Unlocking the mystery of DNA. What we knew: 1.Inherited characteristics are determined by genes...
-
Upload
nicole-clayton -
Category
Documents
-
view
214 -
download
1
Transcript of Unlocking the mystery of DNA. What we knew: 1.Inherited characteristics are determined by genes...
Unlocking the mystery of DNA
What we knew:
1.Inherited characteristics are determined by genes
2.Genes are passes from one generation to the next
3.Genes are part of a chromosome
4.Chromosomes are made of protein and DNA
Prior to the 1950’s
Cell division and DNA replication
• Cells divide
• Growth, Repair, Replacement
• Before cells divide, they have to double cell
structures, organelles and their genetic
information
DNA replication – Mitosis & Meiosis
But…
What did DNAlook like, and how did it replicate itself?
Discovering the structure of DNA
Rosalind Franklin (1920-1958)
• King’s College, London
• Made significant advances in
x- ray diffraction techniques
with DNA
• Her images suggested that
DNA had a spiral shape
• One of her DNA images
Discovering the structure of DNA
Maurice Wilkins – (1916-2004)
• King’s College, London
• Also did X-ray diffraction studies
of DNA
• Worked with Rosalind Franklin
• Shared information with Watson and Crick
Discovering the structure of DNA
Erwin Chargaff – (1905-2002)
• Columbia University, NY
• Investigated the composition of DNA
• His findings by 1950 strongly
suggested the base-pairings
of A-T & G-C
• Met with Watson and Crick in
1952 and shared his findings
• “Chargaff’s rule” A = T & C = G
Discovering the structure of DNA
James Watson (1928) and Francis Crick (1916-2004)
• Worked together at Cavendish Laboratory in Cambridge
to determine the structure of DNA
• Used work from Franklin, Wilkins, and Chargaff to
determine the double helix shape
• Watson, Crick, and Wilkins
were awarded the Nobel Prize
• Rosalind Franklin passed away
(1958) before the Nobel Prize
was awarded in 1962
Discovering the structure of DNA
• DNA = Deoxyribose nucleic acid
• Present in all living cells
• Contains all the information
• Nucleotides:
• a subunit that consists of:
• a sugar (deoxyribose)
• a phosphate
• and one nitrogen base – 4 different bases
•Adenine (A) and Thymine (T)
•Guanine (G) and Cytosine (C)
DNA – What does my code look like?
Computer Code:
10010100111010001100101001110010111100101001001001001011100101000101010010010100101010010010100101001010100101001010010101010101001010100101010111111100
DNA Code:
ATTCGGGGCCTTAAGACATTAATTTCCCAAGAAGAGATAAACTAGAGAGACCCTTTAAAACACACAGAGATAGACAGAAAAACAATAGACAGATACAGATAGACATAAAAAATTTTTTGGGAAA…millions and millions of bases…
Practice DNA Base Pairs
DNA replication – helix unzips
DNA replication – helix unzips
DNA replication – two strands are separated
DNA replication – each side is now a template
DNA replication – two identical strands of DNA
Original DNA strands
DNA replication
Newly assembled DNA strands
DNA replication
Semi-conservative replication
Build a DNA molecule – you try it!
DNA replication- you try it!