Use of Hanseniaspora opuntiae in co-fermentation with

Saccharomyces cerevisiae to enhance the aromatic profile

of craft beer

Miguel Pinto Rocha

Thesis to obtain the Master of Science Degree in

Biotechnology

Supervisors: Dr. Margarida Isabel Rosa Bento Palma

Prof. Dr. Isabel Maria de Sá Correia Leite de Almeida

Examination Committee

Chairperson: Prof. Dr. Arsénio do Carmo Sales Mendes Fialho

Supervisor: Dr. Margarida Isabel Rosa Bento Palma

Members of the Committee: Dr. Cláudia Sofia Pires Godinho

November 2019

i

ii

Preface

The work presented in this thesis was performed at the Institute for Bioengineering and Biosciences of

Instituto Superior Técnico (Lisbon, Portugal), during the period February – October 2019, under the

supervision of Doctor Margarida Palma and Professor Isabel Sá-Correia.

Declaration

I declare that this document is an original work of my authorship and that it fulfils all the requirements

of the Code of Conduct and Good Practices of the Universidade de Lisboa.

iii

Acknowledgements

I would like to start by acknowledging my supervisors, Professor Isabel Sá-Correia and Dr. Margarida

Palma. I am thankful for their patience, knowledge and guidance that allowed the development of this

thesis. I would also like to thank Professor Isabel Sá-Correia, the leader of the Biological Sciences

Research Group (BSRG) of the Institute for Bioengineering and Biosciences (iBB), for the opportunity

to join her group.

I would like to acknowledge Professor Rosário Bronze and lab technician António Ferreira from Instituto

de Biologia Experimental e Tecnológica (iBET) for their collaboration in the GC-MS analysis.

I would also like to acknowledge the expert panel of tasters, composed by Hugo Elias, Bruno Aquino,

Fernando Gonçalves, João Loureiro and Pedro Lima. A special acknowledgment goes to Hugo Elias,

from D’Ourique Flavours, Cerveja Artesanal, for gathering the panel of beer tasters.

This work was performed in the Biological Sciences Research Group (BSRG) of the Institute for

Bioengineering and Biosciences (iBB), Instituto Superior Técnico, Universidade de Lisboa. The funding

received by iBB from the Portuguese Foundation for Science and Technology (FCT)

(UID/BIO/04565/2019) is acknowledged.

The following acknowledgements will be addressed in Portuguese:

Em primeiro lugar, gostaria de agradecer à Professora Isabel Sá-Correia pela orientação, por todo o

conhecimento transmitido e por todas as opiniões e conselhos que possibilitaram a realização desta

tese.

Um agradecimento especial à Dra. Margarida Palma pela disponibilidade e imensa paciência que teve

para comigo, por todo o conhecimento transmitido e aconselhamento diário. Sem a sua ajuda não teria

sido possível realizar esta tese, pelo que estarei para sempre grato.

Quero também agradecer ao grupo do laboratório 6.6.13, Luís, Cláudia, Nuno, Marta, Ricardo e Rui

pela forma como me receberam, por toda a ajuda prestada e por todos os momentos de boa disposição.

Um agradecimento especial ao Nuno, não só pela análise dos resultados do GC-MS, como também

pela disponibilidade e ajuda prestada. Aos meus colegas de mestrado, Catarina, Pedro, Rute e Paula,

um obrigado pela entreajuda no laboratório, mas principalmente por todos os momentos de

descontração e boa disposição, dentro e fora do laboratório.

Um obrigado ao meu padrinho Miguel, por todas as conversas e conselhos e por todo o apoio dado

durante o meu percurso académico.

Por fim, um enorme agradecimento à minha família, aos meus pais Isabel e Carlos, à minha irmã Joana

e à minha namorada Nina, por todo o apoio, compreensão e força que me dão e por me fazerem

acreditar em mim. Sem eles, não seria a pessoa que sou nem seria capaz de chegar a onde estou

hoje.

iv

Abstract

The increasing growth in popularity of craft beer led brewers to explore different Saccharomyces

cerevisiae starters, or mixed culture fermentations with this species and a non-Saccharomyces species

to produce beers of high sensorial complexity. In this work, several yeast species were isolated from

different environments. Four Hanseniaspora strains isolated from wine production environments were

screened for their potential in the enhancement of beer flavour and aroma. Hanseniaspora opuntiae

IST408 was selected to undergo mixed beer fermentations with the commercial strain S. cerevisiae US-

05, either inoculated simultaneously or sequentially. HPLC and GC-MS were used to characterize the

residual sugars and ethanol concentrations and the volatile profile of the produced beers, respectively.

H. opuntiae IST408 produced an overly sweet beer but has potential for the production of low-alcoholic

aromatic beverages. However, beers produced by mixed fermentations presented higher

concentrations of acetate esters and organic acids than single S. cerevisiae fermentations, in

agreement with the organoleptic evaluation of the beers, performed by an expert panel. Beers produced

by simultaneous inoculation of the two species were considered the most pleasant, with a citric, fruity

and acidic profile. Population dynamics studies were performed to investigate the evolution of each

species’ population in single and mixed culture fermentations. A S. cerevisiae mutant in which the three

main genes involved in acetate ester synthesis, ATF1, ATF2 and EAT1, are eliminated was also

constructed. This mutant will be used in future studies for the functional characterization of the

homologous genes from non-Saccharomyces that present high acetate ester production.

Keywords: Beer; Saccharomyces cerevisiae; Hanseniaspora opuntiae; Mixed culture fermentation;

Acetate ester production; Population dynamics

v

Resumo

O aumento da popularidade da cerveja artesanal tem levado os cervejeiros a explorar a realização de

fermentações de cultura mista envolvendo Saccharomyces cerevisiae e uma espécie não-

Saccharomyces, para produzir cervejas de elevada complexidade sensorial. Neste trabalho, a

capacidade de Hanseniaspora opuntiae IST408 em melhorar o perfil organolético da cerveja foi

testado. Para tal, foram realizadas fermentações mistas, com inoculação sequencial ou simultânea,

desta estirpe e da estirpe comercial S. cerevisiae US-05. HPLC e GC-MS foram utilizados para

caracterizar as concentrações de açúcares e etanol e o perfil de compostos voláteis das cervejas

produzidas. H. opuntiae IST408 produziu uma cerveja demasiado doce mas demonstrou potencial para

a produção de bebidas aromáticas pouco alcoólicas. No entanto, cervejas produzidas por fermentação

mista apresentaram concentrações superiores de ésteres de acetato e ácidos orgânicos do que por

fermentação apenas com S. cerevisiae, o que está de acordo com a avaliação organolética das

cervejas, efetuada por um painel de especialistas. Cervejas produzidas por inoculação simultânea

foram consideradas mais agradáveis, apresentando um perfil cítrico, frutado e acídico. Testes de

dinâmica populacional de fermentações com culturas simples e mistas foram efetuados de forma a

avaliar a evolução de cada uma das espécies. Paralelamente, foi construído um mutante de S.

cerevisiae em que os três principais genes envolvidos na produção de ésteres de acetato (ATF1, ATF2,

EAT1) foram parcialmente eliminados. Este mutante foi desenhado para ser utilizado em estudos

futuros que visam a caracterização funcional de genes homólogos de espécies não-Saccharomyces

que apresentam elevada produção de ésteres de acetato.

Palavras-chave: Cerveja; Saccharomyces cerevisiae, Hanseniaspora opuntiae; Fermentações de

cultura mista; Produção de ésteres de acetato; Dinâmica populacional

vi

Table of Contents

1. Motivation and thesis outline ..................................................................................................... 1

2. Introduction ..................................................................................................................................... 3

2.1. Production of different types of beer by Saccharomyces yeasts ............................. 3

2.2. Domestication of yeasts in beer production ................................................................... 3

2.3. Non-Saccharomyces yeasts in beer production ............................................................ 4

2.3.1. Pichia species .................................................................................................................. 4

2.3.2. Torulaspora species ....................................................................................................... 5

2.3.3. Brettanomyces species ................................................................................................. 6

2.3.4. Hanseniaspora species ................................................................................................. 8

2.3.5. Other yeast species ........................................................................................................ 9

2.4. Volatile compounds produced by yeasts ...................................................................... 10

2.4.1. Higher alcohols ............................................................................................................. 10

2.4.2. Volatile esters ................................................................................................................ 11

2.4.3. Carbonyl compounds .................................................................................................. 13

2.4.4. Organic acids ................................................................................................................. 14

2.4.5. Volatile sulphuric compounds .................................................................................. 15

2.4.6. Volatile phenols ............................................................................................................. 15

2.4.7. Monoterpene alcohols ................................................................................................. 17

3. Materials and Methods ............................................................................................................... 18

3.1. Yeast isolation and identification .................................................................................... 18

3.1.1. Samples collected ......................................................................................................... 18

3.1.2. Yeast isolation ............................................................................................................... 18

3.1.3. DNA extraction ............................................................................................................... 18

3.1.4. Polymerase Chain Reaction (PCR) and gel electrophoresis ............................. 19

3.1.5. DNA sequencing and yeast species identification .............................................. 19

3.1.6. Addition to the IST yeast collection ......................................................................... 19

3.2. Fermentative Trials .............................................................................................................. 20

3.2.1. Preparation of the beer wort ...................................................................................... 20

3.2.2. Strain selection for fermentation .............................................................................. 20

3.2.3. Inoculum preparation and fermentative conditions for the first screening .. 20

3.2.4. Organoleptic evaluation of the fermentation products from the first

screening .................................................................................................................................... 21

3.2.5. Inoculum preparation and fermentative conditions for the single and mixed

culture fermentations .............................................................................................................. 21

3.2.6. Fermentation monitoring ............................................................................................ 21

vii

3.2.7. Monitoring of sugar and ethanol concentrations ................................................. 21

3.2.8. Volatile compound analysis by GC-MS ................................................................... 22

3.3. Population Dynamics studies ........................................................................................... 22

3.3.1. Preparation of beer wort ............................................................................................. 22

3.3.2. Inoculum preparation and fermentative conditions for population dynamics

studies......................................................................................................................................... 22

3.3.3. Fermentation monitoring ............................................................................................ 23

3.3.4. Time point sample acquisition .................................................................................. 23

3.3.5. Monitoring of sugar and ethanol concentrations ................................................. 23

3.4. ATF1, ATF2 and EAT1 disruptions by CRISPR-Cas9 methodology ....................... 24

3.4.1. Oligonucleotides used ................................................................................................. 24

3.4.2. Plasmids used for the partial deletion of ATF1, ATF2 and EAT1 genes ........ 25

3.4.3. Saccharomyces cerevisiae CEN.PK113-7D transformation with p51-Cas9

vector........................................................................................................................................... 25

3.4.4. Primer duplexing ........................................................................................................... 25

3.4.5. Preparation of the plasmid with gRNA .................................................................... 26

3.4.6. E. coli transformation .................................................................................................. 26

3.4.7. Transformation with p59-gRNA and donorDNA ................................................... 26

3.4.8. Plasmid loss ................................................................................................................... 27

4. Results ............................................................................................................................................ 29

4.1. Isolation and identification of yeasts .............................................................................. 29

4.2. Selection of a Hanseniaspora strain with potential for increasing the

organoleptic profile of beer ....................................................................................................... 31

4.2.1. First screening fermentations ................................................................................... 31

4.2.2. Organoleptic characterisation of the fermentation products from the first

screening .................................................................................................................................... 33

4.3. Beer production by single and mixed cultures of Hanseniaspora opuntiae

IST408 and Saccharomyces cerevisiae US-05 ..................................................................... 33

4.3.1. Fermentation profile of single and mixed cultures of Hanseniaspora

opuntiae IST408 and Saccharomyces cerevisiae US-05 ............................................... 33

4.3.2. Volatile compound profile of single and mixed culture beer fermentations . 36

4.3.3. Organoleptic characterization of the beers produced by pure and mixed

culture fermentations .............................................................................................................. 43

4.4. Population dynamics during single and mixed culture fermentations of H.

opuntiae IST408 and S. cerevisiae US-05 .............................................................................. 44

4.5. Deletion of ATF1, ATF2 and EAT1 genes in Saccharomyces cerevisiae by

CRISPR-Cas9 methodology ...................................................................................................... 48

5. Discussion ..................................................................................................................................... 51

viii

6. Concluding remarks and future perspectives ..................................................................... 59

7. References..................................................................................................................................... 61

8. Annex .............................................................................................................................................. 75

ix

List of figures

Figure 1 – The three reactions that form the Ehrlich pathway and the genes that code for the enzymes

that catalyse each reaction. Taken from [78]. ....................................................................................... 11

Figure 2 – Biosynthesis of acetate esters (A) and of medium-chain fatty acid ethyl esters (B). The

genes that code for the enzyme responsible for the catalysis of each reaction are displayed above the

reaction arrows. Taken from [78]. ......................................................................................................... 13

Figure 3 – (A) Decarboxylation of phenylacrylic acids into vinyl phenols. S. cerevisiae and

Brettanomyces species can perform this reaction since they possess enzymes with phenylacrylic acids

reductase activity (B) Reduction of vinylphenols into ethylphenols. This reaction can be performed by

Brettanomyces species but not S. cerevisiae, since the former express the enzyme vinylphenol

reductase. Taken from [86]. .................................................................................................................. 16

Figure 4 – Overview of the biotransformation reactions of monoterpene alcohols and respective esters

catalysed by yeasts. The enzymes responsible for the catalysis of each reaction are indicated near the

reaction arrows. Enzymes in green have been experimentally verified in S. cerevisiae. Putative

enzymatic activities that have been implied from metabolite profiling in fermentations with S. cerevisiae

or bacteria are indicated in blue and orange, respectively. Taken from [16]. ....................................... 17

Figure 5 – Samples taken in each time point in the population dynamics studies............................... 23

Figure 6 – Progress of the first screening fermentations performed by different strains of H. uvarum

(IST412) and H. opuntiae (IST399, IST406 and IST408). .................................................................... 32

Figure 7 – (A) – Fermentation progress of single and mixed culture fermentations of H. opuntiae IST408

and S. cerevisiae US-05 fermentations performed for beer production. Orange dots correspond to H.

opuntiae IST408 single culture fermentation, blue dots correspond to S. cerevisiae US-05 single culture

fermentation, yellow dots correspond to sequential fermentation and grey dots correspond to

simultaneous fermentation. The growth curves shown are the result of three independent experiments

that gave rise to the same results. (B) – Fermentation progress of H. opuntiae IST408 single culture

fermentation, using a more appropriate scale. ...................................................................................... 34

Figure 8 – Sugars (maltose, maltotriose, fructose and glucose) and ethanol concentrations obtained

from single (H. opuntiae IST408 and S. cerevisiae US-05) and mixed (sequential and simultaneous)

culture fermentations. Samples were collected prior to fermentation and after primary and secondary

fermentations. An additional sample was collected at 48 hours in sequential fermentations, just before

the introduction of S. cerevisiae US-05. ................................................................................................ 36

x

Figure 9 – Total relative abundance of the four most ample chemical groups across all four

fermentations. Statistical significance was considered between mean values when *P-value<0.05; **P-

value<0.01; ***P-value<0.001; ****P-value<0.0001. T1 identifies samples taken after primary

fermentation and T2 identifies samples taken after secondary fermentation. ...................................... 37

Figure 10 – Relative abundance of the most abundant compounds of the acetate and ethyl esters

chemical groups. Statistical significance was considered between mean values when *P-value<0.05;

**P-value<0.01; ***P-value<0.001; ****P-value<0.0001. T1 identifies samples take after primary

fermentation and T2 identifies samples taken after secondary fermentation. ...................................... 41

Figure 11 – Relative abundance of the most abundant compounds of the higher alcohols and organic

acids chemical groups. Statistical significance was considered between mean values when *P-

value<0.05; **P-value<0.01; ***P-value<0.001; ****P-value<0.0001. T1 identifies samples taken after

primary fermentation and T2 identifies samples taken after secondary fermentation. ......................... 42

Figure 12 – (A) – Fermentation progress of single and mixed culture fermentations of H. opuntiae

IST408 and S. cerevisiae US-05 fermentations performed for population dynamics studies. Orange dots

correspond to H. opuntiae IST408 single culture fermentation, blue dots correspond to S. cerevisiae

US-05 single culture fermentation, yellow dots correspond to sequential fermentation and grey dots

correspond to simultaneous fermentation. The growth curves shown are the result of three independent

experiments that gave rise to the same results. (B) – Fermentation progress of H. opuntiae IST408

single culture fermentation, with a more appropriate scale. ................................................................. 44

Figure 13 – Sugars (maltose, maltotriose, fructose and glucose) and ethanol concentrations obtained

during the fermentation performed for the study of population dynamics in single (H. opuntiae IST408

and S. cerevisiae US-05) and mixed (sequential and simultaneous) culture fermentations. Samples

were periodically collected during 14 days. .......................................................................................... 45

Figure 16 – Alignments between a portion of the target gene sequences obtained by Sanger

sequencing and a portion of the non-mutated target gene sequences; A) Alignment between the non-

mutated ATF1 gene sequence and the mutated ATF1 gene sequence in CEN.PK113-7D atf1Δ; B)

Alignment between the non-mutated ATF2 gene sequence and the mutated ATF2 gene sequence in

CEN.PK113-7D atf2Δ; C) Alignment between the non-mutated EAT1 gene sequence and the mutated

EAT1 gene sequence in CEN.PK113-7D eat1Δ; D) Alignment between the non-mutated ATF2 gene

sequence and the mutated ATF2 gene sequence in CEN.PK113-7D atf1Δ atf2Δ; E) Alignment between

the non-mutated EAT1 gene sequence and the mutated EAT1 gene in CEN.PK113-7D atf1Δ atf2Δ

eat1Δ. .................................................................................................................................................... 49

xi

List of tables

Table 1 – Sequences of the oligos used in the disruption of ATF1, ATF2 and EAT1. ......................... 24

Table 2 – Plasmids created in this study. ............................................................................................. 25

Table 3 – Yeast strains from different species isolated from different samples. The IST Yeast Culture

Collection ID# and the identity (%) obtained in BLAST analysis performed in the NCBI database are

shown. ................................................................................................................................................... 31

Table 4 – pH values of the fermentation products obtained from the first screening fermentations. ... 32

Table 5 – Concentration of maltotriose, maltose, glucose, fructose and ethanol in the fermentation

products after 330 hours of fermentation. ............................................................................................. 33

Table 6 – pH value of the fermented products after the primary and secondary fermentations. ......... 35

Table 7 – Average relative abundance (RA) and standard deviation (SD) of all compounds identified in

single and mixed fermentations ............................................................................................................ 38

Table 8 – Sensory analysis notes of the expert panel for each beer produced in the beers fermented

by single cultures of H. opuntiae IST408 and S. cerevisiae US-05 and by simultaneous or sequential

mixed cultures of both species. ............................................................................................................. 43

xii

List of abbreviations

4-EG 4-ethylguaiacol

4-EP 4-ethylphenol

4-VC 4-vinylcatechol

4-VG 4-vinylguaiacol

4-VP 4-vinylphenol

4-VS 4-vinylsyringol

AATase Alcohol acetyl transferase

AEATase Acyl-CoA:ethanol O-acyltransferase

B. anomala Brettanomyces anomala

B. bruxellensis Brettanomyces bruxellensis

BCAA Branched-chain amino acid

BLAST Basic Local Alignment Search Tool

Car® Carboxen®

CFUs Colony Forming Units

CRISPR Clustered Regularly Interspaced Short Palindromic Repeats

ddH2O Double-distilled water

DMSO Dimethyl sulfoxide

DNA Deoxyribonucleic acid

dNTPs Deoxy nucleotide

DTT Dithiothreitol

DVB Divinylbenzene

E. coli Escherichia coli

EDTA Ethylenediaminetetraacetic acid

EMBOSS European Molecular Biology Open Software Suite

FA Ferulic acid

GC-MS Gas chromatography - Mass spectrometry

gRNA Guide RNA

H. guilliermondii Hanseniaspora guilliermondii

H. opuntiae Hanseniaspora opuntiae

H. uvarum Hanseniaspora uvarum

H. vineae Hanseniaspora vineae

HF High fidelity

HPLC High Performance Liquid Chromatography

HS-SPME Headspace solid-phase microextraction

IST Instituto Superior Técnico

ITS Internal transcriber spacer

L. thermotolerans Lachancea thermotolerans

LB Lysogeny broth

xiii

LBA Lysogeny broth ampicillin

MCFA Medium-chain fatty acids

MS Mass spectrometry

MUSCLE Multiple Sequence Comparison by Log-Expectation

NCBI National Center for Biotechnology Information

OD Optical Density

P. anomala Pichia anomala

P. kluyveri Pichia kluyveri

P. kudriavzevii Pichia kudriavzevii

pCA p-coumaric acid

PCR Polymerase Chain Reaction

PDMS Polydimethylsiloxane

PEG Polyethylene glycol

PTFE Polytetrafluoroethylene

rDNA Ribosomal DNA

RNA Ribonucleic acid

rpm Rotation per minute

S. cerevisiae Saccharomyces cerevisiae

S. eubayanus Saccharomyces eubayanus

S. pastorianus Saccharomyces pastorianus

SA Sinapic acid

STE Sodium chloride-Tris-EDTA

T. delbrueckii Torulaspora delbrueckii

TCM Tris-calcium-magnesium

TPP Thiamine diphosphate

Tris Tris(hydroxymethyl)aminomethane

VDKs Vicinal diketones

W. anomalus Wickerhamomyces anomalus

WLN Wallerstein Laboratory Nutrient

YM Yeast malt

YNB Yeast Nutrient Base

YPD Yeast Extract-Peptone-Dextrose

xiv

1

1. Motivation and thesis outline

Fermented beverages have been produced by humans for thousands of years. Although bacteria can

be involved, yeasts are the most important microorganisms in the production of alcoholic fermented

beverages [1]. These eukaryotic organisms are responsible for metabolizing the sugars of the

fermentative medium into carbon dioxide and ethanol and producing a wide variety of aroma and flavour

active compounds that can influence the organoleptic profile of the beverage [1]. Although the first

fermentations were the result of spontaneous fermentations and some beverages are still produced

using traditional methods, modern production methods use yeast starter cultures as a way to guarantee

a rapid start of fermentation, in order to avoid the risk of contamination by unwanted microorganisms

and the development of undesirable off-favours [2,3]. The use of starter cultures has been also

important to ensure that the production of beverages is consistent across fermentation batches, which

is an important factor for the growth of alcoholic fermented beverages industry [4]. A wide array of

yeasts are used in the production of alcoholic fermented beverages, with Saccharomyces cerevisiae

being the most used [5]. This species presents certain characteristics that justify its dominance in the

production of fermented beverages, such as being highly tolerant to ethanol and capable of producing

high concentrations of this compound, and displaying the Crabtree effect (respiration repression by

glucose), which allows S. cerevisiae to perform fermentation in the presence of oxygen [4,6,7].

Beer is the most consumed alcoholic beverage in the world. Industrial production of this beverage has

narrowed down the type of raw materials and yeast strains used in beer production, leading to more

standardized products across the market [8,9]. However, in the last decade, the increased popularity of

craft beers that differentiate themselves from industrial beers in the complexity of the beers produced,

led to the emergence of new craft breweries [8–10]. Craft breweries are micro to small independent

breweries that produce more traditional styles of beer, while also innovating with new and experimental

styles [8,9]. For instance, craft brewers have experimented mixing malts and hops from different beer

styles, utilizing water with different mineral composition and also using unusual ingredients in beer

production, such as fruit, mushrooms and aromatic herbs [8,9]. One ingredient of beer production that

has received less attention for innovation is the yeast. However, in recent years, this has been changing,

with craft breweries producing beers by fermenting with uncommon yeasts, such as S. cerevisiae Kveik

yeasts, strains traditional to Norwegian farmhouse brewing [11], and with non-Saccharomyces yeasts

that were previously considered spoilage yeasts in beer [12,13]. Due to the increased interest in the

non-Saccharomyces species, the number of studies regarding the isolation, identification and

characterization of the potential of these non-conventional yeasts for beer production is also increasing

[14]. The majority of non-Saccharomyces species are not capable of fermenting all the sugars present

in beer wort, so a co-fermentation with a S. cerevisiae strain is necessary to obtain a complete

fermentation [15]. Nonetheless, some non-conventional yeasts show promise in beer production due to

producing higher quantities of aroma and flavour active compounds than S. cerevisiae, mainly volatile

esters [6,12].

2

The fact that some non-Saccharomyces are good producers of volatile esters, especially acetate esters,

can also be of interest to other industries [16,17]. For instance, ethyl acetate, in spite of being one of

the most important aroma compounds present in fermented beverages, is also a valuable bulk chemical

in other industries, such as resins and adhesives production [17,18]. Since this ester is produced

industrially from petrochemical resources, yeasts that produce high amounts of ethyl acetate can

become an important alternative to the production of this compound [18].

The objective of this thesis work was the isolation, identification and characterization of non-

Saccharomyces species for the improvement of the organoleptic profile of beer, in particular at the level

of volatile esters that confer fruity and floral aromas to beer. Three samples from wine production

environments, as well as two other samples from fermented products were collected. Species isolated

in this work and that were part of the IST Yeast Collection were screened for their capacity to enhance

the organoleptic profile of beer. Hanseniaspora opuntiae IST408 was deemed the most interesting and

was chosen to undergo further studies. Sequential and simultaneous inoculation of mixed culture

fermentations of H. opuntiae IST408 and S. cerevisiae US-05, a commercial strain with a neutral aroma

profile, were performed, as well as single culture fermentations that served as control. Primary

fermentations were carried out at 20 ⁰C, during 14 days. After this, beers were transferred into bottles

that contained glucose, in order to perform a secondary fermentation and carbonate the beer. Samples

were taken before the start of fermentation and after both primary and secondary fermentations to

analytically characterize the beers produced. These samples were analysed by HPLC to assess ethanol

and residual sugar concentrations and by GC-MS to characterize the volatile profile. Beers were also

organoleptically evaluated by an expert panel composed by experienced beer tasters and professional

craft brewers. Population dynamics studies of the single and mixed culture fermentations were also

performed to assess the species behaviour when alone in the fermentative medium and when both

species were together in the same medium.

A secondary objective of this thesis work was the creation of a mutant of S. cerevisiae where the main

genes involved in acetate esters biosynthesis, ATF1, ATF2 and EAT1, were deleted. CRISPR-Cas9

methodology was used to construct the desired mutant. Confirmation of the deletion of the genes was

done by performing a restriction reaction with the mutated gene sequence, since in the case of a

successful mutation, a restriction site for a specific restriction enzyme was added to the mutated gene.

In addition, we sequenced the mutated genes from yeast colonies that yielded positive results in the

restriction analysis.

3

2. Introduction

2.1. Production of different types of beer by Saccharomyces yeasts

Although there is a vast number of different beer styles worldwide, these can be divided into two big

groups: ales and lagers [19,20]. Ales beers are top-fermented beers, in which fermentation occurs in

relatively high temperatures, between 18⁰C – 25⁰C [19,20]. Traditionally, this type of beer is called top-

fermented since the yeast species responsible for its production, Saccharomyces cerevisiae, exhibits

flotation and traps CO2 bubbles to form a yeast “head” at the top of the fermentation vessel [5,19,20].

However, in the modern cylindroconical vessels, due to the high hydrostatic vessels, this does not tend

to happen, and the cells tend to deposit at the bottom of the vessel [19]. On the other hand, lager beers

are bottom-fermented beers, which are fermented at low temperatures, between 5⁰C – 15⁰C [19,20].

Contrary to ale beers, the yeasts responsible for the production of this type of beer usually clump

together, resulting in flocs that settle at the bottom of the fermentation vessel [19,20]. The yeast

responsible for lager fermentation is Saccharomyces pastorianus, which originates from the

interspecific hybridization between Saccharomyces cerevisiae and Saccharomyces eubayanus, a

closely related species that was isolated in Patagonia, Argentina, and is not typically associated with

industrial fermentations [5,21,22]. Interestingly, there is far more diversity among ale yeast strains than

among lager yeast strains. It is suggested that this difference in variety arises from the fact that ale

yeast strains can be isolated from multiple locations, whereas lager yeast strains are not readily found

in nature, being present in very limited locations [19].

Nonetheless, in a different classification approach that is based on the inoculation method, beers can

also be divided into two other groups: controlled fermentations or spontaneous fermentations.

Controlled fermentations encompass almost all beer styles where a yeast starter culture is used in order

to start fermentation, whereas spontaneous fermentations only include certain beer styles that are still

produced by traditional processes [23,24]. Common examples of this group are traditional beer styles,

such as Lambic, Gueuze and Berliner Weisse, or more recent ones, like American Sour [23,24]. The

particularity of these beers is that not only are they fermented by S. cerevisiae (meaning that they are

also ale beers), but they are also fermented by other microorganisms that are present in the production

environment, such as Brettanomyces species and acid-lactic and acetic-acid bacteria, which confers a

unique organoleptic profile to these beers [24].

2.2. Domestication of yeasts in beer production

Domestication is defined as human selection and breeding of wild species to obtain cultivated variants

with enhanced desirable features that thrive in man-made environments, but behave suboptimally in

natural environments [25]. From all the yeasts used in industrial production, S. cerevisiae is the most

4

well studied regarding its domestication [5]. This species is used in a vast number of industrial

fermentations but, interestingly, the strongest genetic and phenotypic traits of domestication are found

in S. cerevisiae strains used for beer production [5,25]. Several factors are thought to contribute to this

phenomenon, such as beer yeasts being harvested from previous fermentations and re-used in order

to start the next fermentative batch, resulting in a continuous selection imposed by the brewing

environment [5,19]. In addition, beer production occurs throughout the year, which leads to brewing

yeasts being almost completely isolated from wild yeasts. In contrast, wine making is a seasonal

production, so wine yeasts only grow in wine must in a limited time period, while spending most of the

year in the vineyards or in the guts of insects, where they can contact and share genetic material with

wild yeasts [5,25,26].

The most common trait of S. cerevisiae domestication and adaptation to brewing environments is its

ability to ferment maltotriose. This compound is one of the main sugars of beer wort, but is rarely found

in high concentrations in natural yeast environments. Efficient metabolism of maltotriose imposes a

selective advantage in brewing environments since it is an under-utilized energy source by other yeasts

[5,25]. Another well-documented domestication trait is the low production of undesirable compounds,

such as vinylguaiacol (4-VG). Various independent nonsense mutations in the genes involved in the

synthesis of these compounds have been identified in several strains used in beer production, but not

in S. cerevisiae strains used in other industrial activities [5,25,27]. Since S. cerevisiae strains

domesticated for beer production are adapted to favourable environments and are not usually exposed

to an unfavourable one, they present a lack of sexual cycle, which is a crucial trait to a rapid adaptation

to harsh environments but yields no benefits in favourable conditions [5,25].

The majority of studies involving S. pastorianus focus on the origins of this hybrid and not on its

domestication [5]. However, some studies indicate that this hybrid may have arisen from a

domestication phenomenon, since it shows a strong selective advantage over its parental species in

lager brewing conditions [5,21]. Some authors argue that the cold-tolerance displayed by this species

is conferred by the S. eubayanus genome, while the S. cerevisiae genome confers the other brewing

adaptations, mentioned above when discussing S. cerevisiae domestication [5,21].

2.3. Non-Saccharomyces yeasts in beer production

2.3.1. Pichia species

Yeasts from the genus Pichia are one of the most commonly found yeasts in grapes and wine must

[28]. The most studied species regarding their application in production of fermented beverages are

Pichia anomala, Pichia kluyveri and Pichia kudriavzevii [1,29,30]. All these three species are capable

of fermenting glucose [31], with P. anomala also being capable of fermenting sucrose [32,33]. Some

strains of P. anomala are also capable of fermenting galactose [31,33] and maltose [34].

5

Strains of this genus are able to grow in a wide temperature range (between 3⁰C and 37⁰C), under

extreme pH values (between 2.0 and 12.4) [6,35] and in high osmotic pressure, being efficient in their

mechanisms of adaptation to stress factors [6,33]. Although they show tolerance to these harsh

conditions, which can occur during fermentations, these yeasts are not particularly tolerant against

acetate and ethanol [6,36].

When using Pichia species in mixed culture fermentations with S. cerevisiae, it should be taken into

account the fact that some species, like P. anomala and P. kudriavzevii, can produce killer toxins with

antimicrobial activity, which might be effective against certain S. cerevisiae strains [37,38].

Regarding the production of sensory active compounds, P. anomala is an especially good producer of

ethyl acetate [6,35,36]. The production of this compound is a way to prevent toxic accumulation of acetic

acid inside the cells in limited oxygen conditions [35], since P. anomala synthesizes ethyl acetate from

acetate and ethanol by a reverse reaction of esterase [39,40]. Ethyl acetate directly affects both aroma

and flavour profile of beverages, giving an interesting fruity character, when in low concentrations, or

an unpleasant solvent-like aroma, when in higher concentrations [6,41].

Studies have shown the potential of P. kluyveri in the production of low-alcohol or alcohol-free beers,

due to its low fermentative power, with glucose being the only sugar present in beer wort that this yeast

is capable of fermenting [14,31,42]. It has also been shown that P. kluyveri can produce relatively high

amounts of volatile thiols such as 3-mercaptohexyl (passion fruit aroma) and 3-mercaptohexan-1-ol

(grapefruit aroma) in Sauvignon Blanc wines [14,43], and high amounts of isoamyl acetate (banana

aroma) and ethyl acetate (fruity aroma) in sequential beer fermentations with S. cerevisiae [44].

P. anomala has also been studied for the production of beer, with single culture fermentations of this

yeast producing clean, aromatic and fruity beers, with notes of pears, apple and apricot [45]. The use

of P. anomala in mixed culture fermentations with S. cerevisiae has also been studied, with beers

produced by this approach showing an increase in ethyl butanoate and ethyl acetate and a reduction in

acetaldehyde when compared to beers produced by single culture of P. anomala or S. cerevisiae, which

positively affected the aromatic profile of the beers produced [46].

P. kudriavzevii can have interesting applications in wine production, since this species can degrade

malic acid, thus contributing to the deacidification in the production of young wines [47]. Some P.

kudriavzevii strains have been reported as capable of producing extremely high amounts of ethyl

acetate but low amounts of isoamyl acetate in sequential beer fermentations with S. cerevisiae [44].

2.3.2. Torulaspora species

Torulaspora delbrueckii is considered the most important species of Torulaspora genus in the

production of fermented beverages [14]. This yeast can be isolated from grapes, fermenting wine must

or ageing wine [28]. T. delbrueckii is used in the production of red, rosé and sparkling wines [14,48,49]

6

and was one of the first commercial non-Saccharomyces species to be released as a starter [48–50].

Some authors indicate that this yeast is involved in the fermentation of traditional Bavarian wheat beers

[6,14,51].

T. delbrueckii can withstand high osmotic pressures [52,53], can grow well at low temperatures and

require oxygen to ferment, although not displaying the Custers effect (inhibition of fermentation in

anaerobic conditions and stimulation of fermentation in aerobic conditions) [52,54,55]. This yeast

species is capable of consuming sucrose, due to the fact that it presents invertase activity [6,56], with

some strains being described as capable of consuming maltose and maltotriose, which are the most

abundant sugars in beer wort [52,56]. Ethanol tolerance and fermentation efficiency are considered

strain-dependent features [6,14,51]. Studies show that certain strains can tolerate up to 5% (v/v) ethanol

in beer wort [56], while other strains are able to tolerate up to 11% (v/v) ethanol in wine must [51].

Studies that focused on the use of T. delbrueckii in beer fermentation indicated that this yeast presents

low production of phenolic off-flavours but a high acetaldehyde production [6,57], which is pleasant in

low concentrations, but in high concentrations gives an undesirable “grassy” aroma [14]. It has also

been shown that certain strains are capable of hop monoterpene alcohols into other derivatives

[14,44,58]. Beers produced by mixed culture fermentations of T. delbrueckii and S. cerevisiae presented

a fruity and citric flavour, with a very pleasant aroma, while beers produced with T. delbrueckii pure

cultures showed a similar but not as pronounced aroma profile and lower ethanol concentration

[51,56,57].

2.3.3. Brettanomyces species

In spite of being considered a spoilage yeast in wine and soft drinks [6,14,59,60], Brettanomyces

species are important yeasts in the production of certain beer styles, such as the traditional Lambic and

Gueuze beers of Belgium [3,23,59]. Yeasts from these genus display tolerance to osmotic pressure,

ethanol, limiting oxygen and pH, with the extent of these characteristics being species and strain specific

[6,59].

Brettanomyces anomala and Brettanomyces bruxellensis are the Brettanomyces species most studied

and the most utilized in beer fermentations, and are usually found in the surface of grapes and in

spontaneous fermentation beers, such as the styles mentioned above, particularly during the maturation

step [28,59,61]. Both species display the Crabtree effect (respiration repression by glucose), contrarily

to other Brettanomyces species, such as Brettanomyces naardenensis [59], and the Custers effect

[59,62,63]. These two species show different ethanol tolerance, with B. bruxellensis being resistant to

concentrations of up to 13.5 – 15% (v/v) of ethanol, whereas B. anomala is more susceptible, tolerating

concentrations of up to 8% (v/v) of ethanol [64]. The capacity of these species to tolerate relatively high

concentrations of ethanol is associated to a “make-accumulate-consume” strategy, where yeasts first

produce ethanol to prevent the growth of competing microorganisms and then respire the ethanol when

7

the fermentable sugars are depleted [65,66]. The production of acetic acid in aerobic conditions that B.

bruxellensis and B. anomala display, coupled with their ability to withstand low pH environments [67,68],

is another example of an additional “make-accumulate-consume” strategy that these yeasts present

[6,59,66]. In Lambic beers, the presence of acetic acid is considered positive, in concentrations between

0.4 – 1.2 g/L, although in other beers styles it might be considered negative [59].

B. bruxellensis and B. anomala are capable of fermenting most of the sugars present in beer wort, such

as glucose, fructose and maltose [59,69–71]. But, most importantly, B. anomala and B. bruxellensis are

able to degrade and ferment complex sugars, such as cellobiose and dextrins, which are not readily

utilized by Saccharomyces species [6,59]. Dextrins, such as maltotetraose and maltopentaose, are the

main components of the residual sugar content of beers fermented by Saccharomyces species [59].

Brettanomyces species produces an enzyme, α-glucosidase, which enables the hydrolysis of these

dextrins into fermentable glucose monomers, resulting in “superattenuated” beers with higher ethanol

levels and lower sugar concentrations (lower caloric contents) [59,72]. These yeasts also produce β-

glucosidase, an enzyme that allows the degradation of cellobiose, disaccharide found in wooden

barrels, commonly used to mature beers and wine [73,74]. This enzyme also allows the hydrolysis of

glycosides, which are water soluble, non-volatile and odourless compounds composed by one aroma

active (volatile) molecule bound to one β-D-glucose, with possible additional sugar units attached

[6,75,76]. These compounds are present in hops, one of the principal ingredients of beer, and in other

uncommon beer ingredients such as fruits, flowers and other plant parts [59,74,76,77]. The hydrolysis

of the glycosidic bond by the β-glucosidase releases the aroma active compound, which can positively

affect the aroma profile of the beverage [59,75,76].

Like other non-Saccharomyces species, B. bruxellensis and B. anomala have been described as

improving organoleptic profile of beer, by contributing to an overall fruity and floral aroma [6].

Interestingly, the ester profile produced by these Brettanomyces species is quite different than the

previously described non-Saccharomyces species, with B. bruxellensis and B. anomala producing high

amounts of ethyl acetate (fruity aroma [41,78]) ethyl hexanoate (apple, fruity, pineapple aroma [14,41])

and ethyl octanoate (apple, waxy, aniseed, musty aroma [14,41]) and low amounts of isoamyl acetate

and phenethyl acetate [6,14,23,24]. This imbalance between acetate and ethyl ester concentration is

caused by the degradation of acetate esters by the esterase enzyme present in Brettanomyces species,

which is much more efficient in hydrolysing acetate esters than non-acetate esters [59,79,80].

However, these Brettanomyces species produce some peculiar and characteristic volatile phenolic

compounds [81]. B. anomala and B. bruxellensis produce these compounds by metabolizing certain

acids present in beer wort, such as p-coumaric, ferulic and caffeic acids [14]. These acids are present

in the peel, pericarp and endosperm of cereal grains, associated to the arabinoxylans structural

carbohydrates, and are incorporated into beer wort during the mashing process [82–84]. The most

important volatile phenol compounds produced by these yeasts are 4-vynilphenol (4-VP), 4-

vynilguaiacol (4-VG), 4-ethylphenol (4-EP) and 4-ethylguaiacol (4-EG) [59]. The aroma that 4-VP and

4-EP give to the beverage is described as medicinal and horsy, with clove being used to describe the

aroma 4-VG and 4-EG impart to the beverages, and spicy also being used to describe 4-EG [85,86].

8

Although the presence of these compounds is considered an off-flavour in the majority of beer styles,

they are desirable in certain styles such as Lambic, Gueuze and Red Flanders [82].

2.3.4. Hanseniaspora species

Yeasts from the Hanseniaspora genus have not been significantly studied concerning beer

fermentation. However, some species are well-characterized, mainly Hanseniaspora uvarum and

Hanseniaspora guilliermondii, due to their important role in wine fermentation [87,88], in which they

confer a wide variety of aroma active compounds to the wine [89–91]. H. uvarum and H. guilliermondii

are the non-Saccharomyces yeasts most commonly found in grape berries and are also frequently

found at the start of wine must fermentation [48,92–94]. Although they are not commonly isolated from

spontaneously fermented beers, yeasts from this genus have been found in Lambic beers (a

spontaneous fermentation beer style) in a study that detected the presence of Hanseniaspora species

DNA in beer by utilizing Denaturing Gradient Gel Electrophoresis. However, in this study it was not

possible to isolate Hanseniaspora species from beer, indicating that they can be present in viable but

non-culturable state [3].

Hanseniaspora species show a low fermentative power, which could arise from the fact that they are

not capable of synthesizing certain vitamins like thiamine [91], whose concentration was linked to the

fermentation rate in S. cerevisiae, by determining the glycolytic flux [95,96]. However, these yeasts

produce a wide range of volatile compounds and in high quantities [28,48,97]. Acetate esters is a

chemical group that these species produce in high quantities, with ethyl acetate and phenethyl acetate

being the most prevalent, conferring fruity or flowery and rose aroma, respectively, to the final fermented

product [41,48,78]. These yeast have also been used in wine fermentations to reduce acidity or alcohol

levels [88,98,99]. In beer wort, these yeasts are not capable of fermenting maltose and maltotriose,

since they do not possess transporters for the uptake of these sugars [91].

Although being present in high numbers in the first stages of fermentation, the Hanseniaspora spp.

population diminishes as fermentation proceeds, like most other non-Saccharomyces yeasts [93,100–

102]. The increase in ethanol concentration has been hypothesised as the main cause for this decrease

in population, since usually non-Saccharomyces species found on grapes are not tolerant to ethanol

concentrations above 5-7% (v/v) [99,102,103]. However, recent studies indicate that ethanol tolerance

by Hanseniaspora spp. might be strain-specific, particularly in H. guilliermondii strains, presenting a

relatively high tolerance to ethanol [100,104,105].

Hanseniaspora uvarum is considered to be particularly suitable to be used in wine mixed fermentations

with S. cerevisiae, since the former is fructophilic and the latter is glucophilic, which leads to a faster

fermentation process [88]. Wines produced by mixed culture fermentations of H. guilliermondii and S.

cerevisiae presented higher concentrations of acetate and ethyl esters when compared to wines

produced by S. cerevisiae pure culture fermentations [106,107].

9

Hanseniaspora guilliermondii and Hanseniaspora vineae have been studied regarding their application

in beer production. In the case of H. guilliermondii, previous work performed in our laboratory

demonstrated that beers produced by mixed culture fermentation of this species and S. cerevisiae

showed an increase in ethyl acetate content when compared to beers produced by S. cerevisiae single

culture, leading to beers with a fruity aroma [108]. Regarding H. vineae, strains of this species have

been tested for the production of sour beers without use of lactic-acid bacteria. Beers produced by H.

vineae single cultures showed an organoleptic profile very similar to the ones produced by lactic-acid

bacteria, with a high concentration of lactic acid, although longer fermentation times (four weeks) were

necessary to obtain the final product [45]. H. vineae strains have also been tested for the production of

low-alcohol beers, with its fermentation product aroma profile being described as wort- and bread-like,

as well as black tea and caramel being used as descriptors [42].

Hanseniaspora opuntiae has not been intensively studied like H. guilliermondii or H. uvarum.

Nonetheless, studies have shown that wines produced by mixed culture fermentations of H. opuntiae

and S. cerevisiae presented higher levels of higher alcohols and phenylacetaldehyde, intensifying the

floral and sweet aroma of the wine [97,109], as well as an increase in anthocyanins-derived pigments

[110], which contributed to an enhanced colour stability [97,110,111].

However, not all Hanseniaspora strains can be used in mixed culture fermentations with S. cerevisiae

since some are capable of producing toxins that could lead to the death of S. cerevisiae cells, with the

reverse being also true [91,112].

2.3.5. Other yeast species

Saccharomycodes ludwigii is commonly used in the production of low-alcohol or alcohol-free beers,

since it is not capable of fermenting maltose and maltotriose [4,14]. This yeast species produced esters

that were able to mask the typical wort-like flavour that are usually described in alcohol-free or low

alcohol beers [4,14].

Beers produced by mixed culture fermentations of L. thermotolerans and S. cerevisiae showed

increased content of ethyl acetate [46], whereas pure culture fermentations of L. thermotolerans showed

high concentrations of lactic acid, similar to the amounts produced by acid-lactic bacteria in sour beer

fermentations [45].

The use of Zygotorulaspora florentina in mixed culture fermentations with S. cerevisiae for beer

production has also been studied, with the beers produced showing an increase in isoamyl acetate and

α-terpineol [46]

10

2.4. Volatile compounds produced by yeasts

2.4.1. Higher alcohols

Higher alcohols, also called fusel alcohols, are the most abundant organoleptic compounds present in

beer [78]. These compounds present an –OH group and more than two carbons and can significantly

contribute to the aroma and flavour profile of fermented beverages, contributing with floral, fruity or

herbal aromas depending on the synergistic effects displayed with other flavour-active compounds

present in the beverage [14]. Over 40 different higher alcohols have been identified in beer, with

isobutanol (solvent aroma), n-propanol (sweet aroma), isoamyl alcohol (banana aroma) and phenethyl

alcohol (roses, honey aroma) being considered the most important in beer [14,113].

Production of higher alcohols is a by-product of amino acid metabolism and catabolism of yeasts [14].

The majority of research regarding the biosynthesis of higher alcohols has been performed in S.

cerevisiae, and it is assumed that non-Saccharomyces species synthesize higher alcohols in similar

ways, although with differences in gene expression and pathway regulation [87,114].

In S. cerevisiae, the Ehrlich pathway is the principal and most studied pathway for higher alcohols

biosynthesis (Figure 1) [115]. This metabolic pathway is comprised of three steps, transamination,

decarboxylation and reduction, in which amino acids are degraded and metabolized into higher alcohols

[78,114].

The first step in the Ehrlich pathway is a transamination step, in which four transaminases are involved

[78,116]. These enzymes catalyse the transfer of amines between amino acids and their respective α-

keto acid, using glutamate and α-ketoglutarate as a donor and acceptor, respectively [115]. These

transaminases are encoded by the genes BAT1, BAT2, ARO8 and ARO9 [78,117]. Bat1 and Bat2 are

branched-chain amino acid (BCAA) aminotransferases involved in the BCAA transamination, whereas

Aro8 and Aro9 are aromatic amino acids aminotransferases I and II, respectively, involved in the

transamination of aromatic amino acids and also methionine and leucine [78,118,119]. These enzymes

are responsible for deamination amino acids, enabling the incorporation of the amino group into the

yeasts’ own structure [114].

The second step of the Ehrlich pathway, consists on an irreversible reaction where the remaining α-

keto acids are decarboxylated to form the respective fusel aldehyde [78,116]. There are four

decarboxylases involved in this step of the pathway, which are encoded by four different genes.

Specifically, PDC1, PDC5 and PDC6 code for pyruvate decarboxylases and ARO10 codes for

phenylpyruvate decarboxylase [120,121]. The activity of all four enzymes depend on the cofactor

thiamine diphosphate (TPP) [78]. Pdc5p and Aro10p were described as having a broader substrate

specificity than Pdc1p and Pdc6p [120,122]. In S. cerevisiae, there is another gene that encodes a

11

decarboxylase, THI3 [78]. However, studies suggest that the role of the enzyme encoded by this gene

is more regulatory than catalytic, being involved in the biosynthesis of thiamine [123].

Figure 1 – The three reactions that form the Ehrlich pathway and the genes that code for the enzymes that catalyse each reaction.

Taken from [78].

In the last step of the Ehrlich pathway, the fusel aldehydes are converted into their respective alcohols

by the action of alcohol dehydrogenases [78,116]. This conversion is the result of a reduction reaction

that can be performed, in S. cerevisiae, by any of the alcohol dehydrogenases encoded by ADH1,

ADH2, ADH3, ADH4 and ADH5 or the formaldehyde dehydrogenase encoded by SFA1 [116]. To note

that instead of being reduced into higher alcohols, fusel aldehydes can be oxidized into the respective

fusel acid, depending on the redox balance of the cell. In fermentative growth, with sufficient amounts

of glucose, the reduction reaction is favoured [115,116].

Although the Ehrlich pathway is the most studied, higher alcohols can also be produced during

upstream (anabolic pathway) biosynthesis of amino acids [14,124]. The most important of these

pathways are the de novo synthesis of BCAA through the isoleucine-leucine-valine pathway or through

carbohydrate metabolism [14,114,115].

2.4.2. Volatile esters

Volatile esters are only trace elements when compared with other metabolites produced by yeasts.

However, they are one of the most important aroma active compounds since they have low sensorial

threshold, influencing the organoleptic profile of beers even at low concentrations [20,41,125,126].

Nevertheless, their presence can be felt even at concentrations below their sensorial threshold, due to

12

the presence of different esters having synergistic effects on the individual flavours [41]. These

compounds can impart beer with a wide variety of fruity aroma but, if overproduced, they can negatively

affect the beverage with an undesirable bitter, over fruity taste [14].

The majority of esters are formed during the active phase of the primary fermentation by the enzymatic

condensation of organic acids with alcohols. Volatile esters present in beer can be divided into two

major groups, acetate esters and medium-chain fatty acids (MCFA) ethyl esters [78,114]. Acetate esters

are synthesized from acetic acid (acetate) with ethanol or a higher alcohol, whereas ethyl esters are

formed from a medium chain (6 to 12 carbon atoms) fatty acids and an ethanol radical [14,78,114].

Although a large number of different esters can be identified in beer, some are considered of major

importance in regards to beer aroma, particularly ethyl acetate (fruity, solvent-like aroma), isoamyl

acetate (banana aroma), isobutyl acetate (sweet aroma), phenethyl acetate (roses, honey aroma), ethyl

hexanoate (apple, fruity, pineapple aroma) and ethyl octanoate (apple, aniseed aroma) [41,78]. Acetate

esters are present in higher concentration in beer than ethyl esters, which can be correlated with their

capability of diffusing through the plasma membrane [78]. Esters are synthesized in the cytoplasm and

can readily leave the cell since these compounds are lipophilic. However, while small-chain acetate

esters can easily diffuse through the membrane, MCFA ethyl ester diffusion rates decrease as the

length of the aliphatic tail increases [78,127,128].

In order to be synthesized into esters, organic acids must be linked to a coenzyme A to form an acyl-

CoA molecule. This thioester linkage will provide the necessary energy to catalyse the enzymatic

reaction to synthesize the acetate or MCFA ethyl esters, which differs for both cases (Figure 2)

[78,114].

Acetate esters are synthesised by the enzymes alcohol acetyl transferases (AATase) I and II, which

are encoded by the genes ATF1 and ATF2, respectively [129,130]. Interestingly, it was found that

bottom fermenting lager yeasts possess an extra ATF1 homologous gene (Lg-ATF1), which encodes

an AATase very similar to AATase I [129]. The expression of this additional gene enhances acetate

ester production and can explain why lager beers normally present higher concentrations of acetate

esters than ale beers [78]. However, recent studies have also shown that other enzymes might be

involved in the synthesis of acetate esters, which is the case of the AATase family encoded by EAT1

and its homologues [17,131,132].

On the other hand, MCFA ethyl esters are synthesized by two acyl-CoA:ethanol O-acyltransferases

(AEATases), Eeb1 and Eht1, which are encoded by the genes EEB1 and EHT1, respectively [133,134].

Evidences obtained from deletion mutants show that Eeb1 is the main enzyme in the condensation

reaction to produce the ethyl ester, whereas Eht1 plays a minor role [133,134]. Also, double deletion of

these genes did not completely abolished the production of MCFA ethyl esters, which indicates that

other enzymes might be involved in ethyl ester synthesis [78,133,134]. Both Eeb1 and Eht1 also display

esterase activity, which explains why the overexpression of their encoding genes did not lead to an

increase in MCFA ester production [78,133].

13

Figure 2 – Biosynthesis of acetate esters (A) and of medium-chain fatty acid ethyl esters (B). The genes that code for the enzyme

responsible for the catalysis of each reaction are displayed above the reaction arrows. Taken from [78].

The final concentration of volatile esters is not only affected by their production rate, but also by the

activity of esterases [134–136]. As mentioned above, MCFA ethyl esters can be hydrolysed by the same

enzymes involved in their production [133,134]. In the case of acetate esters, a carboxylesterase

encoded by the gene IAH1 is involved in the hydrolysis of isoamyl acetate, ethyl acetate, phenethyl

acetate and hexyl acetate [135,136]. Also, volatile ester production is both species- and strain-

dependent, with a high number of non-Saccharomyces species presenting higher production of these

compounds than S. cerevisiae [6,41].

2.4.3. Carbonyl compounds

A large number of carbonyl compounds, over 200, have been reported as contributors to the aroma and

flavour of fermented beverages [114,137], although concentrations of these compounds is usually low

in beer [12,138]. As the name implies, these compounds present a carbonyl group (an oxygen atom

double bonded to a carbon atom), and two groups in particular, aldehydes and vicinal diketones, are of

interest in regards to the organoleptic profile of beer due to being considered undesirable in beer when

in excessive concentration, since they cause a stale flavour [12,137,139].

14

Acetaldehyde is the aldehyde present in higher concentration in beer. It is produced by yeast during the

growth phase, as a result of the decarboxylation of pyruvate [114]. It is an intermediate in the formation

of ethanol and acetate and when in concentrations above its sensorial threshold level (10 – 20 mg/L) it

gives an undesirable grassy or green apple-like aroma to the beer [12,14,114]. Similarly to higher

alcohols and esters, the extent of acetaldehyde accumulation depends on the yeast strain utilised and

the fermentative conditions [114].

Several vicinal diketones (VDKs) are present in beer but the most important when considering the

organoleptic profile of beer are 2,3-butanedione (diacetyl) and 2,3-pentanedione [140]. Diacetyl

presents a very low sensorial threshold (0.1 – 0.15 mg/L) and gives a very potent butter or butterscotch

aroma, with 2,3-pentanedione presenting a similar flavour to diacetyl, although often described as more

toffee-like, but with a higher sensorial threshold (0.9 mg/L) [14,20,139]. VDKs are more easily detected

in lighter beers, where their contribution to aroma and flavour is not masked by malt and hop flavour

and aroma [139]. Diacetyl and 2,3-pentanedione are formed as by-products of valine and isoleucine

synthesis, respectively [14,114,139]. They arise from spontaneous non-enzymatic oxidative

decarboxylation of α-acetohydroxy acids that are intermediates in the aforementioned pathways

[114,139]. Valine and isoleucine synthesis occurs in the mitochondria, whereas the described

spontaneous reactions occur in the wort, so the intermediates, α-acetolactate in the case of valine

pathway and α-acetohydroxybutyrate in the case of isoleucine pathway, need to be secreted out

through the cell membrane [12,139]. The reasons and mechanisms involved in this secretions are not

fully understood, but it is hypothesized that it might occur to protect the yeast from carbonyl stress [139].

At the end of fermentation and during maturation phase, diacetyl is taken up by yeast and reduced to

2,3-butanediol, a compound that does not affect beer flavour and aroma due to its relatively high

sensorial threshold [12,139]. Nevertheless, the presence of diacetyl in detectable concentrations is

acceptable in some beer styles, such as Bohemian Pilsner and some English ales [114,139].

2.4.4. Organic acids

Yeast cells can produce a wide variety of organic acids during fermentation, which can contribute to the

organoleptic profile of beer with sour or acidic notes [141]. Besides contributing to flavour and aroma,

organic acids can also influence the chemical stability and pH of beer [14]. Organic acids can be divided

into two groups, volatile and non-volatile organic acids [14]. The production of organic acids depends

on the yeast strain, with most of these compounds being by-products of glycolysis, the citric acid cycle

and amino acid and fatty acids metabolism [14,141–143].

The main volatile organic acids that can occur in beer are acetic, propionic, isobutyric, butyric, isovaleric,

hexanoic, octanoic, decanoic and dodecanoic acids. When present in high concentrations, these acids

can contribute with a sour and salty flavour, but can also contribute to off-flavours, which are usually

described as cheesy and sweaty [14,143]. Of the eight volatile organic acids previously mentioned, the

15

ones that impact flavour the most are acetic, octanoic, decanoic and dodecanoic acids. Acetic acid can

give a vinegary aroma and flavour but it presents a relatively high sensorial threshold (175 mg/L).

Octanoic acid presents a lower sensorial threshold (15 mg/L) and its aroma is described as goaty.

Decanoic acid is described as having a waxy aroma and presents a threshold of 10 mg/L. Finally,

dodecanoic acid presents the lowest sensorial threshold of the four (6.1 mg/L) and its aroma is

described as soapy [14].

To influence the aroma profile of beer, non-volatile organic acids need to be present in the beverage in

quite high concentrations, since they present a high sensorial threshold [14]. The main non-volatile

acids produced by yeast that can affect beer aroma and flavour are by-products of the citric acid cycle,

such as succinic, citric, fumaric and pyruvic acids [14,141,142]. Succinic acid presents the lowest

threshold of the highlighted compounds (220 mg/L) and an acidic aroma [14,142]. Pyruvic acid presents

a salty and straw-like, with a sensorial threshold of 300 mg/L [14,142]. Both citric and fumaric acids

present a sensorial threshold of 400 mg/L and sour aroma, with fumaric acid aroma also being

described as acidic [14,141,142]. Other commonly found non-volatile organic acid, mainly in Lambic

beers, is lactic acid, which also presents a sour and acidic aroma, with a sensorial threshold of 400

mg/L [14].

2.4.5. Volatile sulphuric compounds

The principal volatile sulphuric compounds that are produced by yeast and can influence the

organoleptic profile of beer are sulphur dioxide and hydrogen sulphide [14,114]. Both compounds arise

as by-products from the biosynthesis of the sulphur-containing amino acids cysteine and methionine

from sulphate. Biosynthesis of these amino acids only occurs when the wort is depleted of cysteine and

methionine [114]. Production of sulphur dioxide and hydrogen sulphide is both species- and strain-

dependent, and is determined as well from the wort composition [14,114]. Sulphur dioxide is important

in flavour stability, acting as an antioxidant in the finished beer, considerably increasing its shelf life

[14]. This compound presents a sulphurous sensorial threshold of 2.5 mg/L, which is considered a

positive trait in some bottom-fermented beers [14]. On the other hand, hydrogen sulphide is considered

an undesirable compound due to having a rotten egg aroma, coupled with a very low sensorial threshold

(0.005 mg/L), which gives this compound a high potential to mask other positive aromas and flavour

that might be present in beer [14,114].

2.4.6. Volatile phenols

Volatile phenols have been reported to contribute to the aroma of both alcoholic and non-alcoholic

beverages [84]. Although the majority of these compounds are considered off-flavours, their presence

is desirable in some beer styles, such as Lambic and Gueuze beers [82,84]. Among the flavour-active

16

volatile phenol, 4-vinylguaiacol (4-VG), 4-vinylphenol (4-VP), 4-ethylguaiacol (4-EG), 4-ethylphenol (4-

EP), 4-vinylsyringol (4-VS), 4-vinylcatechol (4-VC), styrene, eugenol and vanillin have been identified

in beer [14,84,86]. Between these volatile phenols, 4-VP and 4-VG are the most common in

fermentations carried out by S. cerevisiae and are undesirable in high concentrations in the majority of

beer styles due to their strong medicinal and clove-like aroma [59,84,85].

Volatile phenols’ biosynthesis is both species- and strain-dependent, as well as being dependent on

the concentration of precursors in the beer wort, the hydroxycinnamic acids (also known as

phenylacrylic acids) [14,44]. Some of these acids are more abundant in beer wort, such as the p-

coumaric and ferulic acids, which are present in cereal grains and are incorporated into beer wort during

the mashing process [82–84]. Some yeast are capable of performing a non-oxidative decarboxylation

of these hydroxycinnamic acids into volatile phenols (Figure 3) [85]. In the case of S. cerevisiae, this

reaction is catalysed by the enzymes phenylacrylic acid decarboxylase and ferulic acid decarboxylase,

which are encoded by the gene PAD1 and FDC1, respectively [86,144]. These enzymes are responsible

for the decarboxylation of p-coumaric and ferulic acids into 4-VP and 4-VG, respectively [86].

Brettanomyces yeasts also possess the enzyme phenylacrylic acid decarboxylase, encoded by the

gene DbPAD [59,145]. However, contrary to S. cerevisiae, Brettanomyces species are capable of

reducing vinylphenols into ethylphenols, in a reaction catalysed by the enzyme vinylphenol reductase

(Figure 3) [59]. Ethylphenol presents aromas similar to their precursors but their sensorial threshold is

lower. The reduction of 4-VP leads to 4-EP that presents a horsey and medicinal aroma, whereas the

reduction of 4-VG leads to 4-EG, which presents a spicy and clove-like aroma [59,85].

Figure 3 – (A) Decarboxylation of phenylacrylic acids into vinyl phenols. S. cerevisiae and Brettanomyces species can perform

this reaction since they possess enzymes with phenylacrylic acids reductase activity (B) Reduction of vinylphenols into

ethylphenols. This reaction can be performed by Brettanomyces species but not S. cerevisiae, since the former express the

enzyme vinylphenol reductase. Taken from [86].

17

2.4.7. Monoterpene alcohols

Aroma active terpenoids contribute with a highly floral, citrus and fruity aroma to beer, although being

present in much lower concentrations than other volatile compounds, due to their very low sensorial

threshold [16,58,146]. These compounds are found in beer due to being present in high concentrations

in hops, with each hop variety presenting a different terpenoid profile [58,146]. Even though other

terpenoids, such as sesquiterpenoids, can be found in hops, monoterpenes present the highest

concentration, in upwards of 75% of hops’ total terpenoid content [16]. Monoterpene alcohols can be

metabolized by some yeasts, through esterification, hydrolysis, isomerization and other types of

reaction, leading to a higher monoterpene diversity after fermentation (Figure 4) [14,16]. Also, these

compounds can also be found in beer wort in glycosidically bound forms, which are aroma inactive, and

yeasts that possess the enzyme glucoside hydrolase can cleave this chemical bound, releasing the

aroma active monoterpene [58]. The monoterpene alcohols most commonly found in beer are linalool

(lavender aroma, sensorial threshold of 5 µg/L), α-terpineol (lilac aroma, sensorial threshold of 2 mg/L),

β-citronellol (lemon and lime aroma, sensorial threshold of 8 µg/L), geraniol (rose aroma, sensorial

threshold of 6 µg/L) and nerol (rose, citrus aroma, sensorial threshold of 0.5 mg/L) [14,146]. To note

that the contribution of these monoterpene alcohols to the final beer aroma does not only depends on

their final concentration, but also on the ratio between each of the aforementioned compounds [16].

Figure 4 – Overview of the biotransformation reactions of monoterpene alcohols and respective esters catalysed by yeasts. The

enzymes responsible for the catalysis of each reaction are indicated near the reaction arrows. Enzymes in green have been

experimentally verified in S. cerevisiae. Putative enzymatic activities that have been implied from metabolite profiling in

fermentations with S. cerevisiae or bacteria are indicated in blue and orange, respectively. Taken from [16].

18

3. Materials and Methods

3.1. Yeast isolation and identification

3.1.1. Samples collected

A sample from a contaminated beer batch (labelled as CCIST), from the IST Brewer’s Club, was

collected from the top of the liquid, where biofilm was formed. Three wine samples were also collected:

a white wine sample from Sardoal (labelled as SarB), a town in the centre of Portugal and two red wine

must samples from Tomar, a town also located in the centre of Portugal. The latter were taken from the

same wine must, but were collected at different times during production. One was taken in the first day

of fermentation (labelled as Mst) and the other was collected after the wine must was stored in the

barrel (labelled as Bar).

3.1.2. Yeast isolation

The isolation of yeast strains was performed by spreading into YPD agar (Yeast extract (Difco) 1%,

Peptone (Difco) 2%, Glucose (Scharlau) 2%, Agar (NZYTech) 2%) plates, supplemented with 100

µg/mL of chloramphenicol (Sigma-Aldrich), serial dilutions (100 to 10-6) of each sample (CCIST, SarB,

Mst and Bar). All plates were incubated at 30⁰C for 24 hours before counting Colony Forming Units

(CFUs) and plating each morphologically different colony in new plates of the same medium to obtain

pure cultures. Serial dilutions of Mst and Bar were also spread on WLN agar (Yeast extract 4 g/L,

Tryptone (Difco) 5 g/L, Glucose 50 g/L, Potassium dihydrogen phosphate (Panreac) 0.55 g/L,

Potassium chloride (BIOCHEM Chemopharma) 0.425 g/L, Calcium chloride (Alpha Aesar) 0.125 g/L,

Magnesium sulphate (Riedel-de Haën) 0.125 g/L, Ferric chloride (Fisher Chemical) 0.0025 g/L,

Manganese sulphate (Sigma-Aldrich) 0.0025 g/L, Bromocresol green (Sigma-Aldrich) 0.022 g/L, Agar

15 g/L), and incubated at 30⁰C for 48 hours before counting CFUs and plating each morphologically

different colony in new YPD agar supplemented with 100 µg/mL of chloramphenicol to obtain pure

cultures. All pure culture plates were incubated at 30⁰C for 24 hours before performing DNA extraction

or being stored at 4⁰C.

3.1.3. DNA extraction

DNA extraction was performed using phenol-chloroform extraction protocol. Approximately one full loop

of yeast biomass was resuspended in a microcentrifuge tube containing glass beads (0.5 mm diameter)

and 200 µL of ddH2O, to which 300 µL of phenol:chloroform:isoamyl alcohol (25:24:1) (pH 6.7/8.0,

Amressco) was added. The tubes were vortexed for 5 minutes before centrifuging for 5 minutes (4⁰C,

14000 rpm). The supernatant was transferred to a new Eppendorf tube, to which 300 µL of

phenol:chloroform:isoamyl alcohol was added. The tubes were vortexed for 10 seconds before

centrifuging for 5 minutes (4⁰C, 14000 rpm). The supernatant was transferred to a new Eppendorf tube

19

to which 300 µL of ether (Sigma-Aldrich) was added. The tubes were vortexed for 20 seconds before

centrifuging for 5 minutes (4⁰C, 14000 rpm). The lower phase was transferred to a new Eppendorf tube,

to which 1 mL of absolute ethanol (CARLO ERBA Reagents) was added. The tubes were stored at -

20⁰C for 30 minutes before centrifuging for 15 minutes (4⁰C, 14000 rpm). The supernatant was

discarded and 500 µL of 70% ethanol was added before centrifuging for 5 minutes (4⁰C, 14000 rpm).

The supernatant was discarded and the pellet was vacuum dried in the SpeedVac, at 45⁰C, for 15

minutes. After this step, the pellet was resuspended in 100 µL of ddH2O and DNA concentration was

measured using the NanoDrop spectrophotometer before being stored at -20⁰C.

3.1.4. Polymerase Chain Reaction (PCR) and gel electrophoresis

Polymerase Chain Reaction (PCR) was used to amplify the D1/D2 region of the 26S ribosomal DNA

(rDNA) using the primers NL-1 (forward primer; 5’-GCATATCAATAAGCGGAGGAAAAG-3’) and NL-4

(reverse primer; 5’-GGTCCGTGTTTCAAGACGG-3’) or to amplify the ITS region of the rDNA using the

primers ITS-1 (forward primer; 5’-TCCGTAGGTGAACCTGCGG-3’) and ITS-4 (reverse primer; 5’-

TCCTCCGCTTATTGATATGC-3’). These primers were previously validated to use in yeast

identification [147][148]. The master mix prepared consisted of 1X Phusion HF Buffer, 2.5 mM MgCl2,

2 mM dNTPs (200 µM each), 0.5 µM of each primer, 3% DMSO and 0.02 U/µM of Phusion DNA

Polymerase (Thermo Fisher). The volume of reaction was 50 µL (49 µL of master mix and 1 µL of DNA)

and three reactions were prepared for each extracted DNA sample. The PCR protocol consisted in

denaturation at 98⁰C for 30 seconds, followed by 35 cycles of denaturation at 98⁰C for 10 seconds,

annealing at 52⁰C for 20 seconds and extension at 72⁰C for 30 seconds, finalizing with an extension at

72⁰C for 10 minutes. PCR products were separated by electrophoresis on a 0.8% agarose (NZYTech)

gel, with green safe (NZYTech) incorporated to stain DNA. After the run, the gel was placed in a

transilluminator to cut the sections that contained the DNA bands. To purify the DNA in the cut portions,

NZYGelpure® (NZYTech) kit was used, following the manufacturer’s instruction. The purified DNA was

quantified in the NanoDrop spectrophotometer and stored at -20⁰C.

3.1.5. DNA sequencing and yeast species identification

The amplified and purified rDNA samples were sent to STAB VIDA for sequencing by Sanger

sequencing. Using the Standard Nucleotide BLAST tool of NCBI, the DNA sequences obtained were

compared to those present in the NCBI database, in order to taxonomically identify the isolated yeast

species.

3.1.6. Addition to the IST yeast collection

DNA sequences of isolates from the same samples that were identified as belonging to the same

species were compared using EMBOSS Water pairwise sequence alignment and EMBOSS MUSCLE

alignment tools. If a comparison yielded that two or more isolates were the same strain, only one was

20

added to the IST yeast collection. Samples of isolates that were chosen to be added to the collection

were prepared by resuspending a full loop of biomass in liquid YPD with 15% glycerol (v/v) and

maintained at -80⁰C.

3.2. Fermentative Trials

3.2.1. Preparation of the beer wort

Beer wort was prepared by dissolving 100 g/L of malt extract (Light Dry Malt Extract, Muntons) in water

(commercial bottled water was used), and the pH was adjusted to 5.2 ± 0.1, when required. The medium

was boiled for 1 hour, followed by an addition of 1 g/L of Saaz hops and another hour of boiling. The

beer wort was left to cool overnight and, in the next day, was centrifuged at 10000 rpm for 10 minutes,

at room temperature, to precipitate solids present in the medium. The liquid was transferred to sterile

SCHOTT bottles and stored at room temperature for later use.

3.2.2. Strain selection for fermentation

Based on results from previous studies, it was decided that the yeast strains to be used in fermentative

trials would be from the Hanseniaspora genus. Two Hanseniaspora isolates that were identified in this

study were chosen, as well as two more Hanseniaspora isolates that are part of the IST yeast collection.

The commercial yeast strain S. cerevisiae SafAle™ US-05, was selected for the mixed fermentation

tests, because it is described as being a strain that produces a very clean beer, meaning that it should

give a neutral aroma to the beer, thus allowing the aromatic contribution of the non-Saccharomyces

strain to stand out in the beer.

3.2.3. Inoculum preparation and fermentative conditions for the first screening

The inoculum of each strain was prepared by growing the yeast cultures in liquid YM medium (malt

extract, 15 g/L, Difco). The cultures were incubated at 30⁰C, with an agitation of 250 rpm, for 48 hours.

After incubation, the Optical Density (OD) at 600 nm was measured for each culture, using the

spectrophotometer (U-2001, Hitachi). To determine the relation between OD and CFU/mL for each

culture, calibration curves obtained from previous OD vs. CFU studies were used. This allowed to

determine the necessary volume of each culture to inoculate in order to start the fermentation with a

concentration of 5x106 CFU/mL. The necessary volume of inoculum was vacuum filtered, using a

Whatman paper filter (0.2 µm pore size), and the filter was inserted into a 100 mL flask containing 70

mL of beer wort. The flasks were capped with a rubber cork perforated with a syringe needle and sealed

with parafilm. The cultures were incubated at 23⁰C, with no agitation, for 14 days. After incubation, 1

mL samples of each fermentation were collected for HPLC analysis.

21

3.2.4. Organoleptic evaluation of the fermentation products from the first screening

Members of the Biological Sciences Research Group performed the organoleptic evaluation of each

fermentation, immediately after uncapping the flasks. The evaluation focused on classifying the aroma

and flavour of each fermentation as interesting or not interesting, in order to select specific strains for

further studies.

3.2.5. Inoculum preparation and fermentative conditions for the single and mixed

culture fermentations

The inoculum of each strain was prepared by growing the yeast cultures in liquid YM medium (malt

extract, 15 g/L). The cultures were incubated at 30⁰C, with an agitation of 250 rpm, for 24 hours. After

incubation, the OD at 600 nm was measured for each culture and an appropriate volume of each culture

was transferred into new flasks containing fresh liquid YM medium, in order to obtain cultures with a

starting OD (600nm) of 0.1. These cultures were incubated at 30⁰C, with an agitation of 250 rpm, for 24

hours. After incubation, the OD at 600 nm was measured. Using calibration curves obtained in previous

CFU studies, the appropriate volume of inoculum necessary to start the fermentations with a

concentration of 5x106 CFU/mL was calculated. The necessary volume of each culture was centrifuged,

the supernatant discarded and the pellet was resuspended in beer wort and added to 1L Erlenmeyer

flasks containing 1L of beer wort. The flasks were capped with a rubber cork (with a hole filled with

cotton which allowed the release of CO2) and sealed with parafilm. The cultures were incubated at 20⁰C,

with no agitation, for 14 days. After this primary fermentation, the cultures were bottled (one 330 mL

bottle per fermentation) with the addition of a glucose solution (7 g/L of glucose added to the bottle) to

perform a secondary fermentation and carbonate the beer. The bottles were incubated at 20⁰C, with no

agitation, for 30 days. Samples were collected after primary fermentation (14 days in flasks) and

secondary fermentation (30 days in bottle) for HPLC (1 mL samples) and GC-MS (10 mL samples)

analysis.

3.2.6. Fermentation monitoring

Fermentations were monitored by weighting the flasks, without uncapping them. Measurements were

taken in regular intervals, two to three times a day (within the lab working hours) except during the first

two days (four to five measurements taken per day) and weekends (measurements were taken

whenever possible). The fermentations were interrupted after 14 days and the pH of the medium was

measured.

3.2.7. Monitoring of sugar and ethanol concentrations

A 1 mL sample of each fermentation product was collected for HPLC analysis at the end of primary and

secondary fermentations. Samples were centrifuged (10000 rpm, 3 minutes) before 100 µL of the

supernatant were transferred into an HPLC vial and diluting it 1:10 with 0.005 M H2SO4 (Sigma-Aldrich).

22

To determine the concentration of sugars (maltose, maltotriose, glucose and fructose) and ethanol, a

HPX87H column (Biorad) was used, with elution at 65⁰C with 0.005 M H2SO4 at a flow rate of 0.6 mL/min

(for the strain selection test samples) or 0.5 mL/min (for the mixed fermentation trials). Concentrations

were estimated based on appropriate calibration curves.

3.2.8. Volatile compound analysis by GC-MS

In order to analyse the volatile compounds present in each fermentation, 1 mL of the collected samples

was transferred to a 10 mL headspace vial (La-Pha-Pack®) that was capped with a

polytetrafluoroethylene (PTFE) silicone septum (Specanalitica). Volatile compounds were extracted

from the samples using headspace solid-phase microextraction (HS-SPME), with an extraction

temperature of 40⁰C for 15 minutes, stirring speed of 250 rpm, agitation during 10 seconds and a

desorption time of 3 minutes at 250⁰C. A divinylbenzene/Carboxen®/polydimethylsiloxane

(DVB/Car®/PDMS) fibre was used to extract the volatile compounds. Analysis was performed in a

GCMS-QP2010 (Shimadzu®), utilizing a capillary column Sapiens – Wax MS (Teknokroma), with a

length of 60 m, 0.25 mm (IS) and a film thickness of 0.25 µm. Injector and detector temperatures were

set at 250⁰C and injection was performed in a 1:5 split using high purity helium as the carrier gas, with

a flow of 4 mL/min. Column oven temperature was kept at 40⁰C for 5 minutes, after which was increased

to 170⁰C at a rate of 5⁰C per minute and then to 230⁰C at a rate of 30⁰C per minute, which was kept for

4 minutes. Both the MS interface and the ion source were kept at 250⁰C. Mass spectra were acquired

in Electron Ionization mode at 70 eV in a m/z range between 29 and 300 and a scan speed of 588

scans per second. 1-Butanol was added to all samples in a concentration of 5.05 µg/mL and used as

internal standard, in order to extrapolate the relative abundance of each of the identified compounds.

Volatile compounds were identified using the mass spectra libraries NIST 21, 27, 107, 147 and Wiley

229. Analysis of the chromatograms generated by GC-MS was done by the PhD student Nuno Melo.

3.3. Population Dynamics studies

3.3.1. Preparation of beer wort

Beer wort was prepared as described in section 3.2.1.

3.3.2. Inoculum preparation and fermentative conditions for population dynamics

studies

For population dynamics studies, the inocula of H. opuntiae IST408 and S. cerevisiae US-05 were

prepared as described in section 3.2.5, but fermentations were performed with different conditions.

Fermentations occurred in 25 mL glass vials containing 20 mL of beer wort, that were capped with a

plastic cork perforated with a syringe needle. The cultures were incubated at 20⁰C, with no agitation,

23

for 14 days. To monitor how yeast populations evolve during single and mixed fermentations, seven

vials were prepared for each fermentation and discarded after samples from a time point were taken.

3.3.3. Fermentation monitoring

Fermentations were monitored by weighting the vials, without uncapping them. Weight measurements

of the vials were taken before sample acquisition (all vials were measured).

3.3.4. Time point sample acquisition

At each time point, three different samples were acquired from each fermentation. From the top of the

liquid, a 1 mL sample was taken and stored at -20⁰C to be latter analysed by HPLC. A second 1 mL

sample was taken from approximately the central position (core) of the flask, to determine the number

of cells suspended in the liquid. After acquisition of this sample, the liquid was thoroughly mixed in order

to resuspend any biomass that may have been accumulated at the bottom of the vial. After mixing, a

third sample was collected, to determine the number of total cells. These two latter samples were

serially diluted and platted into WLN agar plates and YNB + galactose agar (yeast nitrogen base (Difco)

6.7 g/L, galactose (Sigma-Aldrich) 20 g/L, agar 20 g/L) plates (in the case of samples from mixed

fermentations). WLN agar plates were incubated at 30⁰C for 48 hours and YNB + galactose agar plates

were incubated at 30⁰C for 96 hours. After incubation, CFUs were counted.

Figure 5 – Samples taken in each time point in the population dynamics studies

3.3.5. Monitoring of sugar and ethanol concentrations

HPLC analysis was performed as described in section 3.2.7, but with a different flow rate, of 0.5 mL/min.

1. Sample for HPLC analysis

3. Sample to determine total CFUs

(after resuspending the biomass)

2. Sample for determine

CFUs in suspension

24

3.4. ATF1, ATF2 and EAT1 disruptions by CRISPR-Cas9 methodology

3.4.1. Oligonucleotides used

For the disruption of each gene, three pairs of oligos were designed: the gRNA oligos, the donor DNA

oligos and the primers to confirm the disruption of the genes. The oligos used in the disruption of ATF1,

ATF2 and EAT1 are listed below in Table 1. All donors were designed to contain 45 bp upstream and

45 bp downstream the sequence used for the design of gRNA oligos. The donor DNA for ATF1 partial

deletion introduces a phase-shift mutation (in red and bold) and eliminates an EcoRI restriction site that

is located in the gRNA oligo. The donor DNA for ATF2 partial deletion creates a restriction site for

BamHI by replacing a G for a C (in green and underlined) and introduced a STOP codon by replacing

a G for an A (in red and bold). The donor DNA for EAT1 partial deletion introduces a STOP codon by

replacing a G for a T (in red and bold) and introduces a SacI restriction site by replacing a G for a C (in

green and underlined). Restriction reactions with the corresponding enzymes were used to select

positive candidate mutants.

Table 1 – Sequences of the oligos used in the disruption of ATF1, ATF2 and EAT1.

Oligo Sequence Oligo Sequence Oligo Sequence

ATF1 gRNA forward

5’-GCAGTGAAAGATAAATGATGAAGAATTCAAAAATAGTAAGTTTTAGAG

CTAGAAATAG-3’

ATF2 gRNA forward

5’-GCAGTGAAAGATAAATGATGTTTATGTCACTAACCACTGGTTTTAGAGCTAGAAATAG-

3’

EAT1 gRNA forward

5’-GCAGTGAAAGATAAATGATGTGGCACTCTACTTTGCCAAGTTTTAGAGCTAGAAATA

G-3’

ATF1 gRNA reverse

5’-CTATTTCTAGCTCTAAAACTTACTATTTTTGAATTCTTCATCATTTATCT

TTCACTGC-3’

ATF2 gRNA reverse

5’-CTATTTCTAGCTCTAAAACCAGTGGTTAGTGACATAAACATCATTTATCTTTCACTGC-

3’

EAT1 gRNA reverse

5’-CTATTTCTAGCTCTAAAACTTGGCAAAGTAGAGTGCCACATCATTTATCTTTCACTGC-

3’

Donor ATF1 forward

5’-CTCAATGAAAACAACCTGAGTACAGTGCAGTAATGAAGCAAATATTATCCTATACTGCAAAAATTTTTAAACTTACTACCACTTTGACTATTCC-3’

Donor ATF2 forward

5’-TTACCAGGTAAGGATACTGATGGGTTTGAAACGTGAAAAAACTTCTCCGACGGTGTCAGTGGATCCAATTTTTTCAAAGATTTAGC

TCTA-3’

Donor EAT1 forward

5’-TTTTCAAAAGTTTGTAATGTAATAAGAGGAAATGTGGTGGAGCTCTTTTCTTTCTGTAAAATCCAATAATGTACACCAAGCACAGTTA

CAC-3’

Donor ATF1 reverse

5’-GGAATAGTCAAAGTGGTAGTAAGTTTAAAAATTTTTGCAGTATAGGATAATATTTGCTTCATTACTGCACTGTACTCAGGTTGTTTTCATTGAG-

3’

Donor ATF2 reverse

5’-TAGAGCTAAATCTTTGAAAAAATTGGATCCACTGACACCGTCGGAGAAGTTTTTTCACGTTTCAAACCCATCAGTATCCTTACCTGGT

AA-3’

Donor EAT1 reverse

5’-GTGTAACTGTGCTT

GGTGTACATTATTGGATTTTACAGAAAGAAAAGAGCTCCACCACATTTCCTCTTATTACATTACAAACTTTTGA

AAA-3’

ATF1 confirmation

forward

5’-ATGGATCTCTGGAAG

CGTC-3’

ATF2 confirmation

forward

5’-ACGTTTCTTCGAGG

TCTGTGAA-3’

EAT1 confirmation

forward

5’-ACTGAATACCACAG

CGCGTC-3’

ATF1 confirmation

reverse

5’-AAAGCCGAGGGAGTG

ACAAC-3’

ATF2 confirmation

reverse

5’-CTATACGAAGGCCC

GCTACG-3’

EAT1 confirmation

reverse

5’-GATTTGGGCCTGAC

ACGAGA-3’

25

3.4.2. Plasmids used for the partial deletion of ATF1, ATF2 and EAT1 genes

The plasmids used in the partial deletion of ATF1, ATF2 and EAT1 by CRISPR-Cas9 methodology were

provided by Professor Johan Thevelein from KU Leuven, Belgium. The plasmids used were p51 and

p59. The single copy plasmid p51 contains the gene coding for Cas9 [149] under the control of TEF

promoter and the antibiotic selection marker KanMX, which confers resistance to the antibiotics

kanamycin and geneticin. Plasmid p59 was selected to express the target-specific gRNA and has the

antibiotic selection marker NAT, which confers resistance to the nourseothricin. Plasmids created in

this study are presented in Table 2.

Table 2 – Plasmids created in this study.

Construct Characteristic

p59-ATF1 p59 expressing the ATF1 targeting gRNA

p59-ATF2 p59 expressing the ATF2 targeting gRNA

p59-EAT1 p59 expressing the EAT1 targeting gRNA

3.4.3. Saccharomyces cerevisiae CEN.PK113-7D transformation with p51-Cas9 vector

Saccharomyces cerevisiae CEN.PK113-7D cells were grown in YPD agar medium overnight, at 30⁰C.

Two full loops of biomass were resuspended in 1 mL of sterile ddH2O. Centrifugation was performed to

pellet the cells. The supernatant was discarded and the cells were resuspended in the remaining liquid

and ddH2O was added to desired volume (20 µL per transformation). In a new microcentrifuge tube, 20

µL of cell suspension were mixed with 1 µL of p51-Cas9 (concentration of 1700 ng/µL; 1 µL of ddH2O

for control reaction) and 100 µL of ONE-STEP buffer (0.2 M LiAc (Sigma-Aldrich); 40% PEG1000

(Merck); 100 mM DTT (Sigma-Aldrich)). This mix was vortexed for 5 seconds and incubated for 30

minutes at 42⁰C. After incubation, tubes were centrifuged to pellet the cells and the supernatant was

discarded. YPD liquid medium (1 mL) was added to the tubes and the cells were left to recover for 4

hours at 30⁰C. After recover, tubes were centrifuged to pellet the cells and the supernatant was

discarded. Cells were resuspended in 100 µL of sterile ddH2O and were plated in YPD agar plates

supplemented with 200 mg/L of geneticin (Sigma-Aldrich). Plates were incubated for 72 hours at 30⁰C.

3.4.4. Primer duplexing

Primers were dissolved in STE-buffer pH 8 (10 mM Tris (NZYTech), 1 mM EDTA (Sigma-Aldrich), 50

mM NaCl (Panreac)) to a concentration of 500 µM. Each primer pair (gRNA forward and reverse, donor

forward and reverse) were mixed in equal amounts (10 µL of each primer) and incubated in the heat

block at 94⁰C, for 3 minutes. After incubation, the heat block was unplugged and the primers were left

there to cool to 30⁰C during approximately 2 hours. After cooling, the mixes were diluted 500x with Milli-

Q water. Mixes (concentrated and diluted) were stored at -20⁰C.

26

3.4.5. Preparation of the plasmid with gRNA

The selected plasmid (p59) was opened using EcoRV and XhoI, following the enzyme manufacturers’

instructions. The assembly of gRNA with the restricted vector was performed using the Gibson

assembly technique [150]. For each gRNA primer pair, two Gibson reactions were performed, one with

the gRNA mix and other with water, for control. For a final reaction volume of 10 µL, 7.5 µL of 1.33x

Gibson Mix, 1 µL of 40 ng/µL solution of open plasmid, 0.75 µL of the prepared gRNA mix or water and

Milli-Q water to complete the volume were used. This mix was incubated at 50⁰C for 1 hour and used

fresh for E. coli transformation.

3.4.6. E. coli transformation

For each gRNA primer pair, three transformations were made: one using gRNA Gibson Mix, one using

the control Gibson Mix and one using water instead of Gibson Mix. For transformation, 150 µL of

competent E. coli (DH5α cells were used for transformations with plasmid containing ATF1 gRNA and

XL1-Blue cells were used for plasmids containing ATF2 gRNA and EAT1 gRNA) were mixed with 50

µL of TCM (10 mM Tris-HCl (Sigma-Aldrich), 10 mM CaCl2 (Alpha Aesar), 10 mM MgCl2 (Sigma-

Aldrich)) buffer. To this mix, 10 µL of fresh Gibson Mix was added and left in ice for 30 minutes. Heat

shock was performed by placing the tubes in the heat block at 42⁰C for 3 minutes and immediately

placing them in ice for 5 minutes. After heat shock, 1 mL of liquid LB (10 g/L Tryptone, 5 g/L Yeast

Extract, 10 g/L NaCl) medium was added and the tubes were incubated at 37⁰C, with an agitation of

250 rpm, for 1 hour. After incubation, the tubes were centrifuged for 2 minutes, in order to pellet the

cells. The supernatant was discarded, the cells were resuspended in 100 µL of sterile ddH2O, platted

in solid LBA medium and incubated at 37⁰C for 24 hours. Colonies of E. coli transformed with gRNA

Gibson Mix (candidates) were transferred into tubes containing 3 mL of liquid LBA medium (1 colony

per tube) and incubated overnight at 37⁰C, with an agitation of 250 rpm. To extract the plasmid from

each candidate, NZYMiniprep® kit (NZYTech) was used following the manufacturer’s instructions. The

extracted plasmids were sent to STAB Vida for sequencing, to identify if the plasmid contained gRNA.

3.4.7. Transformation with p59-gRNA and donorDNA

The inoculum of S. cerevisiae CEN.PK expressing p51-Cas9 was prepared by growing the strain in

liquid YPD, supplemented with 200 mg/L of geneticin. The culture was incubated overnight at 30⁰C,

with an agitation of 250 rpm. After incubation, the OD at 600 nm was measured using the

spectrophotometer. The necessary volume of inoculum to start a culture with an OD of 0.1 was

transferred into a new flask with liquid YPD medium, supplemented with 200 mg/L of geneticin, and

incubated for approximately 3 to 4 hours at 30⁰C, with an agitation of 250 rpm. Transformation of the

incubated cells was performed using the Alkali-Cation™ Yeast Transformation Kit from MP

Biomedicals, following the manufacturer’s instructions. A total of 250 ng of the plasmid expressing the

gRNA being utilized, as well as 2 µL of concentrated duplexed donor DNA (250 µM) were transformed

in S. cerevisiae. Transformed cells were plated into YPD agar plates supplemented with 200 mg/L of

27

geneticin and 100 mg/L of nourseothricin (Sigma-Aldrich) and incubated at 30⁰C for 48 hours. Colonies

of cells transformed with p59-gDNA and donorDNA (candidates) were spread in new plates of the same

medium and were incubated at 30⁰C for 48 hours. DNA extraction was performed using the same

protocol described in section 3.1.3. To determine if the desired mutants were obtained, PCR was

performed using the protocol described in section 3.1.4, but using the appropriate confirmation primers.

The PCR products of each candidate’s DNA were submitted to enzymatic restriction assays to asses if

the transformation was successful (each Donor oligo possessed a restriction site for a specific enzyme:

Donor ATF1 – EcoRI; Donor ATF2 – BamHI; Donor EAT1 – SacI). The products of the restriction

reaction were separated by electrophoresis on a 0.8% agarose gel, with green safe incorporated to

stain DNA. New PCR products of candidate’s DNA that yield positive results in the enzymatic restriction

assays were sent to STAB VIDA for sequencing by Sanger sequencing to confirm the disruption of the

gene.

3.4.8. Plasmid loss

After confirmation that the desired mutation was obtained (by comparing the sequence results with the

non-mutated sequence), the mutated strain was grown in liquid YPD, supplemented with 200 mg/L of

geneticin to lose the plasmid and allow subsequent transformation with other gRNA and deletions of

the other target genes. The culture was incubated at 30⁰C, with an agitation of 250 rpm, for 24 hours.

After incubation, a small volume of culture was transferred into fresh medium and incubated for another

24 hours, in the same conditions. This process was performed one more time (three incubations in

total). After the third incubation, serial dilutions were performed and the cultures were plated into YPD

agar plates, supplemented with 200 mg/L of geneticin and 100 mg/L of nourseothricin, and YPD agar

plates, supplemented with 200 mg/L of geneticin, in order to conclude if the cells had lost p59-ATF1,

p59-ATF2 or p59-EAT1.

28

29

4. Results

4.1. Isolation and identification of yeasts

In order to isolate and identify yeast strains with potential for improvement of the aromatic profile of craft

beer, a variety of samples from different origins was used. Wine and wine must samples were

considered interesting since non-Saccharomyces strains that are present in these types of samples are

described in the literature as being capable of producing a wide variety of flavour and aroma active

compounds [28,61,93]. Three different wine production samples were collected, one being a white wine

sample from Sardoal (labelled SarB), and the other two being red wine must samples from Tomar,

collected from the same wine production, but at different fermentation times. One was collected in the

first day of fermentation (labelled Mst) and the other was collected after the transferring the wine must

into the fermentation barrel (labelled Bar). Samples from a contaminated beer batch from the IST

Brewer’s Club (labelled CCIST), collected at the top of the liquid where a biofilm was formed, was also

used.

Serial dilutions (100 to 10-6) of the collected samples were spread on YPD agar medium, supplemented

with 100 µg/mL of chloramphenicol to prevent the growth of the bacteria present in the sample. Plates

were incubated at 30⁰C for 24 hours, after which each morphologically different colony was spread on

new YPD plates to obtain pure cultures. Serial dilutions of Mst and Bar samples were also spread on

WLN agar plates, which were incubated at 30⁰C for 48 hours before plating each morphologically

different colony in new YPD agar supplemented with 100 µg/mL of chloramphenicol to obtain pure

cultures. Due to the presence of bromocresol green in WLN agar, the colonies acquire a green

coloration, with variations in intensity, related to the microorganism’s metabolism, which provides

another morphological factor to differentiate colonies, allowing the distinction of strains of the same

species or variants of the same strain [151–153]. Accordingly, more morphologically different colonies

were detected in WLN plates than in YPD plates. In addition, pure colonies that were plated in YPD

agar plates were also plated in WLN agar plates (after being grown in YPD agar) to compare their

morphology and stability. Since Mst and Bar samples came from the same wine production, if colonies

with the same morphology were present in both samples, they will only be considered from one of the

samples. Also, since Mst and Bar samples were platted on two different media, samples platted in YPD

agar were labelled MstY and BarY, whereas samples platted in WLN agar were labelled MstW and

BarW.

For the identification of the strains, genomic DNA was extracted from the isolates and the very

conserved regions of ribosomal DNA, D1/D2 of the 26S subunit or Internal Transcribed Spacer (ITS),

were amplified and sequenced by Sanger sequencing outside the laboratory as a service. After

comparing the results obtained from Sanger sequencing (sequences presented in the Annex) with the

DNA sequences present in the NCBI database, it was possible to taxonomically identify the isolated

colonies.

30

Regarding CCIST samples, the colonies obtained were identified as Pichia kudriavzevii. Regarding

SarB, two types of morphologically different colonies were obtained and identified as Candida

intermedia and Clavispora lusitaniae. In MstY, six morphologically different colonies were isolated and

identified as belonging to five different species: Metschnikowia pulcherrima, Pichia kudriavzevii,

Saccharomyces cerevisiae (two colonies), Hanseniaspora uvarum and Starmerella bacillaris. As

mentioned above, regarding BarY, only colonies that were morphologically different from the ones

present in MstY were isolated, which led to the isolation of three different strains, that were identified

as Pichia kluyveri, Pichia kudriavzevii and Hanseniaspora uvarum. In the case of MstW, six

morphologically different colonies were isolated and identified as belonging to four different species: S.

cerevisiae (three colonies), Pichia kluyveri, Pichia terricola and Candida humilis. In BarW, a total of ten

morphologically different colonies were isolated and identified as belonging to five different species: S.

cerevisiae (two colonies), Metschinokowia ziziphicola, Starmerella bacillaris, Hanseniaspora opuntiae

and Hanseniaspora uvarum (four colonies). For one of the isolates it was not possible to conclude if it

was from H. opuntiae or H. uvarum because the BLAST analysis performed yielded H. uvarum as first

BLAST result, but similar identities (99% identity) were obtained for the two species. Nevertheless, this

strain is referred as H. uvarum from now on, since it was the first BLAST result yielded. Since Mst and

Bar were samples from the same wine production, pairwise sequence alignment analysis was

performed with D1/D2 sequences from the isolates from both samples that were identified as belonging

to the same species, in order to determine if they belonged to the same strain. In the case of a positive

result, only one of these isolates was added to the IST yeast collection.

In total, fifteen different isolates were obtained and added to the IST yeast collection, with fourteen

being from non-Saccharomyces species and one from S. cerevisiae. A list of all the isolated strains and

the corresponding isolation sample are summarized in Table 3.

31

Table 3 – Yeast strains from different species isolated from different samples. The IST Yeast Culture Collection ID# and the

identity (%) obtained in BLAST analysis performed in the NCBI database are shown.

Samples Isolated strain IST Yeast Culture Collection

ID # Identity

CCIST Pichia kudriavzevii IST376 100%

SarB Candida Intermedia IST385 100%

Clavispora lusitaniae IST413 99%

Mst

Candida humilis IST409 99%

Metschnikowia pulcherrima IST402 98%

Pichia kluyveri IST411 99%

Pichia terricola IST410 99%

Saccharomyces cerevisiae IST403 99%

Starmerella bacillaris IST401 99%

Bar

Hanseniaspora opuntiae IST399 99%

Hanseniaspora uvarum IST400 99%

Hanseniaspora uvarum IST412 99%

Metschnikowia ziziphicola IST404 99%

Pichia kluyveri IST397 99%

Pichia kudriavzevii IST398 99%

4.2. Selection of a Hanseniaspora strain with potential for increasing the organoleptic

profile of beer

Isolates from Hanseniaspora genus have been described in the literature as being capable of producing

a wide array of aromatic compounds [90,97,110]. For this reason, four Hanseniaspora strains were

chosen to undergo the first fermentative screening to find strains with potential for increasing the

organoleptic profile of beer. Hanseniaspora uvarum IST412 isolated in this work, as well as three H.

opuntiae strains, one isolated in this work (IST399), and two from the IST Yeast Culture Collection

(IST406 and IST408), were selected.

4.2.1. First screening fermentations

Since the flasks used for the fermentations were tightly capped and sealed, the entry of oxygen into the

flasks was very difficult, but the carbon dioxide produced as a by-product of alcoholic fermentation can

easily be expelled through the syringe needle that perforated the cork, due to pressure, leading to a

decrease in the weight of the fermentation flask. During sugar fermentation, carbon dioxide and ethanol

are produced at the same molar proportions (1:1 ratio) and, since carbon dioxide diffuses out of the

flask, it is possible to monitor the fermentations by weighting the flasks in set intervals of time and plot

the decrease in mass over time. Also to note that since carbon dioxide production is correlated to yeast

growth, these graphs can roughly be interpreted as fermentation growth curves. Plots generated with

32

this approach are shown in Figure 6. By analysing this figure, it is possible to observe that H. opuntiae

IST408 and H. uvarum IST412 show very similar weight loss patterns, as well as H. opuntiae strains

IST399 and IST406.

Figure 6 – Progress of the first screening fermentations performed by different strains of H. uvarum (IST412) and H. opuntiae

(IST399, IST406 and IST408).

Fermentations were performed at 23 ⁰C and were interrupted after 330 hours (approximately 14 days),

which is the typical fermentation time in beer production, and the pH of the broth was measured (Table

4). Although different species and strains were used, the pH in all fermentations decreased to similar

levels.

Table 4 – pH values of the fermentation products obtained from the first screening fermentations.

Samples pH

Beer wort (t0) 5.2

H. opuntiae IST399 4.56

H. opuntiae IST406 4.46

H. opuntiae IST408 4.43

H. uvarum IST412 4.43

After 330 hours of fermentation, each fermentation product was analysed by HPLC and its sugar and

ethanol concentrations were determined (Table 5).

0,00

0,10

0,20

0,30

0,40

0 50 100 150 200 250 300 350

Wei

ght

loss

(g)

Time (h)

IST399

0,00

0,10

0,20

0,30

0,40

0 50 100 150 200 250 300 350

Wei

ght

lost

(g)

Time (h)

IST406

0,00

0,10

0,20

0,30

0,40

0 50 100 150 200 250 300 350

Wei

ght

loss

(g)

Time (h)

IST408

0,00

0,10

0,20

0,30

0,40

0 50 100 150 200 250 300 350

Wei

ght

lost

(g)

Time (h)

IST412

33

Table 5 – Concentration of maltotriose, maltose, glucose, fructose and ethanol in the fermentation products after 330 hours of

fermentation.

Samples Maltotriose (g/L) Maltose (g/L) Glucose (g/L) Fructose (g/L) Ethanol (%v/v)

Beer wort (t0)

12.57 53.18 5.48 3.83 0.00

H. opuntiae IST399

11.85 49.81 0.00 0.00 0.37

H. opuntiae IST406

11.15 48.96 0.00 0.00 0.37

H. opuntiae IST408

11.16 47.48 0.00 0.00 0.40

H. uvarum IST412

11.40 49.14 0.00 0.00 0.41

As expected, glucose and fructose were completely consumed by all four strains, whereas maltose and

maltotriose were not fermented by any of the tested strains. Regarding ethanol production, all four

strains produced similar quantities of ethanol and in very small percentages (less than 0.5%).

4.2.2. Organoleptic characterisation of the fermentation products from the first

screening

After interruption of the fermentations, a preliminary organoleptic evaluation of the fermented product

was conducted by members of the Biological Sciences Research Group, to evaluate if the tested strains

produced interesting flavours and aromas. The fermentations products from H. opuntiae IST399 and H.

uvarum IST412 had an acidic taste (more pronounced in IST412) and did not present any interesting

aroma. The two remaining fermentations were the ones that yielded the more interesting results. The

fermentation carried out by H. opuntiae IST406 presented an oregano aroma but an insipid flavour,

whereas the fermentation carried out by H. opuntiae IST408 presented a caramel aroma and a sweet

taste. Due to its flavour and aroma profile, the fermentations with H. opuntiae IST408 was deemed the

most interesting, which led to the selection of this strain for further testing in mixed fermentations with

S. cerevisiae.

4.3. Beer production by single and mixed cultures of Hanseniaspora opuntiae IST408

and Saccharomyces cerevisiae US-05

4.3.1. Fermentation profile of single and mixed cultures of Hanseniaspora opuntiae

IST408 and Saccharomyces cerevisiae US-05

Since H. opuntiae does not ferment all the sugars present in beer wort, the utilization of this species for

beer production requires the presence of S. cerevisiae in the fermentative medium, due to its capability

34

to ferment all sugars present in beer wort. Regarding the choice of the Saccharomyces strain to be

used, SafAle™ US-05 (referred to as US-05 from now on) was selected. This is a commercial S.

cerevisiae strain from Fermentis that gives a neutral aroma to the beer (does not contribute significantly

to the aromatic profile of the beer). This trait would allow the aromatic contribution of the non-

Saccharomyces strain to stand out in the final product. In these trials, two types of mixed fermentations

were conducted, with differences in the method of inoculation. For one fermentation, sequential

inoculation of both species was done, with the non-Saccharomyces species being added to the medium

at the start of fermentation and the S. cerevisiae strain being added 48 hours after the first inoculation

(referred as sequential fermentation in this work). In this fermentation, the non-Saccharomyces species

H. opuntiae IST408 was added first, to allow the fermentation of glucose and fructose, without S.

cerevisiae competition for sugars and ethanol accumulation. For the other mixed fermentation,

simultaneous inoculation was performed with both species being added to the medium at the same time

(referred as simultaneous fermentation in this work). In both mixed fermentations, the two species were

added in the same ratio (1:1 ratio). As control, single culture fermentations of both species were

conducted. Also to note that a scale-up was done (total volume of 1 L) to better simulate commercial

beer production and to have sufficient volume to bottle beer in standard size bottles (330 mL). Three

experimental replicates were made for this trial.

The different fermentations performed were monitored by periodically weighting the flasks and plotting

the weight loss over time (Figure 7).

Figure 7 – (A) – Fermentation progress of single and mixed culture fermentations of H. opuntiae IST408 and S. cerevisiae US-

05 fermentations performed for beer production. Orange dots correspond to H. opuntiae IST408 single culture fermentation, blue

dots correspond to S. cerevisiae US-05 single culture fermentation, yellow dots correspond to sequential fermentation and grey

dots correspond to simultaneous fermentation. The growth curves shown are the result of three independent experiments that

gave rise to the same results. (B) – Fermentation progress of H. opuntiae IST408 single culture fermentation, using a more

appropriate scale.

By analysing this figure, it is possible to observe that when compared to the fermentation carried out by

S. cerevisiae US-05, the fermentation carried out by H. opuntiae IST408 shows a significantly lower

weight loss, which means that H. opuntiae IST408 has a much lower fermentative capacity. The mixed

fermentation where S. cerevisiae US-05 and H. opuntiae IST408 were simultaneously inoculated

0,0

5,0

10,0

15,0

20,0

25,0

30,0

0 100 200 300 400

Wei

ght

loss

(g)

Time (h)

All fermentations

0,0

0,5

1,0

1,5

2,0

2,5

3,0

0 100 200 300 400

Wei

ght

loss

(g)

Time (h)

IST408A B

35

shows a similar weight loss pattern to the S. cerevisiae US-05 single culture fermentation. This was

expected because, as seen in section 4.2.1 and considering that H. opuntiae IST408 possesses a low

fermentative capacity, the majority of the fermentative work is done by S. cerevisiae US-05. Regarding

the sequential inoculation mixed fermentation, the fermentation behaviour during the first 48 hours was

similar to H. opuntiae IST408 single culture fermentation, as expected because both were IST408 pure

culture fermentations. After the addition of S. cerevisiae US-05 to the sequential fermentation at 48

hours of fermentation, the subsequent weight loss pattern is similar to the patterns of both S. cerevisiae

US-05 single culture and simultaneous fermentations, but the maximum weight loss was lower than

those two other fermentations. This was also expected as S. cerevisiae US-05 will outcompete H.

opuntiae IST408 and takeover the fermentation.

Fermentations were interrupted after fourteen days of incubation and the pH of the liquid medium was

measured. The cultures were then bottled with the addition of a glucose solution (7 g/L of glucose added

to each bottle) to perform a secondary fermentation, in order to carbonate the beer. The bottles were

opened after 30 days to perform an organoleptic evaluation, and the pH of the beer was measured

(Table 6).

Table 6 – pH value of the fermented products after the primary and secondary fermentations.

Fermentation pH after primary fermentation pH after secondary fermentation

Beer wort (control) 5.38±0.022 5.26

H. opuntiae IST408 4.63±0.016 4.34

S. cerevisiae US-05 4.22±0.045 4.12

Sequential 4.13±0.026 4.08

Simultaneous 4.17±0.022 4.14

For the four fermentations, a decrease in final pH value was observed after the primary fermentation.

This decrease is more pronounced for the mixed fermentations than for the single culture fermentations.

The pH level decrease during H. opuntiae IST408 fermentation is not so significant when compared

with the other fermentations. The pH level of the S. cerevisiae US-05 single culture fermentation is

slightly higher than the values presented by the mixed fermentations. Regarding the pH values after the

secondary fermentation, the comparison with the pH values obtained after primary fermentation cannot

be easily done because they correspond to a single measurement, and beer wort presents a pH value

after the secondary fermentation that is below the value measured after primary fermentation.

Contamination of beer wort was not observed and this pH decrease may have been caused by the

deficient calibration of the pH meter.

Sugar and ethanol concentrations in samples collected at the end of primary and secondary

fermentations were analysed by HPLC (Figure 8). Glucose and fructose were almost totally consumed

after fermentation. In the case of fermentations where S. cerevisiae US-05 is present (single culture

and the two mixed fermentations), maltose and maltotriose were also used, whereas in H. opuntiae

IST408 single culture fermentation these sugars were not consumed.

36

The concentrations of ethanol in mixed culture fermentations are similar, around 4.4% (v/v), whereas

in S. cerevisiae US-05 single culture fermentation are around 3.9% (v/v). In the case of H. opuntiae

IST408 single culture fermentation, ethanol levels are much lower, reaching a concentration of around

0.5% (v/v). Sugar concentration remained constant during secondary fermentation, with the exception

of glucose, which was added at the beginning of the secondary fermentation and was completely

consumed. A slight increase in ethanol concentration after secondary fermentation can be observed in

all fermentations with the exception of the sequential fermentation.

0 10 20 30 40 50

0

20

40

60

0

1

2

3

4

5

H. opuntiae IST408

Time (days)

Su

ga

r (g

/L)

Eth

an

ol (%

v/v

)

0 10 20 30 40 50

0

20

40

60

0

1

2

3

4

5

S. cerevisiae US-05

Time (days)

Su

ga

r (g

/L)

Eth

an

ol (%

v/v

)

Maltotriose

Maltose

Glucose

Fructose

Ethanol

0 10 20 30 40 50

0

20

40

60

0

1

2

3

4

5

Sequential

Time (days)

Su

ga

r (g

/L)

Eth

an

ol (%

v/v

)

0 10 20 30 40 50

0

20

40

60

0

1

2

3

4

5

Simultaneous

Time (days)

Su

ga

r (g

/L)

Eth

an

ol (%

v/v

)

Figure 8 – Sugars (maltose, maltotriose, fructose and glucose) and ethanol concentrations obtained from single (H. opuntiae

IST408 and S. cerevisiae US-05) and mixed (sequential and simultaneous) culture fermentations. Samples were collected prior

to fermentation and after primary and secondary fermentations. An additional sample was collected at 48 hours in sequential

fermentations, just before the introduction of S. cerevisiae US-05.

4.3.2. Volatile compound profile of single and mixed culture beer fermentations

In order to identify the flavour-active volatile compounds present in each beer after primary and

secondary fermentations, samples were analysed by GC-MS (Table 7). Quantification of the identified

compounds was performed by calculating the area ratio between the areas of the compounds and

internal standard (1-butanol) peaks. Across all four fermentations, the same four chemical groups

37

(acetate esters, ethyl esters, higher alcohols and organic acids) presented higher relative abundance

when compared to other chemical groups. The relative abundance for these four chemical groups, in

each fermentation, is presented in Figure 9.

Statistical analysis was performed to assess if there were significant differences in relative abundance

of the highlighted chemical groups, between primary and secondary fermentation, to which the results

indicated that no significant differences existed (Figure 9).

IST40

8

US-0

5

Sequen

tial

Simulta

neous

0

5

10

15

20

Total acetate esters

Rela

tive a

bu

nd

an

ce

IST40

8

US-0

5

Sequen

tial

Simulta

neous

0

10

20

30

Total ethyl esters

Rela

tive a

bu

nd

an

ce

IST40

8

US-0

5

Sequen

tial

Simulta

neous

0

10

20

30

40

Total higher alcohols

Rela

tive a

bu

nd

an

ce

IST40

8

US-0

5

Sequen

tial

Simulta

neous

0

2

4

6

8

Total acids

Rela

tive a

bu

nd

an

ce

T1

T2

Figure 9 – Total relative abundance of the four most ample chemical groups across all four fermentations. Statistical significance

was considered between mean values when *P-value<0.05; **P-value<0.01; ***P-value<0.001; ****P-value<0.0001. T1 identifies

samples taken after primary fermentation and T2 identifies samples taken after secondary fermentation.

Although no significant difference was observed in the total relative abundance of each family of

compounds between T1 and T2, single flavour-active volatile compounds produced during each

fermentation show some differences. In Figures 10 and 11, the relative abundance of specific

compounds within each chemical group are presented.

38

Table 7 – Average relative abundance (RA) and standard deviation (SD) of all compounds identified in single and mixed fermentations

Fermentation

Compound RA (avg) SD (A_ratio) RA (avg) SD (A_ratio) RA (avg) SD (A_ratio) RA (avg) SD (A_ratio) RA (avg) SD (A_ratio) RA (avg) SD (A_ratio) RA (avg) SD (A_ratio) RA (avg) SD (A_ratio)

Ethyl acetate 2,4948 0,3768 5,7182 1,2436 2,9850 0,2550 3,2437 0,7498 5,7298 0,2669 5,7657 0,9865 4,6042 0,3352 5,0756 0,2858

Ethyl butanoate - - - - 0,4765 0,0676 0,4821 0,0156 0,2659 0,0114 0,3269 0,0108 0,4346 0,0053 0,5072 0,0514

Isobutanol 0,3836 0,0782 0,6939 0,1473 2,1236 0,5546 1,8809 0,0351 2,3760 0,4037 2,2601 0,2172 2,4215 0,3725 2,6892 0,2716

Isoamyl acetate 0,4179 0,1938 1,9416 1,1152 4,7007 0,2314 4,8761 0,4418 4,0895 0,4711 5,7528 0,5388 5,3090 0,0786 6,5635 0,3073

Isoamyl acetate (2) - - 0,0112 0,0112 0,0197 0,0197 0,0446 0,0283 0,0270 0,0186 0,0166 0,0166

2-Heptanone 0,0094 0,0004 0,0082 0,0082 0,0156 0,0156 0,0224 0,0085 0,0048 0,0048 0,0106 0,0028 0,0211 0,0211 0,0095 0,0095

Isoamyl propionate 0,0127 0,0061 0,0256 0,0001 0,0045 0,0045 0,0154 0,0066 0,0282 0,0020 0,0087 0,0007 0,0139 0,0030 0,0147 0,0014

Isoamyl propionate 0,0127 0,0061 0,0256 0,0001 0,0045 0,0045 0,0154 0,0066 0,0282 0,0020 0,0087 0,0007 0,0139 0,0030 0,0147 0,0014

Isoamyl alcohol 4,5116 0,7667 8,0419 2,8009 24,2455 1,8456 21,7426 2,8370 23,9274 0,3830 22,1516 2,0026 24,2145 1,0502 26,1339 0,2650

Ethyl hexanoate 0,0425 0,0167 0,2722 0,0423 2,5709 0,4998 2,5835 1,0140 1,1727 0,0051 1,5258 0,5683 1,8377 0,1551 2,3014 0,1790

Ethyl hexanoate (2) - - 0,0155 0,0020 0,0735 0,0056 0,0937 0,0002 0,0315 0,0004 0,0800 0,0095 0,0881 0,0188 0,0899 0,0430

Hexyl acetate - - 0,0170 0,0170 0,0235 0,0032 0,0233 0,0057 0,0151 0,0030 0,0309 0,0119 0,0111 0,0008 0,0264 0,0020

2-Octanone - - - - - - 0,0046 0,0046 - - - - - - - -

Acetoin 0,0426 0,0147 0,0291 0,0291 - - - - - - - - - - - -

Octanal - - - - 0,0216 0,0041 - - - - - - - - - -

Ethyl 3-hexenoate - - - - 0,0125 0,0008 0,0078 0,0078 0,0101 0,0003 0,0139 0,0038 0,0140 0,0005 0,0167 0,0035

Ethyl heptanoate 0,0234 0,0117 0,0279 0,0195 0,0585 0,0303 0,0514 0,0401 0,0625 0,0264 0,0472 0,0340 0,0525 0,0217 0,0549 0,0307

Ethyl lactate - - - - - - 0,0177 0,0031 - - 0,0135 0,0007 - - 0,0219 0,0019

1-Hexanol 0,0569 0,0075 0,0784 0,0137 0,0912 0,0053 0,0280 0,0280 0,1217 0,0141 0,1160 0,0195 0,1153 0,0069 0,0874 0,0141

Heptyl acetate - - 0,0041 0,0041 0,0093 0,0038 0,0069 0,0034 0,0071 0,0002 0,0100 0,0058 0,0018 0,0018 0,0090 0,0004

2-Nonanone - - - - 0,0112 0,0014 0,0095 0,0036 0,0020 0,0020 0,0035 0,0011 - - 0,0044 0,0044

Nonanal 0,0032 0,0015 0,0156 0,0026 0,0720 0,0101 0,0709 0,0354 0,0531 0,0190 0,0507 0,0060 0,0555 0,0164 0,0578 0,0116

Nonanal (2) - - - - 0,0172 0,0064 0,0150 0,0150 0,0092 0,0092 0,0127 0,0008 0,0139 0,0027 0,0130 0,0005

Ethyl octanoate 0,2778 0,1667 0,5101 0,3400 7,0261 3,2597 6,0098 3,8261 2,4035 0,4119 3,3558 2,1514 3,3940 0,0266 5,8165 2,1724

Acetic acid 0,6017 0,1842 1,3154 0,5457 0,8061 0,1558 0,8207 0,0991 1,8946 0,2149 1,9821 0,1806 2,1341 0,5079 1,9058 0,4660

Isoamyl hexanoate - - - - 0,0056 0,0056 0,0050 0,0050 - - - - - - - -

1-Heptanol 0,0365 0,0025 0,0391 0,0091 0,0762 0,0009 0,0707 0,0410 0,1114 0,0097 0,0974 0,0205 0,1247 0,0148 0,1387 0,0112

Octyl acetate - - - - 0,0088 0,0034 - - - - - - - - - -

2-Ethylhexanol 0,0115 0,0027 0,0381 0,0381 0,0368 0,0089 0,0943 0,0542 0,0405 0,0071 0,0835 0,0397 - - 0,1029 0,0538

2-Acetylfuran 0,0076 0,0021 0,0150 0,0051 0,0072 0,0069 0,0292 0,0182 0,0201 0,0085 0,0273 0,0157 0,0177 0,0042 0,0310 0,0133

Benzaldehyde - - - - - - - - 0,1997 0,0180 0,1854 0,0632 0,1965 0,0171 0,0963 0,0963

Furfuryl acetate 0,0196 0,0196 0,0638 0,0091 - - - - - - - - - - - -

Ethyl nonanoate 0,0697 0,0190 0,0667 0,0667 0,6731 0,0591 1,3741 0,8293 0,7006 0,1121 1,1896 0,7129 0,7738 0,1957 1,4330 0,5019

Linalool 0,0619 0,0215 0,0851 0,0335 0,1529 0,0759 0,1448 0,0949 0,1598 0,0870 0,1429 0,0909 0,1541 0,0739 0,1673 0,0783

Isobutanoic acid 0,0336 0,0065 0,0879 0,0164 - - - - - - - - - - - -

1-Octanol - - - - 0,5160 0,0760 0,4287 0,0399 0,2876 0,0059 0,2399 0,0152 0,5004 0,0052 0,5226 0,0330

1-(2,4-Dimethyl-furan-3-yl)-ethanone 0,0194 0,0065 0,0290 0,0094 0,0462 0,0086 0,0394 0,0037 0,0474 0,0050 0,0399 0,0013 0,0497 0,0024 0,0531 0,0086

Butanoic acid - - - - 0,0223 0,0223 0,0801 0,0344 0,0180 0,0180 0,0157 0,0157 0,0182 0,0182 0,0328 0,0328

2-Decanol 0,0286 0,0118 0,0378 0,0190 0,0690 0,0690 - - 0,0746 0,0746 0,0566 0,0566 0,0525 0,0525 0,0585 0,0585

Ethyl decanoate 0,5747 0,2580 1,4407 1,3155 0,7872 0,0916 1,2777 0,1745 0,4863 0,0127 1,5486 1,3749 0,3951 0,1265 1,3308 0,0778

Simultaneous T1 Simultaneous T2IST408 T1 IST408 T2 US-05 T1 US-05 T2 Sequential T1 Sequential T2

39

Table 7 (continuation) – Average relative abundance (RA) and standard deviation (SD) of all compounds identified in single and mixed fermentations

Fermentation

Compound RA (avg) SD (A_ratio) RA (avg) SD (A_ratio) RA (avg) SD (A_ratio) RA (avg) SD (A_ratio) RA (avg) SD (A_ratio) RA (avg) SD (A_ratio) RA (avg) SD (A_ratio) RA (avg) SD (A_ratio)

p-Tolualdehyde, o-Tolualdehyde 0,0021 0,0021 0,0663 0,0124 0,0341 0,0341 0,0742 0,0071 0,0204 0,0102 0,0589 0,0182 0,0829 0,0249 0,0814 0,0461

Furfuryl alcohol 0,0907 0,0019 0,1382 0,0211 0,1815 0,0321 0,1998 0,1153 0,1966 0,0251 0,1796 0,0704 0,1545 0,0187 0,1797 0,0230

Isoamyl octanoate - - - - - - - - - - - - 0,0121 0,0121 0,0316 0,0008

Isovaleric acid 0,0327 0,0003 0,0610 0,0190 0,2401 0,0074 0,2526 0,0813 0,1093 0,0112 0,0989 0,0050 0,2152 0,0022 0,2409 0,0373

2-Undecanol 0,0043 0,0043 0,0062 0,0062 - - - - 0,0073 0,0073 - - - - - -

Ethyl 9-decenoate 0,0410 0,0275 0,0585 0,0585 0,4560 0,2596 0,5889 0,3296 0,0339 0,0048 0,1879 0,1201 0,1115 0,0247 0,7660 0,2130

Alpha-terpineol 0,0060 0,0026 0,0062 0,0062 - - - - 0,0107 0,0107 0,0102 0,0102 - - - -

3-Hydroxypropyl methyl sulfide 0,0093 0,0022 0,0233 0,0056 - - 0,0117 0,0117 0,0347 0,0036 0,0281 0,0094 0,0418 0,0001 0,0415 0,0037

2-Dodecanol 0,0206 0,0068 0,0311 0,0223 - - - - 0,0345 0,0140 0,0161 0,0161 0,0160 0,0160 - -

Ethyl undecanoate - - 0,0028 0,0028 - - 0,0531 0,0455 0,0373 0,0164 0,0442 0,0351 0,0189 0,0148 0,0665 0,0448

10-Undecen-1-ol 0,0099 0,0060 0,0108 0,0108 0,0177 0,0177 0,0103 0,0103 0,0184 0,0184 0,0132 0,0132 0,0137 0,0137 0,0127 0,0127

Isoamyl nonoate, Isoamyl laurate - - - - - - - - 0,0089 0,0023 0,0135 0,0090 0,0079 0,0035 0,0149 0,0068

1-Decanol 0,0049 0,0005 0,0069 0,0013 0,2368 0,0572 0,1113 0,0033 0,1392 0,0001 0,0777 0,0128 0,1829 0,0200 0,1735 0,0054

Citronellol - - 0,0100 0,0100 0,0156 0,0156 0,0188 0,0051 0,0262 0,0010 0,0192 0,0054 0,0249 0,0004 0,0246 0,0090

Phenethyl acetate 0,1498 0,0533 0,3431 0,0696 0,5416 0,0485 0,5838 0,1074 0,4868 0,0540 0,6916 0,0884 0,5622 0,0166 0,7942 0,0368

Damascenone 0,0028 0,0004 0,0068 0,0003 0,0040 0,0040 0,0058 0,0058 0,0085 0,0004 0,0159 0,0022 0,0043 0,0043 0,0227 0,0017

Hexanoic acid 0,0182 0,0037 0,0525 0,0306 0,3179 0,0633 0,3259 0,1081 0,1419 0,0027 0,2019 0,0421 0,2330 0,0065 0,3170 0,0262

Ethyl dodecanoate 0,6232 0,1573 1,8290 1,7290 0,2963 0,0143 0,4813 0,2573 0,8027 0,2626 1,0236 0,9672 0,1031 0,0240 0,4442 0,1453

Geraniol 0,0070 0,0006 0,0055 0,0055 - - - - - - 0,0023 0,0023 0,0047 0,0047 - -

Furaneol - - - - 0,0995 0,0160 0,0719 0,0480 0,0809 0,0110 0,0490 0,0298 0,0795 0,0044 0,0931 0,0248

Geranyl acetone - - 0,0067 0,0026 - - - - - - 0,0044 0,0044 - - - -

Isoamyl decanoate 0,0079 0,0024 0,0073 0,0073 - - - - - - 0,0136 0,0136 - - 0,0115 0,0009

Phenethyl alcohol 0,1186 0,0265 0,4601 0,2434 3,8258 0,3382 3,6033 0,4506 3,6453 0,2276 3,5416 0,2214 4,0907 0,1718 4,7987 0,2137

2-Acetylpyrrole - - - - - - - - - - 0,0041 0,0041 0,0091 0,0091 0,0057 0,0057

1-Dodecanol 0,0149 0,0004 0,0220 0,0015 0,0525 0,0001 0,0510 0,0147 0,0509 0,0026 0,0493 0,0162 0,0354 0,0023 0,0692 0,0203

Amylbutyrolactone - - - - - - - - 0,0042 0,0042 0,0147 0,0017 0,0048 0,0048 0,0194 0,0002

Octanoic acid 0,0832 0,0046 0,2963 0,0628 1,6633 0,1610 1,4720 0,2202 1,0200 0,0434 1,2960 0,2648 1,3287 0,0867 1,8048 0,1782

1-Tetradecanol - - - - - - - - 0,0268 0,0015 0,0318 0,0098 0,0396 0,0222 0,0389 0,0054

Nonanoic acid 0,1280 0,0567 0,2274 0,0223 0,4448 0,1699 0,4286 0,1299 0,5173 0,2846 0,5117 0,2140 0,3216 0,0409 0,5600 0,1756

1-Pentadecanol - - - - - - - - 0,0226 0,0002 0,0155 0,0155 0,0102 0,0102 0,0189 0,0189

4-Vinylguaiacol 0,0145 0,0002 0,0175 0,0001 0,0411 0,0056 0,0315 0,0036 0,0454 0,0060 0,0297 0,0152 0,0535 0,0010 0,0418 0,0093

Butoxytriglycol 0,0061 0,0024 0,0099 0,0039 0,0068 0,0068 0,0195 0,0010 0,0116 0,0116 0,0141 0,0063 0,0056 0,0056 0,0121 0,0121

Ethyl hexadecanoate 0,0049 0,0049 - - 0,2024 0,0916 0,3300 0,1686 0,4315 0,0074 0,2885 0,1788 0,2584 0,0660 0,3476 0,0570

Decanoic acid 0,2048 0,0144 0,3498 0,0336 0,2204 0,0472 0,2348 0,0336 0,2028 0,0594 0,4398 0,3451 0,1674 0,0004 0,3999 0,0382

Ethyl 9-hexadecenoate 0,0684 0,0634 0,0771 0,0771 0,1681 0,1310 0,4248 0,4058 0,2216 0,1528 0,1020 0,1020 0,2254 0,1556 0,2817 0,2817

2,4-Di-tert-butylphenol 0,0819 0,0223 0,1291 0,0602 0,1838 0,0085 0,1946 0,0525 0,3387 0,0140 0,1358 0,0002 0,2878 0,1638 0,2437 0,0834

Dimethyl phthalate 0,0064 0,0028 0,0022 0,0022 0,0142 0,0024 0,0065 0,0065 0,0149 0,0020 0,0052 0,0052 - - 0,0065 0,0065

Undecylenic acid - - - - - - - - - - 0,0226 0,0226 - - 0,0662 0,0161

Diethyl phthalate 0,0759 0,0047 0,0686 0,0423 0,2195 0,0200 0,1666 0,1205 0,2045 0,0317 0,1581 0,1129 0,1183 0,0677 0,1937 0,1429

1-Hexadecanol 0,0115 0,0004 0,0418 0,0141 0,0272 0,0005 0,0431 0,0069 0,0250 0,0034 0,0402 0,0142 0,0330 0,0060 0,0445 0,0123

Simultaneous T1 Simultaneous T2IST408 T1 IST408 T2 US-05 T1 US-05 T2 Sequential T1 Sequential T2

40

Statistical analysis was performed to assess if there were significant differences between fermentations

regarding the highligthed compounds. Since beers are considered finished only after secondary

fermentation and no significant differences were detected between primary and secondary

fermentations, the focus of the analysis will be the volatile profile of each produced beer in T2.

For acetate esters, the compounds that exhibit the higher relative abundance are ethyl acetate, isoamyl

acetate and phenethyl acetate. After secondary fermentation, H. opuntiae IST408 single culture

fermentation presents a higher relative abundance of ethyl acetate when compared to S. cerevisiae

US-05 single culture fermentation. The relative abundance of this compound in the mixed fermentations

is similar to IST408 single culture fermentation. Regarding phenethyl acetate, H. opuntiae IST408

presents a lower production of this compound when compared to S. cerevisiae US-05. Both mixed

fermentations show a relative abundance of this acetate ester similar to US-05 single culture

fermentation. Finally, regarding isoamyl acetate, IST408 single culture fermentation presents a lower a

relative abundance of this compound when compared to US-05 single culture fermentation. In the case

of mixed fermentations, both show higher relative abundace than US-05 single culture fermentation,

with the simultaneous fermentation presenting higher levels than the sequential fermentation. Although

these differences can be observed in Figure 10, the only difference that was considered significantly

relevant by the statistical analysis was the difference beween H. opuntiae IST408 single culture

fermentation and the remaing fermentations regarding isoamyl acetate.

Regarding ethyl esters, the only differences that were deemed significantly relevant by the statistical

analysis were the differences in the relative abundance of ethyl octanoate beween H. opuntiae IST408

single culture fermentation and S. cerevisiae US-05 single culture and between H. opuntiae single

culture fermentation and simultaneous fermentation. The relative abundance of ethyl octanoate in H.

opuntiae IST408 and S. cerevisiae US-05 sequential fermentation is also higher than H. opuntiae single

culture fermentation, although not statiscally significant. The relative abundance of ethyl hexanoate was

also superior in fermentations where S. cerevisiae US-05 is present when compared to H. opuntiae

IST408 single culture. Ethyl butanoate, ethyl nonaoate and ethyl hexadecanoate were only identified in

fermentations where US-05 is present, presenting similar levels across the three fermentations,

although ethyl nonaoate presents a higher relative abundance than the other two compounds. Ethyl

dodecanoate presents higher relative abundance in H. opuntiae IST408 single culture fermentation

when compared with the remaining fermentations, whereas ethyl decanoate shows similar relative

abundance across all fermentations.

41

Figure 10 – Relative abundance of the most abundant compounds of the acetate and ethyl esters chemical groups. Statistical

significance was considered between mean values when *P-value<0.05; **P-value<0.01; ***P-value<0.001; ****P-value<0.0001.

T1 identifies samples take after primary fermentation and T2 identifies samples taken after secondary fermentation.

Regarding higher alcohols, the members of this group presenting higher relative abundances were

isobutanol, isoamyl alcohol and phenethyl alcohol. The relative abundance of each of these higher

alcohols was much higher in fermentations where S. cerevisiae US-05 was present than in H. opuntiae

IST408 single culture fermentations. Across all four fermentations, the compound that presented higher

relative abundance was isoamyl alcohol. Isobutanol and phenethyl alcohol presented similar relative

abundance levels in IST408 single culture fermentations, with the latter presenting a slighlty higher

relative abundance in the remaning fermentations. Although these differences can be observed in

Figure 10, only the difference between H. opuntiae IST408 single culture fermentations and the

Ethyl

ace

tate

Isoam

yl a

ceta

te

Phenet

hyl a

ceta

te

0

2

4

6

8

Acetate esters T1R

ela

tive a

bu

nd

an

ce

Ethyl

ace

tate

Isoam

yl a

ceta

te

Phenet

hyl a

ceta

te

0

2

4

6

8

Acetate esters T2

Rela

tive a

bu

nd

an

ce

IST408

US-05

Sequential

Simultaneous

Ethyl

buta

noate

Ethyl

hex

anoat

e

Ethyl

oct

anoat

e

Ethyl

nonao

ate

Ethyl

dec

anoat

e

Ethyl

dodec

anoat

e

Ethyl

hex

adec

anoat

e

0

5

10

15

Ethyl esters T1

Rela

tive a

bu

nd

an

ce

Ethyl

buta

noate

Ethyl

hex

anoat

e

Ethyl

oct

anoat

e

Ethyl

nonao

ate

Ethyl

dec

anoat

e

Ethyl

dodec

anoat

e

Ethyl

hex

adec

anoat

e

0

5

10

15

Ethyl esters T2R

ela

tive a

bu

nd

an

ce

**** *** **** **

*

**** ****

****

* **

** *

** ** ****

**** ** *

*

42

remaining fermentations regarding isoamyl acetate was deemed significantly relevant by the statistical

analysis.

Figure 11 – Relative abundance of the most abundant compounds of the higher alcohols and organic acids chemical groups.

Statistical significance was considered between mean values when *P-value<0.05; **P-value<0.01; ***P-value<0.001; ****P-

value<0.0001. T1 identifies samples taken after primary fermentation and T2 identifies samples taken after secondary

fermentation.

Finally, regarding the organic acids group, the six different acids that presented higher relative

abundances were acetic acid, isovaleric acid, hexanoic acid, octanoic acid, nonanoic acid and decanoic

acid. Although some differences can be observed in the relative abundance of these organic acids

across all fermentations (Figure 11), only the differences between S. cerevisiae US-05 single culture

fermentation and the mixed fermentations regarding acetic acid, and the differences between H.

opuntiae IST408 and the remaining fermentations regarding octanoic acid were deemed significantly

relevant by the statistical analysis. After secondary fermentation, the relative abundance of acetic acid

in mixed fermentations was higher compared to the two single culture fermentations. Moreover, the

beer produced by H. opuntiae IST408 single culture presented slightly higher relative abundance of

Isobuta

nol

Isoam

yl a

lcohol

Phenet

hyl a

lcohol

0

10

20

30

Higher alcohols T1

Rela

tive a

bu

nd

an

ce

Isobuta

nol

Isoam

yl a

lcohol

Phenet

hyl a

lcohol

0

10

20

30

Higher alcohols T2

Rela

tive a

bu

nd

an

ce

IST408

US-05

Sequential

Simultaneous

Ace

tic a

cid

Isova

leric

acid

Hex

anoic

aci

d

Oct

anoic

aci

d

Nonan

oic a

cid

Dec

anoic

aci

d

0

1

2

3

Acids T1

Rela

tive a

bu

nd

an

ce

Ace

tic a

cid

Isova

leric

acid

Hex

anoic

aci

d

Oct

anoic

aci

d

Nonan

oic a

cid

Dec

anoic

aci

d

0

1

2

3

Acids T2

Rela

tive a

bu

nd

an

ce

**** **** ****

* * **

**** ****

****

*** ****

**** ****

*** ** * ***

**** **** *

** **

43

acetic acid when compared with the beer produced by S. cerevisiae US-05 single culture. A similar

profile can be observed for decanoic acid, but the relative abundace of this acid is much lower across

all four fermentations. In the fermentations where S. cerevisiae US-05 is present the relative abundance

of octanoic acid was significantly higher than in the fermentation carried out by H. opuntiae single

culture. A similar profile was obtained for hexanoic and nonanoic acids, although the statistical analysis

did not consider statistically significant the differences between H. opuntiae fermentation and the

fermentations where S. cerevisiae is present. Regarding isovaleric acid, H. opuntiae IST408 single

culture fermentation presented the highest relative abundance of this acid across all fermentations.

Interrestingly, the lowest relative abundance of this acid is presented by the sequential fermentation,

with S. cerevisiae US-05 single culture and simultaneous fermentation showing similar intermediate

relative abundance levels.

4.3.3. Organoleptic characterization of the beers produced by pure and mixed culture

fermentations

After secondary fermentation, the beers produced in the single and mixed culture fermentations were

evaluated by a panel of experienced beer tasters and professional craft brewers. The sensory analysis

notes attributed to each beer are presented in Table 8.

Table 8 – Sensory analysis notes of the expert panel for each beer produced in the beers fermented by single cultures of H.

opuntiae IST408 and S. cerevisiae US-05 and by simultaneous or sequential mixed cultures of both species.

Fermentation Tasting Notes

H. opuntiae IST408

Aroma Very sweet, with notes of butter, popcorn and honey; Slightly fruity

and notes of lactic acid (yogurt)

Flavour Malt flavour, without attenuation; Very sweet, with notes of fruits

and honey

Overall Impression

Very sweet, with no attenuation and hard to drink

S. cerevisiae US-05

Aroma Neutral aroma, with the presence of some esters, giving a slight

caramel aroma

Flavour Dry beer, slightly fruity and acidic

Overall Impression

Fresh and light beer, with a clean profile and easy to drink

H. opuntiae IST408 + S. cerevisiae US-05

(Sequential)

Aroma Attenuated malt, slightly citric aroma

Flavour Equilibrated flavour, light and fresh, with citric and slightly acidic

notes

Overall Impression

Pleasant beer

H. opuntiae IST408 + S. cerevisiae US-05

(Simultaneous)

Aroma Fruity, citric and slightly acid and vegetable aroma; Fresh

Flavour Well-attenuated beer, fruity and acidic; Dry

Overall Impression

Pleasant beer with good attenuation, well-equilibrated

44

The comparison between the sensory analysis notes and the volatile profile of the beers is done in the

discussion section.

4.4. Population dynamics during single and mixed culture fermentations of H. opuntiae

IST408 and S. cerevisiae US-05

The study of population dynamics was conducted in order to know how cell populations of the two yeast

species behave and interact in mixed culture fermentations. Since these studies were performed in

small-scale conditions, different from those described before for beer production, single and mixed

culture fermentations of H. opuntiae IST408 and S. cerevisiae US-05 were also monitored by

periodically weighting the vials and plotting the decrease of mass over time, and measuring sugar and

ethanol concentrations, as described previously.

Each fermentation comprised seven vials (one for each time point) and each of these vials was weighted

before acquiring samples for CFUs counting and determination of sugars and ethanol concentrations.

Since the vials were discarded after sample acquisition, the plots presented in Figure 12 were generated

with the weight measurements of vials corresponding to the last time point.

Figure 12 – (A) – Fermentation progress of single and mixed culture fermentations of H. opuntiae IST408 and S. cerevisiae US-

05 fermentations performed for population dynamics studies. Orange dots correspond to H. opuntiae IST408 single culture

fermentation, blue dots correspond to S. cerevisiae US-05 single culture fermentation, yellow dots correspond to sequential

fermentation and grey dots correspond to simultaneous fermentation. The growth curves shown are the result of three

independent experiments that gave rise to the same results. (B) – Fermentation progress of H. opuntiae IST408 single culture

fermentation, with a more appropriate scale.

As expected, the weight loss patterns for each fermentation observed in Figure 12 are similar to those

described in section 4.3.1 (Figure 7), as well as the profiles for sugar consumption and ethanol

production across the four fermentations (Figure 8). This means that these small-scale fermentations

mimic the beer fermentations described before, but this analysis has the advantage of being more

detailed since more time points were taken during primary fermentation, allowing the observation of the

evolution of sugar consumption and ethanol production.

0,0

0,1

0,2

0,3

0,4

0,5

0,6

0,7

0 50 100 150 200 250 300 350

Wei

ght

loss

(g)

Time (h)

All fermentationsA

0,00

0,02

0,04

0,06

0,08

0,10

0 50 100 150 200 250 300 350

Wei

ght

loss

(g)

Time (h)

IST408B

45

Regarding ethanol production (Figure 13), it is possible to observe that H. opuntiae IST408 fermentation

reaches 0.44% (v/v) after 24 hours and this value remains constant during the rest of fermentation,

whereas ethanol concentration is higher in the fermentations where S. cerevisiae US-05 is present. The

ethanol production profile is very similar in the case of S. cerevisiae US-05 single culture and

simultaneous fermentations, reaching a final concentration of 3.70% (v/v) and 3.45% (v/v), respectively.

In the case of the sequential fermentation, during the first 48 hours, when H. opuntiae is the only species

present, the ethanol production is similar to H. opuntiae IST408 single culture fermentation. After the

addition of S. cerevisiae US-05 to the sequential fermentation, an increase in ethanol production similar

to US-05 single culture fermentation is observed, reaching a final concentration of 3.40% (v/v), similar

to the simultaneous fermentation.

Regarding sugar consumption (Figure 13), H. opuntiae IST408 did not ferment maltose and maltotriose

but consumed glucose and fructose almost completely, whereas S. cerevisiae US-05 consumed all four

sugars almost entirely. The sugars consumption pattern for the simultaneous fermentation is similar to

the one observed for S. cerevisiae US-05 single culture fermentation. Finally, regarding the sequential

fermentation, during the first 48 hours, only glucose and fructose were fermented, with maltose and

maltotriose being consumed after the addition of S. cerevisiae US-05, but at a slower rate. The final

concentration for all sugars in each fermentation is similar to the one presented in section 4.3.1.

0 100 200 300 400

0

20

40

60

0

1

2

3

4

H. opuntiae IST408

Time (h)

Su

ga

r (g

/L)

Eth

an

ol (%

v/v

)

0 100 200 300 400

0

20

40

60

0

1

2

3

4

S. cerevisiae US-05

Time (h)

Su

ga

r (g

/L)

Eth

an

ol (%

v/v

)

Maltotriose

Maltose

Glucose

Fructose

Ethanol

0 100 200 300 400

0

20

40

60

0

1

2

3

4

Sequential

Time (h)

Su

ga

r (g

/L)

Eth

an

ol (%

v/v

)

0 100 200 300 400

0

20

40

60

0

1

2

3

4

Simultaneous

Time (h)

Su

ga

r (g

/L)

Eth

an

ol (%

v/v

)

Figure 13 – Sugars (maltose, maltotriose, fructose and glucose) and ethanol concentrations obtained during the fermentation

performed for the study of population dynamics in single (H. opuntiae IST408 and S. cerevisiae US-05) and mixed (sequential

and simultaneous) culture fermentations. Samples were periodically collected during 14 days.

46

The study of population dynamics was conducted by taking two samples from each fermentation vial:

one to assess CFUs in suspension and another to assess total CFUs. It is possible to distinguish

colonies of H. opuntiae IST408 and S. cerevisiae US-05 in WLN agar plates since the first forms big,

green colonies, whereas the second forms small, white colonies. In addition, to assess S. cerevisiae

CFUs in suspension samples from mixed fermentations were also plated in YNB + galactose agar

plates, since only S. cerevisiae can grow in this medium because H. opuntiae IST408 is not able to

consume this sugar. For each fermentation, CFUs over time were plotted, for either CFUs in suspension

and total CFUs, presented in Figures 14 and 15, respectively.

0 100 200 300 400

1×101

1×102

1×103

1×104

1×105

1×106

1×107

1×108

H. opuntiae IST408

Time (h)

CF

U/m

L

0 100 200 300 400

1×101

1×102

1×103

1×104

1×105

1×106

1×107

1×108

S. cerevisiae US-05

Time (h)

CF

U/m

L

0 100 200 300 400

1×101

1×102

1×103

1×104

1×105

1×106

1×107

1×108

Sequential

Time (h)

CF

U/m

L

0 100 200 300 400

1×101

1×102

1×103

1×104

1×105

1×106

1×107

1×108

Simultaneous

Time (h)

CF

U/m

L

Figure 14 – CFUs in suspension in single (H. opuntiae IST408 and S. cerevisiae US-05) and mixed (sequential and simultaneous)

culture fermentations. Full circles represent CFUs of H. opuntiae IST408 and full triangles represent CFUs of S. cerevisiae US-

05.

Regarding the CFUs/mL in suspension (Figure 14), it is possible to observe an increase in CFU/mL

during the first hours of H. opuntiae IST408 single culture (first two time points; increase of around 10-

fold), followed by a decrease to similar but slightly lower values of CFU/mL than the initial value. In the

case S. cerevisiae US-05 single culture fermentation, a very different behaviour can be observed, with

a rapid decrease to levels of around 103 CFU/mL in the first 100 hours, remaining stable during the rest

of fermentation. Regarding mixed culture fermentations, in the case of the sequential fermentation, the

behaviour shown by H. opuntiae IST408 during the first 48 hours (first three time points) is similar to

the one shown by IST408 single culture fermentation. After addition of S. cerevisiae US-05, a steady

decrease in H. opuntiae IST408 CFU/mL in suspension can be observed until the last time point,

although in the last time point the values of CFU/mL in suspension from H. opuntiae are still around ten

47

times higher than the values of CFU/mL for S. cerevisiae. The behaviour of S. cerevisiae US-05 in

suspension in the sequential fermentation is similar to its behaviour in single culture fermentation. In

the case of simultaneous fermentation, S. cerevisiae US-05 also shows a similar behaviour to the one

shown in its single culture fermentation, with the exception of two time points (the third and seventh).

In this fermentation, H. opuntiae IST408 shows a similar behaviour to the one shown in the sequential

fermentation, with the exception of the last time point.

0 100 200 300 400

1×105

1×106

1×107

1×108

H. opuntiae IST408

Time (h)

CF

U/m

L

0 100 200 300 400

1×105

1×106

1×107

1×108

S. cerevisiae US-05

Time (h)

CF

U/m

L

0 100 200 300 400

1×105

1×106

1×107

1×108

Sequential

Time (h)

CF

U/m

L

0 100 200 300 400

1×105

1×106

1×107

1×108

Simultaneous

Time (h)

CF

U/m

L

Figure 15 – Total CFUs in single (H. opuntiae IST408 and S. cerevisiae US-05) and mixed (sequential and simultaneous) culture

fermentations. Full circles represent CFUs of H. opuntiae IST408 and full triangles represent CFUs of S. cerevisiae US-05.

Regarding total CFU/mL (Figure 15) in H. opuntiae IST408 fermentation, we can observe that the

number of CFU/mL increases during the first 48 hours, but starts to decrease after this period and until

200 hours of fermentation. After 200 hours and until the end of fermentation, the number of CFU/mL

remains constant. In the case of S. cerevisiae US-05 fermentation, the number of CFU/mL also

increases in the first 48 hours of fermentation, although reaching lower levels than H. opuntiae IST408

in its single culture fermentation. After 48 hours of fermentation, the levels of S. cerevisiae CFU/mL

remain constant during the rest of the fermentation. Regarding the sequential fermentation, as it was

observed with the CFUs in suspension, during the first 48 hours, the increase of H. opuntiae IST408

total CFUs is similar to the one presented by this strain in its single culture fermentation. After addition

of S. cerevisiae US-05 to the fermentation broth, at 48 hours, a decrease in total CFUs of H. opuntiae

IST408 can be observed until the end of fermentation, reaching a level of total CFUs/mL lower than

total CFUs/mL of S. cerevisiae US-05. This strain, after being added to the fermentation, exhibits an

increase in total CFUs/mL, but not as pronounced as the increased observed in its single culture

48

fermentation and not as fast. After reaching the highest number of CFU/mL, S. cerevisiae US-05 viable

cells remain constant during the rest of the fermentation, overtaking H. opuntiae IST408 as the dominant

strain in terms of total CFU/mL in the last hours of fermentation. In the case of the simultaneous

fermentation, H. opuntiae IST408 exhibits a similar behaviour with the one presented in the sequential

fermentation, with the difference that it does not reach the same high values for total CFU/mL and it

reaches lower total CFU/mL in the end of fermentation. S. cerevisiae US-05 exhibits a similar behaviour

with the one it presented in its single culture fermentation and, similarly to H. opuntiae IST408, it does

not reach the same high levels for total CFU/mL in this fermentation. Remarkably, when comparing the

two mixed fermentations, it can be observed is that in the simultaneous fermentation, S. cerevisiae US-

05 becomes the dominant strain at around 200 hours, whereas in sequential fermentation is dominant

only after 300 hours of fermentation.

4.5. Deletion of ATF1, ATF2 and EAT1 genes in Saccharomyces cerevisiae by CRISPR-

Cas9 methodology

The objective of this molecular biology work was to delete three of the most important genes involved

in the production of acetate esters in S. cerevisiae, ATF1, ATF2 and EAT1, in order to obtain a mutant

strain to be used in future studies for the expression and functional characterization of homologous

genes from non-Saccharomyces strains capable of producing higher yields of acetate esters. All three

genes, ATF1, ATF2 and EAT1, code for alcohol acetyl transferases [129,131].

CRISPR-Cas9 methodology was used to produce the desired mutants. In order to obtain the desired

triple deletion mutant CEN.PK113-7D atf1Δ atf2Δ eat1Δ, single and double deletion mutants

(CEN.PK113-7D atf1Δ and CEN.PK113-7D atf1Δ atf2Δ, respectively) were sequentially obtained.

Single deletion of ATF2 and EAT1 was also performed to obtain CEN.PK113-7D atf2Δ and CEN.PK113-

7D eat1Δ. To confirm if the partial deletions were successfully done, the donor DNA utilized was

designed in a way to introduce (or remove, in the case of ATF1 partial deletion) a restriction site for a

specific restriction enzyme. With this approach, if mutation of the target DNA region occurred, a

restriction reaction performed with the appropriate enzyme would be positive (or negative in the case

of ATF1 partial deletion). The DNA sequence of each gene from positive candidates was sent to be

sequenced by Sanger sequencing and the sequence obtained was compared to the non-mutated DNA

sequence to confirm the partial deletion of the gene. The comparison between the non-mutated DNA

and the sequences obtained from Sanger sequencing are presented in Figure 16. The alignment of the

two DNA sequences shows that a partial deletion of the target gene occurred, which indicates that the

five mutants were successfully obtained. Considering that single, double and triple deletion mutants

were sequentially obtained, the alignments shown in Figure 16D and 16E correspond to the partial

deletion of ATF2 in atf1Δ background strain and EAT1 in atf1Δatf2Δ, respectively.

49

Figure 16 – Alignments between a portion of the target gene sequences obtained by Sanger sequencing and a portion of the

non-mutated target gene sequences; A) Alignment between the non-mutated ATF1 gene sequence and the mutated ATF1 gene

sequence in CEN.PK113-7D atf1Δ; B) Alignment between the non-mutated ATF2 gene sequence and the mutated ATF2 gene

sequence in CEN.PK113-7D atf2Δ; C) Alignment between the non-mutated EAT1 gene sequence and the mutated EAT1 gene

sequence in CEN.PK113-7D eat1Δ; D) Alignment between the non-mutated ATF2 gene sequence and the mutated ATF2 gene

sequence in CEN.PK113-7D atf1Δ atf2Δ; E) Alignment between the non-mutated EAT1 gene sequence and the mutated EAT1

gene in CEN.PK113-7D atf1Δ atf2Δ eat1Δ.

A

B

E

D

C

50

51

5. Discussion

The main goal of this thesis work was the isolation and identification of non-Saccharomyces species

and the evaluation of their potential for the enhancement of the aromatic profile of beer when used in

co-fermentation with a Saccharomyces cerevisiae strain. This study started with the isolation and

identification of microorganisms from a variety of samples of different origins. A total of three different

wine production samples were collected, with two being wine must samples from the same production,

collected at different stages (Mst and Bar), and one being a wine sample (SarB), as well as a

contaminated beer batch sample (CCIST). From the non-vinous sample (CCIST), only one species was

isolated, being identified as Pichia kudriavzevii. This species is considered a spoilage yeast in beer

fermentation and causes biofilms in low pH products [60], which is consistent with the origin of the

CCIST sample. From SarB, only two species were isolated, Clavispora lusitaniae and Candida

intermedia. Since this wine sample was taken quite some time after the wine was produced, a low

biodiversity is expected since only a few species can tolerate the final ethanol concentrations in wine

[28,102,105]. The presence of these species in wine is not common, although they have been isolated

from other fermented beverages [154,155]. Regarding the remaining samples, Mst and Bar, S.

cerevisiae was isolated, as expected, since it is the major contributor in wine fermentation [28]. Yeasts

from the Metschnikowia, Pichia and Hanseniaspora genera were also isolated. The presence of species

from these genera is very common in wine fermentation, mainly in the first stages of fermentations

[28,48,93]. Particularly, Hanseniaspora uvarum and Pichia kluyveri are some of the predominant

species present in the surface of grape berries, which contributes to their presence in high numbers in

the earlier stages of wine fermentation [28]. Candida humilis and Starmerella bacillaris were also

isolated from these samples and these species are also commonly found in wine fermentations

[156,157].

Since some of the non-Saccharomyces species that produce a wide variety of flavour and aroma active

compounds are Hanseniaspora species [89,90,97], strains from this genus (isolated in this work or that

were present in the IST Yeast Culture Collection) were selected to undergo a screening to assess which

ones produced an interesting flavour and aromatic profile in beer. From the four tested strains, H.

opuntiae IST408 was considered the most interesting as its fermentation product was characterized as

having a caramel aroma and sweet taste. Our results demonstrated that H. opuntiae IST408 does not

ferment the two most abundant sugars in beer wort, maltose and maltotriose, which results in low

alcohol concentrations and a very sweet beverage. In order to use this strain in beer production, a mixed

fermentation with inoculation of a S. cerevisiae strain was the strategy planned to be tested. This

approach allowed the fermentation of maltose and maltotriose, leading to a complete fermentation.

SafAle™ US-05 was selected as the S. cerevisiae strain to be used due to its capability of producing a

dry beer, with a neutral aroma, which allows the aroma active compounds produced by H. opuntiae

IST408 to stand out in the final product. This commercial yeast strain has been utilised in other studies

where mixed fermentation of a non-Saccharomyces strains with a S. cerevisiae strain was performed,

as it is the case of the work of Canonico et al. (2019), where three non-Saccharomyces species

52

(Lachancea thermotolerans, Wickerhamomyces anomalus and Zygotorulaspora florentina) where

tested in mixed fermentations with US-05.

Single and mixed culture fermentations of S. cerevisiae US-05 and H. opuntiae IST408 were monitored

by plotting the weight loss of the fermentation flasks over time. This approach is based on the fact that,

since ethanol and carbon dioxide are produced in the same molar proportions during fermentation, and

the latter diffuses out of the flask, it is possible to monitor ethanol production by weighting the flasks.

This assumption was adequate since the fermentations that presented higher weight loss were also

found to exhibit higher sugar consumption and ethanol production. H. opuntiae IST408 single culture

fermentations presented the lowest production of ethanol, which arises from the fact that this strain

does not consume maltose and maltotriose. In fact, this study demonstrates that in single culture

fermentations, H. opuntiae IST408 consume almost all glucose and fructose in the first 48 hours, which

led to an increase of around 10-fold in total CFUs of H. opuntiae IST408 during this time. After this

period, a decrease in the concentration of H. opuntiae IST408 viable cells was observed, which could

be linked to nutrient limitation, since only maltose and maltotriose are available in the fermentation

medium. When comparing the sugar consumption after primary fermentation, the simultaneous

fermentations presented a slightly higher concentration of residual sugars, mainly maltose and

maltotriose, than S. cerevisiae US-05 single culture fermentation. As observed in the population

dynamics studies, S. cerevisiae US-05 was present in higher concentrations during fermentation in its

single culture fermentation than in the simultaneous fermentation, which may explain the difference in

residual sugars observed. Although US-05 single culture fermentation presents a slightly higher total

weight loss value, ethanol production is higher in the simultaneous fermentation. The weight loss pattern

presented by the sequential fermentation is a mix between the patterns presented by both H. opuntiae

and S. cerevisiae single culture fermentations. However, the final weight loss of the sequential

fermentation is lower than the other two fermentations where S. cerevisiae US-05 is present. This can

be correlated to the fact that the concentration of residual sugars, mainly maltose and maltotriose, was

higher in the sequential fermentation, although the ethanol concentration after primary fermentation

was similar to the simultaneous fermentation. As it can be observed in the population dynamics studies,

when S. cerevisiae US-05 was added to the sequential fermentation, glucose and fructose had already

been consumed by H. opuntiae and maltose and maltotriose were the only sugars available. This

contrasts with S. cerevisiae single culture and simultaneous fermentation where S. cerevisiae can

readily use glucose and fructose. This evidence might explain why S. cerevisiae US-05 concentration

in the sequential fermentation is much lower than in US-05 single culture fermentation (around 10 times

lower), which in turn can explain this difference in residual sugar concentration. Both H. opuntiae IST408

and S. cerevisiae US-05 present different fermentative capabilities, mainly in beer wort, since members

of the Hanseniaspora genus do not ferment maltose and maltotriose due to the fact that they not

possess transporters for these sugars [91]. On the other hand, S. cerevisiae strains are particularly

adapted to beer fermentation since they possess membrane transporters for the principal sugars

present in beer wort (maltose, maltotriose, glucose and fructose) and are capable of fermenting them

[5].

53

While S. cerevisiae US-05 presents a similar behaviour after consuming all fermentable sugars in all

fermentations where it is present, a much different behaviour can be observed for H. opuntiae IST408,

where a decrease to lower levels than the initial concentration occur in mixed fermentations, which may

be related with ethanol production by S. cerevisiae US-05. In H. opuntiae IST408 single culture

fermentations, ethanol concentration reached 0.44% (v/v), whereas in the mixed fermentations it

reached a concentration of around 3.40% (v/v). Comparing the CFUs and the ethanol concentration

over time, it can be observed that this much steeper decrease of H. opuntiae IST408 begins when

ethanol concentration reaches a range between 2-3% (v/v). A similar situation can be observed in wine

fermentation where, in the first stages, Hanseniaspora species are the dominant yeasts, but their

presence diminishes throughout fermentation, with S. cerevisiae becoming the dominant species [104].

Although ethanol might have an important role regarding the decrease in H. opuntiae it has been

demonstrated that in S. cerevisiae and H. guilliermondii mixed culture wine fermentations, the former

species accumulates antimicrobial peptides on its cell surface that cause death of the H. guilliermondii

cells upon cell-cell contacts [91,158].

When comparing the values of total CFUs and CFUs in suspension in single culture fermentations, 42%

of the total cells were deposited in the bottom of the vial in H. opuntiae IST408 single culture

fermentation, whereas in S. cerevisiae US-05 single culture fermentation 99.95% of the total cells were

deposited in the bottom of the vial. According to the manufacturer’s commercial sheet, S. cerevisiae

US-05 has a moderate sedimentation but in our experimental conditions, sedimentation of cells was

high. In mixed fermentations, H. opuntiae IST408 presents a deposition of 99.2% of total cells in the

sequential fermentation and a deposition of 96.8% if total cells in the simultaneous fermentation. This

increase in sedimentation might occur due to H. opuntiae IST408 cells becoming trapped in the middle

of S. cerevisiae US-05 aggregates and being pushed down by these aggregates. In the case of US-05,

it presents in mixed fermentations a sedimentation level similar to its single culture fermentation and,

therefore, its sedimentation is not affected by the presence of H. opuntiae cells. Our results demonstrate

that in the mixed fermentations the majority of the cells that will be transferred to the bottle are H.

opuntiae IST408 cells. Nevertheless, only a small part of H. opuntiae and S. cerevisiae total cells will

be transferred to the bottles, since mixed fermentations have high sedimentation levels.

After primary and secondary fermentation, the pH level was measured and a decrease was observed

across all four fermentations. The decrease in pH is associated with the fermentative capacity of each

strains, which is associated with the production of certain metabolites, in particular organic acids [13].

The decrease in pH after primary fermentation was higher for fermentations where S. cerevisiae US-05

is present, with the mixed fermentations exhibiting a lower final pH value than the single culture

fermentation. These values are in accordance with GC-MS results obtained, where the relative

abundance of total organic acids after primary fermentation is much higher in fermentations in which S.

cerevisiae US-05 is involved. After secondary fermentation, an additional decrease in pH was observed,

with H. opuntiae IST408 single culture fermentation still presenting the highest pH value. However, in

this situation, the decrease in pH is higher for this fermentation, minimizing its pH difference to the other

three fermentations. This variation is also in agreement with the GC-MS results, since the relative

54

abundance of total organic acids in the fermentations where US-05 was present is similar between

primary and secondary fermentations, whereas an increase in relative abundance of total organic acids

regarding H. opuntiae IST408 single culture fermentation was observed. Although an increase occurs,

the relative abundance of total organic acids is still lower in IST408 fermentation than in the remaining

fermentations.

Volatile compound analysis of single and mixed culture fermentations was performed by GC-MS.

Across all four fermentations, four chemical groups (acetate esters, ethyl esters, higher alcohols and

organic acids) exhibited the highest relative abundance when compared to other chemical groups.

Higher alcohols are the most abundant organoleptic compounds present in beer, with esters being

present in trace amounts when compared with other yeast metabolites [78]. However, volatile esters

are the most important aroma elements produced by yeast, due to their very low odour threshold in

beer, which confers them an important role in defining the aroma profile [12,20,78]. In the results

obtained for the volatile analysis, higher alcohols was the chemical group with the higher relative

abundance, followed by the acetate and ethyl esters chemical groups. However, these chemical groups

were not present in trace amounts, as mentioned above, and if we group both acetate esters and ethyl

esters in one more general group, esters, their relative abundance is almost similar to the relative

abundance of higher alcohols. When comparing the production of volatile compounds by H. opuntiae

IST408 and S. cerevisiae US-05, we found that similar quantities of total acetate esters and organic

acids were produced, but strain US-05 presented a higher production of total ethyl esters and higher

alcohols. Accordingly, a higher relative abundance regarding total acetate esters and organic acids was

observed when comparing mixed fermentations with US-05 single culture fermentation, which suggests

a synergistic effect between H. opuntiae IST408 and S. cerevisiae US-05. Synergistic effects between

H. guilliermondii, which is genetically closely related to H. opuntiae [91,159,160], and S. cerevisiae

strains were previously described [91,101]. Moreover, differences detected in the aroma profiles of the

wines obtained by mixed culture fermentations were correlated with the changes observed in the

transcript profiles of S. cerevisiae genes involved in the production of the aroma compounds identified

in mixed culture fermentations and attributable to the presence of H. guilliermondii [91,101].

Regarding the organoleptic evaluation of the produced beers, although isoamyl acetate (banana aroma

[41,78]) was present in all four fermentations, the expert panel did not describe any of the beers as

having banana aroma, which may indicate that this compound might be present in a concentration

below its sensorial threshold (1.2-2 mg/L) [78]. Absolute quantification of the identified compounds by

GC-MS was not performed, so conclusions regarding their presence in values above or below their

sensorial threshold may only be drawn from the sensory analysis notes, which constitutes a limitation

of this study. The expert panel described beers produced by fermentations where H. opuntiae IST408

was present as having a fruity aroma, characteristic of ethyl acetate [41,78], that indeed, has higher

relative abundance in these fermentations than in US-05 single culture fermentation. This may indicate

that in beers produced by fermentations where H. opuntiae IST408 was present, ethyl acetate could be

present in higher concentrations than its sensorial threshold (25-30 mg/L) [41,78]. Phenethyl acetate

(floral, rose, honey, sweet aroma [41,78]) appears to influence more the aroma profile of the single

55

culture fermentations, in which their aroma was characterized using descriptors that can be associated

to this ester, as it is the case of honey (identified in H. opuntiae IST408) and sweet (identified in S.

cerevisiae US-05). Although phenethyl acetate exhibits the lowest relative abundance among the three

highlighted acetate esters, this ester has a sensorial threshold of 0.2-3.8 mg/L [41,78], which might

explain why it could influence the aromatic profile of the beers.

Regarding the ethyl esters, ethyl octanoate (apple, aniseed) [41,78,161] exhibits the higher relative

abundance in fermentations where S. cerevisiae US-05 was present and a much lower relative

abundance in H. opuntiae IST408 single culture fermentation. This ethyl ester presents a sensorial

threshold of 0.9-1.0 mg/L [41,78] and, apparently, did not influence the aroma profile of the beers. The

ethyl esters that had higher relative abundance in IST408 single culture fermentations were ethyl

decanoate (sweet, fruity, grapefruit, apple aroma [161]) and ethyl dodecanoate (sweet, soapy and waxy

aroma [161]), which presented similar and lower relative abundance, respectively, in fermentations

where US-05 is involved. Both ethyl esters might have influenced the aroma profile of the beers

produced by IST408 single culture fermentation, since both can confer a sweet aroma to the beer.

Regarding fermentations where S. cerevisiae US-05 is present, ethyl decanoate might have a more

important role than ethyl dodecanoate, since the aroma profile of these beers was characterized using

some of the aroma descriptors associated to this ethyl ester, like sweet (in the case of US-05 single

culture fermentation) or fruity (in the case of the simultaneous fermentation). Other ethyl ester that

presented a high relative abundance, mainly in fermentations where S. cerevisiae US-05 is present, is

ethyl hexanoate (apple, fruity and pineapple aroma [41,78,161]), which might have influenced over the

aroma profile of the beers produced by the simultaneous fermentations, since aromatic descriptors like

fruity were used to characterize these beers.

The abundance of ethyl esters in beer is highly influenced by their precursors availability, which are

medium chain fatty acids [127]. Other factor that can influence the abundance of ethyl esters in beer is

their diffusion across the membrane, since these compounds are liposoluble. The transfer of ethyl

esters to the fermenting medium decreases drastically with the increase of chain length, from 100% for

ethyl hexanoate, to 54%-68% for ethyl octanoate and 8%-17% for ethyl decanoate [127,128]. Octanoic

acid, the precursor of ethyl octanoate (the most abundant ethyl ester), was the fatty acid that presented

the highest relative abundance in all fermentations. Regarding hexanoic, nonanoic and decanoic acids,

which are precursors of ethyl hexanoate, ethyl nonaoate and ethyl decanoate, respectively, differences

in their relative abundance across all fermentations were in accordance to what was observed regarding

the ethyl ester of which they are a precursor. The only exception is nonanoic acid, which was present

in H. opuntiae IST408 single culture fermentation, but not ethyl nonanoate. The aroma descriptors

associated with these fatty acids are cheesy and rancid [161] and since none of the beers were

described as having this aroma, we can suggest that they were present in concentrations below their

sensorial threshold.

Besides medium chain fatty acids, the other detected organic acid was acetic acid, which is the

precursor of ethyl acetate [162,163]. Relative abundance of acetic acid in H. opuntiae IST408 single

culture fermentations was higher than in S. cerevisiae US-05 single culture fermentations, similarly to

56

the relative abundance of acetate ester in these two fermentations. The relative abundance of acetic

acid was similar in both mixed fermentations, which is in agreement with the relative abundance of ethyl

acetate in these fermentations, but was higher than the relative abundance in IST408 single culture

fermentation, which was not observed in the case of ethyl acetate. The presence of acetic acid in all

four beers might contribute to the acidic flavour that the beers presented, with the exception of the beers

produced by H. opuntiae IST408 single culture fermentation. Since IST408 is unable to ferment maltose

and maltotriose, the beers produced by H. opuntiae IST408 present higher concentration of residual

sugars (observed in the HPLC analysis) and, consequently, their sweet flavour can mask their acidity.

The higher alcohols present with the highest relative abundance were isobutanol, isoamyl alcohol and

phenethyl alcohol. Isobutanol (solvent aroma [78,161]) has a relatively high sensorial threshold (100

mg/L) [78], which might explain why it did not contribute to the aroma profile of the beers. Phenethyl

alcohol (roses, honey aroma [78,161]) and isoamyl alcohol (banana aroma [78,161]), the precursors of

phenethyl acetate and isoamyl acetate, respectively, presented a similar relative abundance in the

fermentations where S. cerevisiae US-05 is involved, with a much lower relative abundance in H.

opuntiae IST408 single culture fermentation. These observations are in accordance with the relative

abundances observed for the acetate ester of which these alcohols are a precursor. Although isoamyl

alcohol and phenethyl alcohol have the same aroma descriptors as their acetate ester counterparts, the

sensorial thresholds for these higher alcohols are much higher (50-65 mg/L for isoamyl alcohol and 40

mg/L for phenethyl alcohol [78]). Like it was observed for isoamyl acetate, since none of the beers

presented a banana aroma, isoamyl alcohol concentration appears to be lower than its sensorial

threshold. In the case of phenethyl alcohol, it may also contribute for the aroma profile of beers where

phenethyl acetate appears to have a significant role. One reason that may explain why H. opuntiae

IST408 single culture fermentations present a much lower relative abundance of higher alcohols is the

fact that this yeast does not possess aryl-alcohol dehydrogenases, which are enzymes responsible for

the synthesis of higher alcohols from aldehydes [91].

A chemical group that might have influenced the aroma profile of the beers but was not present with

one of the highest relative abundances is the terpenes. From this group, β-citronellol and linalool were

identified and the aroma descriptors associated with these compounds are citric and floral aroma

[16,146], with the former being used by the expert panel to describe the aroma of the beers produced

by mixed fermentation. The precursor of these compounds, geraniol, is present in the essential oils of

hops, and can be metabolized into β-citronellol and linalool, in a metabolic cascade [16,146]. Although

these compounds present a very low olfactory threshold (8 µg/L for β-citronellol and 5 µg/L for linalool),

citric aroma was only described for the mixed fermentations, even though they are present in similar

relative abundances in beers produced by S. cerevisiae US-05 fermentation. This can indicate that the

citric aroma may arise due to a conjugation of different volatile compounds in the mixed fermentations

[57], or as a result of the presence of a volatile compound that was not identified in the GC-MS spectra,

possibly due to its retention time being similar to other more abundant compounds, which could have

masked the peak of this unidentified compound.

57

It is important to point out that only two replicates were analysed by GC-MS, which resulted in the

relative quantification of some compounds having a relatively high standard deviation, which affected

the statistical analysis to determine if differences between fermentations were significantly relevant.

This is particularly important in the case of ethyl esters, because these compounds are very volatile,

presumably leading to a big difference between replicates.

Taking into consideration the evaluation of the expert panel and the volatile profile of the beers

produced, we can say that performing mixed fermentation of S. cerevisiae US-05 with H. opuntiae

IST408 leads to the improvement of the organoleptic profile of the final product. Higher relative

abundance of acetate esters and organic acids was obtained, which contributed to a more complex

aroma and flavour profile. Regarding both mixed fermentations, the expert panel preferred the beers

produced by the simultaneous fermentation to those that were produced by sequential fermentation,

because it was considered to present a more complex aroma and more prominent fruity and acidic

flavour notes.

As mentioned before, acetate esters are one of the most important chemical groups in regards to the

aroma profile of beer, conferring fruity and floral aromas to this beverage [16,44,132]. Among the

acetate esters, ethyl acetate is one of the most important aroma compound in fermented foods, but its

chemical relevance goes beyond being a flavour-active compound. Ethyl acetate is also a valuable

bulk chemical, industrially produced from petrochemical resources, that can be used as a chemical

solvent and applied in the synthesis of biodiesels paints, adhesives, herbicides and resins [17,131].

Although S. cerevisiae is capable of producing compounds from this group, some non-Saccharomyces

species produce acetate esters in higher concentrations [16,44]. In S. cerevisiae, ATF1, ATF2 and

EAT1 genes are responsible for the majority of the biosynthesis of acetate esters, mainly ethyl acetate

[131,164,165]. When this thesis work started, S. cerevisiae EAT1 deletion mutant and S. cerevisiae

ATF1 ATF2 double deletion mutant were described in the literature [17,129], but the triple deletion

mutant was not. Ethyl acetate production was reduced by 50% in both mutants [17,129,132], with

isoamyl acetate and phenethyl acetate production being reduced by 80% in the S. cerevisiae ATF1

ATF2 double deletion mutant [129,164]. In this thesis work, we aimed at the construction of the S.

cerevisiae triple deletion mutant, by partially eliminating the aforementioned genes in the genome of S.

cerevisiae CEN.PK 113-7D using CRISPR-Cas9 methodology. The desired triple deletion mutant,

CEN.PK113-7D atf1Δ atf2Δ eat1Δ, was successfully obtained, which was confirmed by the positive

results of the restriction assays and the DNA sequences obtained by Sanger sequencing. However,

during this thesis work, the triple deletion mutant was constructed and described by a different

laboratory [132]. In their work, Kruis et al. obtained a total of 14 CEN.PK2-1D disruption mutants,

including six single knockouts (atf1Δ, atf2Δ, eat1Δ, eht1Δ, eeb1Δ, imo32Δ) and 8 multiple disruption

mutants [132]. Their results showed that, contrary to what was expected, the triple mutant atf1Δ atf2Δ

eat1Δ still produced ethyl acetate and isoamyl acetate. The authors concluded that there are other

mechanisms producing ethyl acetate and isoamyl acetate in S. cerevisiae, which are not yet fully

elucidated. Besides constructing the aforementioned mutants in their work, Kruis et al. (2018) also

performed heterologous expression in CEN.PK2-1D of EAT1 homologous genes from different non-

58

Saccharomyces species, with some overexpression strains showing increased production of acetate

esters. Nevertheless, there are other non-Saccharomyces species capable of producing ethyl acetate

that have not been tested that could be interesting, such as Hanseniaspora guilliermondii [91]. It should

be also noted that there is a high variability regarding acetate esters production within each species,

with certain strains producing higher quantities of acetate esters than others [13]. The work developed

in this thesis is a starting point for the exploration of ethyl acetate production in yeasts. In specific, the

triple deletion mutant, CEN.PK113-7D atf1Δ atf2Δ eat1Δ, will be very useful in future studies for the

functional characterization of ATF1, ATF2 and EAT1 homologous genes from non-Saccharomyces

species that present a high yield of acetate esters production.

59

6. Concluding remarks and future perspectives

The recent increase in craft beer popularity and the emergence of new craft breweries has led to more

experimentation in the craft beer industry, in a way to produce beers with complex organoleptic profiles

[8,9]. One of the approaches taken is the use of non-Saccharomyces species as starters, which are not

commonly used in beer production, to obtain a final product with distinct aroma and flavour profiles

[6,8,13]. In this work, the potential of Hanseniaspora opuntiae IST408 to enhance the organoleptic

profile of beer was assessed. Fermentation of beer wort with this strain yielded a final product with low

ethanol concentration and high sugar concentration, because this species only ferments glucose and

fructose, leaving maltose and maltotriose in the medium, which resulted in a beer that is very sweet and

hard to drink. Nevertheless, H. opuntiae IST408 shows promise in the production of fermented

beverages with low alcohol content, although special attention should be taken to the sugar composition

of the fermentative medium, in order to avoid the production of an overly sweet beverage. In regards to

its potential for beer production, mixed culture fermentations with Saccharomyces cerevisiae US-05

were performed. The beers produced by co-fermentation presented an improved organoleptic profile

when compared with beers produced by S. cerevisiae US-05 single culture fermentation, in particular

the beers produced by simultaneous inoculation of both H. opuntiae IST408 and S. cerevisiae US-05

that were considered the most pleasant.

Although positive results were obtained, it should be interesting to perform these fermentations with a

different set of conditions, such as varying the inoculation ratio between both species or changing the

temperature, which is one of the parameters that can affect the production of volatile compounds

[20,130]. In addition, since volatiles’ production is both species- and strain-specific [14,41,90], mixed

culture fermentations of S. cerevisiae US-05 with other strains of H. opuntiae or other non-

Saccharomyces species should also be investigated. For this, the isolation and identification of new

yeasts from different environments should be done, followed by the characterization of the volatile

esters produced by each isolate prior to beer fermentation.

The quantification of the volatile compounds by GC-MS is one aspect that can be improved in future

studies. Although the relative quantification was done in this thesis work, absolute quantification is

preferable and desired, since it allows to directly compare the concentration of the compound with its

sensorial threshold and understand if it influences the aroma profile of the beer.

In parallel with the co-fermentation studies, molecular biology work was performed in order to construct

a S. cerevisiae mutant in which the three main genes involved in the acetate ester biosynthesis are

eliminated. Acetate esters are important compounds regarding the aroma profile of beer [12,41]. Ethyl

acetate, in particular, is one of the most important aroma compounds in fermented beverages, while

also being a valuable bulk chemical in other industries [17]. Since this ester is produced industrially

from petrochemical resources, yeasts that produce high amounts of ethyl acetate can become an

important sustainable alternative to the production of this compound [18,165]. The desired triple deletion

mutant, CEN.PK113-7D atf1Δ atf2Δ eat1Δ, was successfully obtained, but the confirmation of the

60

acetate esters’ deficient production phenotype should be further investigated. If positive, the mutant

strain constructed in this thesis work will be useful in future studies for the functional characterization

of ATF1, ATF2 and EAT1 homologous genes from non-Saccharomyces species that present high

acetate ester production. To perform these studies, several different non-Saccharomyces species

should be screened for their acetate ester production in different media, in order to assess which

species could be of interest regarding the desired application.

61

7. References

[1] Arevalo-Villena M, Briones-Perez A, Corbo MR, Sinigaglia M, Bevilacqua A. Biotechnological

application of yeasts in food science: Starter cultures, probiotics and enzyme production. J Appl

Microbiol 2017;123:1360–72. https://doi.org/10.1111/jam.13548.

[2] Berbegal C, Spano G, Fragasso M, Grieco F, Russo P, Capozzi V. Starter cultures as biocontrol

strategy to prevent Brettanomyces bruxellensis proliferation in wine. Appl Microbiol Biotechnol

2018;102:569–76. https://doi.org/10.1007/s00253-017-8666-x.

[3] Spitaels F, Wieme AD, Janssens M, Aerts M, Daniel H, Van Landschoot A, et al. The Microbial

Diversity of Traditional Spontaneously Fermented Lambic Beer. PLoS One 2014;9:e95384.

https://doi.org/10.1371/journal.pone.0095384.

[4] Steensels J, Verstrepen KJ. Taming Wild Yeast : Potential of Conventional and Nonconventional

Yeasts in Industrial Fermentations. Annu Rev Microbiol 2014;68:61–80.

https://doi.org/10.1146/annurev-micro-091213-113025.

[5] Gallone B, Mertens S, Gordon JL, Maere S, Verstrepen KJ, Steensels J. Origins, evolution,

domestication and diversity of Saccharomyces beer yeasts. Curr Opin Biotechnol 2018;49:148–

55. https://doi.org/10.1016/j.copbio.2017.08.005.

[6] Basso RF, Alcarde AR. Could non-Saccharomyces yeasts contribute on innovative brewing

fermentations? Food Res Int 2016;86:112–20. https://doi.org/10.1016/j.foodres.2016.06.002.

[7] Marsit S, Dequin S. Diversity and adaptive evolution of Saccharomyces wine yeast : a review.

FEMS Yeast Res 2015;15:1–12. https://doi.org/10.1093/femsyr/fov067.

[8] Aquilani B, Laureti T, Poponi S, Secondi L. Beer choice and consumption determinants when

craft beers are tasted: An exploratory study of consumer preferences. Food Qual Prefer

2015;41:214–24. https://doi.org/10.1016/j.foodqual.2014.12.005.

[9] Elzinga KG, Tremblay CH, Tremblay VJ. Craft Beer in the United States: History, Numbers, and

Geography. J Wine Econ 2015;10:242–74. https://doi.org/10.1017/jwe.2015.22.

[10] Murray DW, O’Neill MA. Craft beer: Penetrating a niche market. Br Food J 2012;114:899–909.

https://doi.org/10.1108/00070701211241518.

[11] Bråtå HO. Local traditions as a means for commercial production of historical beers: The case

of Vossaøl, Norway. Nor Geogr Tidsskr 2017;71:301–12.

https://doi.org/10.1080/00291951.2017.1395909.

[12] Olaniran AO, Hiralal L, Mokoena MP, Pillay B. Flavour-active volatile compounds in beer:

production, regulation and control. J Inst Brew 2017;123:13–23. https://doi.org/10.1002/jib.389.

[13] Padilla B, Gil J V., Manzanares P. Past and Future of Non- Saccharomyces Yeasts : From

62

Spoilage Microorganisms to Biotechnological Tools for Improving Wine Aroma Complexity.

Front Microbiol 2016;7:411–31. https://doi.org/10.3389/fmicb.2016.00411.

[14] Michel M, Meier-Dörnberg T, Jacob F, Methner FJ, Wagner RS, Hutzler M. Review: Pure non-

Saccharomyces starter cultures for beer fermentation with a focus on secondary metabolites

and practical applications. J Inst Brew 2016;122:569–87. https://doi.org/10.1002/jib.381.

[15] Rijswijck IMH, Wolkers – Rooijackers JCM, Abee T, Smid EJ. Performance of non‐conventional

yeasts in co‐culture with brewers’ yeast for steering ethanol and aroma production. Microb

Biotechnol 2017;10:1591–602. https://doi.org/10.1111/1751-7915.12717.

[16] Holt S, Miks MH, de Carvalho BT, Foulquié-Moreno MR, Thevelein JM. The molecular biology

of fruity and floral aromas in beer and other alcoholic beverages. FEMS Microbiol Rev

2019;43:193–222. https://doi.org/10.1093/femsre/fuy041.

[17] Kruis AJ, Levisson M, Mars AE, van der Ploeg M, Garcés Daza F, Ellena V, et al. Ethyl acetate

production by the elusive alcohol acetyltransferase from yeast. Metab Eng 2017;41:92–101.

https://doi.org/10.1016/j.ymben.2017.03.004.

[18] Löser C, Urit T, Bley T. Perspectives for the biotechnological production of ethyl acetate by

yeasts. Appl Microbiol Biotechnol 2014;98:5397–415. https://doi.org/10.1007/s00253-014-5765-

9.

[19] Bokulich NA, Bamforth CW. The Microbiology of Malting and Brewing. Microbiol Mol Biol Rev

2013;77:157–72. https://doi.org/10.1128/mmbr.00060-12.

[20] Hiralal L, Olaniran AO, Pillay B. Aroma-active ester profile of ale beer produced under different

fermentation and nutritional conditions. J Biosci Bioeng 2014;117:57–64.

https://doi.org/10.1016/j.jbiosc.2013.06.002.

[21] Baker EC, Wang B, Bellora N, Peris D, Hulfachor AB, Koshalek JA, et al. The genome sequence

of Saccharomyces eubayanus and the domestication of lager-brewing yeasts. Mol Biol Evol

2015;32:2818–31. https://doi.org/10.1093/molbev/msv168.

[22] Libkind D, Hittinger CT, Valeŕio E, Gonca̧lves C, Dover J, Johnston M, et al. Microbe

domestication and the identification of the wild genetic stock of lager-brewing yeast. Proc Natl

Acad Sci U S A 2011;108:14539–44. https://doi.org/10.1073/pnas.1105430108.

[23] Van Oevelen D, Spaepen M, Timmermans P, Verachtert H. Microbiological Aspects of

Spontaneous Wort Fermentation in the Production of Lambic and Gueuze. J Inst Brew

1977;83:356–60. https://doi.org/10.1002/j.2050-0416.1977.tb03825.x.

[24] Crauwels S, Steensels J, Aerts G, Willems KA, Verstrepen KJ, Lievens B. Brettanomyces

bruxellensis, essential contributor in spontaneous beer fermentations providing novel

opportunities for the brewing industry. BrewingScience 2015;68:110–21.

[25] Gallone B, Steensels J, Prahl T, Soriaga L, Saels V, Herrera-Malaver B, et al. Domestication

63

and Divergence of Saccharomyces cerevisiae Beer Yeasts. Cell 2016;166:1397-1410.e16.

https://doi.org/10.1016/j.cell.2016.08.020.

[26] Stefanini I, Dapporto L, Berń L, Polsinelli M, Turillazzi S, Cavalieri D. Social wasps are a

Saccharomyces mating nest. Proc Natl Acad Sci U S A 2016;113:2247–51.

https://doi.org/10.1073/pnas.1516453113.

[27] Gonçalves M, Pontes A, Almeida P, Barbosa R, Serra M, Libkind D, et al. Distinct Domestication

Trajectories in Top-Fermenting Beer Yeasts and Wine Yeasts. Curr Biol 2016;26:2750–61.

https://doi.org/10.1016/j.cub.2016.08.040.

[28] Capozzi V, Garofalo C, Assunta M, Grieco F, Spano G. Microbial terroir and food innovation :

The case of yeast biodiversity in wine. Microbiol Res 2015;181:75–83.

https://doi.org/10.1016/j.micres.2015.10.005.

[29] Marsh AJ, Hill C, Ross RP, Cotter PD. Fermented beverages with potential : Past and future

perspectives. Trends Food Sci Technol 2014;38:113–24.

https://doi.org/10.1016/j.tifs.2014.05.002.

[30] Baschali A, Tsakalidou E, Kyriacou A, Karavasiloglou N, Matalas AL. Traditional low-alcoholic

and non-alcoholic fermented beverages consumed in European countries: A neglected food

group. Nutr Res Rev 2017;30:1–24. https://doi.org/10.1017/S0954422416000202.

[31] Kurtzman CP, Fell JW, Boekhout T. Summry of Species Characteristics. Yeasts a Taxon. Study,

Elsevier B.V.; 2011, p. 223–77. https://doi.org/10.1016/b978-0-444-52149-1.00165-8.

[32] Rodriguez J, Perez JA, Ruiz T, Rodriguez L. Characterization of the invertase from Pichia

anomala. Biochem J 1995;306:235–9. https://doi.org/10.1042/bj3060235.

[33] Walker GM. Pichia anomala: Cell physiology and biotechnology relative to other yeasts. Antonie

van Leeuwenhoek, Int J Gen Mol Microbiol 2011;99:25–34. https://doi.org/10.1007/s10482-010-

9491-8.

[34] Lee YJ, Choi YR, Lee SY, Park JT, Shim JH, Park KH, et al. Screening wild yeast strains for

alcohol fermentation from various fruits. Mycobiology 2011;39:33–9.

https://doi.org/10.4489/MYCO.2011.39.1.033.

[35] Fredlund E, Druvefors UÄ, Olstorpe MN, Passoth V, Schnürer J. Influence of ethyl acetate

production and ploidy on the anti-mould activity of Pichia anomala. FEMS Microbiol Lett

2004;238:133–7. https://doi.org/10.1016/j.femsle.2004.07.027.

[36] Passoth V, Fredlund E, Druvefors UÄ, Schnürer J. Biotechnology, physiology and genetics of

the yeast Pichia anomala. FEMS Yeast Res 2006;6:3–13. https://doi.org/10.1111/j.1567-

1364.2005.00004.x.

[37] Bajaj BK, Raina S, Singh S. Killer toxin from a novel killer yeast Pichia kudriavzevii RY55 with

idiosyncratic antibacterial activity. J Basic Microbiol 2012;52:1–11.

64

https://doi.org/10.1002/jobm.201200187.

[38] Belda I, Ruiz J, Alonso A, Marquina D, Santos A. The biology of pichia membranifaciens killer

toxins. Toxins (Basel) 2017;9. https://doi.org/10.3390/toxins9040112.

[39] Rojas V, Gil J V., Manzanares P, Gavara R, Piñaga F, Flors A. Measurement of alcohol

acetyltransferase and ester hydrolase activities in yeast extracts. Enzyme Microb Technol

2002;30:224–30. https://doi.org/10.1016/S0141-0229(01)00483-5.

[40] Yoshioka K, Hashimoto N. Ester Formation by Alcohol Acetyltransferase from Brewers’’

Yeast</i>. Agric Biol Chem 1981;45:2183–90. https://doi.org/10.1271/bbb1961.45.2183.

[41] Verstrepen KJ, Derdelinckx GUY, Dufour J, Winderickx J, Thevelein JM, Pretorius IS, et al.

Flavor active esters: Adding fruitiness to beer. J Biosci Bioeng 2003;96:1–9.

https://doi.org/10.1016/S1389-1723(03)90112-5.

[42] Bellut K, Michel M, Zarnkow M, Hutzler M, Jacob F, De Schutter DP, et al. Application of non-

Saccharomyces yeasts isolated from kombucha in the production of alcohol-free beer.

Fermentation 2018;4. https://doi.org/10.3390/fermentation4030066.

[43] Anfang N, Brajkovich M, Goddard MR. Co-fermentation with Pichia kluyveri increases varietal

thiol concentrations in Sauvignon Blanc. Aust J Grape Wine Res 2004;15:1–8.

https://doi.org/10.1111/j.1755-0238.2008.00031.x.

[44] Holt S, Mukherjee V, Lievens B, Verstrepen KJ, Thevelein JM. Bioflavoring by non-conventional

yeasts in sequential beer fermentations. Food Microbiol 2018;72:55–66.

https://doi.org/10.1016/j.fm.2017.11.008.

[45] Osburn K, Amaral J, Metcalf SR, Nickens DM, Rogers CM, Sausen C, et al. Primary souring: A

novel bacteria-free method for sour beer production. Food Microbiol 2018;70:76–84.

https://doi.org/10.1016/j.fm.2017.09.007.

[46] Canonico L, Galli E, Ciani E, Comitini F, Ciani M. Exploitation of Three Non-Conventional Yeast

Species in the Brewing Process. Microorganisms 2019;7:11.

https://doi.org/10.3390/microorganisms7010011.

[47] Barda NB, Rubio NC, Caballero AC. Selection and characterization of a Patagonian Pichia

kudriavzevii for wine deacidification. J Appl Microbiol 2014;117:451–64.

https://doi.org/10.1111/jam.12547.

[48] Jolly NP, Varela C, Pretorius IS. Not your ordinary yeast: non-Saccharomyces yeasts in wine

production uncovered. FEMS Yeast Res 2014;14:215–37. https://doi.org/10.1111/1567-

1364.12111.

[49] van Breda V, Jolly N, van Wyk J. Characterisation of commercial and natural Torulaspora

delbrueckii wine yeast strains. Int J Food Microbiol 2013;163:80–8.

https://doi.org/10.1016/j.ijfoodmicro.2013.02.011.

65

[50] Ciani M, Beco L, Comitini F. Fermentation behaviour and metabolic interactions of multistarter

wine yeast fermentations. Int J Food Microbiol 2006;108:239–45.

https://doi.org/10.1016/j.ijfoodmicro.2005.11.012.

[51] Tataridis P, Kanelis A, Logotetis S, Nerancis E. Use of non-saccharomyces Torulaspora

delbrueckii yeast strains in winemaking and brewing. Zb Matice Srp Za Prir Nauk 2013:415–26.

https://doi.org/10.2298/ZMSPN1324415T.

[52] Alves-Araujo C, Pacheco A, Almeida MJ, Spencer-Martins I, Leao C, Sousa MJ. Sugar utilization

patterns and respiro-fermentative metabolism in the baker’s yeast Torulaspora delbrueckii.

Microbiology 2007;153:898–904. https://doi.org/10.1099/mic.0.2006/003475-0.

[53] Bely M, Stoeckle P, Masneuf-Pomarède I, Dubourdieu D. Impact of mixed Torulaspora

delbrueckii–Saccharomyces cerevisiae culture on high-sugar fermentation. Int J Food Microbiol

2008;122:312–20. https://doi.org/10.1016/j.ijfoodmicro.2007.12.023.

[54] Hanl L, Sommer P, Arneborg N. The effect of decreasing oxygen feed rates on growth and

metabolism of Torulaspora delbrueckii. Appl Microbiol Biotechnol 2005;67:113–8.

https://doi.org/10.1007/s00253-004-1695-2.

[55] Salvadó Z, Arroyo-López FN, Guillamón JM, Salazar G, Querol A, Barrio E. Temperature

adaptation Markedly Determines evolution within the genus Saccharomyces. Appl Environ

Microbiol 2011;77:2292–302. https://doi.org/10.1128/AEM.01861-10.

[56] Michel M, Kopecká J, Meier-Dörnberg T, Zarnkow M, Jacob F, Hutzler M. Screening for new

brewing yeasts in the non- Saccharomyces sector with Torulaspora delbrueckii as model. Yeast

2016;33:129–44. https://doi.org/10.1002/yea.3146.

[57] Canonico L, Agarbati A, Comitini F, Ciani M. Torulaspora delbrueckii in the brewing process: A

new approach to enhance bioflavour and to reduce ethanol content. Food Microbiol 2016;56:45–

51. https://doi.org/10.1016/j.fm.2015.12.005.

[58] King A, Richard Dickinson J. Biotransformation of monoterpene alcohols by Saccharomyces

cerevisiae, Torulaspora delbrueckii and Kluyveromyces lactis. Yeast 2000;16:499–506.

https://doi.org/10.1002/(SICI)1097-0061(200004)16:6<499::AID-YEA548>3.0.CO;2-E.

[59] Steensels J, Daenen L, Malcorps P, Derdelinckx G, Verachtert H, Verstrepen KJ. Brettanomyces

yeasts - From spoilage organisms to valuable contributors to industrial fermentations. Int J Food

Microbiol 2015;206:24–38. https://doi.org/10.1016/j.ijfoodmicro.2015.04.005.

[60] Fleet GH. Yeast Spoilage of Foods and Beverages. Yeasts, A Taxon. Study, Elsevier B.V.; 2006,

p. 53–63. https://doi.org/10.1016/B978-0-444-52149-1.00005-7.

[61] Varela C, Borneman AR. Yeasts found in vineyards and wineries. Yeast 2017;34:111–28.

https://doi.org/10.1002/yea.3219.

[62] Schifferdecker AJ, Dashko S, Ishchuk OP, Piškur J. The wine and beer yeast Dekkera

66

bruxellensis. Yeast 2014;31:323–32. https://doi.org/10.1002/yea.3023.

[63] Barnett JA, Entian KD. A history of research on yeasts 9: Regulation of sugar metabolism. Yeast

2005;22:835–94. https://doi.org/10.1002/yea.1249.

[64] Barata A, Caldeira J, Botelheiro R, Pagliara D, Malfeito-Ferreira M, Loureiro V. Survival patterns

of Dekkera bruxellensis in wines and inhibitory effect of sulphur dioxide. Int J Food Microbiol

2008;121:201–7. https://doi.org/10.1016/j.ijfoodmicro.2007.11.020.

[65] De Deken RH. The Crabtree effect: a regulatory system in yeast. J Gen Microbiol 1966;44:149–

56. https://doi.org/10.1099/00221287-44-2-149.

[66] Rozpedowska E, Hellborg L, Ishchuk OP, Orhan F, Galafassi S, Merico A, et al. Parallel

evolution of the make-accumulate-consume strategy in Saccharomyces and Dekkera yeasts.

Nat Commun 2011;2. https://doi.org/10.1038/ncomms1305.

[67] Freer SN. Acetic acid production by Dekkera/Brettanomyces yeasts. World J Microbiol

Biotechnol 2002;18:271–5. https://doi.org/10.1023/A:1014927129259.

[68] Freer SN, Dien B, Matsuda S. Production of acetic acid by Dekkera/Brettanomyces yeasts under

conditions of constant pH. World J Microbiol Biotechnol 2003;19:101–5.

https://doi.org/10.1023/A:1022592810405.

[69] Blomqvist J, Eberhard T, Schnürer J, Passoth V. Fermentation characteristics of Dekkera

bruxellensis strains. Appl Microbiol Biotechnol 2010;87:1487–97.

https://doi.org/10.1007/s00253-010-2619-y.

[70] De Barros Pita W, Silva DC, Simões DA, Passoth V, De Morais MA. Physiology and gene

expression profiles of Dekkera bruxellensis in response to carbon and nitrogen availability.

Antonie van Leeuwenhoek, Int J Gen Mol Microbiol 2013;104:855–68.

https://doi.org/10.1007/s10482-013-9998-x.

[71] Blomqvist J, Passoth V. Dekkera bruxellensis-spoilage yeast with biotechnological potential, and

a model for yeast evolution, physiology and competitiveness. FEMS Yeast Res 2015;15:1–9.

https://doi.org/10.1093/femsyr/fov021.

[72] Kumara HMCS, De Cort S, Verachtert H. Localization and characterization of α-glucosidase

activity in Brettanomyces lambicus. Appl Environ Microbiol 1993;59:2352–8.

[73] Vanderhaegen B, Neven H, Coghe S, Verstrepen KJ, Derdelinckx G, Verachtert H. Bioflavoring

and beer refermentation. Appl Microbiol Biotechnol 2003;62:140–50.

https://doi.org/10.1007/s00253-003-1340-5.

[74] Daenen L, Saison D, Sterckx F, Delvaux FR, Verachtert H, Derdelinckx G. Screening and

evaluation of the glucoside hydrolase activity in Saccharomyces and Brettanomyces brewing

yeasts. J Appl Microbiol 2008;104:478–88. https://doi.org/10.1111/j.1365-2672.2007.03566.x.

67

[75] Winterhalter P, Skouroumounis GK. Glycoconjugated aroma compounds: Occurrence, role and

biotechnological transformation. In: Berger RG, Babel W, Blanch HW, Cooney CL, Enfors S-O,

Eriksson K-EL, et al., editors. Biotechnol. Aroma Compd., Berlin, Heidelberg: Springer Berlin

Heidelberg; 1997, p. 73–105. https://doi.org/10.1007/BFb0102063.

[76] Daenen L, Sterckx F, Delvaux FR, Verachtert H, Derdelinckx G. Evaluation of the glycoside

hydrolase activity of a Brettanomyces strain on glycosides from sour cherry (Prunus cerasus L.)

used in the production of special fruit beers. FEMS Yeast Res 2008;8:1103–14.

https://doi.org/10.1111/j.1567-1364.2008.00421.x.

[77] Fia G, Giovani G, Rosi I. Study of β-glucosidase production by wine-related yeasts during

alcoholic fermentation. A new rapid fluorimetric method to determine enzymatic activity. J Appl

Microbiol 2005;99:509–17. https://doi.org/10.1111/j.1365-2672.2005.02657.x.

[78] Pires EJ, Teixeira JA, Brányik T, Vicente AA. Yeast: The soul of beer’s aroma - A review of

flavour-active esters and higher alcohols produced by the brewing yeast. Appl Microbiol

Biotechnol 2014;98:1937–49. https://doi.org/10.1007/s00253-013-5470-0.

[79] Spaepen M, Verachtert H. Esterase activity in the genus Brettanomyces. J Inst Brew

1982;88:11–7. https://doi.org/10.1002/j.2050-0416.1982.tb04061.x.

[80] Spaepen M, Van Oevelen D, Verachtert H. Fatty acids and esters produced during the

spontaneous fermentation of lambic and gueuze. J Inst Brew 1978;84:278–82.

https://doi.org/10.1002/j.2050-0416.1978.tb03888.x.

[81] Oelofse A, Pretorius IS, du Toit M. Significance of Brettanomyces and Dekkera during

Winemaking: A Synoptic Review. South African J Enol Vitic 2016;29:128–44.

https://doi.org/10.21548/29-2-1445.

[82] Lentz M, Harris C. Analysis of Growth Inhibition and Metabolism of Hydroxycinnamic Acids by

Brewing and Spoilage Strains of Brettanomyces Yeast. Foods 2015;4:581–93.

https://doi.org/10.3390/foods4040581.

[83] Yu J, Vasanthan T, Temelli F. Analysis of phenolic acids in barley by high-performance liquid

chromatography. J Agric Food Chem 2001;49:4352–8. https://doi.org/10.1021/jf0013407.

[84] Vanbeneden N, Van Roey T, Willems F, Delvaux F, Delvaux FR. Release of phenolic flavour

precursors during wort production: Influence of process parameters and grist composition on

ferulic acid release during brewing. Food Chem 2008;111:83–91.

https://doi.org/10.1016/j.foodchem.2008.03.029.

[85] Vanbeneden N, Delvaux F, Delvaux FR. Determination of hydroxycinnamic acids and volatile

phenols in wort and beer by isocratic high-performance liquid chromatography using

electrochemical detection. J Chromatogr A 2006;1136:237–42.

https://doi.org/10.1016/j.chroma.2006.11.001.

68

[86] Vanbeneden N, Gils F, Delvaux F, Delvaux FR. Formation of 4-vinyl and 4-ethyl derivatives from

hydroxycinnamic acids: Occurrence of volatile phenolic flavour compounds in beer and

distribution of Pad1-activity among brewing yeasts. Food Chem 2008;107:221–30.

https://doi.org/10.1016/j.foodchem.2007.08.008.

[87] Gamero A, Quintilla R, Groenewald M, Alkema W, Boekhout T, Hazelwood L. High-throughput

screening of a large collection of non-conventional yeasts reveals their potential for aroma

formation in food fermentation. Food Microbiol 2016;60:147–59.

https://doi.org/10.1016/j.fm.2016.07.006.

[88] Tristezza M, Tufariello M, Capozzi V, Spano G, Mita G, Grieco F. The Oenological Potential of

Hanseniaspora uvarum in Simultaneous and Sequential Co-fermentation with Saccharomyces

cerevisiae for Industrial Wine Production. Front Microbiol 2016;7:1–14.

https://doi.org/10.3389/fmicb.2016.00670.

[89] Moreira N, Mendes F, Pinho PG De, Hogg T, Vasconcelos I. Heavy sulphur compounds , higher

alcohols and esters production profile of Hanseniaspora uvarum and Hanseniaspora

guilliermondii grown as pure and mixed cultures in grape must. Int J Food Microbiol

2008;124:231–8. https://doi.org/10.1016/j.ijfoodmicro.2008.03.025.

[90] Moreira N, Pina C, Mendes F, Couto JA, Hogg T, Vasconcelos I. Volatile compounds

contribution of Hanseniaspora guilliermondii and Hanseniaspora uvarum during red wine

vinifications. Food Control 2011;22:662–7. https://doi.org/10.1016/j.foodcont.2010.07.025.

[91] Seixas I, Barbosa C, Mendes-Faia A, Güldener U, Tenreiro R, Mendes-Ferreira A, et al. Genome

sequence of the non-conventional wine yeast Hanseniaspora guilliermondii UTAD222 unveils

relevant traits of this species and of the Hanseniaspora genus in the context of wine

fermentation. DNA Res 2019;26:67–83. https://doi.org/10.1093/dnares/dsy039.

[92] Wang C, García-Fernández D, Mas A, Esteve-Zarzoso B. Fungal diversity in grape must and

wine fermentation assessed by massive sequencing, quantitative PCR and DGGE. Front

Microbiol 2015;6:1–8. https://doi.org/10.3389/fmicb.2015.01156.

[93] Grangeteau C, Gerhards D, Rousseaux S, von Wallbrunn C, Alexandre H, Guilloux-Benatier M.

Diversity of yeast strains of the genus Hanseniaspora in the winery environment: What is their

involvement in grape must fermentation? Food Microbiol 2015;50:70–7.

https://doi.org/10.1016/j.fm.2015.03.009.

[94] Clavijo A, Calderón IL, Paneque P. Diversity of Saccharomyces and non-Saccharomyces yeasts

in three red grape varieties cultured in the Serranía de Ronda (Spain) vine-growing region. Int J

Food Microbiol 2010;143:241–5. https://doi.org/10.1016/j.ijfoodmicro.2010.08.010.

[95] Bataillon M, Rico A, Sablayrolles JM, Salmon JM, Barre P. Early thiamin assimilation by yeasts

under enological conditions: Impact on alcoholic fermentation kinetics. J Ferment Bioeng

1996;82:145–50. https://doi.org/10.1016/0922-338X(96)85037-9.

69

[96] Brion C, Ambroset C, Delobel P, Sanchez I, Blondin B. Deciphering regulatory variation of THI

genes in alcoholic fermentation indicate an impact of Thi3p on PDC1 expression. BMC

Genomics 2014;15:1–11. https://doi.org/10.1186/1471-2164-15-1085.

[97] Martin V, Valera M, Medina K, Boido E, Carrau F. Oenological Impact of the

Hanseniaspora/Kloeckera Yeast Genus on Wines—A Review. Fermentation 2018;4:76.

https://doi.org/10.3390/fermentation4030076.

[98] Contreras A, Hidalgo C, Henschke PA, Chambers PJ, Curtin C, Varela C. Evaluation of non-

Saccharomyces yeasts for the reduction of alcohol content in wine. Appl Environ Microbiol

2014;80:1670–8. https://doi.org/10.1128/AEM.03780-13.

[99] Ciani M, Morales P, Comitini F, Tronchoni J, Canonico L, Curiel JA, et al. Non-conventional

yeast species for lowering ethanol content of wines. Front Microbiol 2016;7:1–13.

https://doi.org/10.3389/fmicb.2016.00642.

[100] Pérez-Nevado F, Albergaria H, Hogg T, Girio F. Cellular death of two non-Saccharomyces wine-

related yeasts during mixed fermentations with Saccharomyces cerevisiae. Int J Food Microbiol

2006;108:336–45. https://doi.org/10.1016/j.ijfoodmicro.2005.12.012.

[101] Barbosa C, Mendes-Faia A, Lage P, Mira NP, Mendes-Ferreira A. Genomic expression program

of Saccharomyces cerevisiae along a mixed-culture wine fermentation with Hanseniaspora

guilliermondii. Microb Cell Fact 2015;14:1–17. https://doi.org/10.1186/s12934-015-0318-1.

[102] Branco P, Monteiro M, Moura P, Albergaria H. Survival rate of wine-related yeasts during

alcoholic fermentation assessed by direct live/dead staining combined with fluorescence in situ

hybridization. Int J Food Microbiol 2012;158:49–57.

https://doi.org/10.1016/j.ijfoodmicro.2012.06.020.

[103] Ciani M, Comitini F. Yeast interactions in multi-starter wine fermentation. Curr Opin Food Sci

2015;1:1–6. https://doi.org/10.1016/j.cofs.2014.07.001.

[104] Albergaria H, Arneborg N. Dominance of Saccharomyces cerevisiae in alcoholic fermentation

processes: role of physiological fitness and microbial interactions. Appl Microbiol Biotechnol

2016;100:2035–46. https://doi.org/10.1007/s00253-015-7255-0.

[105] Pina C, Santos C, Couto JA, Hogg T. Ethanol tolerance of five non-Saccharomyces wine yeasts

in comparison with a strain of Saccharomyces cerevisiae - Influence of different culture

conditions. Food Microbiol 2004;21:439–47. https://doi.org/10.1016/j.fm.2003.10.009.

[106] Hu K, Jin GJ, Mei WC, Li T, Tao YS. Increase of medium-chain fatty acid ethyl ester content in

mixed H. uvarum/S. cerevisiae fermentation leads to wine fruity aroma enhancement. Food

Chem 2018;239:495–501. https://doi.org/10.1016/j.foodchem.2017.06.151.

[107] Curiel JA, Morales P, Gonzalez R, Tronchoni J. Different non-Saccharomyces yeast species

stimulate nutrient consumption in S. cerevisiae mixed cultures. Front Microbiol 2017;8:1–9.

70

https://doi.org/10.3389/fmicb.2017.02121.

[108] Bourbon e Carvalho Melo N. <i>Isolation, identification and assessment of the potential of

Saccharomyces and non-Saccharomyces strains for craft beer production<i/>. 2018.

[109] Luan Y, Zhang BQ, Duan CQ, Yan GL. Effects of different pre-fermentation cold maceration time

on aroma compounds of Saccharomyces cerevisiae co-fermentation with Hanseniaspora

opuntiae or Pichia kudriavzevii. LWT - Food Sci Technol 2018;92:177–86.

https://doi.org/10.1016/j.lwt.2018.02.004.

[110] Lleixà J, Martín V, Portillo M del C, Carrau F, Beltran G, Mas A. Comparison of fermentation and

wines produced by inoculation of Hanseniaspora vineae and Saccharomyces cerevisiae. Front

Microbiol 2016;7:1–12. https://doi.org/10.3389/fmicb.2016.00338.

[111] Medina K, Boido E, Dellacassa E, Carrau F. Yeast interactions with anthocyanins during red

wine fermentation. Am J Enol Vitic 2005;56:104–9.

[112] Becker B, Schmitt MJ. Yeast killer toxin k28: Biology and unique strategy of host cell intoxication

and killing. Toxins (Basel) 2017;9:1–15. https://doi.org/10.3390/toxins9100333.

[113] Oka K, Hayashi T, Matsumoto N, Yanase H. Decrease in hydrogen sulfide content during the

final stage of beer fermentation due to involvement of yeast and not carbon dioxide gas purging.

J Biosci Bioeng 2008;106:253–7. https://doi.org/10.1263/jbb.106.253.

[114] Stewart G. The Production of Secondary Metabolites with Flavour Potential during Brewing and

Distilling Wort Fermentations. Fermentation 2017;3:63.

https://doi.org/10.3390/fermentation3040063.

[115] Hazelwood LA, Daran JM, Van Maris AJA, Pronk JT, Dickinson JR. The Ehrlich pathway for

fusel alcohol production: A century of research on Saccharomyces cerevisiae metabolism. Appl

Environ Microbiol 2008;74:2259–66. https://doi.org/10.1128/AEM.02625-07.

[116] Dickinson JR, Salgado LEJ, Hewlins MJE. The catabolism of amino acids to long chain and

complex alcohols in Saccharomyces cerevisiae. J Biol Chem 2003;278:8028–34.

https://doi.org/10.1074/jbc.M211914200.

[117] Picotti P, Clément-Ziza M, Lam H, Campbell DS, Schmidt A, Deutsch EW, et al. A complete

mass-spectrometric map of the yeast proteome applied to quantitative trait analysis. Nature

2013;494:266–70. https://doi.org/10.1038/nature11835.

[118] Iraqui I, Vissers S, André B, Urrestarazu A. Transcriptional Induction by Aromatic Amino Acids

in Saccharomyces cerevisiae. Mol Cell Biol 1999;19:3360–71.

https://doi.org/10.1128/mcb.19.5.3360.

[119] Eden A, Van Nedervelde L, Drukker M, Benvenisty N, Debourg A. Involvement of branched-

chain amino acid aminotransferases in the production of fusel alcohols during fermentation in

yeast. Appl Microbiol Biotechnol 2001;55:296–300. https://doi.org/10.1007/s002530000506.

71

[120] Romagnoli G, Luttik MAH, Kötter P, Pronk JT, Daran JM. Substrate specificity of thiamine

pyrophosphate-dependent 2-oxo-acid decarboxylases in Saccharomyces cerevisiae. Appl

Environ Microbiol 2012;78:7538–48. https://doi.org/10.1128/AEM.01675-12.

[121] Bolat I, Romagnoli G, Zhu F, Pronk JT, Daran JM. Functional analysis and transcriptional

regulation of two orthologs of ARO10, encoding broad-substrate-specificity 2-oxo-acid

decarboxylases, in the brewing yeast Saccharomyces pastorianus CBS1483. FEMS Yeast Res

2013;13:505–17. https://doi.org/10.1111/1567-1364.12051.

[122] Vuralhan Z, Morais MA, Tai SL, Piper MDW, Pronk JT. Identification and characterization of

phenylpyruvate decarboxylase genes in Saccharomyces cerevisiae. Appl Environ Microbiol

2003;69:4534–41. https://doi.org/10.1128/AEM.69.8.4534-4541.2003.

[123] Mojzita D, Hohmann S. Pdc2 coordinates expression of the THI regulon in the yeast

Saccharomyces cerevisiae. Mol Genet Genomics 2006;276:147–61.

https://doi.org/10.1007/s00438-006-0130-z.

[124] Chen Y, Siewers V, Nielsen J. Profiling of cytosolic and peroxisomal acetyl-CoA metabolism in

Saccharomyces cerevisiae. PLoS One 2012;7. https://doi.org/10.1371/journal.pone.0042475.

[125] Saison D, De Schutter DP, Uyttenhove B, Delvaux F, Delvaux FR. Contribution of staling

compounds to the aged flavour of lager beer by studying their flavour thresholds. Food Chem

2009;114:1206–15. https://doi.org/10.1016/j.foodchem.2008.10.078.

[126] Saerens SMG, Verbelen PJ, Vanbeneden N, Thevelein JM, Delvaux FR. Monitoring the

influence of high-gravity brewing and fermentation temperature on flavour formation by analysis

of gene expression levels in brewing yeast. Appl Microbiol Biotechnol 2008;80:1039–51.

https://doi.org/10.1007/s00253-008-1645-5.

[127] Saerens SMG, Delvaux FR, Verstrepen KJ, Thevelein JM. Production and biological function of

volatile esters in Saccharomyces cerevisiae. Microb Biotechnol 2010;3:165–77.

https://doi.org/10.1111/j.1751-7915.2009.00106.x.

[128] Nykänen L, Nykänen I. Production of Esters By Different Yeast Strains in Sugar Fermentations.

J Inst Brew 1977;83:30–1. https://doi.org/10.1002/j.2050-0416.1975.tb03787.x.

[129] Verstrepen KJ, Laere SDM Van, Vanderhaegen BMP, Derdelinckx G, Dufour J, Pretorius IS, et

al. Expression Levels of the Yeast Alcohol Acetyltransferase Genes ATF1 , Lg-ATF1 , and ATF2

Control the Formation of a Broad Range of Volatile Esters. Appl Environ Microbiol

2003;69:5228–37. https://doi.org/10.1128/AEM.69.9.5228.

[130] Molina AM, Swiegers JH, Varela C, Pretorius IS, Agosin E. Influence of wine fermentation

temperature on the synthesis of yeast-derived volatile aroma compounds. Appl Microbiol

Biotechnol 2007;77:675–87. https://doi.org/10.1007/s00253-007-1194-3.

[131] Kruis AJ, Mars AE, Kengen SWM, Borst JW, van der Oost J, Weusthuis RA. Alcohol

72

Acetyltransferase Eat1 Is Located in Yeast Mitochondria. Appl Environ Microbiol 2018;84:1–11.

https://doi.org/10.1128/AEM.01640-18.

[132] Kruis AJ, Gallone B, Jonker T, Mars AE, van Rijswijck IMH, Wolkers–Rooijackers JCM, et al.

Contribution of Eat1 and Other Alcohol Acyltransferases to Ester Production in Saccharomyces

cerevisiae. Front Microbiol 2018;9:1–11. https://doi.org/10.3389/fmicb.2018.03202.

[133] Saerens SMG, Verstrepen KJ, Van Laere SDM, Voet ARD, Van Dijck P, Delvaux FR, et al. The

Saccharomyces cerevisiae EHT1 and EEB1 genes encode novel enzymes with medium-chain

fatty acid ethyl ester synthesis and hydrolysis capacity. J Biol Chem 2006;281:4446–56.

https://doi.org/10.1074/jbc.M512028200.

[134] Saerens SMG, Delvaux F, Verstrepen KJ, Van Dijck P, Thevelein JM, Delvaux FR. Parameters

affecting ethyl ester production by Saccharomyces cerevisiae during fermentation. Appl Environ

Microbiol 2008;74:454–61. https://doi.org/10.1128/AEM.01616-07.

[135] Fukuda K, Yamamoto N, Kiyokawa Y, Yanagiuchi T, Wakai Y, Kitamoto K, et al. Balance of

activities of alcohol acetyltransferase and esterase in Saccharomyces cerevisiae is important

for production of isoamyl acetate. Appl Environ Microbiol 1998;64:4076–8.

[136] Lilly M, Bauer FF, Lambrechts MG, Swiegers JH, Cozzolino D, Pretorius IS. The effect of

increased yeast alcohol acetyltransferase and esterase activity on the flavour profiles of wine

and distillates. Yeast 2006;23:641–59. https://doi.org/10.1002/yea.1382.

[137] Bamforth CW. The non-Biological Instability of Beer. J Inst Brew 2011;117:488–97.

https://doi.org/10.1002/j.2050-0416.2011.tb00496.x.

[138] Kobayashi M, Shimizu H, Shioya S. Beer Volatile Compounds and Their Application to Low-Malt

Beer Fermentation. J Biosci Bioeng 2008;106:317–23. https://doi.org/10.1263/jbb.106.317.

[139] Krogerus K, Gibson BR. 125th anniversary review: Diacetyl and its control during brewery

fermentation. J Inst Brew 2013;119:86–97. https://doi.org/10.1002/jib.84.

[140] Lodolo EJ, Kock JLF, Axcell BC, Brooks M. The yeast Saccharomyces cerevisiae - The main

character in beer brewing. FEMS Yeast Res 2008;8:1018–36. https://doi.org/10.1111/j.1567-

1364.2008.00433.x.

[141] Whiting GC. Organic acid metabolism of yeasts during fermentation of alcoholic beverages - A

review. J Inst Brew 1976;82:84–92. https://doi.org/10.1002/j.2050-0416.1976.tb03731.x.

[142] Li H, Liu F. The chemistry of sour taste and the strategy to reduce the sour taste of beer. Food

Chem 2015;185:200–4. https://doi.org/10.1016/j.foodchem.2015.03.135.

[143] Li H, Liu F. Changes in organic acids during beer fermentation. J Am Soc Brew Chem

2015;73:275–9. https://doi.org/10.1094/ASBCJ-2015-0509-01.

[144] Mukai N, Masaki K, Fujii T, Kawamukai M, Iefuji H. PAD1 and FDC1 are essential for the

73

decarboxylation of phenylacrylic acids in Saccharomyces cerevisiae. J Biosci Bioeng

2010;109:564–9. https://doi.org/10.1016/j.jbiosc.2009.11.011.

[145] Godoy L, García V, Peña R, Martínez C, Ganga MA. Identification of the Dekkera bruxellensis

phenolic acid decarboxylase (PAD) gene responsible for wine spoilage. Food Control

2014;45:81–6. https://doi.org/10.1016/j.foodcont.2014.03.041.

[146] Takoi K, Itoga Y, Koie K, Kosugi T, Shimase M, Katayama Y, et al. The contribution of geraniol

metabolism to the citrus flavour of beer: Synergy of geraniol and β-citronellol under coexistence

with excess linalool. J Inst Brew 2010;116:251–60. https://doi.org/10.1002/j.2050-

0416.2010.tb00428.x.

[147] Kurtzman CP, Robnett CJ. Phylogenetic relationships among yeasts of the ‘ Saccharomyces

complex ’ determined from multigene sequence analyses. FEMS Yeast Res 2003;3:417–32.

https://doi.org/10.1016/S1567-1356(03)00012-6.

[148] White TJ, Bruns T, Lee S, Taylor J. Amplification and Direct Sequencing of Fungal Ribosomal

Rna Genes for Phylogenetics. PCR Protoc 1990:315–22. https://doi.org/10.1016/b978-0-12-

372180-8.50042-1.

[149] Dicarlo JE, Norville JE, Mali P, Rios X, Aach J, Church GM. Genome engineering in

Saccharomyces cerevisiae using CRISPR-Cas systems. Nucleic Acids Res 2013;41:4336–43.

https://doi.org/10.1093/nar/gkt135.

[150] Gibson DG, Young L, Chuang RY, Venter JC, Hutchison CA, Smith HO. Ezymatic assembly of

DNA molecules up to several hundred kilobases. Nat Methods 2009;6:343–5.

https://doi.org/10.1038/nmeth.1318.

[151] Hall JF. Detection of wild yeasts in the brewery. J Inst Brew 1971;77:513–6.

[152] Jespersen L, Jakobsen M. Specific spoilage organisms in breweries and laboratory media for

their detection. Int J Food Microbiol 1996;33:139–55. https://doi.org/10.1016/0168-

1605(96)01154-3.

[153] Preiss R, Tyrawa C, Krogerus K, Garshol LM, van der Merwe G. Traditional Norwegian Kveik

Are a Genetically Distinct Group of Domesticated Saccharomyces cerevisiae Brewing Yeasts.

Front Microbiol 2018;9. https://doi.org/10.3389/fmicb.2018.02137.

[154] Pérez-Brito D, Magaña-Alvarez A, Lappe-Oliveras P, Cortes-Velazquez A, Torres-Calzada C,

Herrera-Suarez T, et al. Genetic diversity of Clavispora lusitaniae isolated from Agave

fourcroydes Lem, as revealed by DNA fingerprinting. J Microbiol 2015;53:14–20.

https://doi.org/10.1007/s12275-015-4373-4.

[155] Santiago-Urbina JA, Arias-García JA, Ruiz-Terán F. Yeast species associated with spontaneous

fermentation of taberna, a traditional palm wine from the southeast of Mexico. Ann Microbiol

2015;65:287–96. https://doi.org/10.1007/s13213-014-0861-8.

74

[156] Gutiérrez A, Boekhout T, Gojkovic Z, Katz M. Evaluation of non-Saccharomyces yeasts in the

fermentation of wine, beer and cider for the development of new beverages. J Inst Brew

2018;124:389–402. https://doi.org/10.1002/jib.512.

[157] Englezos V, Giacosa S, Rantsiou K, Luca R, Luca R. Starmerella bacillaris in winemaking:

opportunities and risks. Curr Opin Food Sci 2017;17:30–5.

https://doi.org/10.1016/j.cofs.2017.08.007.

[158] Branco P, Kemsawasd V, Santos L, Diniz M, Caldeira J, Almeida MG, et al. Saccharomyces

cerevisiae accumulates GAPDH-derived peptides on its cell surface that induce death of non-

Saccharomyces yeasts by cell-to-cell contact. FEMS Microbiol Ecol 2017;93:1–10.

https://doi.org/10.1093/femsec/fix055.

[159] Cadez N, Poot GA, Raspor P, Smith MT. Hanseniaspora meyeri sp. nov. Hanseniaspora

clermontiae sp. nov., Hanseniaspora lachancei sp. nov. and Hanseniaspora opuntiae sp. nov.,

novel apiculate yeast species. Int J Syst Evol Microbiol 2003;53:1671–80.

https://doi.org/10.1099/ijs.0.02618-0.

[160] Nisiotou AA, Nychas GJE. Yeast populations residing on healthy or Botrytis-infected grapes

from a vineyard in Attica, Greece. Appl Environ Microbiol 2007;73:2765–8.

https://doi.org/10.1128/AEM.01864-06.

[161] Liu SQ, Quek AYH. Evaluation of beer fermentation with a novel yeast Williopsis saturnus. Food

Technol Biotechnol 2016;54:403–12. https://doi.org/10.17113/ft b.54.04.16.4440.

[162] Plata C, Millán C, Mauricio JC, Ortega JM. Formation of ethyl acetate and isoamyl acetate by

various species of wine yeasts. Food Microbiol 2003;20:217–24. https://doi.org/10.1016/S0740-

0020(02)00101-6.

[163] Fan G, Sun B, Xu D, Teng C, Fu Z, Du Y, et al. Isolation and Identification of High-Yield Ethyl

Acetate-Producing Yeast from Gujinggong Daqu and Its Fermentation Characteristics. J Am Soc

Brew Chem 2018;76:117–24. https://doi.org/10.1080/03610470.2017.1396849.

[164] De Carvalho BT, Holt S, Souffriau B, Brandão RL, Foulquié-Moreno MR, Theveleina JM.

Identification of novel alleles conferring superior production of rose flavor phenylethyl acetate

using polygenic analysis in yeast. MBio 2017;8:1–21. https://doi.org/10.1128/mBio.01173-17.

[165] Holt S, Trindade de Carvalho B, Foulquié-Moreno MR, Thevelein JM. Polygenic Analysis in

Absence of Major Effector ATF1 Unveils Novel Components in Yeast Flavor Ester Biosynthesis.

MBio 2018;9. https://doi.org/10.1128/mBio.01279-18.

75

8. Annex

Partial sequence of the D1/D2 region of the 26S rDNA:

Candida humilis IST409

agcacgttcctcaaaagcggctggccgtattcctgcaggctgtaacacttcccgaagcaagctacgttcctgcagttttgtccggccgccaaaa

ctgatgctggcccagtgagctgcgagagtcccccacccacaaggagcggggggcgcaaaacaccatgtctgatcaaatgcccttccctttca

acaatttcacgtactttttcactctcttttcaaagttcttttcatctttccatcactgtacttgttcgctatcggtctctcgccaatatttagctttagatggaatt

taccacccacttagagctgcattcccaaacaactcgactcttcgagagcgctttacacggaaccgcactcctcgccacacgggattctcaccct

ctatgacgtcctgttccaaggaacatagacaaggagccgccccaaagtcgccctctacaaattacaactcgggcaccgaaggtaccagattt

caaatttgagcttttgccgcttcactcgccgttactgaggcaatcccggttggtttcttttcctccgcttattgatatgcaaat

Clavispora lusitaniae IST413

cctaaaatctgcaggcctcgaaaagggatggaggcgtcaacacgagctataacacgcgcgcccgaaggtgcgcgccacattctcgagttct

tgttcctccccccttttcgacgctggcccggtaaaaccgtgtctgcttgcaagcccttccctttcaacaatttcacgtgctgtttcactctcttttcaaagt

gcttttcatctttccatcactgtacttgttcgctatcggtctctcgccaatatttagctttagatggaatttaccacccacttagagctgcattcccaaaca

actcgactcgtcggagccgcggtgtacaaagagtcggcgtgcgccatacggggctctcaccctcccaggcgccatgttccaatggacttggg

cgcggccgactcagaccacgaaaccttcaaattacaattcccgcaggatttcaaatttgagcttttgccgcttcactcgccgttactggggcaatc

cctgttggtttcttttcctccgcttatttggatatgcaaac

Hanseniaspora opuntiae IST399

cgtttttgaccgaagcgcagtcctcaatcccagctagcagtattccaataagctataacactaccgaggtagctacattcttaatgatttatcctact

gccagaattgatgttggcccagtgaaatttttgagaggcccaagcccacgagaggcgagtgcatgcaaaaaacaccatgtctgatcaaatgc

ccttccctttcaacaatttcacgtactttttcactctcttttcaaagttcttttcatctttccatcactgtacttgttcgctatcggtctctcgccaatatttagctt

tagatggaatttaccacccactttgagctgcattcccaaacaactcgactcttcgaaaaagtcttacagagaaaaggtatcctcgccaaacggg

attctcaccctctatgacgtcctgttccaaggaacatagacaaggacctaatcaaagacaaattctacaaattacaactcgggcactgaaagta

ccagatttcaaatttgagcttttaccgcttcactcgccgttactaaggtaatcccagttggtttcttttcctccgcttattgatatgcaat

Hanseniaspora uvarum IST400

gttttatgaccgaagcacagtcctcaatcgcggctaacagtattccaaaaagctataacactaccgaagtagctacattcttaatgatttatcctgc

tgccagaattgatgttggcccagtgaaatttttgagaggcccaagcccacgagaggcgagtgcatgcaaaaaacaccatgtctgatcaaatg

cccttccctttcaacaatttcacgtactttttcactctcttttcaaagttcttttcatctttccatcactgtacttgttcgctatcggtctctcgccaatatttagc

tttagatggaatttaccacccactttgagctgcattcccaaacaactcgactcttcgaaaaagtcttacagagaaaaggtatcctcgccaaacgg

gattctcaccctctatgacgtcctgttccaaggaacatagacaaggacctaatcaaagacaaattctacaaattacaactcgggcactgaaagt

accagatttcaaatttgagcttttaccgcttcactcgccgttactaaggtaatcccagttggtttcttttcctccgcttattgatatgcaata

76

Hanseniaspora uvarum IST412

ggggcccggttctcaaacggggctgggtgtattccggtaagctataacactaccgaggtagctacattcttaatgatttatcctgctgccagaatt

gatgttggcccagtgaaatttttgagaggcccaagcccacgagaggcgagtgcatgcaaaaaacaccatgtctgatcaaatgcccttccctttc

aacaatttcacgtactttttcactctcttttcaaagttcttttcatctttccatcactgtacttgttcgctatcggtctctcgccaatatttagctttagatggaa

tttaccacccactttgagctgcattcccaaacaactcgactcttcgaaaaagtcttacagagaaaaggtatcctcgccaaacgggattctcaccc

tctatgacgtcctgttccaaggaacatagacaaggacctaatcaaagacaaattctacaaattacaactcgggcactgaaagtaccagatttc

aaatttgagcttttaccgcttcactcgccgttactaaggtaatcccagttggtttcttttcctccgcttatttgatatgcact

Metschnikowia pulcherrima IST402

aaggcccgcctctagaaggtgagggattaagacaggggcttaataatcccgagagaggtacattccccggtggttttgctccccgccgcccc

gatgctggcccagttaagtgtctgcttgcaagcccttccctttcaacaatttcacgtactttttcactctcttttcaaagtgcttttcatctttccatcactgt

acttgttcgctatcggtctctcgccggtatttagctttagatggaatttaccacccacttagagctgcattcccaaacaactcgactcttggagatctg

ggatgagggcgttgaaggggttcacggggctgtcaccctctgtggcgccactttccagtggacttaacccccgccggccggacccaaatctctt

caaattacaattcccgggggatttcaaatttgagcttttgccgcttcactcgccgttactgaggcaatccctgttggtttcttttcctccgacttattgata

tgcaac

Metschnikowia ziziphicola IST404

Gggctagggaaaattgagaccaggggttataatcctcgaaaggtacattccccggtggttttgtttcccgccgccccgatgctggcccagttaa

gtgtctgcttgcaagcccttccctttcaacaatttcacgtactttttcactctcttttcaaagtgcttttcatctttccatcactgtacttgttcgctatcggtct

ctcgccggtatttagctttagatggaatttaccacccacttagagctgcattcccaaacaactcgactcttggagatctgggatgaaggcgttgag

ggggttcacggggctgtcaccctctgtggcgccactttccagtggacttaacccccgccggccggacccaaatctcttcaaattacaattcccgg

gggatttcaaatttgagcttttgccgcttcactcgccgttactgaggcaatccctgttggtttcttttcctccgcttattgatatgca

Pichia kluyveri IST411

gaagccaagttccgccacagccctcggtccccatacgcagcatctacaaaaggctataacactccgaggagccacattccaattgtccttatc

ctgcaacgaaaaccgatgctggcccaggaaaaacccagagcgccgcccacgagaggcaacgatgcgtaaatcccatgtcgagcccaat

acccttccctttcaacaatttcacgtgctgtttcactctcttttcaaagtgcttttcatctttccttcacagtacttgttcgctatcggtctctcgccaatattta

gccttagatggaatttaccacccacttagagctgcattcccaaacaactcgactcgtcagaagggcctcacaggtgtcgacatgcacgatacg

gggctctcaccctcagtggcaccctgttccaagggacttgcacacacgtctaacccgagactccaacctgcaatttacaactcgcacactaggt

gagatttcaaatctgagctcttgccgcttcactcgccgctactgaggcaatccctgttggtttcttttcctccgctttttgatatgcact

Pichia kluyveri IST397

agcaagtttctacacagccctacaagtccccatacgcagcatctacaaaaggctataacactccgaggagccacattccaattgtccttatcct

gcaacgaaaaccgatgctggcccaggaaaaacccagagcgccgcccacgagaggcaacgatgcgtaaatcccatgtcgagcccaatac

77

ccttccctttcaacaatttcacgtgctgtttcactctcttttcagagtgcttttcatctttccttcacagtacttgttcgctatcggtctctcgccaatatttagc

cttagatggaatttaccacccacttagagctgcattcccaaacaactcgactcgtcagaagggcctcacaggtgtcgacatgcacgatacggg

gctctcaccctcagtggcaccctgttccaagggacttgcacacacgtctaacccgagactccaacctgcaatttacaactcgcacactaggtga

gatttcaaatctgagctcttgccgcttcactcgccgctactgaggcaatccctgttggtttcttttcctccgcttattgatatgc

Pichia kudriavzevii IST398

ggttcaagaaagggcgacgccgcacgaagcatctggccctggctataacactccgaagagccacgttccagaaccccttctcctgcagcaa

gaaccgatgctggcccagggaaagcccagagcgccgcccacgagaggcagcggtgcgcaatccccatgtcgggcgcaatacccttccct

ttcaacaatttcacgtgctgtttcactctcttttcaaagtgcttttcatctttccttcacagtacttgttcgctatcggtctctcgccagtatttagccttagat

ggaatttaccacccgcttggagctgcattcccaaacaactcgactcgtcagaagggcctcactgcttccgccggcatcccacggggctctcac

cctcctgggcgccctgttccaagggacttggacaccgccttccacacagactccaacctgcaatctacaactcgtgccgcaaagcacgatttc

aaatctgagctcttgccgcttcactcgccgctactgaggcaatccctgttggtttcttttcctccgcttattgatatgcacg

Pichia terricola IST410

gcattacctaaggccccgctcgcggcatctgagagaggctataacactccgaagagccacgttcctccccccattctcccgcggcaaaaact

gatgctggcccagaaaccgcacagagcgccgcctacaagaagcaacggtgcgcagtccccatgtcgagcccaatacccttccctttcaaca

atttcacgtgctgtttcactctcttttcaaagtgcttttcatctttccttcacagtacttgttcgctatcggtctctcgccagtatttagccttagatggaattta

ccacccacttagagctgcattcccaaacaactcgactcgtcagaagggtcttaaagcttagacgcgtgccgcacggggctctcaccctcaatg

gcgccctgttccaagggacttagacacacgccgccacaaagactccaacctgcaatttacaactcgccgaggcgatttcaaatctgagctctt

gccgcttcactcgccgctactgaggcaatccctgttggtttcttttcctccgcttatttgatatgcacat

Saccharomyces cerevisiae IST403

ccgtcgcattcctacagtcccagctggcagtattcccacaggctataatacttaccgaggcaagctacattcctatggatttatcctgccaccaaa

actgatgctggcccagtgaaatgcgagattcccctacccacaaggagcagagggcacaaaacaccatgtctgatcaaatgcccttccctttca

acaatttcacgtactttttcactctcttttcaaagttcttttcatctttccatcactgtacttgttcgctatcggtctctcgccaatatttagctttagatggaatt

taccacccacttagagctgcattcccaaacaactcgactcttcgaaggcactttacaaagaaccgcactcctcgccacacgggattctcaccct

ctatgacgtcctgttccaaggaacatagacaaggaacggccccaaagttgccctctccaaattacaactcgggcaccgaaggtaccagattt

caaatttgagcttttgccgcttcactcgccgttactaaggcaatcccggttggtttcttttcctccgcttattgatatgcaat

Starmerella bacillaris IST401

gtcgcaactctcgtgaggaatatgaccagcatctataatactccgaggagctacattctacagcatttatcttccccccaaacacggctctacatg

gttagcggcctacccttccatttcaacaatttcacgtactttttcactctcttttcaaagttcttttcatctttccctcacagtacttgtttactatcggtctctc

gcagatatttagctttagatggagcataccacccatttgagctgcattcccaaacaactcgactccatgttaagatcctatatgaggtcaatgcta

gacggggctatcaccctccatggcgctcctttccagaagacttaagcatcgtttctcaggaccctaacttcagaatacaacggcacaaaagtgc

ctttcaaatctgagctcttgcctgttcactcgccgttactagggcaatccctgttggtttcttttcctccgcttattgatatgcact

78

Partial sequence of the Internal Transcriber Spacer region rDNA:

Candida intermedia IST385

gatttggagggcgaagaataaagttgaagtaacgtattgcaacaactgtgatatttcggaaggcaacaccaaacccgggggtttgaaggga

gccgacgctcaaacaggcatgccttgaggaatacctcaaggcgcaatgtgcgttcaaagattgatgattcacgtctgcaagtcatgatacgtat

cgcaattcgctgcgttcttcatcgatgcgagaaccaagagatccgttgttgaaagttttgatttttctaagttattgaatattaatggttattagtgtttgct

tcaaaaacaatgtaataaattaattttaatgatccttccgcaggttcacctacggaagg

Pichia kudriavzevii IST376

cgaaggtcgagctttttgttgtctcgcaacactcgctctcggccgccaagcgtccctgaaaaaaagtctagttcgctcggccagcttcgctcccttt

caggcgagtcgcagctccgacgctctttacacgtcgtccgctccgctcccccaactctgcgcacgcgcaagatggaaacgacgctcaaaca

ggcatgccccccggaatgccgaggggcgcaatgtgcgttcaagaactcgatgattcacgatggctgcaattcacactaggtatcgcatttcgct

gcgctcttcatcgatgcgagaaccaagagatccgttgttgaaagttttgtttgtttttcgtagatttctcttgtcgactatatgctatattccacattttaggt

gttgttgttttcgttccgctcacgcagtgtagtactaaatcacagtaatgatccttccgcaggttcaccctacagaaaaggtg