University of Zurich - UZH · Mutation of solute carrier SLC16A12 associates with a syndrome...

University of ZurichZurich Open Repository and Archive

Winterthurerstr. 190

CH-8057 Zurich

http://www.zora.uzh.ch

Year: 2008

Mutation of solute carrier SLC16A12 associates with a syndromecombining juvenile cataract with microcornea and renal

glucosuria

Kloeckener-Gruissem, B; Vandekerckhove, K; Nürnberg, G; Neidhardt, J; Zeitz, C;Nürnberg, P; Schipper, I; Berger, W

Kloeckener-Gruissem, B; Vandekerckhove, K; Nürnberg, G; Neidhardt, J; Zeitz, C; Nürnberg, P; Schipper, I;Berger, W (2008). Mutation of solute carrier SLC16A12 associates with a syndrome combining juvenile cataractwith microcornea and renal glucosuria. American Journal of Human Genetics, 82(3):772-779.Postprint available at:http://www.zora.uzh.ch

Posted at the Zurich Open Repository and Archive, University of Zurich.http://www.zora.uzh.ch

Originally published at:American Journal of Human Genetics 2008, 82(3):772-779.

Kloeckener-Gruissem, B; Vandekerckhove, K; Nürnberg, G; Neidhardt, J; Zeitz, C; Nürnberg, P; Schipper, I;Berger, W (2008). Mutation of solute carrier SLC16A12 associates with a syndrome combining juvenile cataractwith microcornea and renal glucosuria. American Journal of Human Genetics, 82(3):772-779.Postprint available at:http://www.zora.uzh.ch

Posted at the Zurich Open Repository and Archive, University of Zurich.http://www.zora.uzh.ch

Originally published at:American Journal of Human Genetics 2008, 82(3):772-779.

Mutation of solute carrier SLC16A12 associates with a syndromecombining juvenile cataract with microcornea and renal

glucosuria

Abstract

Unobstructed vision requires a particular refractive index of the lens, a measure based on theorganization of the structural proteins within the differentiated lens cells. To ensure an intact lensstructure, homeostasis within the lens cells is indispensable. Alterations of the lens structure result inopacity and lead to cataract. Renal glucosuria is defined by elevated glucose level in the urine withouthyperglycemia and without evidence of morphological renal anomalies. In a Swiss family withautosomal dominant juvenile cataract, microcornea, and renal glucosuria, we have identified a nonsensemutation in a member of the carboxylic acid transporter family SLC16. The underlying gene defect inSLC16A12 resides within a 3 cM region on chromosome 10q23.13 defined by linkage mapping of thisphenotype. We found tissue-specific variability of SLC16A12 transcript levels in control samples, withhigh expression in the eye and kidney, the two organs affected by this syndrome. This reportdemonstrates biological relevance of this solute carrier. We hypothesize that SLC16A12 is important forlens and kidney homeostasis and discuss its potential role in age-related cataract.

SLC12A16 in cataract and glucosuria

1

Mutation of solute carrier SLC16A12 associates with a novel syndrome 1

combining juvenile cataract with microcornea and renal glucosuria. 2

3

Running Title: SLC16A12 in cataract and glucosuria 4

5

Barbara Kloeckener-Gruissem* 1,2, Kristof Vandekerckhove*3,4, Gudrun Nürnberg5,7, 6

John Neidhardt1, Christina Zeitz1,8, Peter Nürnberg5,6, Isaak Schipper3 and Wolfgang 7

Berger1 8

9

1 Division of Medical Molecular Genetics and Gene Diagnostics, Institute of Medical 10

Genetics, University Zurich, Switzerland; 2 Department of Biology, ETH, Zurich, 11

Switzerland; 3 Eye Clinic, Kanton Hospital Luzern, Switzerland; 4 present address: 12

Eye Clinic, Inselspital, Bern, Switzerland; 5 Cologne Center for Genomics, University 13

of Cologne, Germany; 6 Institute for Genetics, University of Cologne, Germany; 7 14

RZPD Deutsches Ressourcenzentrum für Genomforschung GmbH, Berlin, Germany; 15

8 UMR S 592, Institut de la Vision, Université Paris, Paris, France 16

* these authors showed equal contribution 17

18

19

Correspondence to: 20

Barbara Kloeckener-Gruissem 21

Division of Medical Molecular Genetics and Gene Diagnostics, Institute of Medical 22

Genetics, University of Zurich, Switzerland 23

Schorenstrasse 16 24

CH-8603 Schwerzenbach 25


2

Tel. +41 44 655 7453 1

Fax +41 44 655 7213 2

e-mail: [email protected] 3

Key words: autosomal dominant juvenile cataract, microcornea, renal glucosuria, 4

monocarboxylate transporter, solute carrier SLC16A12 5


3

Abstract 1

Unobstructed vision requires a particular refractive index of the lens, a measure based 2

on the organization of the structural proteins within the differentiated lens cells. To 3

ensure an intact lens structure, homeostasis within the lens cells is indispensable. 4

Alterations of the lens structure result in opacity and lead to cataract. Renal 5

glucosuria is defined by elevated glucose level in the urine without hyperglycemia 6

and without evidence of morphological renal anomalies. In a Swiss family with 7

autosomal dominant juvenile cataract, microcornea and renal glucosuria, we have 8

identified a nonsense mutation in a member of the carboxylic acid transporter family 9

SLC16A. The underlying gene defect in SLC16A12 resides within a 3 cM region on 10

chromosome 10q23.13 defined by linkage mapping of this novel phenotype. We 11

found tissue-specific variability of SLC16A12 transcript levels in control individuals, 12

with high expression in the eye and kidney, the two organs affected by this novel 13

syndrome. This is the first report of the biological relevance of this solute carrier. 14

We hypothesize that SLC16A12 is important for lens and kidney homeostasis and 15

discuss its potential role in age-related cataract. 16


4

Lens transparency, a requirement of unobstructed vision, is achieved by ordered 1

events of cell differentiation accompanied with controlled arrangement of proteins, 2

mainly crystallins. Differentiation of the lens cells follows a precise sequence of 3

events 1. Mitotic activity of a small number of lens epithelial cells (LEC) provides a 4

continuous supply of new cells that, upon signal induced differentiation will begin 5

with a cellular elongation process, followed by the breakdown of the nucleus and 6

organelles. Concomitantly, some but not all metabolic activity ceases. Tightly 7

packed, highly elongated cells comprise the several millimeter thick lens structure. 8

Changes in this structure, composition or the assembly of the structural proteins, of 9

which crystallines make about 90%, will result in alteration of the refractive index. 10

This increasing opacity of the lens is termed cataract. Defined by age of onset, one 11

distinguishes between congenital (infantile), juvenile, and age-related cataract. The 12

first two, also referred to as childhood cataract, show wide heterogeneity with respect 13

to the genetic and phenotypic aspects 2. Frequently, mutations that disturb the 14

development of the lens occur in structural lens proteins and will lead to childhood 15

cataract. Among the genetic factors that influence age-related cataract, no genes with 16

mutations have yet been identified. Genes involved in recessively or dominantly 17

inherited cataract encode structural components of the lens cells but also components 18

of the cytoskeleton, of the cell membrane, transcription factors, metabolic proteins, 19

chromatin modifying protein -4B and the gene TMEM114, encoding a protein with 4 20

predicted transmembrane domains but of unknown function 3,4,5,6. 21

Occasionally, cataract is accompanied by additional symptoms, among them 22

microcornea 4,5. Of particular interest to this work is a Swiss family with juvenile 23

cataract, associated with microcornea and renal glucosuria 7. While renal glucosuria 24

is not considered a disease, affected individuals show characteristic elevation of 25


5

glucose concentration in the urine, without evidence of renal tubular defects. The 1

pattern of inheritance has been described as codominant with variable penetrance 8. 2

In the family described by Vandekerckhove and colleagues, 9 of 12 cataract patients 3

also showed elevated levels of glucose in their urine, in the absence of any other renal 4

or metabolic abnormalities (fig.1, 2 and table 1). 5

To determine the underlying genetic defect and whether cataract and glucosuria are 6

caused by the same pathogenic alteration was subject of this study. We began with 7

linkage analysis using the Affymetrix GeneChip Human Mapping 10K Array, version 8

2.0 (Affymetrix, Santa Clara, CA). Nonparametric linkage analysis using all 9

genotypes of a chromosome simultaneously was carried out with MERLIN and 10

parametric linkage analysis was performed by the program ALLEGRO 9 assuming a 11

disease allele frequency of 0.0001 and autosomal dominant inheritance with full 12

penetrance for cataract. Haplotypes were reconstructed with ALLEGRO and 13

presented graphically with HaploPainter 10. Results predicted that the disease causing 14

mutation for the juvenile cataract and microcornea maps to an interval on 15

chromosome 10q23.31 (fig. 3) of 3 cM, spanning between the SNP markers rs701826 16

and rs2254391(fig. 4). For the glucosuria phenotype no significant LOD score was 17

obtained (data not shown), probably due to low penetrance. Calculations of 50% 18

penetrance for affected patients revealed a LOD score slightly above 2 on a region of 19

chromosome 10, which overlaps with the 3 cM interval for cataract. These findings 20

suggest that more affected family members are required to obtain a significant LOD 21

score for glucosuria. 22

The NCBI map viewer (Build 36.2, August 2007) displayed 31 genes and 3 known 23

phenotypes (selection shown in Table 2) within the linkage interval on Chromosome 24

10q23.31. Among the phenotypes, none seemed obviously related to cataract. Distal 25


6

to this linkage interval maps the homeobox gene PITX3 (MIM-602669). Mutations in 1

this gene are known to cause the dominant form of congenital cataract and anterior 2

segment mesenchymal dysgenesis (ASMD) 11,12. We performed sequence analysis in 3

the DNA of one affected patient (II-1) without finding a mutation (data not shown; 4

primer sequences are available upon request). 5

Considering the function of each of the 31 genes within the linkage interval, we 6

reasoned, that FAS and SLC16A12 were potential candidate genes. FAS, (MIM- 7

134637) encoding the tumor necrosis factor receptor super family member 6, could 8

play a role during differentiation of lens cells 13. DNA sequence analysis did not 9

reveal a coding region mutation, but upstream of the transcription unit, we detected a 10

deletion of six thymidin residues. Since this alteration was also found in unaffected 11

family members it was excluded as disease causing. In addition, a deletion of seven 12

thymidin residues at the same site has been reported as SNP rs3074157. 13

Metabolic requirements of the lens cells can be accommodated by establishing a 14

transport system for small molecules. The gene encoding the solute carrier 15

SLC16A12 (ENSG00000152779, NCBI GeneID: 387700) belongs to a family of 14 16

monocarboxylate transporters 14. All members display an average size of 40-50 kDa 17

and are characterized by 12 transmembrane domains (TMDs). Besides DNA sequence 18

and gene annotation for SLC16A12, no information on its genetic and biochemical 19

properties was available. We sequenced the five coding exons (3 to 8) including 20

approximately 50-100 base pairs of their respective flanking introns and UTR regions 21

and found a heterozygous mutation in exon 6: c.643C>T, which is predicted to lead to 22

a premature termination codon p.Q215X (fig. 5). This mutation was found in all 12 23

cataract patients of the Swiss family while the three unaffected individuals (II/11, III/9 24

and III/11) did not carry this alteration. It was also absent in 370 normal alleles, two 25


7

of which were from an unrelated spouse of the family (II/10) (fig 1). Thus, we 1

considered SLC16A12 as the gene associated with the development of cataract. 2

Knowledge of the expression pattern of SLC16A12 would aid in understanding its 3

effect on cataract with microcornea and glucosuria. For that purpose, we performed 4

RT-PCR experiments based on established procedures 15 with RNA from several 5

organs, including the two affected structures, lens and kidney (fig. 6). In general, the 6

solute carrier was detected in retina, brain, lung, kidney, liver and testis, although at 7

remarkably different levels. We compared the amount of SLC16A12 transcripts with 8

that of the endogenous control transcripts from RNA polymerase II gene, and 9

estimated that the solute carrier seemed most highly expressed in kidney, followed by 10

retina, lung and testis and very weakly in brain and liver (fig. 6B). The expected RT-11

PCR fragment was not detected in blood cells (data not shown). In addition, we 12

assayed SLC16A12 transcripts isolated from human retina, retinal pigment epithelial 13

cells (RPE) and lens of a 47 year old eye donor lacking any signs of cataract and 14

confirmed the expression pattern we had seen from purchased RNA (fig. 6B and C). 15

Importantly, SLC16A12 transcripts were also detected in the human lens (fig. 6C). 16

Since only a very small portion of the lens, namely the lens epithelial cells (LECs), 17

may be transcriptionally active, we concluded that expression of SLC16A12 in the 18

LECs must be relatively high. Our RT-PCR data show that SLC16A12 expression is 19

regulated in a cell/tissue -specific manner. These observations concur with the 20

reported expression pattern of other SLC16A family members, which can be either 21

ubiquitous or tissue-specific 16,14. Tissue-specific regulation of SLC16A12 expression 22

is further supported by the lack of additional manifesting symptoms in the Swiss 23

family. 24


8

This report provides first evidence for the physiological function of SLC16A12. In 1

combination with the knowledge of the transport function of other SLC16A isoforms, 2

a prediction of molecular activity is possible. These transporters are highly conserved 3

throughout evolution and can be found in prokaryotes as well as eukaryotes, from 4

yeast to mammals. They can transport lactate, aromatic amino acids, short-chain fatty 5

acids, butyrate, ketones or thyroid hormone in a proton-dependent or -independent 6

fashion 14. Sub-cellular localization of some family members in the eye and also 7

kidney points to highly specific tasks of molecular transport 17,18. Although neither 8

the localization in the lens or kidney, nor substrate specificity of this transporter is 9

known, we speculate that its reduction would interfere with homeostasis. In the lens, 10

solutes need to move from the cortical lens epithelial cells to the inner fiber cells. In 11

the kidney, solutes also need to move between tubular cells and blood. 12

Prediction of membrane topology 19 revealed a 536 amino acid protein containing 12 13

transmembrane domains (TMDs) with both termini located intracellularly. While the 14

large intra-cellular loop and both termini show high variability in their amino acid 15

sequence among the different SLC16A family members, highest conservation is found 16

in the 1st and 5th TMD 14. The p.Q215X mutation in SLC16A12 is located within the 17

large cytoplasmic loop near the fourth TMD (fig. 7), predicted to result in a truncated 18

protein with severely impaired or completely absent transport function. The 19

premature termination codon might cause mRNA decay of the mutant allele, possibly 20

by the mechanism of nonsense mediated decay 20, but a dominant negative effect or 21

gain of function of the truncated protein can not be excluded. Consequently, reduced 22

amounts of the normal allele in the patients could account for a gradual, progressive 23

nature of the cataract. The resulting deficiency in transportation of metabolites in the 24

lens could lead to alteration of structural components of the fiber cells and the 25


9

refractive index, contributing to the development of cataract. Similarly, defective 1

transport in the kidney could lead to excessive accumulation of glucose in the urine, 2

making SLC16A12, directly or indirectly, involved in glucose transport. Since the 3

causes of glucosuria can be heterogeneous, other factors, singly or in combination 4

with deficient SLC transporter activity, could result in the highly variable phene of 5

glucosuria. 6

Although several arguments have been presented that support a model, in which 7

cataract and glucosuria are caused by the same mutation, we can not rule out that the 8

two diseases may segregate independently. In case of an unlinked locus for 9

glucosuria, examples of potential candidates include the caperone protein CD147, 10

which facilitates subcellular sorting of SLC16A members 17 or proteins involved in 11

glucose transportation, i.e.GLUT proteins 21 or SLC5A2 8. 12

Age-related cataract, which is the most common cause for avoidable blindness 13

worldwide, is known to be dependent on both, environmental risk factors and genetic 14

factors. A twin study on the cortical type of age-related cataract implies the action of 15

dominant genes to account for genetic heritability of about 50% 22,23. The progressive 16

course of juvenile cataract described here, resulting most likely from defective 17

transport of small molecules, suggests the potential role of the SLC16A12 transporter 18

in age-related cataracts as well. Depending on the type and location of mutations 19

within the SLC16A12 transporter, more or less severe forms of cataract would be 20

expected, which may also vary in the time of onset. We propose that mutations in a 21

solute carrier such as SLC16A12 could lead to the age-related form of cataract. 22

Knowledge of the substrate may open new venues for non-surgical treatment. 23


10

Taken together, we show for the first time the biological relevance of the solute 1

carrier SLC16A12 and suggest a function in the establishment and/or maintenance of 2

homeostasis in the lens and probably also in the kidney. 3


11

Figure Legends 1

Figure 1 2

Pedigree of Swiss family segregating juvenile cataract with microcornea and 3

glucosuria (modified after 7). Dark filled symbols represent affected status for all 4

three phenotypes, with three exceptions indicated by star; III-1 and III-2 are negative, 5

III-5 is borderline for glucosuria (table 1). Five-digit laboratory identification numbers 6

(given below pedigree symbols) were assigned prior to DNA extraction. Family 7

members IV-2 and IV-3 were not tested for any of the three phenotypes. 8

9

Figure 2 10

Cataract and microcornea phenotype of patient III-5. Pre-operative cortico-nuclear 11

cataract in right eye is shown in (A) and microcornea (9.8 x 9.5 mm) in (B). 12

13

Figure 3 14

LOD scores across the genome for the phenotype of cataract with microcornea. 15

Chromosome number and genetic distances in cM (centi Morgan) is horizontally 16

displayed; LOD score is given along the vertical axis. 17

18

Figure 4 19

Haplotypes for the cataract-linked region on chromosome 10. Recombinations in 20

patients 26808 (III-4) and 26274 (IV-1) define a critical interval of 2.6 Mega bases 21

(Mb) delimited by markers SNP_A_1510595 (rs701826) (*) and SNP_A_1511227 22

(rs2254391) (**) at positions 108.48 and 111.55 cM, respectively. Disease 23

chromosome in red. 24

25


12

Figure 5 1

Mutation screening in SCL16A12. Electropherogram shows the mutation in exon 6 2

within the context of 21 nucleotides. The DNA sequence of the unaffected individual 3

III-9 is displayed to the left, while the heterozygous change of C>T (Y) in the affected 4

individual III- 8 is shown to the right. The genotypes are given in brackets. 5

Translation codons are underlined and amino acid identity is written below using 6

single letter code. 7

8

Figure 6 9

Expression studies of SLC16A12. (A) Schematic representation of exons. Protein 10

coding regions are displayed in darker shade. Translation initiates within exon 3 11

(vertical arrow, ATG) and terminates within exon 8 (vertical arrow, STOP). 12

Mutation, c.643C>T, in exon 6 (vertical arrow) is predicted to lead to a premature 13

termination. Positions of primers are indicated by forward and reverse horizontal 14

arrows, yielding RT-PCR product a (exon spanning 4_5 to exon 6) and product b 15

(exon 3 to exon 5). (B) RT-PCR analyses from human tissues with commercially 16

available mRNA. Primers to yield product a were used to amplify SLC16A12 17

transcripts. RNA Polymerase II transcripts served as endogenous control. (C) RT-18

PCR analysis from tissues isolated from a single human donor eye. Primers to yield 19

product b of SLC16A12 and RNA Polymerase II gene (control) were used for 20

amplification. Lens RNA was three-fold concentrated compared to the other samples. 21

22

Figure 7 23

Schematic representation of the predicted secondary structure of SLC16A12. 24

Prediction of membrane topology revealed a 536 amino acid protein with 12 25


13

transmembrane domains separated by intra and extra cellular domains of varying 1

lengths with both termini (NH2 and COOH) located intracellularly. Amino acid 2

glutamin (Gln, Q) at position 215 is mutated to a stop in the patients described herein 3

(red circle). 4


14

Table 1. Summary of clinical data 1

Pedigree ID Cataract Microcornea

Glucosuria

II-1 + + + II-3 + + + II-5 + + + II-7 + + + 1) II-9 + + + II-11 - - - III-1 + + - 1) III-2 + + - III-4 + + + III-5 + + +/- 2) III-7 + + + III-8 + + + III-9 - - + 3) III-11 - - -

2 Pedigree identification numbers are taken from Figure 1. Presence/absence of 3

cataract, microcornea and renal glucosuria is given as +/-. Assignment of microcornea 4

was given if values were below 11.0mm. Glucosuria was evaluated as positive (+) if 5

glucose concentration was above 0.8 mmol/L. Glucose values were generally 6

obtained from postprandial samples except for patients II-7 and III-11). 2) test 7

performed during pregnancy; 3) borderline value. 8

9


15

Table 2. Phenotype and loci that map to the linkage interval on chromosome 10. 1 2 Symbol Description MIM Position phenotypes TNFRSF6 tumor necrosis factor receptor

superfamily, member 6 134637 10q24.1

LIPA Wolman disease, liposomal acid lipase deficiency

278000 10q24-q25

SCZD11 schizophrenia susceptibility locus 608078 10q22.3 Loci MIM or Ensembl GeneID LIPF lipase, gastric 601980 8513 LIPK lipase, family member K ENSG00000204021 643414 LIPN member N ENSG00000204020 643418 LIPM member M ENSG00000173239 340654 ANKRD22 ankyrin repeat domain 22 ENSG00000152766 118932 STAMBPL1 STAM binding protein-like 1 ENSG00000138134 57559 ACTA2 actin, alpha 2, smooth muscle, ENSG00000107796 59 FAS Fas (TNF receptor superfamily,

member 6) 134637 355

CH25H cholesterol 25-hydroxylase 604551 9023 LIPA lipase A, (Wolman disease) 278000 3988 IFIT2 interferon-induced protein with

tetratricopeptide repeats 2 147040 3433

IFIT3 repeats 3 604650 3437 IFIT1L repeats 1-like ENSG00000204010 439996 IFIT1 repeats 1 147690 3434 IFIT5 repeats 5 ENSG00000152778 24138 SLC16A12 solute carrier family 16, member 12

(monocarboxylic acid transporter 12) ENSG00000152779 387700

MIRN107 microRNA 107 406901 PANK1 pantothenate kinase 1 606160 53354 MPHOSPH1 M-phase phosphoprotein 1 605498 9585 HTR7 5-hydroxytryptamine (serotonin)

receptor 7 (adenylate cyclase-coupled) 182137 3363

RPP30 ribonuclease P/MRP 30kDa subunit 606115 10556 ANKRD1 ankyrin repeat domain 1 (cardiac

muscle) 609599 27063

NUDT9P1 nudix (nucleoside diphosphate linked moiety X)-type motif 9 pseudogene 1

119369

PCGF5 polycomb group ring finger 5 ENSG00000180628 84333 HECTD2 HECT domain containing 2 ENSG00000165338 143279 PPP1R3C protein phosphatase 1, regulatory

(inhibitor) subunit 3C 602999 5507

TNKS2 tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase 2

607128 80351

3


16

From the NCBI map viewer (Build 36.2, August 2007) selected 27 annotated genes 1

and all phenotypes located to the affected region on chromosome 10q23.31 are 2

shown. For identification, MIM code, Ensembl code or GeneID ( NCBI) is given. 3


17

Table 3. Primer information 1

gene - exon - direction sequence purpose SLC16A12 ex3f gtctgccccagtctagtattca Genomic sequencing SLC16A12 ex3r cggaaatacacacacaccaca Genomic sequencing SLC16A12 ex4f ccctgtggtggttgaacact Genomic sequencing SLC16A12 ex4r tggctttggctgaagatagg Genomic sequencing SLC16A12 ex5f tctattccaaccctgctgct Genomic sequencing SLC16A12 ex5r ccagctctgtttaactgctagg Genomic sequencing SLC16A12 ex6af gaatgactggtgaggggaga Genomic sequencing SLC16A12 ex6ar aacagaacggagacggctaa Genomic sequencing SLC16A12 ex6bf cggggagccttactcattct Genomic sequencing SLC16A12 ex6br agtaccagcaagggagatgc Genomic sequencing SLC16A12 ex7f cacaatgggaaagccatctc Genomic sequencing SLC16A12 ex7r atggttttgggggctcttat Genomic sequencing SLC16A12 ex8f caaagttacaattggtggtgct Genomic sequencing SLC16A12 ex8r agttatgagcacaaatcccaaa Genomic sequencing SLC16A12exon3f caggaagtcactggacagca RT-PCR SLC16A12exon5r caggaagtcactggacagca RT-PCR SLC16A12exon4_5f gtgtgaccatgctctgtgct RT-PCR SLC16A12exon6r aagacaaagcccccaagaat RT-PCR RPII_cDNA_N20_F tgtggagatcttcacggtgct RT-PCR RPII_cDNA_N234_R cataagcacgtccaccgtttc RT-PCR 2 The name of primers contains information about the gene (SLC16A12 or RNA 3

polymerase II (RPII), exon and direction, forward (f,F) or reverse(r,R). The sequence 4

of primers points 5’ to 3’. Primers were used to amplify genomic DNA for sequence 5

analysis or for transcript analysis in RT-PCR experiments. 6


18

1

2

Acknowledgement 3

We would like to thank the family for participation in this study, Jaya Balakrishnan, 4

Esther Glaus and Philippe Reuge (Berger laboratory) for DNA preparations, C. 5

Becker (Nürnberg laboratory) for expert technical assistance in providing the SNP 6

genotype data from Affymetrix microarrays; Gabor Matyas (Berger laboratory) for 7

providing the RNA II Polymerase primers for RT-PCR experiments and for 8

invaluable support with DNA sequencing, and Adrian Knoepfel (Berger laboratory) 9

for sequencing of the FAS promoter. We are also grateful for the donation of the 10

human eyes from the eye bank at the University of Zurich. This work was funded in 11

part by the German Federal Ministry of Sciences and Education through the National 12

Genome Research Network (grant 01GR0416 to P.N.) and by a scientific grant from 13

the eyeclinic of the Kanton Hospital Luzern, Switzerland. 14

15

16

Web Resources 17

http://www.predictprotein.org/ 18

http://www.ncbi.nlm.nih.gov/ 19

http://www.ncbi.nlm.nih.gov/Omim/ 20

21

22

References 23 24

1. Augusteyn RC (2007) Growth of the human eye lens. Mol Vis 13:252-257 25


19

2. Francis PJ, Berry V, Bhattacharya SS, Moore AT (2000) The genetics of 1

childhood cataract. J Med Genet 37:481-488 2

3. Jamieson RV, Farrar N, Stewart K, Perveen R, Mihelec M, Carette M, Grigg JR, 3

McAvoy JW, Lovicu FJ, Tam PP et al. (2007) Characterization of a familial 4

t(16;22) balanced translocation associated with congenital cataract leads to 5

identification of a novel gene, TMEM114, expressed in the lens and disrupted 6

by the translocation. Hum Mutat 28:968-977 7

4. Lorenz B (2007) [Genetic examination in cases of congenital cataract]. 8

Ophthalmologe 104:559-565 9

5. Shiels A, Hejtmancik JF (2007) Genetic origins of cataract. Arch Ophthalmol 10

125:165-173 11

6. Shiels A, Bennett TM, Knopf HL, Yamada K, Yoshiura K, Niikawa N, Shim S, 12

Hanson PI (2007) CHMP4B, a novel gene for autosomal dominant cataracts 13

linked to chromosome 20q. Am J Hum Genet 81:596-606 14

7. Vandekerckhove K, Lange AP, Herzog D, Schipper I (2007) [Juvenile cataract 15

associated with microcornea and glucosuria: a new syndrome]. Klin Monatsbl 16

Augenheilkd 224:344-346 17

8. Santer R, Kinner M, Lassen CL, Schneppenheim R, Eggert P, Bald M, Brodehl 18

J, Daschner M, Ehrich JH, Kemper M et al. (2003) Molecular analysis of the 19

SGLT2 gene in patients with renal glucosuria. J Am Soc Nephrol 14:2873-2882 20

9. Gudbjartsson DF, Jonasson K, Frigge ML, Kong A (2000) Allegro, a new 21

computer program for multipoint linkage analysis. Nat Genet 25:12-13 22


20

10. Thiele H, Nurnberg P (2005) HaploPainter: a tool for drawing pedigrees with 1

complex haplotypes. Bioinformatics 21:1730-1732 2

11. Burdon KP, McKay JD, Wirth MG, Russell-Eggit IM, Bhatti S, Ruddle JB, 3

Dimasi D, Mackey DA, Craig JE (2006) The PITX3 gene in posterior polar 4

congenital cataract in Australia. Mol Vis 12:367-371 5

12. Semina EV, Ferrell RE, Mintz-Hittner HA, Bitoun P, Alward WL, Reiter RS, 6

Funkhauser C, Daack-Hirsch S, Murray JC (1998) A novel homeobox gene 7

PITX3 is mutated in families with autosomal-dominant cataracts and ASMD. 8

Nat Genet 19:167-170 9

13. Futter CE, Crowston JG, Allan BD (2005) Interaction with collagen IV protects 10

lens epithelial cells from Fas-dependent apoptosis by stimulating the production 11

of soluble survival factors. Invest Ophthalmol Vis Sci 46:3256-3262 12

14. Halestrap AP, Meredith D (2004) The SLC16 gene family-from 13

monocarboxylate transporters (MCTs) to aromatic amino acid transporters and 14

beyond. Pflugers Arch 447:619-628 15

15. Neidhardt J, Glaus E, Barthelmes D, Zeitz C, Fleischhauer J, Berger W (2007) 16

Identification and characterization of a novel RPGR isoform in human retina. 17

Hum Mutat 28:797-807 18

16. Halestrap AP, Price NT (1999) The proton-linked monocarboxylate transporter 19

(MCT) family: structure, function and regulation. Biochem J 343 Pt 2:281-299 20

17. Deora AA, Philp N, Hu J, Bok D, Rodriguez-Boulan E (2005) Mechanisms 21

regulating tissue-specific polarity of monocarboxylate transporters and their 22


21

chaperone CD147 in kidney and retinal epithelia. Proc Natl Acad Sci U S A 1

102:16245-16250 2

18. Philp NJ, Wang D, Yoon H, Hjelmeland LM (2003) Polarized expression of 3

monocarboxylate transporters in human retinal pigment epithelium and ARPE-4

19 cells. Invest Ophthalmol Vis Sci 44:1716-1721 5

19. Rost B, Yachdav G, Liu J (2004) The PredictProtein server. Nucleic Acids Res 6

32:W321-W326 7

20. Holbrook JA, Neu-Yilik G, Hentze MW, Kulozik AE (2004) Nonsense-8

mediated decay approaches the clinic. Nat Genet 36:801-808 9

21. Wallner EI, Wada J, Tramonti G, Lin S, Kanwar YS (2001) Status of glucose 10

transporters in the mammalian kidney and renal development. Ren Fail 23:301-11

310 12

22. Hammond CJ, Snieder H, Spector TD, Gilbert CE (2000) Genetic and 13

environmental factors in age-related nuclear cataracts in monozygotic and 14

dizygotic twins. N Engl J Med 342:1786-1790 15

23. Hammond CJ, Duncan DD, Snieder H, de Lange M, West SK, Spector TD, 16

Gilbert CE (2001) The heritability of age-related cortical cataract: the twin eye 17

study. Invest Ophthalmol Vis Sci 42:601-605 18

19

20

21

22


22

Figures 1

1 2 3 121110987654

1 2 3

1211109876541 2 3

25941 25863 25862 25869 25966 25967 25898

25901

26274

25864 25940 25865 2589926810 26808 26836

I

II

III

IV

* **

2

Figure 1 3

4

5

6

A

B

9.5

9.8

7

Figure 2 8


23

1

Figure 3 2

3

4

5

Chromosome 10

111.67SNP_A−1512789

111.65SNP_A−1511112

111.65SNP_A−1511600

111.55SNP_A−1511227

110.58SNP_A−1516392

110.58SNP_A−1509478

110.57SNP_A−1515488

110.31SNP_A−1513124

110.19SNP_A−1515007

110.17SNP_A−1507567

109.79SNP_A−1517877

109.68SNP_A−1509995

109.57SNP_A−1519517

109.18SNP_A−1508154

109.18SNP_A−1511369

108.95SNP_A−1518661

108.48SNP_A−1510552

108.48SNP_A−1510595

108.3SNP_A−1508121

107.99SNP_A−1510459

107.91SNP_A−1513235

positionmarker

**

*

**

*

III-325864 25901 26808 26836 25899 26810 25865 25940

25966259672594125898258692586325862

26274

II-6 II-4 II-8 II-12 II-2

I-2I-1

6

Figure 4 7

8


24

[c.643C>T] + [=]

GTGTAGAACTCAGAAAGAAGAC QTR EK

GTGTAGAACTYAGAAAGAAGA

p.Q215X

Unaffected (III-9) Affected (III-8)BA [=] + [=]

1

Figure 5 2

3

A

B

product a

RNApol II

C

product b

RNApol II

retina retina

brain

lung

kidne

yliv

ertes

tis

RPE

lens

RT-PCR productsb

a

ATG STOPmutation

3 4 5 6 7 821 321exons 3‘UTR

4

Figure 6 5

6

7


25

NH2COOHp.Q215X

membrane

extracellular

intracellular

1

Figure 7 2

University of Zurich - UZH · Mutation of solute carrier SLC16A12 associates with a syndrome...

Documents

Transcript of University of Zurich - UZH · Mutation of solute carrier SLC16A12 associates with a syndrome...