNA in each sampleapplied to the nylon membrane was determined by hybrid-ization of the universal oligonucleotide. The lower limit fordetecting a unique 16S rRNA in the 2 jig of nucleic acidspotted on the membrane was approximately 0.005% of16S-like rRNAs. The detection limit was probably somewhatgreater for nucleic acid recovered from ruminal contents (ca.0.01%) because of contributing plant nucleic acid. We havenot quantified the contribution of plant nucleic acid to thesesamples, and the abundance determinations may not repre-sent an absolute proportion of ruminal microorganisms.

Cultural methods. Rigorous anaerobic techniques wereused in the preparation of medium and inoculation. Allenumeration media, in tubes under a CO2 atmosphere,contained (per liter) 166 ml each of salts solutions A and B(16) 200 ml of preincubated (7-day) ruminal fluid, 500 mgeach of yeast extract and Trypticase (BBL MicrobiologySystems), vitamin and volatile fatty acid mixtures (16),Na2CO3 to adjust to pH 6.8 (ca. 5 g), and 250 mg each ofcysteine hydrochloride and Na2S. In addition, specific enu-meration media included the following additions (per liter):cellobiose-agar contained 2 g of cellobiose and 14 g of agar,cellulose broth contained 4 g of Whatman no. 1 filter paperwhich had been pebble milled for 24 h (pebble-milled cellu-lose); cellulose-agar contained 5 g of pebble-milled celluloseand 6 g of GIBCO select agar; and total viable count mediumcontained 0.1% each glucose, cellobiose, xylose, maltose,and soluble starch. Dilution solution contained twice thelevels of the salt solutions and no ruminal fluid but wasotherwise the same as the basal enumeration medium.Whole ruminal contents were transported in a sealed jar

into an anaerobic glove box within 30 min. Samples (20 ml)of contents were added to 180 ml of anaerobic dilutionsolution and blended for 1 min. A sample was removed fromthe glove box in a stoppered tube and serially diluted (10-foldsteps). Appropriate dilutions were inoculated into enumera-tion media, which were incubated at 38°C. After 4 days ofincubation, colonies were picked from cellobiose-agar (thehighest dilutions with colonies) into pebble-milled cellulosebroth. Cultures which degraded pebble-milled cellulose werepresumptively identified based on morphology.

RESULTS

To evaluate the relative abundance of B. succinogenes inthe rumen, three different oligonucleotide probes were syn-

1080 STAHL ET AL.

on March 15, 2020 by guest

http://aem.asm

.org/D

ownloaded from

USE OF 16S rRNA TO ASSESS MICROBIAL ECOSYSTEM CHANGE

thesized. The "signature" probe was complementary to the16S rRNA of all but one strain of B. succinogenes (DR7,S85, HM2, REH9-1, and A3c) so far characterized bycomparative sequencing (strain NR9 differs in a singleA-to-G transition). The other probes identified either of twonatural groups within the larger assemblage. One group(ruminal type) was represented by ruminal strains S85 andA3c; the second group (cecal type) was represented bystrains NR9 and DR7, isolated from rat (16) and pig (H. R.Mansfield and L. Montgomery, unpublished data) ceca,respectively. The results of the hybridization study withthese probes are shown in Fig. 1. The profiles are drawnfrom a running 3-day average of daily values for the entiresampling period. This treatment reduces some of the fluctu-ation due to variations in sampling and more clearly displaysthe population trends reflected in the daily values. A partialreplicate hybridization series of the same sample for thegroup-specific B. succinogenes probes (days 1 through 30, 35through 37, 42 through 44, 49 through 51, and 59 through 73)was consistent with the trends displayed in Fig. 1 (data notshown).The two groups of B. succinogenes responded very differ-

ently to the addition of the antibiotic. The proportion (as apercentage of total 16S-like rRNAs) of rumen-type B. suc-cinogenes increased about fivefold (relative to the baselineperiod) immediately after addition. This is consistent withthe observed resistance in pure culture of gram-negativebacteria (e.g., B. succinogenes) relative to gram-positivebacteria (7, 9). In contrast to expectations, the proportion ofcecum-type B. succinogenes was depressed. The ruminaltype remained elevated (accounting transiently for about 1%of total ribosome numbers) for several days before dropping,over a 2-week period, below baseline proportions. Duringthat time the cecal type gained relative dominance, althoughpresent in much lower levels than the earlier peak of theruminal type. Over the next 3-week period the ruminal typepredominated, showing two clear peaks of several daysduration each. Upon withdrawal of monensin, the cecaltypes reached their highest levels (0.4%), transiently equal-ling the proportion of the ruminal type before again droppingto earlier levels (<0.1%).

Hybridization to the B. succinogenes signature probe,which detects all strains so far characterized by comparativesequencing, was generally consistent with the trends shownby the group-specific probes. There was one notable excep-tion. Between days 24 and 30, the signature probe responsegreatly exceeded the sum of the ruminal and cecal types.Thus, a relatively large proportion of B. succinogenes-likeorganisms was unaccounted for by the group-specificprobes, suggesting the presence of another assemblage of B.succinogenes-like microorganisms that had not been charac-terized.To relate the hybridization data to data obtained by

traditional (cultural) techniques, we enumerated B. succino-genes in six of the samples (days 1, 8, 15, 36, 43, and 50) bytwo cultural techniques, nonselective isolation from cello-biose agar and examination of clearings in cellulose-agar rolltubes (14). Of 600 colonies picked from cellobiose-agar (100from each of six samples), 24 yielded cellulose-degradingcultures, of which 1 was presumptively identified as B.succinogenes (day 50). From this data we can suggest anupper limit of 1 to 2% of the viable counts made up by B.succinogenes. No clearings typical of B. succinogenes wereobserved in the cellulose-agar tubes.

Relative numbers of Lachnospira cells were expected tofall with addition of monensin, based on its gram-positive

z

ckJL.

y

-JI-

0I-

1.2 -

o B. succinogenes SIGNATURE PROBE1 .0 -- 0 DAILY VALUES

0-3 DAY AVERAGE

n~~~~n

0.8- a a5 00 1~~~0~~~~~~~

- 0~~~~~~~~0.640-0 ~~0 0

0~~~~~~~~~~~~

0.4 - 0000

1 1~~~~0.0 I I I I I I i I I

1.0

0.8 +

0.64

0.4

0.2-

0.0 "r'I 'A0 5 1015 2025 30 35 40 45 50 55 60 65 70 75

DAYSFIG. 1. Dot-blot quantitation. Arrows mark the addition to and

removal from the feed of the ionophore antibiotic monensin. Pointscorrespond to normalized daily values. The profiles are drawn froma running 3-day average of the daily values (Materials and Methods).

wall structure and sensitivity to monensin (7, 9). Althoughrelative numbers in the 2- to 3-week period after the additionof monensin were generally about half of those for thebaseline period, the response was neither immediate nor

sustained. The clearest population response transiently fol-lowed the removal of the antibiotic from the animal's diet,when more than 1% of total 16S-like rRNAs hybridized tothe lachnospira probe.

DISCUSSION

Virtually all ruminal microorganisms are fastidious anaer-

obes and so are not amenable to the usual techniques ofbenchtop microbiology. Nevertheless, the rumen is one ofthe best-described microbial ecosystems (4, 11-13), with a

resultant large culture collection of representative bacteria

0 0-- RUMINAL-TYPE PROSE

*- CECAL-TYPE PROE

S~

a I015II*I I 0 d~

I IiI I I I °

o0o 6a A JCOb

VOL. 54, 1988 1081

on March 15, 2020 by guest

http://aem.asm

.org/D

ownloaded from

APPL. ENVIRON. MICROBIOL.

and a history of descriptive and experimental ecology (5, 6).The ruminal microbiota is a well-contained community witha well-defined function, the conversion of plant matter tocompounds useful to the animal, principally propionate,acetate, and protein (4). It is an ecosystem that can beconveniently perturbed, for example, by altering diet. Withthe intention of developing a more explicit approach for thestudy of complex microbial ecosystems, we have begun asystematic survey, based upon comparative 16S rRNA se-quencing, of dominant ruminal bacteria. Comparative 16SrRNA sequencing simultaneously examines the validity ofthe existing classifications and identifies signature regionswithin these rRNAs that can serve as hybridization targetsfor oligonucleotide probes.For the initial evaluation of the application of phylogenet-

ically based hybridization probes, we chose to perturb theruminal ecology by the addition of monensin and to trackseveral groups of microorganisms anticipated to responddifferently to this perturbant. This sodium ionophore isroutinely included in cattle feedlot diets to improve feedutilization efficiency (3). Increased propionate production,decreased methane production, and a protein-sparing effecthave been suggested to be in part responsible for improvedfeed conversion (3, 24). Yet, it remains unresolved whetheralteration of the ruminal population or of the metabolism ofa relatively unchanged population contributes most to theseeffects.Organism abundance has been expressed as a fractional

contribution to the total ribosome population. We elected touse this relative measure to avoid uncertainties of nucleicacid recovery. For example, during the multiple organicextractions of each sample, variation in the amount ofresidual aqueous phase (and nucleic acid) left with theorganic phase was unavoidable. Since cellular ribosomeabundance is correlated with growth rate, a relative measureprobably better reflects the contribution to total metabolicactivity by each organism. However, absolute numberscannot be directly inferred from the data. For example, achange in total ribosome abundance without change inribosome abundance of a specific organism would be re-flected in a change in the fractional contribution of thatorganistn. Nevertheless, a rough estimate of rRNA concen-tration for the organisms inspected in this study shows thesame population trends as the fractional representations(data not shown).

Hybridization sites were selected within a phylogeneticframework, taking advantage of variation in sequence con-servation across the length of the 16S rRNA (19, 26). Thenucleotide sequences of some regions of this molecule areinvariant and present in all kingdoms (eucaryotes, eubacte-ria, and archaebacteria), whereas others vary among but notwithin kingdoms. More variable regions can be used todefine major lines of bacterial descent and so on; the mostvariable regions can be used to identify specific species oreven subspecies of bacteria (25, 27). One of the mostvariable regions of the molecule was used as a target site forthe oligonucleotide probes used in this study (Materials andMethods). L. multiparus D32 and 40 have identical 16SrRNA sequences through this region (D. A. Stahl and B.Flesher, unpublished data) and were quantitated by the samehybridization probe. However, the different strains of B.succinogenes characterized varied markedly through thisregion.

Previous 16S rRNA cataloging of the neotype strain (S85)of B. succinogenes showed it to be unrelated to the "true"Bacteroides spp., with no close association with any other

organism (ca. 600 organisms) so far characterized by com-parative 16S rRNA sequencing (18). More recent studieshave shown that although this species (as now recognized) isphylogenetically coherent, it is very diverse (L. Montgom-ery, B. Flesher, and D. A. Stahl, submitted for publication).The 16S rRNA sequence differences separating the ruminaland cecal strains (ca. 90% similarity) are greater than thoseseparating Proteus vulgaris and E. coli (ca. 93% similarity).The various strains are now distinguished mainly by vitaminrequirements and variations in morphology (16). Neverthe-less, the now-recognized genetic diversity was used in thisstudy as a basis to explore the natural distribution of rumen-and cecum-type strains and so point up possible differencesin ecological function.Based on this very partial but high-resolution analysis, the

ruminal ecology appears to be significantly buffered against astable population change induced by monensin. Althoughrelative numbers of the two defined groups of B. succino-genes responded markedly (and differently) to the additionand removal of monensin, the changes appeared to betransient. The early spike of rumen-type B. succinogenesnumbers during the time period immediately after the addi-tion of monensin may have resulted from a transient inhibi-tion of monensin-susceptible competitors. In turn, the de-pression of relative numbers of cecum-type B. succinogenesmay have been a consequence of their exclusion by elevatednumbers of the ruminal type during this same time period.No clear fluctuations over time, such as those seen for B.succinogenes, were observed in relative numbers of lachno-spira. In general, relative numbers were slightly depressedduring monensin feeding.These results do not support the hypothesis that monensin

selects for a greatly altered population and therefore lendsupport to the alternate hypothesis that monensin primarilyacts by altering the metabolism of a relatively stable popu-lation. However, this must be confirmed by more detailedanalyses of these populations, elucidating, for example, thenormal range of variation over longer times.

Target group specificity is a critical factor for this sort ofanalysis. Recent analysis has shown that L. multiparus anda related organism, Roseburia cecicola, have identical se-quences in the region selected for the probe target (D. A.Stahl, unpublished data). Although R. cecicola has yet to bediscovered in the rumen, these hybridization data mayinclude organisms other than Lachnospira. Thus, as theruminal microbiota is more completely represented in the16S reference collection, interpretation of these analysesmay change. Another example comes from recent analysesof B. succinogenes HM2 and REH9-1, isolated from sheepand cow rumens, respectively. Comparative 16S rRNAsequencing has shown them to be more distantly relatedmembers of the rumen-type group, both differing from therumen-type sequence within the target site (Montgomery etal., submitted). Strain HM2 differs at a single nucleotideposition, and strain REH9-1 differs at two positions. Even asingle mismatch should significantly depress hybridization.A single-base-pair mismatch between a 17-nucleotide probeand its target sequence has been shown to reduce the meltingtemperature of the hybrid by 11°C (23). Therefore, suchstrains probably accounted for some of the unassignedsignature probe hybridization. As necessary, hybridizationtargets will be redefined to provide appropriate resolution.Given that most natural systems remain poorly character-

ized, it will generally not be possible to completely circum-scribe the population with a reference sequence collection.However, phylogenetic analysis offers other criteria for the

1082 STAHL ET AL.

on March 15, 2020 by guest

http://aem.asm

.org/D

ownloaded from

USE OF 16S rRNA TO ASSESS MICROBIAL ECOSYSTEM CHANGE

evaluation of probe specificity. First, an understanding ofthe relative conservation of sequence throughout the 16SrRNA helps ensure that the target regions are likely tocircumscribe the selected group of microorganisms (17, 25).Another indication of specificity comes from the use ofprobes of wider or narrower specificity. For example, in thisstudy both general (signature) and group-specific probeswere used to monitor the abundance of B. sid(inogenes.Consistency between signature probe and group- or strain-specific probe hybridization increases confidence in targetgroup selectivity. Conversely, observations of inconsis-tency, as observed between the B. siuc-inogenes signature-and group-specific probes between days 24 and 30, issuggestive of unrecognized diversity within the larger, phy-logenetically coherent assemblage. An indication of speci-ficity can also be inferred by surveying different environ-ments of comparable complexity. For example, examinationof cecal contents from other animals (vole, rat, lemming,rabbit) with the rumen- and cecum-type B. siudnizogenesprobes revealed little or no hybridization (0.002 to 0.015%Y oftotal 16S rRNA) (unpublished data).The results of the cultural enumeration again emphasized

the limitations of enumeration by cultural techniques of anybacterium which constitutes a very small fraction of theviable population and which cannot be enumerated ondifferential medium. In this study, the use of nonselectivemedium was preferred, since some strains of B. sUi(fino-genes, representative of the dominant type in these samples,form clearings in cellulose-agar poorly and therefore wouldnot be detectable by this differential enumeration technique(L. Montgomery, unpublished observations). Although cel-lulose-agar was also inspected for clearings formed by cer-tain strains of B. siccinogenes, clearings typical of rumino-cocci and Butyri'ibriofibrisoli'ens were formed in sufficientnumbers that they likely would have obscured any clearingsby B. succinogenes. Reliable estimates of B. siuccinogenesnumbers would have required picking 1,000 colonies or moreper sample from nonselective medium. Given, in this in-stance, the added labor associated with strict anaerobictechnique, such a study would not have been feasible for thisreason alone.

Studies in microbial ecology must begin with an under-standing of natural diversity. Traditional difficulties of as-sessing this diversity have limited most studies of naturalsystems. The limitations of culturing are generally wellappreciated. Nevertheless, traditional classification schemesprobably are the more serious constraint. Available pheno-typic criteria often obscure diversity or miss specific rela-tionships (10). For example, past studies of the distributionof B. succinogenes in the rumen presumably have lumpedseveral genetically distinct groups into a single category,obscuring how these groups may differ functionally in thisecosystem (21). Recognition of extant diversity within boththe pure culture collection and the environment will contrib-ute to a more complete understanding of microbial ecologyand evolution. Thus, these studies are closely allied if notinseparable.

ACKNOWLEDGMENTS

This research was supported by cooperative research agreementCR812496-01-3 to D. A. Stahl from the U.S. Environmental Protec-tion Agency and by project no. 20-0324 to L. Montgomery from theAgricultural Experiment Station, College of Agriculture. Universityof Illinois at Champaign-Urbana.We thank John W. Urbance for assistance with sampling, Bryan

White for comments on the manuscript, and Neil Merchen for dietformulation.

LITERATURE CITED1. Atlas, R. M. 1983. Use of microbial diversity measurements to

assess environmental stress, p. 540-545. In M. J. Klug and C. A.Reddy (ed.), Current perspectives in microbial ecology. Amer-ican Society for Microbiology, Washington, D.C.

2. Berent, S. L., M. Mahmoudi, R. M. Torczynski, P. W. Bragg,and A. P. Bollon. 1985. Comparison of oligonucleotide and longDNA fragments as probes in DNA and RNA dot, southern,northern, colony and plaque hybridizations. Bio-Techniques 3:208-220.

3. Bergen, W. G., and D. B. Bates. 1984. lonophores: their effecton production efficiency and mode of action. J. Anim. Sci.58: 1465-1527.

4. Bryant, M. P. 1977. Microbiology of the rumen, p. 287-304. InM. J. Swenson (ed.), Dukes' physiology of domestic animals,9th ed. Cornell University Press, Ithaca.

5. Bryant, M. P., and L. A. Burkey. 1953. Numbers and somepredominant groups of bacteria in the rumen of cows feddifferent rations. J. Dairy Sci. 36:218-224.

6. Bryant, M. P., and I. M. Robinson. 1968. Effects of diet, timeafter feeding and position sampled on numbers of viable bacteriain the bovine rumen. J. Dairy Sci. 51:1950-1955.

7. Chen, M., and M. J. Wolin. 1979. Effect of monensin andlasalocid-sodium on the growth of methanogenic and rumensaccharolytic bacteria. Appl. Environ. Microbiol. 38:72-77.

8. Crawford, M. 1987. California field test goes forward. Science236:511.

9. Dennis, S. M., T. G. Nagaraja, and E. E. Bartley. 1981. Effectsof lasalocid or monensin on lactate-producing or -using rumenbacteria. J. Anim. Sci. 52:418-426.

10. Fox, G. E., E. Stackebrandt, R. B. Hespell, J. Gibson, J.Maniloff, T. A. Dyer, R. S. Wolfe, R. Gupta, L. Bonen, B. J.Lewis, D. A. Stahl, K. R. Luehrson, K. N. Chen, and C. R.Woese. 1980. The phylogeny of prokaryotes. Science 209:457-463.

11. Hobson, P. N., and R. J. Wallace. 1982. Microbial ecology andactivities in the rumen. 1. Crit. Rev. Microbiol. 9:165-225.

12. Hobson, P. N., and R. J. Wallace. 1982. Microbial ecology andactivities in the rumen. 11. Crit. Rev. Microbiol. 9:253-320.

13. Hungate, R. E. 1966. The rumen and its microbes. AcademicPress, Inc., New York.

14. Macy, J. M., J. R. Farrand, and L. Montgomery. 1982. Cellu-lolytic and noncellulolytic bacteria in rat gastrointestinal tracts.Appl. Environ. Microbiol. 44:1428-1434.

15. Maniatis, T., E. F. Fritsch, and J. Sambrook. 1982. Molecularcloning: a laboratory manual. Cold Spring Harbor Laboratory,Cold Spring Harbor, N.Y.

16. Montgomery, L., and J. M. Macy. 1982. Characterization of ratcecum cellulolytic bacteria. Appl. Environ. Microbiol. 4:1435-1443.

17. Pace, N. R., D. A. Stahl, D. J. Lane, and G. J. Olsen. 1986. Theuse of rRNA sequences to characterize natural microbial pop-ulations. Adv. Microb. Ecol. 9:1-55.

18. Paster, B. J., W. Ludwig, W. G. Weisburg, E. Stackebrandt,R. B. Hespell, C. M. Hahn, H. Reichenbach, K. 0. Stetter, andC. R. Woese. 1985. A phylogenetic grouping of the bacteroides,cytophagas and certain flavobacteria. Syst. Appl. Microbiol.6:34-42.

19. Stahl, D. A. 1986. Evolution, ecology and diagnosis: unity invariety. Bio/Technology 4:623-628.

20. Stahl, D. A., D. L. Lane, G. J. Olsen, and N. R. Pace. 1985.Characterization of a Yellowstone hot spring microbial commu-nity by 5S ribosomal RNA sequences. Appl. Environ. Micro-biol. 49:1379-1384.

21. Van Gylswyk, N. O., and J. J. T. K. van der Toorn. 1986.Enumeration of Bacwtroides succinogenes in the rumen of sheepfed maize-straw diets. FEMS Microbiol. Ecol. 38:205-209.

22. Wallace, R. B., M. J. Johnson, T. Hirose, T. Miyake, E. H.Kawashima, and K. Itakura. 1981. The use of synthetic oligo-nucleotides as hybridization probes. 11. Hybridization of oligo-nucleotides of mixed sequence to rabbit Beta-globin DNA.Nucleic Acids Res. 4:879-893.

23. Wallace, R. B., J. Shaffer, R. F. Murphy, J. Bonner, T. Hirose,

VOL. 54, 1988 1083

on March 15, 2020 by guest

http://aem.asm

.org/D

ownloaded from

1084 STAHL ET AL. APPL. ENVIRON. MICROBIOL.

and K. Itakura. 1979. Hybridization of synthetic oligonucleo-tides to phi chi 174 DNA: the effect of single base pair mismatch.Nucleic Acids Res. 6:3543-3557.

24. Whetsone, H. D., C. L. Davis, and M. P. Bryant. 1981. Effect ofmonensin on breakdown of protein by ruminal microorganismsin vitro. J. Anim. Sci. 53:803-809.

25. Woese, C. R. 1987. Bacterial evolution. Microbiol. Rev. 51:

221-271.26. Woese, C. R., R. Gutell, R. Gupta, and H. F. Noller. 1983.

Detailed analysis of the higher-order structure of 16S-like ribo-somal ribonucleic acids. Microbiol. Rev. 47:621-669.

27. Woese, C. R., E. Stackebrandt, T. J. Macke, and G. E. Fox.1985. A phylogenetic definition of the major eubacterial taxa.System. Appl. Microbiol. 6:143-151.

on March 15, 2020 by guest

http://aem.asm

.org/D

ownloaded from