Unlocking the mystery of DNA. What we knew: 1.Inherited characteristics are determined by genes...

21
Unlocking the mystery of DNA

Transcript of Unlocking the mystery of DNA. What we knew: 1.Inherited characteristics are determined by genes...

Page 1: Unlocking the mystery of DNA. What we knew: 1.Inherited characteristics are determined by genes 2.Genes are passes from one generation to the next 3.Genes.

Unlocking the mystery of DNA

Page 2: Unlocking the mystery of DNA. What we knew: 1.Inherited characteristics are determined by genes 2.Genes are passes from one generation to the next 3.Genes.

What we knew:

1.Inherited characteristics are determined by genes

2.Genes are passes from one generation to the next

3.Genes are part of a chromosome

4.Chromosomes are made of protein and DNA

Prior to the 1950’s

Page 3: Unlocking the mystery of DNA. What we knew: 1.Inherited characteristics are determined by genes 2.Genes are passes from one generation to the next 3.Genes.

Cell division and DNA replication

• Cells divide

• Growth, Repair, Replacement

• Before cells divide, they have to double cell

structures, organelles and their genetic

information

Page 4: Unlocking the mystery of DNA. What we knew: 1.Inherited characteristics are determined by genes 2.Genes are passes from one generation to the next 3.Genes.

DNA replication – Mitosis & Meiosis

Page 5: Unlocking the mystery of DNA. What we knew: 1.Inherited characteristics are determined by genes 2.Genes are passes from one generation to the next 3.Genes.

But…

What did DNAlook like, and how did it replicate itself?

Page 6: Unlocking the mystery of DNA. What we knew: 1.Inherited characteristics are determined by genes 2.Genes are passes from one generation to the next 3.Genes.

Discovering the structure of DNA

Rosalind Franklin (1920-1958)

• King’s College, London

• Made significant advances in

x- ray diffraction techniques

with DNA

• Her images suggested that

DNA had a spiral shape

• One of her DNA images

Page 7: Unlocking the mystery of DNA. What we knew: 1.Inherited characteristics are determined by genes 2.Genes are passes from one generation to the next 3.Genes.

Discovering the structure of DNA

Maurice Wilkins – (1916-2004)

• King’s College, London

• Also did X-ray diffraction studies

of DNA

• Worked with Rosalind Franklin

• Shared information with Watson and Crick

Page 8: Unlocking the mystery of DNA. What we knew: 1.Inherited characteristics are determined by genes 2.Genes are passes from one generation to the next 3.Genes.

Discovering the structure of DNA

Erwin Chargaff – (1905-2002)

• Columbia University, NY

• Investigated the composition of DNA

• His findings by 1950 strongly

suggested the base-pairings

of A-T & G-C

• Met with Watson and Crick in

1952 and shared his findings

• “Chargaff’s rule” A = T & C = G

Page 9: Unlocking the mystery of DNA. What we knew: 1.Inherited characteristics are determined by genes 2.Genes are passes from one generation to the next 3.Genes.

Discovering the structure of DNA

James Watson (1928) and Francis Crick (1916-2004)

• Worked together at Cavendish Laboratory in Cambridge

to determine the structure of DNA

• Used work from Franklin, Wilkins, and Chargaff to

determine the double helix shape

• Watson, Crick, and Wilkins

were awarded the Nobel Prize

• Rosalind Franklin passed away

(1958) before the Nobel Prize

was awarded in 1962

Page 10: Unlocking the mystery of DNA. What we knew: 1.Inherited characteristics are determined by genes 2.Genes are passes from one generation to the next 3.Genes.

Discovering the structure of DNA

• DNA = Deoxyribose nucleic acid

• Present in all living cells

• Contains all the information

• Nucleotides:

• a subunit that consists of:

• a sugar (deoxyribose)

• a phosphate

• and one nitrogen base – 4 different bases

•Adenine (A) and Thymine (T)

•Guanine (G) and Cytosine (C)

Page 11: Unlocking the mystery of DNA. What we knew: 1.Inherited characteristics are determined by genes 2.Genes are passes from one generation to the next 3.Genes.

DNA – What does my code look like?

Computer Code:

10010100111010001100101001110010111100101001001001001011100101000101010010010100101010010010100101001010100101001010010101010101001010100101010111111100

DNA Code:

ATTCGGGGCCTTAAGACATTAATTTCCCAAGAAGAGATAAACTAGAGAGACCCTTTAAAACACACAGAGATAGACAGAAAAACAATAGACAGATACAGATAGACATAAAAAATTTTTTGGGAAA…millions and millions of bases…

Page 12: Unlocking the mystery of DNA. What we knew: 1.Inherited characteristics are determined by genes 2.Genes are passes from one generation to the next 3.Genes.

Practice DNA Base Pairs

Page 13: Unlocking the mystery of DNA. What we knew: 1.Inherited characteristics are determined by genes 2.Genes are passes from one generation to the next 3.Genes.

DNA replication – helix unzips

Page 14: Unlocking the mystery of DNA. What we knew: 1.Inherited characteristics are determined by genes 2.Genes are passes from one generation to the next 3.Genes.

DNA replication – helix unzips

Page 15: Unlocking the mystery of DNA. What we knew: 1.Inherited characteristics are determined by genes 2.Genes are passes from one generation to the next 3.Genes.

DNA replication – two strands are separated

Page 16: Unlocking the mystery of DNA. What we knew: 1.Inherited characteristics are determined by genes 2.Genes are passes from one generation to the next 3.Genes.

DNA replication – each side is now a template

Page 17: Unlocking the mystery of DNA. What we knew: 1.Inherited characteristics are determined by genes 2.Genes are passes from one generation to the next 3.Genes.

DNA replication – two identical strands of DNA

Original DNA strands

Page 18: Unlocking the mystery of DNA. What we knew: 1.Inherited characteristics are determined by genes 2.Genes are passes from one generation to the next 3.Genes.

DNA replication

Newly assembled DNA strands

Page 19: Unlocking the mystery of DNA. What we knew: 1.Inherited characteristics are determined by genes 2.Genes are passes from one generation to the next 3.Genes.

DNA replication

Semi-conservative replication

Page 20: Unlocking the mystery of DNA. What we knew: 1.Inherited characteristics are determined by genes 2.Genes are passes from one generation to the next 3.Genes.

Build a DNA molecule – you try it!

Page 21: Unlocking the mystery of DNA. What we knew: 1.Inherited characteristics are determined by genes 2.Genes are passes from one generation to the next 3.Genes.

DNA replication- you try it!