UNIVERSIDADE FEDERAL DE GOIÁS INSTITUTO DE CIÊNCIAS ...€¦ · programa de pÓs-graduaÇÃo em...
Transcript of UNIVERSIDADE FEDERAL DE GOIÁS INSTITUTO DE CIÊNCIAS ...€¦ · programa de pÓs-graduaÇÃo em...
![Page 1: UNIVERSIDADE FEDERAL DE GOIÁS INSTITUTO DE CIÊNCIAS ...€¦ · programa de pÓs-graduaÇÃo em ciÊncias biolÓgicas farmacogenÉtica em psiquiatria: influÊncia dos polimorfismos](https://reader033.fdocuments.in/reader033/viewer/2022042413/5f2db3abc003496c580b5cf0/html5/thumbnails/1.jpg)
UNIVERSIDADE FEDERAL DE GOIÁS INSTITUTO DE CIÊNCIAS BIOLÓGICAS
PROGRAMA DE PÓS-GRADUAÇÃO EM CIÊNCIAS BIOLÓGICAS
FARMACOGENÉTICA EM PSIQUIATRIA: INFLUÊNCIA DOS POLIMORFISMOS CYP1A2*1F E CYP2C19*17 NA
REFRATARIEDADE AO TRATAMENTO À CLOZAPINA E AO ESCITALOPRAM
RODRIGO BERNINI DE BRITO
GOIÂNIA-GO 2015
![Page 2: UNIVERSIDADE FEDERAL DE GOIÁS INSTITUTO DE CIÊNCIAS ...€¦ · programa de pÓs-graduaÇÃo em ciÊncias biolÓgicas farmacogenÉtica em psiquiatria: influÊncia dos polimorfismos](https://reader033.fdocuments.in/reader033/viewer/2022042413/5f2db3abc003496c580b5cf0/html5/thumbnails/2.jpg)
![Page 3: UNIVERSIDADE FEDERAL DE GOIÁS INSTITUTO DE CIÊNCIAS ...€¦ · programa de pÓs-graduaÇÃo em ciÊncias biolÓgicas farmacogenÉtica em psiquiatria: influÊncia dos polimorfismos](https://reader033.fdocuments.in/reader033/viewer/2022042413/5f2db3abc003496c580b5cf0/html5/thumbnails/3.jpg)
RODRIGO BERNINI DE BRITO
FARMACOGENÉTICA EM PSIQUIATRIA: INFLUÊNCIA DOS POLIMORFISMOS CYP1A2*1F E CYP2C19*17 NA
REFRATARIEDADE AO TRATAMENTO À CLOZAPINA E AO ESCITALOPRAM
Tese apresentada ao Programa de Pós-Graduação em Ciências Biológicas do Instituto de Ciências Biológicas da Universidade Federal de Goiás, como requisito parcial para obtenção do título de Doutor em Ciências Biológicas.
Área de Concentração: Farmacologia e Fisiologia
Orientador: Prof. Dr. Paulo César Ghedini Co-orientadora: Profa. Dra. Aline Helena da Silva Cruz
GOIÂNIA-GO 2015
![Page 4: UNIVERSIDADE FEDERAL DE GOIÁS INSTITUTO DE CIÊNCIAS ...€¦ · programa de pÓs-graduaÇÃo em ciÊncias biolÓgicas farmacogenÉtica em psiquiatria: influÊncia dos polimorfismos](https://reader033.fdocuments.in/reader033/viewer/2022042413/5f2db3abc003496c580b5cf0/html5/thumbnails/4.jpg)
Ficha catalográfica elaborada automaticamente com os dados fornecidos pelo(a) autor(a), sob orientação do Sibi/UFG.
Brito, Rodrigo Bernini de Farmacogenética em psiquiatria: influência dos polimorfismos CYP1A2*1F e CYP2C19*17 na refratariedade ao tratamento à clozapina e ao escitalopram [manuscrito] / Rodrigo Bernini de Brito. -2015.XII, 70 f.
Orientador: Prof. Dr. Paulo César Ghedini; co-orientador Dr. Aline Helena da Silva Cruz.Tese (Doutorado) - Universidade Federal de Goiás, Instituto deCiências Biológicas (ICB) , Programa de Pós-Graduação em Ciências Biológicas, Goiânia, 2015. Bibliografia. Anexos. Inclui siglas, abreviaturas, tabelas, lista de tabelas.
1. CYP450. 2. Esquizofrenia. 3. Transtorno depressivo maior. 4.Refratariedade ao tratamento. 5. Farmacogenética. I. Ghedini, PauloCésar, orient. II. Cruz, Aline Helena da Silva , co-orient. III. Título.
![Page 5: UNIVERSIDADE FEDERAL DE GOIÁS INSTITUTO DE CIÊNCIAS ...€¦ · programa de pÓs-graduaÇÃo em ciÊncias biolÓgicas farmacogenÉtica em psiquiatria: influÊncia dos polimorfismos](https://reader033.fdocuments.in/reader033/viewer/2022042413/5f2db3abc003496c580b5cf0/html5/thumbnails/5.jpg)
![Page 6: UNIVERSIDADE FEDERAL DE GOIÁS INSTITUTO DE CIÊNCIAS ...€¦ · programa de pÓs-graduaÇÃo em ciÊncias biolÓgicas farmacogenÉtica em psiquiatria: influÊncia dos polimorfismos](https://reader033.fdocuments.in/reader033/viewer/2022042413/5f2db3abc003496c580b5cf0/html5/thumbnails/6.jpg)
INSTITUIÇÕES E FONTES FINANCIADORAS
As pesquisas realizadas no Laboratório de Farmacologia Bioquímica e
Molecular (LFBM) do Departamento de Farmacologia da Universidade Federal Goiás
(UFG) foram subvencionadas pelo Conselho Nacional de Desenvolvimento Científico
e Tecnológico (CNPq) e Fundação de Amparo à Pesquisa do Estado de Goiás
(FAPEG, Brasil).
![Page 7: UNIVERSIDADE FEDERAL DE GOIÁS INSTITUTO DE CIÊNCIAS ...€¦ · programa de pÓs-graduaÇÃo em ciÊncias biolÓgicas farmacogenÉtica em psiquiatria: influÊncia dos polimorfismos](https://reader033.fdocuments.in/reader033/viewer/2022042413/5f2db3abc003496c580b5cf0/html5/thumbnails/7.jpg)
Dedicatória
Dedico este trabalho aos meus filhos
Enzo Bernini e Lara Bernini que são minha fonte de inspiração para
busca incessante de conhecimento e aperfeiçoamento.
![Page 8: UNIVERSIDADE FEDERAL DE GOIÁS INSTITUTO DE CIÊNCIAS ...€¦ · programa de pÓs-graduaÇÃo em ciÊncias biolÓgicas farmacogenÉtica em psiquiatria: influÊncia dos polimorfismos](https://reader033.fdocuments.in/reader033/viewer/2022042413/5f2db3abc003496c580b5cf0/html5/thumbnails/8.jpg)
Na convivência, o tempo não importa. Se for um minuto, uma hora, uma vida.
O que importa é o que ficou deste minuto, desta hora, desta vida...
Lembra que o que importa ... é tudo que semeares colherás.
Por isso, marca a tua passagem, deixa algo de ti,...
do teu minuto, da tua hora,
do teu dia, da tua vida.”
Mário Quintana
![Page 9: UNIVERSIDADE FEDERAL DE GOIÁS INSTITUTO DE CIÊNCIAS ...€¦ · programa de pÓs-graduaÇÃo em ciÊncias biolÓgicas farmacogenÉtica em psiquiatria: influÊncia dos polimorfismos](https://reader033.fdocuments.in/reader033/viewer/2022042413/5f2db3abc003496c580b5cf0/html5/thumbnails/9.jpg)
Agradecimentos
Agradeço aos meus pais Orlando e Maria das Graças, pela imensa bondade,
paciência, incentivo e apoio que deram e dão até hoje na vida, nos estudos e no dia-
a-dia. Graças a vocês estou aqui deixando uma pequena marca de minha
passagem. Agradeço também a companhia e incentivo continuo das minhas irmãs
Suzani e Kamila.
Agradeço a todos os meus ilustríssimos professores e colegas de classe,
todos eles, desde o começo de tudo, alguns marcaram muito e foram deixando boas
lembranças em minha vida. Nos últimos anos dois professores orientadores
marcaram muito a minha vida e trouxeram pra mim um gosto ainda maior pela
docência e pesquisa, os professores e amigos Aparecido Divino da Cruz, durante
meu mestrado e Paulo César Ghedini, durante o meu doutorado. Ambos com jeitos
diferentes e qualidades imensuráveis, demostraram com muito amor e sabedoria
uma orientação contínua, paciente e muito construtiva.
Aos meus pacientes, razão de tanto estudo e escolha profissional. Bem como
aos meus colegas de profissão, principalmente os amigos Mateus Diniz e Leandro
de Carvalho pelo apoio a este trabalho. Aos amigos e colegas de pós-graduação em
ciências biológicas, bem como funcionários e demais professores do ICB-UFG.
A minha esposa, muitas vezes impaciente com minha ausência, mas feliz com
minha evolução profissional. E mais uma vez aos meus filhos Enzo e Lara, que por
muitas vezes deixei de brincar para me dedicar aos estudos, mas que são a minha
força de vida e a razão de tudo.
À todos aqueles que tiveram alguma contribuição neste meu processo de
crescimento pessoal e profissional.
![Page 10: UNIVERSIDADE FEDERAL DE GOIÁS INSTITUTO DE CIÊNCIAS ...€¦ · programa de pÓs-graduaÇÃo em ciÊncias biolÓgicas farmacogenÉtica em psiquiatria: influÊncia dos polimorfismos](https://reader033.fdocuments.in/reader033/viewer/2022042413/5f2db3abc003496c580b5cf0/html5/thumbnails/10.jpg)
SUMÁRIO
Lista de Abreviaturas e Siglas VII
Lista de Tabelas IX
Resumo X
Abstract XII
1 INTRODUÇÃO 1.1 FARMACOGENÉTICA EM PSIQUIATRIA 1.2 FARMACOGENÉTICA NA ESQUIZOFRENIA 1.2.1 Esquizofrenia 1.2.2 CYP1A2 1.2.3 Alelos polimórficos CYP1A2 *1C, *1D e *1F 1.2.4 Associação dos polimorfismos CYP1A2 e o metabolismo da clozapina 1.3 FARMACOGENÉTICA NO TRANSTORNO DEPRESSIVO MAIOR 1.3.1 Transtorno Depressivo Maior 1.3.2 Farmacogenética antidepressiva 1.3.3 Polimorfismos de CYP2C19 e impacto funcional 1.3.4 Farmacoterapia com o escitalopram 1.3.5 Associação de polimorfismos de CYP2C19 e escitalopram 2 OBJETIVOS 3 METODOLOGIA 3.1 ESTUDO NA ESQUIZOFRENIA
3.1.1 Obtenção do material biológico, acompanhamento clínico e terapêutico 3.1.2 Obtenção do DNA 3.1.3 Condições de PCR e reação de sequenciamento
3.1.4 Análise estatística
1
2
4
4
6
7
8
9
9
10
11
13
14
16
18
19
19
20
20
20
22
![Page 11: UNIVERSIDADE FEDERAL DE GOIÁS INSTITUTO DE CIÊNCIAS ...€¦ · programa de pÓs-graduaÇÃo em ciÊncias biolÓgicas farmacogenÉtica em psiquiatria: influÊncia dos polimorfismos](https://reader033.fdocuments.in/reader033/viewer/2022042413/5f2db3abc003496c580b5cf0/html5/thumbnails/11.jpg)
3.2 ESTUDO NO TRANSTORNO DEPRESSIVO MAIOR 3.2.1 Obtenção do material biológico, acompanhamento clínico e terapêutico.
3.2.2 Genotipagem de CYP2C19*2 e CYP2C19*17 3.2.3 Análise estatística
4 ARTIGOS
4.1 ARTIGO DO ESTUDO NA ESQUIZOFRENIA
4.2 ARTIGO DO ESTUDO NO TRANSTORNO DEPRESSIVO MAIOR
5 CONCLUSÕES
REFERÊNCIAS BIBLIOGRÁFICAS
ANEXOS
23
23
23
25
26
27
41
52
54
66
![Page 12: UNIVERSIDADE FEDERAL DE GOIÁS INSTITUTO DE CIÊNCIAS ...€¦ · programa de pÓs-graduaÇÃo em ciÊncias biolÓgicas farmacogenÉtica em psiquiatria: influÊncia dos polimorfismos](https://reader033.fdocuments.in/reader033/viewer/2022042413/5f2db3abc003496c580b5cf0/html5/thumbnails/12.jpg)
VII
LISTA DE ABREVIATURAS E SIGLAS
5-HT – receptores de serotonina 5-HT1-7 – receptores de serotonina tipo 1-7 5-HT2A e 5-HT2C – receptores de serotonina sub-tipo 2A e 2C
APGs – Antipsicóticos de primeira geração (ou típicos)
ASGs – Antipsicóticos de segunda geração (ou atípicos)
BMI – Body Mass Index
BPRS-A - Versão ancorada da escala breve de avaliação psiquiátrica, do inglês
Brief Psychiatric Rating Scale
CLZ – Clozapine
COMT – Catecol-O-metil-transferase
CYP – Cytocromo P450
CYP1A2 – Cytocromo P450, família 1, sub-família A, polipeptídeo 2
CYP2C19 – Cytocromo P450, família 2, sub-família C, polipeptídeo 19
CYP2C9 – Cytocromo P450, família 2, sub-família C, polipeptídeo 9
CYP2D6 – Cytocromo P450, família 2, sub-família D, polipeptídeo 6
CYP2E1 – Cytocromo P450, família 2, sub-família E, polipeptídeo 1
CYP3A4 – Cytocromo P450, família 3, sub-família A, polipeptídeo 4
CYP3A5 – Cytocromo P450, família 3, sub-família A, polipeptídeo 5
D1-5 – Receptores de dopamina, do inglês Dopamine receptors (D1, D2, D3, D4,
and D5)
DSM-IV – manual diagnóstico e estatístico de transtornos mentais, quarta edição,
do inglês diagnostic and statistical manual of mental disorders
DSM-IV-TR – manual diagnóstico e estatístico de transtornos mentais, quarta
edição, texto revisado
![Page 13: UNIVERSIDADE FEDERAL DE GOIÁS INSTITUTO DE CIÊNCIAS ...€¦ · programa de pÓs-graduaÇÃo em ciÊncias biolÓgicas farmacogenÉtica em psiquiatria: influÊncia dos polimorfismos](https://reader033.fdocuments.in/reader033/viewer/2022042413/5f2db3abc003496c580b5cf0/html5/thumbnails/13.jpg)
VIII
DT – Discinesia tardia
ESC – escitalopram
EPS – Efeitos secundários motores extrapiramidais, do inglês extrapyramidal
symptoms
FMO3 – flavina contendo mono-oxigenase do tipo 3 H1-3 – receptores histamínicos tipos 1 a 3
HDRS – Escala de Depressão de Hamilton, do inglês Hamilton Depression Rating
Scale
IRSNs – Inibidores da recaptação de serotonina e da noradrenalina ISRSs – inibidores seletivos da recaptação de serotonina
M1-5 – receptor colinérgico muscarínico tipos 1 a 5
MADRS – do inglês, Montgomery Asberg Depression Rating Scale (MADRS)
MAO-A – Monoamino oxidase A
MDD – Major depressive disorder MEs – Metabolizadores extensivos
MLs – Metabolizadores lentos
MURs – Metabolizadores ultra-rápidos
PCR – reação em cadeia da polimerase, do inglês Polymerase Chain Reaction SNPs – do inglês, Single Nucleotide Polymorphism SRS – Esquizofrenia Super-Refratária, do inglês Super-Refractory Schizophrenia
TDM – Transtorno depressivo maior
TRS – Esquizofrenia Refratária ao Tratamento, do inglês Treatment Refractory
schizophrenia
UMs – Ultra-rapid metabolizers
EMs – Extensive metabolizers
IMs – Intermediate metabolizers
![Page 14: UNIVERSIDADE FEDERAL DE GOIÁS INSTITUTO DE CIÊNCIAS ...€¦ · programa de pÓs-graduaÇÃo em ciÊncias biolÓgicas farmacogenÉtica em psiquiatria: influÊncia dos polimorfismos](https://reader033.fdocuments.in/reader033/viewer/2022042413/5f2db3abc003496c580b5cf0/html5/thumbnails/14.jpg)
IX
LISTA DE TABELAS
Tabela 1. Primer, reagentes e ciclagem para PCR.
Tabela 2. Reagentes e concentrações utilizadas na reação de
sequenciamento (para a corrida utilizando um primer específico)
Tabela 3. Condições de PCR utilizadas para amplificação da região do
gene contendo o alello polimórfico CYP2C19*2.
Tabela 4. Características de PCR e RFLP dos CYP2C19*2 e
CYP2C19*17
21
21
24
24
![Page 15: UNIVERSIDADE FEDERAL DE GOIÁS INSTITUTO DE CIÊNCIAS ...€¦ · programa de pÓs-graduaÇÃo em ciÊncias biolÓgicas farmacogenÉtica em psiquiatria: influÊncia dos polimorfismos](https://reader033.fdocuments.in/reader033/viewer/2022042413/5f2db3abc003496c580b5cf0/html5/thumbnails/15.jpg)
X
RESUMO
A farmacogenética busca compreender a base hereditária da variabilidade da
resposta e dos efeitos adversos dos agentes farmacológicos entre os indivíduos. Os
medicamentos antipsicóticos e antidepressivos são utilizados em tratamentos
bastante efetivos para a esquizofrenia e transtorno depressivo maior (TDM),
respectivamente. Embora boa parte dos pacientes responda às terapias com
antipsicóticos e antidepressivos, 20-40% mostram resposta inadequada, e o custo
de cada tentativa de medicação não-efetiva para os pacientes pode levar a semanas
de permanência da doença, ocorrência de efeitos adversos potenciais e não-
aderência ao tratamento. Este estudo teve como objetivo identificar polimorfismos
genéticos que podem potencialmente influenciar a resposta ao tratamento à
clozapina em pacientes esquizofrênicos e ao escitalopram em pacientes com TDM.
Essa abordagem envolveu o estudo de genes das enzimas metabolizadoras de
fármacos CYP1A2 e CYP2C19, potencialmente envolvidas no metabolismo desses
fármacos e que podem afetar a eficácia do tratamento. Foram estudados 54
pacientes esquizofrênicos em uso de clozapina e 31 pacientes com TDM em
tratamento com escitalopram, ambos por longo prazo. Os polimorfismos
investigados, CYP1A2*1F em pacientes esquizofrênicos e CYP2C19*2 e
CYP2C19*17 em pacientes depressivos, foram estudados por métodos baseados na
reação em cadeia da polimerase (PCR) seguido por sequenciamento (CYP1A2*1F)
ou pela técnica de polimorfismo no comprimento de fragmentos de restrição (RFLP)
(CYP2C19*2 e *17). Os resultados encontrados apontam a associação do
polimorfismo CYP1A2*1F com a super-refratariedade ao tratamento à clozapina e a
associação do polimorfismo CYP2C19*17 com resposta diminuída ao tratamento
com escitalopram. Não foi encontrada associação entre o polimorfismo CYP2C19*2
e a resposta ao tratamento ao escitalopram. Os resultados obtidos sugerem que as
variantes genéticas CYP1A2*1F e CYP2C19*17 podem desempenhar um papel
importante na efetividade do tratamento com antipsicóticos e antidepressivos em
transtornos psiquiátricos incapacitantes como a esquizofrenia e o TDM. A
farmacogenética pode auxiliar na psiquiatria como ferramenta para a escolha de
medicamentos e doses mais adequadas para cada paciente, diminuindo o
sofrimento, reduzindo custos e trazendo qualidade de vida a pacientes e familiares.
![Page 16: UNIVERSIDADE FEDERAL DE GOIÁS INSTITUTO DE CIÊNCIAS ...€¦ · programa de pÓs-graduaÇÃo em ciÊncias biolÓgicas farmacogenÉtica em psiquiatria: influÊncia dos polimorfismos](https://reader033.fdocuments.in/reader033/viewer/2022042413/5f2db3abc003496c580b5cf0/html5/thumbnails/16.jpg)
XI
Palavras-Chave: CYP450, Esquizofrenia, transtorno depressivo maior,
Refratariedade, Farmacogenética.
![Page 17: UNIVERSIDADE FEDERAL DE GOIÁS INSTITUTO DE CIÊNCIAS ...€¦ · programa de pÓs-graduaÇÃo em ciÊncias biolÓgicas farmacogenÉtica em psiquiatria: influÊncia dos polimorfismos](https://reader033.fdocuments.in/reader033/viewer/2022042413/5f2db3abc003496c580b5cf0/html5/thumbnails/17.jpg)
XII
ABSTRACT
The aim of pharmacogenetics is to understand the hereditary basis of
therapeutic response and side effects of pharmacological agents for each individual.
Antipsychotics and antidepressants are effective drugs for schizophrenia and major
depressive disorder (MDD) treatment, respectively. Although a number of patients
respond satisfactorily to antipsychotics and antidepressants, 20-40% of them present
inadequate response, and the treatment with ineffective medication may take weeks
of unremitted illness, potential adverse drug reactions and nonadherence to
treatment. This study aims to identify polymorphisms in genes that potentially
influence the treatment response to clozapine in schizophrenic patients and the
treatment with escitalopram in MDD patients. This approach involved the study of
CYP1A2 and CYP2C19 genes related to the metabolism of these drugs and which
may to affect the efficacy of treatment. It was studied 54 schizophrenic patients
taking clozapine and 31 patients with MDD treated with escitalopram, both for long
term. The investigated polymorphisms, CYP1A2*1F in schizophrenic patients and
CYP2C19*2 and CYP2C19*17 in depressive patients, were analyzed by polymerase
chain reaction (PCR), followed by sequencing (CYP1A2*1F) or by restriction
fragment length polymorphism (RFLP) (CYP2C19*2 and *17) techniques. The results
pointed for the association between CYP1A2*1F polymorphism and super-refractory
clozapine treatment and for the association between CYP2C19*17 polymorphism
and the decreased response to escitalopram treatment. No association was
observed between CYP2C19*2 and the response to escitalopram treatment. These
findings suggest that these genetic variants have an important influence on the
treatment effectiveness of antipsychotics and antidepressants in psychiatric
disorders, as schizophrenia and MDD. The pharmacogenetics may be useful to the
psychiatrists helping in the choice of drugs and doses more efficient for each patient,
reducing suffering and costs and contributing to improve the quality of life for patients
and families.
Keywords: CYP450, Schizophrenia, Major Depressive Disorder, Refractoriness,
Pharmacogenetic.
![Page 18: UNIVERSIDADE FEDERAL DE GOIÁS INSTITUTO DE CIÊNCIAS ...€¦ · programa de pÓs-graduaÇÃo em ciÊncias biolÓgicas farmacogenÉtica em psiquiatria: influÊncia dos polimorfismos](https://reader033.fdocuments.in/reader033/viewer/2022042413/5f2db3abc003496c580b5cf0/html5/thumbnails/18.jpg)
INTRODUÇÃO
![Page 19: UNIVERSIDADE FEDERAL DE GOIÁS INSTITUTO DE CIÊNCIAS ...€¦ · programa de pÓs-graduaÇÃo em ciÊncias biolÓgicas farmacogenÉtica em psiquiatria: influÊncia dos polimorfismos](https://reader033.fdocuments.in/reader033/viewer/2022042413/5f2db3abc003496c580b5cf0/html5/thumbnails/19.jpg)
2
1.1 FARMACOGENÉTICA EM PSIQUIATRIA
A farmacogenética é a área da farmacologia que investiga a influência de
variantes gênicas relacionadas à resposta individual ao uso de determinado
fármaco, como os polimorfismos genéticos [1]. Os genes são constituídos
basicamente de DNA, composta de sequências complexas de nucleotídeos.
Variações nessas sequências que ocorrem na população de forma estável,
encontradas com frequência de 1% ou superior, são denominadas polimorfismos
genéticos [2]. O polimorfismos genéticos mais comuns são deleções, substituições
de base única (em inglês: Single Nucleotide Polymorphisms, ou SNP), ou variações
no número de sequências repetidas (VNTR), micro e minisatélites [3]. As variabilidade interindividual quanto às respostas terapêuticas dos fármacos
geralmente estão associadas com polimorfismos genéticos presentes em genes que
afetam a farmacocinética ou a farmacodinâmica [4]. Tais polimorfismos podem
alterar a expressão e/ou a atividade de sítios de ligação de medicamentos [5], por
afetarem a estabilidade do RNA mensageiro correspondente, ou modificarem a
estrutura conformacional da proteína correspondente. Como consequência, essas
alterações podem levar à redução ou aumento da atividade da proteína codificada
[6]. Desta forma, SNPs em genes que codificam transportadores de medicamentos,
enzimas metabolizadoras de medicamentos ou envolvidas na biossíntese e reparo
do DNA, poderiam determinar a eficácia dos medicamentos e sua toxicidade [7]. Assim, esses componentes genéticos podem estar relacionados a falhas na
resposta terapêutica ou ao aparecimento de efeitos colaterais [1]. A farmacogenética surgiu como uma área científica na década de 1950,
quando Arno Motulsky expôs as bases genéticas dos ataques de porfiria
desencadeados por barbitúricos e das reações adversas ao uso do antimalárico
primaquina e do relaxante muscular succinilcolina. Essa publicação levou o
pesquisador Friedrich Vogel a cunhar o nome farmacogenética [8]. Nos anos 1970, foi descoberto o complexo enzimático do citocromo P450 e
descrita a sua relação com a metabolização de vários medicamentos utilizados na
prática clínica. Posteriormente, além das proteínas relacionadas à metabolização
dos medicamentos, começaram a ser relacionadas outras moléculas-alvo com a
resposta ao uso de medicamentos, como as proteínas transportadoras, os
![Page 20: UNIVERSIDADE FEDERAL DE GOIÁS INSTITUTO DE CIÊNCIAS ...€¦ · programa de pÓs-graduaÇÃo em ciÊncias biolÓgicas farmacogenÉtica em psiquiatria: influÊncia dos polimorfismos](https://reader033.fdocuments.in/reader033/viewer/2022042413/5f2db3abc003496c580b5cf0/html5/thumbnails/20.jpg)
3
receptores de membrana e os segundo-mensageiros intracelulares. Desse modo,
houve a ampliação do termo farmacogenética para farmacogenômica [1]. A farmacogenética de fármacos de uso em psiquiatria tem se concentrado na
resposta terapêutica e efeitos adversos dos antidepressivos e antipsicóticos, haja
vista que a depressão e a esquizofrenia são transtornos psiquiátricos crônicos,
recorrentes e promotores de desarranjo e custo social extenso [9]. Evidências oriundas de observações em famílias com múltiplos portadores de
depressão apontam que fatores genéticos exercem relevante papel na resposta aos
medicamentos antidepressivos ou na intensidade dos seus efeitos adversos [10]. Variantes genéticas também são descritas por desempenhar um papel importante na
efetividade do tratamento com antipsicóticos, podendo ser considerado como
sugestivo o efeito de polimorfismos em genes candidatos para estudos
farmacogenéticos na esquizofrenia [11]. A utilização de testes farmacogenéticos para guiar na prescrição de
medicamentos antidepressivos é associado com a melhora mais efetiva dos
sintomas e com a resposta mais rápida ao tratamento, assim como com a redução
nos gastos globais associados aos cuidados de saúde [12]. A despeito do número crescente de medicações, da frequência e da
gravidade dos efeitos colaterais e da prevalência das doenças mentais, a
farmacogenética encontra um significativo campo de aplicação na atividade clínica
diária. Alguns testes já padronizados, informam o perfil genético de enzimas
metabolizadoras hepáticas, ligando cada enzima a uma lista de medicamentos
antidepressivos e antipsicóticos que são primariamente biotransformados pela
enzima [13]. Apesar dos avanços já alcançados, a utilização dos testes farmacogenéticos
ainda é recente e restrito, sendo necessária uma maior experiência para avaliar seu
verdadeiro papel na prática clínica psiquiátrica. Além disso, é necessário que mais
estudos sejam realizados a fim de confirmar que estas relações sejam seguras, com
boa predição de resposta e adequada relação custo-efetividade [1].
![Page 21: UNIVERSIDADE FEDERAL DE GOIÁS INSTITUTO DE CIÊNCIAS ...€¦ · programa de pÓs-graduaÇÃo em ciÊncias biolÓgicas farmacogenÉtica em psiquiatria: influÊncia dos polimorfismos](https://reader033.fdocuments.in/reader033/viewer/2022042413/5f2db3abc003496c580b5cf0/html5/thumbnails/21.jpg)
4
1.2 FARMACOGENÉTICA NA ESQUIZOFRENIA
1.2.1 Esquizofrenia
A esquizofrenia é um transtorno psiquiátrico crônico e debilitante
caracterizado por sintomas positivos e negativos, tais como alucinações, delírios,
alterações do pensamento e avolição, trazendo prejuízos sociais, cognitivos e
funcionais [14]. A prevalência da esquizofrenia varia entre 0,30% a 0,66% no
mundo, chegando a 2,3% quando associada a outros transtornos psicóticos [15]. A
esquizofrenia carrega co-morbidade médica e consequente aumento da mortalidade,
com uma média de vida reduzida em 10 anos. O início da doença ocorre geralmente
no final da adolescência para início da idade adulta e seu curso é crônico e
incapacitante, portanto, o tratamento é necessário para manter o funcionamento
social e prevenir a recidiva dos sintomas ao longo da vida. A etiologia é considerada
multifatorial, com fatores genéticos e ambientais desempenhando importante
influência [16]. Os medicamentos antipsicóticos são o pilar do tratamento para a
esquizofrenia [14]. Antipsicóticos típicos ou de primeira geração (APGs) são
eficazes na melhoria de sintomas positivos, mas podem causar efeitos motores
extrapiramidais (EPS - do inglês extrapyramidal symptoms), que são perturbadores e
até mesmo irreversíveis, como a discinesia tardia (DT). Os novos antipsicóticos,
atípicos ou de segunda geração (ASGs), podem melhorar os sintomas positivos e
negativos, e apresentam menor relação com EPS e DT em comparação com os
APGs, entretanto, ganho de peso, alterações metabólicas e consequências
cardiovasculares são mais frequentemente observados [17,18]. O mecanismo de ação destes fármacos envolve principalmente o sistema
dopaminérgico. O bloqueio de receptores D2 no corpo estriado tem efetivo efeito
antipsicótico [17], pelo menos para os sintomas positivos, embora outros receptores
dopaminérgicos (D3 e D4), e os sistemas serotoninérgico e glutamatérgico podem
também estar envolvidos nos efeitos antipsicóticos desses fármacos [18]. Apesar dos avanços da psicofarmacologia, muitos pacientes com
esquizofrenia descontinuam ou modificam os regimes de utilização dos
antipsicóticos devido aos efeitos colaterais emergentes do tratamento ou, então, à
ausência da eficácia farmacológica, independente da escolha do medicamento
![Page 22: UNIVERSIDADE FEDERAL DE GOIÁS INSTITUTO DE CIÊNCIAS ...€¦ · programa de pÓs-graduaÇÃo em ciÊncias biolÓgicas farmacogenÉtica em psiquiatria: influÊncia dos polimorfismos](https://reader033.fdocuments.in/reader033/viewer/2022042413/5f2db3abc003496c580b5cf0/html5/thumbnails/22.jpg)
5
antipsicótico [19-23]. Esses indivíduos são considerados como portadores de
esquizofrenia refratária ao tratamento (TRS, do inglês Treatment Refractory
Schyzophrenia).
A TRS ocorre em cerca de um em cada três indivíduos com diagnóstico de
esquizofrenia [24-28]. TRS é definida pelas diretrizes como uma resposta
inadequada ao tratamento sequencial com pelo menos dois antipsicóticos de classes
diferentes (APGS ou ASGs) em doses adequadas com aderência ao tratamento, por
pelo menos seis semanas [25,27,28]. Um estudo com TRS constatou que esses
pacientes apresentam redução da qualidade de vida, aumento dos custos médicos e
das taxas de co-morbidades graves em comparação aos pacientes com
esquizofrenia não refratária [29]. Os custos anuais para pacientes com esquizofrenia
está entre US $15.500 e $ 22.300 nos Estados Unidos, sendo de 3 a 11 vezes
maiores na TRS, incluindo os custos médicos e sociais, como perda da
produtividade, carga do cuidador e assistência social [29]. Provas convincentes derivadas de revisões sistemáticas [30] e de meta-
análises [31,32] estabeleceram que a clozapina é a droga de escolha para a TRS,
no entanto, aproximadamente 30% dos pacientes não respondem plenamente ao
tratamento com clozapina. Esses pacientes são conhecidos como resistentes à
clozapina, respondedores incompletos à clozapina ou portadores de esquizofrenia
super-refratária (SRS, do inglês super refractory schizophrenia) [33]. Pacientes com SRS tem sido objeto de estudos em ensaios clínicos onde
estratégias de potencialização da clozapina foram testadas, tais como associação
com antipsicóticos, antidepressivos ou estabilizadores de humor [33-35]. No entanto,
os mecanismos subjacentes à SRS permanecem desconhecidos e poucos estudos
tem sido realizados abordando esta questão.
No que concerne aos estudos relacionados à farmacogenética da clozapina,
os mesmos tem sugerido que variações genéticas nas enzimas metabolizadoras do
complexo enzimático P450 podem estar relacionadas à eficácia terapêutica,
influenciando a farmacocinética desse fármaco e, consequentemente, a resposta ao
tratamento [36]. Variantes nos genes que codificam essas enzimas produzem metabolismo
hipoativo ou hiperativo, o que pode afetar os níveis plasmáticos do fármaco. A
isoforma do citocromo P450 1A2 (CYP1A2) é primariamente responsável pelo
metabolismo da clozapina. Entretanto, CYP2C19, CYP2D6, CYP2E1, CYP3A4 e
![Page 23: UNIVERSIDADE FEDERAL DE GOIÁS INSTITUTO DE CIÊNCIAS ...€¦ · programa de pÓs-graduaÇÃo em ciÊncias biolÓgicas farmacogenÉtica em psiquiatria: influÊncia dos polimorfismos](https://reader033.fdocuments.in/reader033/viewer/2022042413/5f2db3abc003496c580b5cf0/html5/thumbnails/23.jpg)
6
CYP3A5 podem ser vias alternativas metabólicas secundárias ou terciárias da
clozapina [37].
1.2.2 CYP1A2
Essa isoforma é responsável por 15% do teor total de enzimas P450
presentes no fígado. Os fatores ambientais podem influenciar as diferenças
interindividuais relacionadas à atividade e expressão de CYP1A2, a exemplo do
tabagismo e dos contraceptivos orais, que são indutores estabelecidos da atividade
CYP1A2 [38]. No entanto, cerca de 35% a 75% da variabilidade interindividual na
atividade de CYP1A2 é devida a fatores genéticos [39]. A este respeito, a
identificação genética, epigenética e os fatores ambientais que regulam a expressão
e atividade da CYP1A2 podem auxiliar na otimização dos regimes terapêuticos de
fármacos que são metabolizados pela CYP1A2, evitando uma variabilidade
interindividual imprevisível na resposta ao tratamento com estes fármacos.
Além da cafeína, que também é utilizada como marcador da atividade
metabólica da CYP1A2, medicamentos psicotrópicos clinicamente importantes, tais
como a olanzapina, a clozapina, a asenapina, o haloperidol, a tioridazina, a
imipramina, a clomipramina, a fluvoxamina e a tacrina são completamente ou
parcialmente metabolizados por esta enzima [39-44]. A diferença racial na atividade da CYP1A2 tem sido relatada. Coreanos tem
atividade de CYP1A2 diminuída em cerca de 1,54 vezes quando comparada com
suecos [45]. Populações asiáticas e africanas tem uma atividade enzimática
reduzida quando comparada a populações caucasianas [45-47]. Os níveis
plasmáticos de clozapina são 30-50% mais elevados em pacientes esquizofrênicos
asiáticos em comparação com pacientes caucasianos [48]. A diferença étnica
observada na atividade da enzima CYP1A2 pode ser clinicamente relevante e, uma
vez estabelecida, pode auxiliar em termos de melhorar o resultado terapêutico, em
especial na prescrição de fármacos que apresentam margem terapêutica estreita
(por exemplo, teofilina ou clozapina).
Do ponto de vista genético, alguns dos polimorfismos de CYP1A2 mais
estudados e relacionados ao metabolismo de fármacos são -3860G>A (*1C), -
2467delT (*1D) e -163C> A (*1F), entre outros [49].
![Page 24: UNIVERSIDADE FEDERAL DE GOIÁS INSTITUTO DE CIÊNCIAS ...€¦ · programa de pÓs-graduaÇÃo em ciÊncias biolÓgicas farmacogenÉtica em psiquiatria: influÊncia dos polimorfismos](https://reader033.fdocuments.in/reader033/viewer/2022042413/5f2db3abc003496c580b5cf0/html5/thumbnails/24.jpg)
7
1.2.3 Alelos polimórficos CYP1A2 *1C, *1D e *1F
O alelo CYP1A2 *1C é caracterizado por uma substituição do nucleotídeo
guanina por adenina na posição -3860 da região não-traduzida 5’ flanqueadora
(5’UTR, do inglês untranslated region) de CYP1A2 (-3860G>A), sendo descrito pela
primeira vez em japoneses com uma frequência de 23,3%. Este alelo é associado à
diminuição da atividade enzimática devido a menor capacidade de indução da
expressão da enzima [50]. O polimorfismo -2467delT (CYP1A2*1D) ocorre na região não-traduzida 5’
flanqueadora (5’UTR) de CYP1A2 e foi identificado por Chida e cols. (1999) [51] num grupo de 159 japoneses e com uma frequência de 42,0%. Outro estudo,
também na população japonesa, encontrou uma frequência de 43,8% deste
polimorfismo [52]. No entanto, em grupo de caucasianos alemães, a frequência
encontrada para o CYP1A2*1D foi de 7,9% [53]. Em suecos e coreanos, o
CYP1A2*1D não alterou o metabolismo da cafeína [45], ao passo que em pacientes
alemães com esquizofrenia, o mesmo foi associado a menores concentrações
plasmáticas do antipsicótico olanzapina [54] que, semelhante à clozapina, tem a
CYP1A2 como principal via de metabolização.
O alelo CYP1A2 *1F (-163C>A no intron 1) apresenta alta frequência em
diferentes populações [45,51,55]. Em população alemã foi encontrada uma
frequência de 67,8% [55], em japoneses 62,8% [52] e, em população sueca, foi
verificada uma frequência de 55,9% [45]. Este polimorfismo tem como característica
aumentar a atividade enzimática [55] e é associado a uma menor resposta ao
tratamento com clozapina e olanzapina [56-58], apresentando significativo impacto
nas concentrações séricas de olanzapina [54]. Alguns estudos também tem
associado CYP1A2 *1F com a incidência da discinesia tardia (DT) [59-61]. Estudo
realizado na população do sul do Brasil demonstrou a associação do genótipo
*1F/*1F com crises tônico-clônicas generalizadas induzidas pela clozapina em
pacientes com esquizofrenia, sem haver, no entanto, associação com a combinação
entre os alelos *1F e *1C [62].
![Page 25: UNIVERSIDADE FEDERAL DE GOIÁS INSTITUTO DE CIÊNCIAS ...€¦ · programa de pÓs-graduaÇÃo em ciÊncias biolÓgicas farmacogenÉtica em psiquiatria: influÊncia dos polimorfismos](https://reader033.fdocuments.in/reader033/viewer/2022042413/5f2db3abc003496c580b5cf0/html5/thumbnails/25.jpg)
8
1.2.4 Associação dos polimorfismos CYP1A2 e o metabolismo da clozapina
A clozapina é um fármaco antipsicótico atípico usado para a esquizofrenia
refratária ao tratamento [36,63]. No entanto, a concentração da clozapina plasmática
pode variar em mais de 45 vezes durante o tratamento a longo prazo [64]. Esse
antipsicótico tem uma estreita janela terapêutica de 350-500 ng/mL e, portanto,
precisa de monitoramento constante [64]. As principais vias metabólicas da clozapina são a N-desmetilação e N-
oxidação [65]. CYP1A2, 3A4, 2C9, 2C19 e 2D6 catalisam a formação de N-
desmetilclozapina (norclozapina), enquanto N-oxidação é catalisada pela CYP3A4,
1A2 e flavina contendo mono-oxigenase do tipo 3 (FMO3) [66,67]. A estimativa da
contribuição da CYP1A2, 2C19, 3A4, 2C9 e 2D6 é de 30%, 24%, 22%, 12% e 6%,
respectivamente, em relação a N-desmetilação de clozapina em microssomas de
fígado humano [66]. Em pacientes esquizofrênicos, a depuração da clozapina se correlacionou
com as taxas de cafeína e seus metabólitos [68]. A taxa metabólica da cafeína
também se correlacionou com concentrações plasmáticas de norclozapina. Em não-
fumantes apresentou uma concentração 3,2 vezes maior de clozapina e em
fumantes, concentração 2,3 vezes maior de norclozapina [69], indicando assim o
efeito indutor do cigarro sobre o metabolismo da clozapina. Além disso, a
fluvoxamina (um potente inibidor da CYP1A2) aumenta significativamente os níveis
plasmáticos de clozapina [70]. Ratos knockout para CYP1A2 apresentam
concentração plasmática cerca de 2,6 vezes maior para a clozapina em comparação
com os ratos do tipo selvagem [71]. Estes dados, apontam a CYP1A2 como sendo a
principal enzima metabolizadora da clozapina [72]. Por outro lado, a resistência terapêutica à clozapina devido aos baixos níveis
plasmáticos, tem sido relatada em pacientes esquizofrênicos tabagistas abrigando o
o alelo polimórfico CYP1A2 *1F [56,57]. Eap e cols. (2004) [58] observaram que
pacientes fumantes que não apresentavam resposta terapêutica à clozapina em
doses habituais eram metabolizadores ultra-rápidos (MURs) portadores do alelo
CYP1A2 *1F. Por sua vez, concentrações plasmáticas mais elevadas de clozapina e
reduzidas do seu metabolito N-desmetilclozapina foram observadas em pacientes
portadores de duas variantes polimórficas de CYP1A2 associadas com atividade
reduzida da enzima (*1C e *1D). Estas variantes de CYP1A2 além de estarem
![Page 26: UNIVERSIDADE FEDERAL DE GOIÁS INSTITUTO DE CIÊNCIAS ...€¦ · programa de pÓs-graduaÇÃo em ciÊncias biolÓgicas farmacogenÉtica em psiquiatria: influÊncia dos polimorfismos](https://reader033.fdocuments.in/reader033/viewer/2022042413/5f2db3abc003496c580b5cf0/html5/thumbnails/26.jpg)
9
associadas com maiores concentrações plasmáticas de clozapina, apresentam
relação com risco aumentado de desenvolvimento hiperinsulinemia, hiperlipidemia e
resistência à insulina [73]. Especificamente, a refratariedade ao tratamento na esquizofrenia, faz com
que esses pacientes apresentem uma quantidade maior de sintomas e necessitem
de internações mais frequentes e prolongadas [74,75], chegando a ocupar 25% de
todos os leitos hospitalares [76] e representando 50% de todas as internações
psiquiátricas [77]. Diante disso, há considerável importância em aprimorar a eficácia
clínica do tratamento da esquizofrenia. Nesse contexto, a identificação de fatores
genéticos envolvidos com a resposta farmacológica aos antipsicóticos está entre as
ferramentas que podem auxiliar no tratamento da esquizofrenia [78]. Vários estudos sustentam as evidências de que a grande variabilidade
individual na resposta terapêutica a doses convencionais de fármacos antipsicóticos
pode ser explicada por diferenças na atividade de enzimas do citocromo P450
(CYP450) [73,79,80]. Variantes dos genes codificadores destas enzimas
determinam a variabilidade na capacidade catalítica da enzima, podendo resultar em
metabolizadores lentos, com maior tendência a intolerância ao tratamento ou em
metabolizadores ultra-rápidos, que podem apresentar dificuldades na obtenção de
concentrações plasmáticas adequadas para a resposta terapêutica [81]. Tendo em vista que o alelo polimórfico CYP1A2*1F possui uma alta
frequência em diferentes populações e é associado com a resistência ao tratamento
à clozapina, este estudo visou identificar e estabelecer uma possível relação entre
esse polimorfismo e a refratariedade ao tratamento a esse fármaco.
1.3 FARMACOGENÉTICA NO TRANSTORNO DEPRESSIVO MAIOR 1.3.1 Transtorno Depressivo Maior
O transtorno depressivo maior (TDM) é uma causa emergente de prejuízo
individual e sócio-econômico, com uma prevalência populacional de 12,8% [82], sendo descrito que em torno de 15% destes morrem por suicídio [83]. O TDM está
associado com morbidade, mortalidade e custos financeiros comparáveis aos de
outras doenças clínicas comuns, tais como hipertensão ou diabetes [84,85].
![Page 27: UNIVERSIDADE FEDERAL DE GOIÁS INSTITUTO DE CIÊNCIAS ...€¦ · programa de pÓs-graduaÇÃo em ciÊncias biolÓgicas farmacogenÉtica em psiquiatria: influÊncia dos polimorfismos](https://reader033.fdocuments.in/reader033/viewer/2022042413/5f2db3abc003496c580b5cf0/html5/thumbnails/27.jpg)
10
TDM é geralmente diagnosticado quando estão presentes o rebaixamento do
humor persistente e não reativo, perda do interesse e prazer acompanhados por
uma variedade de sintomas, incluindo perda de apetite, insônia, fadiga, perda de
energia, falta de concentração, sintomas psicomotores, sentimentos excessivos de
culpa e pensamentos mórbidos de morte [86]. Mais de meio século após a descoberta acidental do primeiro medicamento
antidepressivo (imipramina), ainda existem poucos medicamentos com mecanismo
de ação inovador e poucos testes confiáveis para guiar na escolha do tratamento
estão disponíveis. Na verdade, em ambientes clínicos, o tratamento do TDM ainda é
baseado em um princípio de tentativa e erro, tanto na escolha de fármacos quanto
na titulação de doses. Esta abordagem condiz com as observações de que alguns
indivíduos estão propensos a responder a diferentes tipos de tratamentos, outros
respondem seletivamente a uma classe de fármacos específica, enquanto outros
não respondem a quaisquer dos tratamentos disponíveis [87]. Da mesma forma, o
ajuste da dose padrão pode levar a subtratamento prejudicial ou a efeitos colaterais
incapacitantes e ambos podem resultar na interrupção precoce do tratamento.
Assim, a grande variabilidade inter-individual na resposta ao tratamento
antidepressivo e aos efeitos colaterais induzidos pelos fármacos sugerem a
necessidade premente de diretrizes para individualizar o tratamento. Algumas
diferentes estratégias complementares tem sido estudadas para se atingir este
objetivo, dentre elas, os preditores farmacogenéticos tem ganhado um interesse
particular [88-90]. 1.3.2 Farmacogenética antidepressiva
Com base na hipótese de disfunção dos sistemas monoaminérgicos cerebrais
na depressão, o primeiro gene candidato foi a tirosina hidroxilase, uma enzima que
limita o ritmo de síntese de monoaminas. Variantes genéticas relacionadas à
hipótese monoaminérgica são: 1) a substituição do aminoácido valina por metionina
na posição 108 (val108met) do gene codificando a enzima catecol o-metiltransferase
(COMT) [91]; 2) repetição polimórfica na região promotora do gene codificando a
enzima monoaminooxidade (MAO-A) [92] e; 3) a deleção de 44 pares de bases na
região promotora do gene da serotonina (5-HTT), que determina menor atividade
transcricional no gene [93]. No entanto, até o presente momento, estes estudos não
![Page 28: UNIVERSIDADE FEDERAL DE GOIÁS INSTITUTO DE CIÊNCIAS ...€¦ · programa de pÓs-graduaÇÃo em ciÊncias biolÓgicas farmacogenÉtica em psiquiatria: influÊncia dos polimorfismos](https://reader033.fdocuments.in/reader033/viewer/2022042413/5f2db3abc003496c580b5cf0/html5/thumbnails/28.jpg)
11
foram capazes de estabelecer resultados definitivos, haja vista que alguns achados
positivos não puderam ser replicados, o que sugere que possam tratar-se de falsos
positivos decorrentes das amostras populacionais ou do acaso [94]. Em outra vertente, sabe-se que os antidepressivos são substratos do sistema
enzimático citocromo P450 no qual existem várias isoformas enzimáticas codificadas
por diferentes genes. Variantes desses genes podem determinar variabilidade na
capacidade catalítica da enzima, podendo resultar em metabolizadores lentos, com
maior tendência a efeitos colaterais ou tóxicos e metabolizadores ultra-rápidos, que
podem apresentar dificuldades na obtenção de concentrações plasmáticas
adequadas para a resposta terapêutica [81]. Dois genes relacionados ao complexo
enzimático CYP450 e associados aos estudos da farmacogenética do TDM são os
que codificam as isoformas CYP2D6 e CYP2C19 [95,96]. Neste estudo, será
enfatizada a isoforma CYP2C19.
1.3.3 Polimorfismos de CYP2C19 e impacto funcional
CYP2C19 é responsável pelo metabolismo de aproximadamente 10% dos
medicamentos comumente usados, incluindo os inibidores da bomba de prótons,
clopidogrel e vários agentes psicotrópicos [97,98]. O gene CYP2C19 é altamente polimórfico e é um importante gene da região
do cromossômica 10q24.1-q24.3 com pelo menos 35 variantes alélicas e
subvariantes (*1B-*34) já identificadas [99]. O alelo CYP2C19*1, tipo selvagem,
codifica uma enzima funcional que caracteriza o fenótipo “metabolizadores
extensivos” (MEs). A maioria dos metabolizadores lentos (MLs), oriundos do
genótipo CYP2C19, são os portadores dos alelos variantes *2 e *3, que são alelos
relacionados com perda de função enzimática. Por outro lado, os metabolizadores
ultra-rápidos (MURs) são portadores do alelo polimórfico *17, que é associado com
atividade enzimática aumentada [100,101]. A frequência alélica de CYP2C19*2 é de cerca de 15% em africanos, 29-35%
em asiáticos, 12-15% em caucasianos. CYP2C19*3 é encontrada principalmente em
asiáticos (5-9%) e apresenta baixa frequência em caucasianos (<0,5%). Para o
CYP2C19*17, foi relatado que 21% dos europeus e 18% dos africanos são
portadores desse alelo [99].
![Page 29: UNIVERSIDADE FEDERAL DE GOIÁS INSTITUTO DE CIÊNCIAS ...€¦ · programa de pÓs-graduaÇÃo em ciÊncias biolÓgicas farmacogenÉtica em psiquiatria: influÊncia dos polimorfismos](https://reader033.fdocuments.in/reader033/viewer/2022042413/5f2db3abc003496c580b5cf0/html5/thumbnails/29.jpg)
12
Os antidepressivos triciclicos amitriptilina, imipramina e clomipramina são
extensivamente metabolizados pela CYP2C19, com contribuições de CYP2C9,
CYP3A4 e CYP1A2 [102]. Os polimorfismos de CYP2C19 promovem a N-
desmetilação da amitriptilina in vivo [103,104]. As concentrações séricas de
amitriptilina e a relação amitriptilina/nortriptilina no estado estacionário, foram
maiores em indivíduos com dois alelos mutados em homozigoze de CYP2C19
(*2,*3) em comparação com o genótipo tipo selvagem, tanto em pacientes
psiquiátricos japoneses [105] quanto em caucasianos [106,107]. Além disso, estudo
conduzido em pacientes hospitalizados, encontrou que o alelo CYP2C19*17 foi
responsável pela baixa relação amitriptilina/nortriptilina em comparação com o
genótipo CYP2C19 *1 [108]. Entre os inibidores seletivos da recaptação de serotonina (ISRSs), o
citalopram e o escitalopram, são primariamente metabolizados por CYP2C19 [109]. Os clearences do citalopram em indivíduos MLs foram de 43 e 33% menores em
comparação com portadores do alelo selvagem em homozigose ou heterozigoze,
respectivamente [110]. Resultados semelhantes foram encontrados para o
escitalopram, tanto no estado de equilíbrio (steady-state) [111,112] como após
aplicações de doses do fármaco [113]. As médias de concentrações séricas do
escitalopram foram 42% menores em pacientes homozigotos para CYP2C19 *17 e
5,7 vezes mais elevadas em indivíduos homozigotos para alelos *2 ou *3, em
comparação com o subgrupo CYP2C19 *1 [114]. A desmetilação da sertralina para um metabólito quase inativo é mediada por
diferentes isoformas de CYP, onde o CYP2C19 é o mais importante. Um estudo de
dose única em indivíduos saudáveis relatou que a área sobre a curva (AUC) de
sertralina foi 41% superior em indivíduos MLs em comparação aos MEs [115]. Para outros ISRSs, tais como fluoxetina [116,117], fluvoxamina [118] e para o
Inibidor da recaptação de serotonina e da noradrenalina (IRSN), venlafaxina [119], a
evidência de uma associação entre os parâmetros farmacocinéticos e polimorfismos
CYP2C19 é menos evidente. CYP2C19 também está envolvida na biotransformação
de moclobemida, um inibidor da monoamina oxidase reversível, onde foi observado
aumento na concentração plasmática deste fármaco em indivíduos coreanos com
característica de MLs [120]. Por fim, Kirchheiner e cols. (2004) [22] sugeriram a redução da dose de
citalopram e moclobemida baseada no genótipo CYP2C19 para indivíduos MLs.
![Page 30: UNIVERSIDADE FEDERAL DE GOIÁS INSTITUTO DE CIÊNCIAS ...€¦ · programa de pÓs-graduaÇÃo em ciÊncias biolÓgicas farmacogenÉtica em psiquiatria: influÊncia dos polimorfismos](https://reader033.fdocuments.in/reader033/viewer/2022042413/5f2db3abc003496c580b5cf0/html5/thumbnails/30.jpg)
13
Swen e cols. (2011) [121] recomendaram o monitoramento sérico e o aumento da
dose por um fator de 1,5 vezes em pacientes CYP2C19 MURs em uso de citalopram
e de escitalopram, ou o corte da dosagem pela metade em pacientes MLs sob uso
de sertralina.
1.3.4 Farmacoterapia com o escitalopram
O escitalopram é o S-enantiomero puro do citalopram racêmico e é o
tratamento de primeira linha para a depressão moderada a grave [122,123]. Tal
como para todos os outros antidepressivos que pertencem à classe de ISRS, o
mecanismo de ação antidepressiva do escitalopram se presume na potenciação da
atividade serotoninérgica no sistema nervoso central resultante da inibição da
recaptação neuronal da serotonina. É pelo menos 100 vezes mais potente do que o
enantiomero R em relação à inibição da recaptação da 5-HT e a inibição da taxa de
disparo neuronal da 5-HT. O escitalopram tem pouca ou muito baixa afinidade para
outros receptores (alfa e beta-adrenérgicos, dopaminérgicos (D1-5), histamina (H1-
3), muscarínicos (M1-5) e benzodiazepinicos. A farmacocinética de doses múltiplas
do escitalopram é linear e proporcional à dose, em um intervalo de dose entre 10 a
30 mg/dia [124]. A eficácia do escitalopram no tratamento do transtorno depressivo maior foi
estabelecida em três estudos, de 8 semanas, controlados com placebo, realizados
em pacientes ambulatoriais entre 18 e 65 anos de idade que preenchiam os critérios
do manual diagnóstico e estatístico de transtornos mentais, DSM-IV (do inglês
diagnostic and statistical manual of mental disorders) [86] para transtorno depressivo
maior (www.fda.gov) [125]. O desfecho primário em todos os três estudos foi a
alteração da linha de base até ao ponto final da Montgomery Asberg Depression
Rating Scale (MADRS) [126]. Os grupos de tratamento com 10 mg/dia e 20 mg/dia
de escitalopram mostraram uma melhoria significativamente superior em
comparação com o placebo na MADRS. Análise da relação entre o resultado do
tratamento e a idade, sexo e etnia não sugeriram diferença entre os pacientes. Entre
os 715 pacientes deprimidos que receberam escitalopram em ensaios controlados
com placebo, 6% descontinuaram o tratamento devido a um evento adverso, em
comparação com 2% de 592 pacientes que receberam placebo. A taxa de
interrupção para eventos adversos em pacientes designados para uma dose fixa de
![Page 31: UNIVERSIDADE FEDERAL DE GOIÁS INSTITUTO DE CIÊNCIAS ...€¦ · programa de pÓs-graduaÇÃo em ciÊncias biolÓgicas farmacogenÉtica em psiquiatria: influÊncia dos polimorfismos](https://reader033.fdocuments.in/reader033/viewer/2022042413/5f2db3abc003496c580b5cf0/html5/thumbnails/31.jpg)
14
20 mg/dia de escitalopram foi de 10%, que foi significativamente diferente da taxa de
interrupção para eventos adversos em pacientes recebendo 10 mg/dia de
escitalopram (4%) e o placebo (3%). Os eventos adversos mais comumente
observados foram insônia, distúrbio de ejaculação, náuseas, sudorese aumentada,
fadiga e sonolência [127]. 1.3.5 Associação de polimorfismos de CYP2C19 e escitalopram
Estudo conduzido com 172 pacientes em tratamento com escitalopram,
mostrou que indivíduos que não portavam os alelos *2 ou *3 apresentaram taxa de
metabolismo do fármaco 33,7% vezes mais rápida quando comparados com
indivíduos portadores desses alelos em homozigoze ou heterozigoze [112]. Como o metabolismo do escitalopram é realizado preferencialmente por
CYP2C19, é recomendado que pacientes com características para MLs utilizem
doses reduzidas daquelas utilizadas pelos MEs. No entanto, no estudo conduzido
por Ng e cols. (2013) [128], apesar de não haver a diferenciação nas doses
administradas de escitalopram entre MLs e MEs, não foi detectado aumento na
incidência de efeitos colaterais em indivíduos MLs.
Por sua vez, o genótipo ultra-rápido CYP2C19 *17 foi associado com menores
concentrações séricas de escitalopram, o que pode implicar em risco aumentado de
falha terapêutica [114]. As diretrizes para recomendações de dose terapêutica tendo
como subsídio os testes farmacogenéticos, sugerem a necessidade de aumento da
dosagem em 150% nos metabolizadores ultra-rápidos sob uso de escitalopram
[129]. No entanto, devido à grande janela terapêutica desse fármaco, Samer e cols.
(2013) [130] consideram que a influência de variantes de CYP2C19 no resultado
clínico é marginal e, portanto, que os ajustes de dose não são necessários. Hodgson
e cols. (2014) [131] concluiu que, embora haja uma relação significativa entre o
genótipo CYP450 e as concentrações séricas de escitalopram, os genótipos não são
preditivos de diferenças na resposta ao tratamento e que as diferenças nas
concentrações séricas não estão associadas à variabilidade na resposta ao
tratamento.
Diante da associação do metabolismo do escitalopram com a enzima
CYP2C19 e dos estudos contraditórios em relação à influência dos polimorfismos da
isoforma com a resposta ao tratamento com escitalopram, este estudo visou avaliar
![Page 32: UNIVERSIDADE FEDERAL DE GOIÁS INSTITUTO DE CIÊNCIAS ...€¦ · programa de pÓs-graduaÇÃo em ciÊncias biolÓgicas farmacogenÉtica em psiquiatria: influÊncia dos polimorfismos](https://reader033.fdocuments.in/reader033/viewer/2022042413/5f2db3abc003496c580b5cf0/html5/thumbnails/32.jpg)
15
se os polimorfismos CYP2C19*2 e CYP2C19*17 podem influenciar a remissão dos
sintomas depressivos em grupo de pacientes com transtorno depressivo maior em
uso de escitalopram por longa duração.
![Page 33: UNIVERSIDADE FEDERAL DE GOIÁS INSTITUTO DE CIÊNCIAS ...€¦ · programa de pÓs-graduaÇÃo em ciÊncias biolÓgicas farmacogenÉtica em psiquiatria: influÊncia dos polimorfismos](https://reader033.fdocuments.in/reader033/viewer/2022042413/5f2db3abc003496c580b5cf0/html5/thumbnails/33.jpg)
OBJETIVOS
![Page 34: UNIVERSIDADE FEDERAL DE GOIÁS INSTITUTO DE CIÊNCIAS ...€¦ · programa de pÓs-graduaÇÃo em ciÊncias biolÓgicas farmacogenÉtica em psiquiatria: influÊncia dos polimorfismos](https://reader033.fdocuments.in/reader033/viewer/2022042413/5f2db3abc003496c580b5cf0/html5/thumbnails/34.jpg)
17
! Correlações entre o genótipo CYP1A2*1F (rs762551) com refratariedade ao
tratamento com a clozapina, dados clínicos e dados demográficos nos pacientes
com esquizofrenia.
! Correlações entre os genótipos CYP2C19*2 (rs4244285) e CYP2C19*17
(rs12248560) com a remissão ao tratamento com escitalopram, dados clínicos e
dados demográficos nos pacientes com TDM.
![Page 35: UNIVERSIDADE FEDERAL DE GOIÁS INSTITUTO DE CIÊNCIAS ...€¦ · programa de pÓs-graduaÇÃo em ciÊncias biolÓgicas farmacogenÉtica em psiquiatria: influÊncia dos polimorfismos](https://reader033.fdocuments.in/reader033/viewer/2022042413/5f2db3abc003496c580b5cf0/html5/thumbnails/35.jpg)
METODOLOGIA
![Page 36: UNIVERSIDADE FEDERAL DE GOIÁS INSTITUTO DE CIÊNCIAS ...€¦ · programa de pÓs-graduaÇÃo em ciÊncias biolÓgicas farmacogenÉtica em psiquiatria: influÊncia dos polimorfismos](https://reader033.fdocuments.in/reader033/viewer/2022042413/5f2db3abc003496c580b5cf0/html5/thumbnails/36.jpg)
19
3.1 ESTUDO NA ESQUIZOFRENIA 3.1.1 Obtenção do material biológico, acompanhamento clínico e terapêutico.
Foram coletadas amostras sanguíneas (2 mL), através de punção a vácuo da
veia braquial média, de 54 pacientes com diagnóstico de esquizofrenia refratária (em
uso de clozapina) e super-refratária (em uso de clozapina combinada a outro
antipsicótico mais lamotrigina ou não) em condições naturalísticas de tratamento,
atendidos na Clínica Brain Institute e Pax Clínica Psiquiátrica – Instituto de
Neurociências. As amostras foram coletadas após o esclarecimento e aprovação
dos pacientes de todo o procedimento e finalidade da pesquisa, de acordo com o
Termo de Consentimento Livre e Esclarecido aprovado pelo Comitê de Ética em
Pesquisa da UFG no. 39/2013. O material biológico foi enviado ao Laboratório de
Farmacologia Bioquímica e Molecular (LFBM) do ICBII da UFG para extração de
DNA.
Foram agregados ao estudo pacientes de 18 a 65 anos com esquizofrenia
(segundo critérios do DSM-IV-TR) em uso de clozapina respondedores e não
respondedores (critérios de inclusão). A avaliação da eficácia terapêutica foi
efetuada pela avaliação clínica do médico e pela aplicação de questionário
estruturado e validado na língua portuguesa para a aplicação no Brasil. Para avaliar
os sinais e sintomas psiquiátricos, foi utilizado a versão ancorada da escala breve de
avaliação psiquiátrica (BPRS-A) [132]. As medidas foram realizadas antes do início
do tratamento e periodicamente em cada avaliação bimestral ou trimestral durante
todo o tratamento. A resposta clínica foi relacionada à dose efetiva para melhora dos
sintomas, bem como redução da BPRS em mais de 20%. Para realização da
genotipagem, foram incluídos apenas os pacientes que preencheram os critérios
para a resposta a clozapina por um período de, pelo menos, seis meses, sem
histórico de drop-out ou incumprimento do tratamento farmacológico.
Os pacientes com doenças neurológicas, como epilepsia ou encefalopatia;
retardo mental; doenças clínicas não-estáveis; risco de gravidez; ou abuso de álcool
e de drogas ilícitas foram excluídos do estudo.
![Page 37: UNIVERSIDADE FEDERAL DE GOIÁS INSTITUTO DE CIÊNCIAS ...€¦ · programa de pÓs-graduaÇÃo em ciÊncias biolÓgicas farmacogenÉtica em psiquiatria: influÊncia dos polimorfismos](https://reader033.fdocuments.in/reader033/viewer/2022042413/5f2db3abc003496c580b5cf0/html5/thumbnails/37.jpg)
20
3.1.2 Obtenção do DNA
O DNA foi extraído do sangue venoso de cada paciente utilizando o kit
comercial PureLink Genomic DNA Mini Kit® (Invitrogen, San Diego, EUA), seguindo
as instruções do fabricante. Foram transferidos 200 µL de sangue total para
microtubos de 1,5 mL, em seguida foram acrescentados proteinase K e Rnase A. A
seguir as amostras foram incubadas a 55°C por 10 min. Foram adicionados 200 µL
de etanol para o lisado e em seguida foi submetido à coluna de separação, que foi
centrifugada a 10.000 X g por 1 min. A coluna, contendo o DNA, foi reservada e
submetida à lavagem com tampão fornecido pelo kit. Após centrifugação, o DNA
purificado foi obtido através da adição de tampão de eluição à coluna. O tampão
remanescente, contendo o DNA, foi recolhido e armazenado a -20 ºC até o momento
do uso.
3.1.3 Condições de PCR e reação de sequenciamento
A amplificação foi realizada a partir de 100 ng de DNA genômico, utilizando 1
unidade de Taq polimerase (Invitrogen, San Diego, EUA) com 0,8 µM do conjunto de
primers especificamente desenhados para este estudo (5'-
AGCCATTACAACCCTGCCAA-3’ e 5'-ACTGATGCGTGTTCTGTGCT-3'). As
condições de PCR utilizadas foram 94°C durante 2 min, seguido de 36 ciclos de
94ºC durante 1 min, 60ºC durante 1 min, e 72ºC, durante 1,5 minuto, e, em seguida,
uma extensão final a 72 ºC durante 3 min (Tabela 1). A amplificação das amostras
foi avaliada em gel de agarose 1% corado com brometo de etídio e visualizados sob
luz UV.
![Page 38: UNIVERSIDADE FEDERAL DE GOIÁS INSTITUTO DE CIÊNCIAS ...€¦ · programa de pÓs-graduaÇÃo em ciÊncias biolÓgicas farmacogenÉtica em psiquiatria: influÊncia dos polimorfismos](https://reader033.fdocuments.in/reader033/viewer/2022042413/5f2db3abc003496c580b5cf0/html5/thumbnails/38.jpg)
21
Tabela 1. Dados do primer e das condições de PCR utilizadas para amplificação da região
do gene contendo o alello polimórfico CYP1A2*1F.
CYP1A2 (GENE) SEQUÊNCIA (5'-3') TAMANHO
ESPERADO REAGENTES CICLAGEM
CYP1A2 *1F F: AGCCATTACAACCCTGCCAA
R:ACTGATGCGTGTTCTGTGCT 793pb
Buffer 10x: 5µL
dNTP (10mM): 0,38 µL
Primer *FR: 2 µL
MgCL2 (50mM): 1,5 µL
Taq (5U/uL): 0,4 µL
DNA: 260ng
H2O mq q.s.p: 50 µL
Volume final: 50 µL
94oC - 2'
36x ciclos
94oC - 1'
60oC - 1
72oC - 1' 30"
72oC - 3'
4oC - infinito
Em seguida, os produtos de PCR foram tratados com reagentes específicos
do kit comercial para purificação de produtos de PCR (GE Healthcare,
Buckinghamshire, Reino Unido) seguindo as instruções do fabricante e,
posteriormente, foram preparadas para o sequenciamento utilizando o kit ABI Big
Dye Terminator Cycle Sequencing Kit (Applied Biosystems, Foster City, CA, EUA)
(Tabela 1).
Tabela 2. Condições utilizadas na reação de sequenciamento Componentes da Reação - Reagentes Quantidade BigDye Terminator v.3.1 1,5 µL Buffer BigDye v.3.1 (5x) 1,25 µL Iniciador/Primer (5 µM) 1 µL Produto de PCR purificado (50 ng/ µL) 1 µL Água ultrapura (q.s.p. 10 µL) 5,25 µL TOTAL 10 µL
A purificação e precipitação da reação de sequenciamento foi realizada
utilizando-se protocolo recomendado pelo fabricante. Em cada poço da placa de 96
poços, foi adicionado 2,5 µL da solução de EDTA (125 mM) e 30 µL de etanol
absoluto gelado (mantido por no mínimo 2 horas em freezer -20oC). Cobriu-se a
placa, selando-a com papel alumínio e a seguir procedeu-se a homogeneização. A
placa foi então incubada por 15 minutos à temperatura ambiente. Posteriormente, a
placa foi centrifugada por 30 minutos a 3000 x g. Em seguida, a placa foi invertida e
centrifugada por 1 minuto a 185 x g com papel absorvente para se retirar os
componentes da primeira etapa de precipitação. Adicionou-se então 30 µL de etanol
![Page 39: UNIVERSIDADE FEDERAL DE GOIÁS INSTITUTO DE CIÊNCIAS ...€¦ · programa de pÓs-graduaÇÃo em ciÊncias biolÓgicas farmacogenÉtica em psiquiatria: influÊncia dos polimorfismos](https://reader033.fdocuments.in/reader033/viewer/2022042413/5f2db3abc003496c580b5cf0/html5/thumbnails/39.jpg)
22
70% gelado a cada poço, seguido de centrifugação por 15 minutos a 1650 x g com
uma temperatura de 4oC. Inverteu-se a placa e centrifugou-se por 1 minuto a 185 x g
com papel absorvente para se retirar os componentes da segunda etapa de
precipitação. Por fim, a placa foi secada em um termociclador a temperatura de 90
oC por 1 minuto.
Após a precipitação, as amostras foram ressuspendidas em 10 µL de
formamida Hi-Di, desnaturadas por 5 minutos a 95 oC e posteriormente
acondicionadas no sequenciador ABI Prism 3500 DNA Analyzer (Applied
Biosystems). Todas as variações detectadas foram confirmadas por repetição da
PCR a partir do DNA genômico e o sequenciamento dos produtos de PCR gerados
novamente.
As sequências foram analisadas pelo pacote PHRED/PHRAP/CONSED e
todos os pontos de variação foram determinados.
3.1.4 Análise estatística
As distribuições alélicas e genotípicas entre os grupos foi avaliada pelo teste
de χ2 ou exato de Fisher. As diferenças nas doses de clozapina foram calculados
pelo teste t ou o teste de Mann-Whitney. A regressão logística foi realizada para
estimar o efeito do genótipo CYP1A2*1F (-163C>A) no ajuste da dose de clozapina,
presença de co-medicação, tabagismo e consumo de cafeína (presente ou ausente).
Quando apropriado foram utilizados testes paramétricos e não paramétricos para
análise de dados demográficos. As médias (± SD) foram comparados por análise de
variância (ANOVA) com post hoc de Scheffé para comparações múltiplas. O nível de
significância estatística foi estabelecido em P <0,05. Teste de qui-quadrado foi
utilizado para analisar variáveis como etnia, estado civil, IMC e sexo, e correção de
Yates foi aplicada quando necessário. O pacote estatístico SPSS (versão 21.0;
SPSS Inc., IL, EUA) foi utilizado para analisar os dados.
![Page 40: UNIVERSIDADE FEDERAL DE GOIÁS INSTITUTO DE CIÊNCIAS ...€¦ · programa de pÓs-graduaÇÃo em ciÊncias biolÓgicas farmacogenÉtica em psiquiatria: influÊncia dos polimorfismos](https://reader033.fdocuments.in/reader033/viewer/2022042413/5f2db3abc003496c580b5cf0/html5/thumbnails/40.jpg)
23
3.2 ESTUDO NO TRANSTORNO DEPRESSIVO MAIOR 3.2.1 Obtenção do material biológico, acompanhamento clínico e terapêutico.
Foram coletadas amostras sanguíneas (2 mL), através de punção a vácuo da
veia braquial média de 31 indivíduos caucasianos de ambos os sexos, recrutados da
clínica Brain Institute em Goiânia-GO, Brasil. Os pacientes incluídos eram portadores
de TDM segundo critérios do manual diagnóstico e estatístico de transtornos
mentais, quarta edição, texto revisado (DSM-IV-TR), em uso de escitalopram (ESC).
Para realização da genotipagem, foram incluídos apenas os pacientes que
preencheram os critérios para a remissão de TDM por um período de, pelo menos,
doze meses, sem histórico de drop-out ou incumprimento do tratamento
farmacológico. Os indivíduos estavam recebendo ESC (10, 15, ou 20 mg por dia),
isoladamente ou em combinação com mirtazapina ou bupropiona (combinação), em
condições naturalísticas de tratamento. A remissão dos sintomas depressivos foi
avaliada por medidas escala de depressão de Hamilton, 17 itens (HDRS) [133] (Hamilton, 1960); a remissão foi determinada por uma pontuação ≤7 na HDRS. Os
dados de cada HDRS e peso do paciente, foram coletadas e analisadas
periodicamente durante todo o tratamento em avaliações bimestrais.
Os pacientes eram inelegíveis se fossem mulheres grávidas ou lactantes; se
menores de 18 anos de idade; se tivessem recebido diagnósticos primários ou
comorbidade com esquizofrenia, transtorno esquizoafetivo, transtorno bipolar,
demência ou doenças médicas clinicamente significativas; se tivessem resultados
laboratoriais anormais na triagem ou presença de dependência de álcool ou de
substâncias ilícitas, com base nos critérios do DSM-IV TR.
Os indivíduos deram seu consentimento para participar do estudo e todos os
procedimentos foram realizados utilizando uma metodologia padrão aprovada pelo
comitê de ética em pesquisa local (UFG 204/2009).
3.2.2 Genotipagem de CYP2C19*2 e CYP2C19*17
O DNA foi extraído a partir do sangue venoso de cada paciente através do kit
comercial PureLink DNA genomico Mini Kit® (Invitrogen, San Diego, EUA); seguindo
as instruções do fabricante. A genotipagem foi realizada utilizando a reação em
cadeia da polimerase (PCR). A amplificação da região do gene contendo o alelo
![Page 41: UNIVERSIDADE FEDERAL DE GOIÁS INSTITUTO DE CIÊNCIAS ...€¦ · programa de pÓs-graduaÇÃo em ciÊncias biolÓgicas farmacogenÉtica em psiquiatria: influÊncia dos polimorfismos](https://reader033.fdocuments.in/reader033/viewer/2022042413/5f2db3abc003496c580b5cf0/html5/thumbnails/41.jpg)
24
polimórfico CYP2C19*2 foi realizada com o conjunto de primers desenhados
especificamente para este estudo: senso 5’-CAACCAGAGCTTGGCATATTG-3’ e
anti-senso 5'-TAAAGTCCCGAGGGTTGTTG-3'. As condições de PCR utilizadas
estão especificadas na tabela 3. A amplificação por PCR de CYP2C19*17 e as
condições utilizadas foram realizadas de acordo com a metodologia descrita por
Anichavezhi e cols. (2012) [134].
Tabela 3. Condições de PCR utilizadas para amplificação da região do gene contendo o
alello polimórfico CYP2C19*2.
TAMANHO ESPERADO REAGENTES CICLAGEM
CYP2C19*2 223pb
DNA: 50ng
Buffer 10x: 5µL
dNTP (5mM): 0,8 µL
Primers (20µM): 0,8 µL
MgCL2 (50mM): 0,6 µL
Taq (5U/uL): 0,4 µL
H2O mq q.s.p: 20 µL
94oC - 2'
Ciclos:
94oC - 1'
60oC – 1’ 36X
72oC - 1' 30"
72oC - 3'
4oC - infinito
Os produtos de PCR de CYP2C19*2 e CYP2C19*17 foram digeridos com
endonucleases de restrição específicas, Smal e Nsil, respectivamente, seguindo as
instruções do fabricante (ThermoScientific®). Os fragmentos de DNA resultantes
foram analisados em gel de agarose 1,5% corado com brometo de etídio (Tabela 4).
Tabela 4. Características dos produtos de PCR após digestão
Produto PCR (bp)
Enzima Tipo
selvagem (bp)
heterozigoto (bp)
Homozigoto mutado (bp) Alelo
2C19*2 223 SmaI 113-110 223-113-110 223 2C19*17 143 NsiI 166 -27 143-116-27 143
![Page 42: UNIVERSIDADE FEDERAL DE GOIÁS INSTITUTO DE CIÊNCIAS ...€¦ · programa de pÓs-graduaÇÃo em ciÊncias biolÓgicas farmacogenÉtica em psiquiatria: influÊncia dos polimorfismos](https://reader033.fdocuments.in/reader033/viewer/2022042413/5f2db3abc003496c580b5cf0/html5/thumbnails/42.jpg)
25
3.2.3 Análise estatística
Os testes Hardy-Weinberg e desequilíbrio de ligação foram realizados
usando o software Arlequin versão 3.5.1.2. Comparações entre os grupos foram
realizadas usando X2 e o teste exato de Fisher para as variáveis categóricas; os
testes Kruskal Wallis e Mann Whitney para variáveis contínuas não-paramétricas e o
teste t de Student ou análise de variância (ANOVA) para dados contínuos. Um valor
de P inferior a 0,05 foi considerado estatisticamente significativo. As análises
estatísticas foram realizadas utilizando o software SPSS (versão 21.0; SPSS Inc., IL,
EUA).
![Page 43: UNIVERSIDADE FEDERAL DE GOIÁS INSTITUTO DE CIÊNCIAS ...€¦ · programa de pÓs-graduaÇÃo em ciÊncias biolÓgicas farmacogenÉtica em psiquiatria: influÊncia dos polimorfismos](https://reader033.fdocuments.in/reader033/viewer/2022042413/5f2db3abc003496c580b5cf0/html5/thumbnails/43.jpg)
ARTIGOS
![Page 44: UNIVERSIDADE FEDERAL DE GOIÁS INSTITUTO DE CIÊNCIAS ...€¦ · programa de pÓs-graduaÇÃo em ciÊncias biolÓgicas farmacogenÉtica em psiquiatria: influÊncia dos polimorfismos](https://reader033.fdocuments.in/reader033/viewer/2022042413/5f2db3abc003496c580b5cf0/html5/thumbnails/44.jpg)
27
4.1 ARTIGO DO ESTUDO NA ESQUIZOFRENIA The CYP1A2 –163C>A polymorphism is associated with Super-Refractory Schizophrenia in Brazilian patients
Rodrigo Bernini de Brito, MD1,2; Leandro de Carvalho Araujo, MD3; Mateus José
Abdalla Diniz, MD4; Raphaela de Castro Georg, PhD1; João Carlos Nabout, PhD5;
Rosana Pereira Vianelo, Ph.D¹; Rodrigo da Silva Santos, PhD1; Aline Helena da
Silva Cruz, PhD1; Paulo César Ghedini, PhD1.
1Post-Graduate Program in Biological Sciences, Institute of Biological Sciences,
Federal University of Goiás, Goiânia-GO, Brazil 2Brain Institute – Bueno Medical Center, Goiânia-GO, Brazil 3Instituto Especializado em Psiquiatria e Psicologia, Goiânia-GO, Brazil 4Pax Clínica Psiquiátrica – Instituto de Neurociências, Goiânia-GO, Brazil 5Universidade Estadual de Goiás, Anápolis-GO, Brazil
Corresponding author: Paulo César Ghedini, PhD
Laboratory of Biochemistry and Molecular Pharmacology, Department of
Pharmacology, Institute of Biological Sciences, Federal University of Goiás, Campus
Samambaia, Sala 215, 74001-970 Goiânia, GO, Brazil. Tel.: +55 62 3521 1725; fax:
+55 62 3521 1204. E-mail address: [email protected].
Financial Support: This work was supported by grants from Fundação de Amparo à Pesquisa do Estado
de Goiás (FAPEG) and Conselho Nacional de Desenvolvimento Científico e
Tecnológico (CNPq).
Running Title: CYP1A2 –163C>A Polymorphism on clozapine failure
![Page 45: UNIVERSIDADE FEDERAL DE GOIÁS INSTITUTO DE CIÊNCIAS ...€¦ · programa de pÓs-graduaÇÃo em ciÊncias biolÓgicas farmacogenÉtica em psiquiatria: influÊncia dos polimorfismos](https://reader033.fdocuments.in/reader033/viewer/2022042413/5f2db3abc003496c580b5cf0/html5/thumbnails/45.jpg)
28
ABSTRACT
Objective Approximately 30% of treatment-resistant schizophrenic patients do not
fully respond to clozapine (CLZ) treatment and such patients constituting the group
known as clozapine non-responders or super-refractory schizophrenics. We
investigated the influence of CYP1A2 *1F (−163C>A, rs762551) polymorphism in
refractory and super-refractory schizophrenic patients in a naturalistic clinical setting. Method CYP1A2*1F genotype testing included 54 individuals undergoing
pharmacological treatment for refractory or super-refractory schizophrenia averaging
2.3 years in naturalistic conditions. The demographical, psychopathological and
clinical data from each patient were collected and analyzed as recorded in his or her
file. DNA was extracted by venous blood and the polymorphism was analyzed by
polymerase chain reaction (PCR) and sequencing technique. Results CYP1A2*1F presented a positive correlation for super-refractory
schizophrenia. All patients of this group are carriers of the mutant allele and the
genotype homozygous *1F/*1F was present in 74% of these individuals. Smoking
and coffee consumption are not related with the clozapine treatment refractoriness
associated to CYP1A2*1F polymorphism.
Conclusion CYP1A2*1F influences the clozapine response in schizophrenic patients
whereas the smoking and coffee consuming do not seem associated with super-
refractory schizophrenia. Genotyping testing for CYP1A2*1F may be an useful tool to
predict the response to clozapine treatment.
Keywords CYP1A2*1F (–163C>A), schizophrenia, refractory, super-refractory,
clozapine
![Page 46: UNIVERSIDADE FEDERAL DE GOIÁS INSTITUTO DE CIÊNCIAS ...€¦ · programa de pÓs-graduaÇÃo em ciÊncias biolÓgicas farmacogenÉtica em psiquiatria: influÊncia dos polimorfismos](https://reader033.fdocuments.in/reader033/viewer/2022042413/5f2db3abc003496c580b5cf0/html5/thumbnails/46.jpg)
29
1. INTRODUCTION
Schizophrenia is a devastating psychiatric disorder that affects ~1% of the
population and requires lifelong treatment, even when symptoms have subsided
(Andreasen, 1999; Yu et al., 2014). However, 30-60% of patients with the diagnosis
of schizophrenia do not adequately respond to treatment with antipsychotics, being
known as having Treatment Refractory Schizophrenia (TRS) (Henna Neto & Elkis,
2007).
Clozapine, the prototype of atypical antipsychotics, is the drug of choice for
TRS. It is demonstrated efficacy of clozapine in the treatment-resistant patients in
many outcomes including treatment response, with improvements in positive and
negative symptoms of schizophrenia (Sharafi, 2005; Englisch & Zink, 2012). Despite
the introduction of other new atypical antipsychotics, none of them demonstrated
superiority to clozapine for treatment-resistant schizophrenia (Warnez & Alessi-
Severini, 2014). Although the evidence of clozapine effectiveness and that it is
recommended as the drug choice for TRS, it has been described that 30% of these
patients are resistant to clozapine treatment, constituting the group having Super
Refractory Schizophrenia (SRS) (Buckley et al., 2001, Henna Neto & Elkis, 2007).
Inter-individual variation in response to antipsychotics may be associated with
genetic factors, as polymorphisms present in the cytochrome P450 (CYP) drug
metabolizing enzymes (Balibey et al., 2011). CYP1A2 is a member of the CYPs
superfamily associated with metabolism of many drugs, as clozapine (Olsson et al.,
2015). Among the variants described for CYP1A2 until now, CYP1A2*1F has been
primarily associated with the clinical response to clozapine treatment (Balibey et al.,
2011; Ferrari et al., 2012; Yasar et al., 2007).
CYP1A2*1F (–163 C>A, rs762551) causes increased enzyme activity
(Nakajima et al., 1999) and smokers individuals present higher enzyme inducibility
for CYP1A2 substrates (Sachse et al., 1999). In this way, the occurrence of the
CYP1A2*1F genotype has been suggested as a risk factor for treatment failure to
clozapine in psychotic patients, especially in the cigarette smokers (Balibey et al.,
2011), and is suggested as the most likely explanation in non-responder patients with
low clozapine plasma levels receiving usual doses (Ozdemir et al., 2001).
Considering that there are little studies regarding the influence of the
CYP1A2*1F polymorphism and the clinical response to clozapine, this study aimed to
![Page 47: UNIVERSIDADE FEDERAL DE GOIÁS INSTITUTO DE CIÊNCIAS ...€¦ · programa de pÓs-graduaÇÃo em ciÊncias biolÓgicas farmacogenÉtica em psiquiatria: influÊncia dos polimorfismos](https://reader033.fdocuments.in/reader033/viewer/2022042413/5f2db3abc003496c580b5cf0/html5/thumbnails/47.jpg)
30
evaluate the influence of this polymorphism on the response to clozapine treatment
between patients groups with refractory schizophrenia and super refractory
schizophrenia.
2. MATERIALS AND METHODS
2.1 Patients
Patients for the CYP1A2*1F genotype testing included 54 individuals
undergoing pharmacological treatment for refractory or super-refractory
schizophrenia averaging 2.3 years in naturalistic conditions and whose genotype
characteristic was unknown. The demographical, psychopathological and clinical
data from each patient were collected and analyzed as recorded in his or her file. The
psychopathological data was defined according the Brief Psychiatric Rating Scale -
anchored version (BPRS-A) (Romano and Elkis, 1996) and the cluster symptoms as
derived from BPRS-A (Alves and Elkis, 2003). Lack of response was defined as lack
of improvement of at least 20% of the Brief Psychiatric Rating Scale (BPRS) scores.
Demographic and general clinical features such as age, age of onset of
schizophrenia, gender, ethnicity, duration of the illness, number of hospitalizations,
age of first hospitalization, cigarette smoking and coffee consumption, comorbidity
with other relevant medical diseases and substance abuse were collected.
All patients were recruited from Brain Institute and Pax Clínica Psiquiátrica –
Instituto de Neurociências in Goiânia, Goiás state, Brazil. Refractoriness includes
poor response to at least two conventional antipsychotics for at least 6 weeks each
with doses corresponding to 20 mg/day or more of haloperidol, or 1000 mg/day of
chlorpromazine (Kane et al., 1988). Patients who met the criteria for refractoriness
received CLZ and those who did not improve after 6-months’ treatment with CLZ, i.e.
maintained persistent psychotic symptoms, were then classified as super-refractory.
Refractory patients received CLZ only in monotherapy. Super-refractory patients
were often under politherapy, i.e. combination of CLZ with another antipsychotic plus
lamotrigine or not. This was a cohort study in which, at the time of enrollment, all
patients were already undergoing treatment according to their clinical condition,
being refractory or super-refractory.
Patients with neurological diseases such as epilepsy or encephalopathy,
mental retardation, non-stable clinical diseases, risk of pregnancy, history of non-
![Page 48: UNIVERSIDADE FEDERAL DE GOIÁS INSTITUTO DE CIÊNCIAS ...€¦ · programa de pÓs-graduaÇÃo em ciÊncias biolÓgicas farmacogenÉtica em psiquiatria: influÊncia dos polimorfismos](https://reader033.fdocuments.in/reader033/viewer/2022042413/5f2db3abc003496c580b5cf0/html5/thumbnails/48.jpg)
31
compliance, or alcohol and illicit drug abuse were excluded from the study. The
present study was conducted in compliance with the Declaration of Helsinki and its
amendments, and was approved by the institutional ethical committee from Federal
University of Goiás, under number 039/2013.
2.2 DNA Genotyping for CYP1A2*1F
DNA was extracted from the venous blood of each patient with a Purelink
Genomic DNA Mini Kit® (Invitrogen, San Diego, USA) following the manufacturer’s
instructions. Amplification was performed using 100 ng of genomic DNA plus 1 unit of
Taq polymerase (Invitrogen, San Diego, USA) and 0.8 µM of the primers sets (5´-
AGCCATTACAACCCTGCCAA-3’ forward primer and 5’-
ACTGATGCGTGTTCTGTGCT-3’ reverse primer). The PCR conditions were 94 ºC
for 2 min, followed by 36 cycles of 94 ºC for 1 min, 60 ºC for 1 min, and 72 ºC for 1,5
min, and then a final extension at 72 ºC for 3 min. Thereafter, the PCR products were
treated with a PCR product pre-sequencing kit (GE Healthcare, Buckinghamshire,
UK) and directly sequenced on both strands using an ABI BigDye Terminator Cycle
Sequencing Kit (Applied Biosystems, Foster City, CA, USA). The eluates were
analyzed on an ABI Prism 3500 DNA Analyzer (Applied Biosystems). All the detected
variations were confirmed by repeating the PCR from genomic DNA and sequencing
the newly generated PCR products. The nucleotide composition analyses was
performed using the BioEdit software, version 7.2.5 (Tom Hall, Ibis Biosciences,
Carlsbad, CA, USA).
Statistical Analysis
The significance of allele and genotype distributions between groups was
assessed by the χ2 test or Fisher's exact test. The t-test or the Mann–Whitney test
calculated differences in CLZ doses. Logistic regression was performed to estimate
the effect of CYP1A2 *1F (-163C>A) polymorphism on the CLZ dose, presence of co-
medication, smoking and coffee consumption (present or absent). When appropriate,
parametric and non-parametric tests were used for analyses of demographic data.
Analysis of Variance (ANOVA) compared means (± SD) followed by post-hoc Scheffe
or Bonferroni tests for multiple comparisons, when appropriate. Chi square tests
were used to analyze the variables ethnicity; marital status and gender and Yates
correction was applied when necessary. The SPSS software statistical package
![Page 49: UNIVERSIDADE FEDERAL DE GOIÁS INSTITUTO DE CIÊNCIAS ...€¦ · programa de pÓs-graduaÇÃo em ciÊncias biolÓgicas farmacogenÉtica em psiquiatria: influÊncia dos polimorfismos](https://reader033.fdocuments.in/reader033/viewer/2022042413/5f2db3abc003496c580b5cf0/html5/thumbnails/49.jpg)
32
(version 21.0; SPSS Inc., IL, US) was used to analyze the data. The level of
statistical significance was P<0.05.
RESULTS
The study included 54 patients where 27 (50%) were classified as refractory
(CLZ responders) and 27 (50%) as super-refractory. The mean age was 39 years
(SD 9.9), most of them were males (64.8%) and the mean age at onset of the
schizophrenia for both groups was 22.2 years (SD 5.1), while the mean age at first
hospitalization was 23.1 years (SD 4.9). Educational levels also did not differ
between the groups. The refractory patients had a mean of 5.0 (SD 2.9)
hospitalizations, while the super-refractory patients had a mean of 13.4 (SD 7.4)
(P=0.03) (Table 1).
Super-Refractory group had de highest scores of total BPRS when compared
with the Refractory Group (P<0,001) (Table 1). Both groups reduced BPRS after
treatment in >20% (P<0,05), observed at time of the genotyping testing. In the
Refractory Group the mean of CLZ dose was 535 mg (SD 116), while in the Super-
Refractory Group was 593 mg (SD 114 ). Among the 27 patients for whom another
antipsychotic agent was added, 52% received a second-generation, with risperidone
added most frequently (eight patients, or 30%), followed by quetiapine (three
patients, or 11%), olanzapine (one patient, or 3.7%), aripiprazole (one patient, or
3.7%), and ziprasidone (one patient, or 3.7%), and thirteen patients (48%) received a
first-generation agent. The added antipsychotic agent was not specified for two
patients. Five patients received lamotrigine in combination to CLZ and other
antipsychotic.
The genotype testing for CYP1A2*1F showed that 7 (13%) patients were
homozygous wild-type (*1A/*1A), 18 (33.3%) were heterozygous (*1A/*1F), and 29
(53.7%) were homozygous mutant (*1F/*1F). Comparing the three genotypes, no
differences were observed on clozapine dosage, Body Mass Index (BMI), number of
smokers and coffee consumption individuals. However, the analysis of severity of
symptoms by BPRS showed that carriers of genotype *1F/*1F has the highest scores
before and after treatment compared to the other genotypes (P = 0.010 and P=
0.002, respectively) (Table 2). It was observed that 100% of super-refractory patients
are carriers of the allele *1F (*1A/*1F or *1F/*1F) and a significant correlation was
![Page 50: UNIVERSIDADE FEDERAL DE GOIÁS INSTITUTO DE CIÊNCIAS ...€¦ · programa de pÓs-graduaÇÃo em ciÊncias biolÓgicas farmacogenÉtica em psiquiatria: influÊncia dos polimorfismos](https://reader033.fdocuments.in/reader033/viewer/2022042413/5f2db3abc003496c580b5cf0/html5/thumbnails/50.jpg)
33
observed between super-refractory patients and genotype 1F/*1F (P=0.0002) (Table
2).
The analysis of influence of smoking and coffee consumption on the response
to clozapine treatment (refractory or super-refractory patients), showed that these
factors are not associated with clozapine dosage and CYP1A2 genotypes (F=0.93;
P= 0.43 and F=1.37; P= 0.26, respectively) (Table 3 and Table 4).
DISCUSSION
The data showed that the patients with super-refractory schizophrenia did not
differ from refractory patients in terms of their demographical characteristics but
presented higher severity of illness and a higher score of positive symptoms, which
are predictive of super-refractoriness (Henna Neto and Elkis, 2007). The CYP1A2*1F
variant is a common allele in different populations (Chida et al., 1999; Sachse et al.,
1999; Soyama et al., 2005; Ghotbi et al., 2007). In our study, when is grouped both
patients of refractory and super-refractory groups, the frequency of CYP1A2*1F allele
is similar to those populations studies. However, the groups are analyzed separately,
it was observed that frequency of CYP1A2*1F is increased in the super-refractory
group (87%) in relation to the refractory group (53.7%). Accordingly, previous study
performed with Brazilian refractory schizophrenia patients, showed similar frequency
of CYP1A2*1F with our study (Kohlrausch el al., 2013).
To our knowledge, this is the first study performed with patients with super-
refractory schizophrenia and analyzing the influence of CYP1A2*1F polymorphism
with the response to clozapine treatment between refractory and super-refractory
patients groups. Some studies have suggested that CYP1A2*1F allele may
contribute to resistance to clozapine treatment in psychotic patients (Yasar et al.,
2007; Balibey et al., 2011; Jaquenoud Sirot et al., 2009; Ozdemir et al., 2001, Eap et
al., 2004, Bondolfi et al., 2005, Olsson et al., 2015). The present study corroborates
with the previous studies, since the CYP1A2*1F presented a positive correlation only
for the super-refractory group, in which all individuals of this group were carriers of
the mutant allele and the genotype homozygous *1F/*1F was present in the majority
of these patients. A possible explanation is that the polymorphism *1F promotes
![Page 51: UNIVERSIDADE FEDERAL DE GOIÁS INSTITUTO DE CIÊNCIAS ...€¦ · programa de pÓs-graduaÇÃo em ciÊncias biolÓgicas farmacogenÉtica em psiquiatria: influÊncia dos polimorfismos](https://reader033.fdocuments.in/reader033/viewer/2022042413/5f2db3abc003496c580b5cf0/html5/thumbnails/51.jpg)
34
higher enzyme inducibility, and high CYP1A2 activity is associated with lower plasma
levels and an inadequate clinical response to clozapine (Ozdemir et al., 2001).
In addition to CYP1A2*1F polymorphism, it is reported that smoking has
influence in the activity of CYP1A2 and in the clozapine plasma concentrations.
However, the studies are not in full accordance. Eap et al. (2004) reported the
resistance to clozapine in smoking schizophrenic patients is associated with
CYP1A2*1F/*1F genotype and van der Weide et al. (2003) showed that clozapine
daily dose was associated with smoking, but CYP1A2 genetic polymorphism showed
no significant effect. On the other hand, Jaquenoud Sirot et al. (2009) do not confirm
any influence of CYP1A2*1F polymorphism on clozapine plasma concentrations or
CYP1A2 activity, but showed the inducing effect of smoking on CYP1A2 activity and
clozapine metabolism. Tsuda et al. (2014) suggest that the doses of clozapine should
be reduced by 50% in non-smokers to obtain an equivalent plasma concentration
observed in the smokers. Our results showed no association between cigarette
smoking and clozapine dosage, refractoriness or genotype, suggesting that smoking
are not associated with the refractoriness to clozapine treatment observed for the
CYP1A2*1F.
On the other hand, it is established that caffeine is an inducer of CYP1A2
enzyme (Chen et al., 1996). However, Kalow and Tang (1991) did not observe an
association of CYP1A2 activity with habitual coffee consumption when studying
caffeine urinary ratio as an index of CYP1A2 activity. The CYP1A2*1F allele is the
most commonly studied variant with respect to caffeine metabolism and it was
showed that the genotype CYP1A2*1F/*1F was associated with increased
metabolism in Swedish and Serbian heavy coffee consumers (Djordjevic et al.,
2010). Tantcheva-Poor et al. (1999) revealed that CYP1A2 induction was more
dependent on the regular coffee consumption alone than a combined estimate with
the total daily food intake containing caffeine, suggesting that the enzyme inducing
effect might be due to other constituents present in coffee that not to caffeine.
Considering the association between coffee consumption and the inducibility of
CYP1A2 enzyme, we hypothesize that the coffee consumption could be associated
with the non-response to clozapine treatment. Although our coffee consumers
patients are daily users, we don’t found any association between coffee consuming
and CYP1A2 genotypes for the refractoriness to clozapine treatment.
![Page 52: UNIVERSIDADE FEDERAL DE GOIÁS INSTITUTO DE CIÊNCIAS ...€¦ · programa de pÓs-graduaÇÃo em ciÊncias biolÓgicas farmacogenÉtica em psiquiatria: influÊncia dos polimorfismos](https://reader033.fdocuments.in/reader033/viewer/2022042413/5f2db3abc003496c580b5cf0/html5/thumbnails/52.jpg)
35
Taken together, the results here obtained suggest the CYP1A2*1F
polymorphism influences the clozapine response in schizophrenic patients whereas
the smoking and coffee consuming do not seem associated with super-refractory
schizophrenia. Genotyping testing for CYP1A2*1F may be an useful tool to predict
the response to clozapine treatment.
REFERENCES
Alves T.M., Elkis H., 2003. The psychopathology of treatment resistant
schizophrenia: a factor analysis using the BPRS-A. Schizophr. Res. 60(2-3):10.
Andreasen NC., 1999. Understanding the causes of schizophrenia. N Engl J Med.
340(8):645–647.
Balibey H., Basoglu C., Lundgren S., Babaoglu M.O., Yasar U., Herken H., Rane A.,
Bozkurt A., Cetin M., 2011. CYP1A2*1F Polymorphism Decreases Clinical
Response to Clozapine in Patients with Schizophrenia. Bulletin of Clinical
Psychopharmacology. 21(2): 93-99.
Bondolfi G., Morel F., Crettol S., Rachid F., Baumann P., Eap C.B., 2005. Increased
clozapine plasma concentrations and side effects induced by smoking cessation
in 2 CYP1A2 genotyped patients. Ther Drug Monit. 27(4):539-43.
Buckley PF, Dayem M, Parker G, Weisser L. Schizophrenia today: what do we know-
and how sure are we? J Psychiatr Pract, 2001 Jul;7(4):244-6.
Chen L., Bondoc FY, Lee MJ, Hussin AH, Thomas PE, Yang CS., 1996. Caffeine
induces cytochrome P4501A2: induction of CYP1A2 by tea in rats. Drug Metab
Dispos., 24(5):529-533.
Chida M., Yokoi T., Fukui T., Kinoshita M., Yokota J., Kamataki T., 1999. Detection of
three genetic polymorphisms in the 5'-flanking region and intron 1 of human
CYP1A2 in the Japanese population. Jpn. J. Cancer Res. 90(9):899-902.
Djordjevic N, Ghotbi R, Jankovic S, Aklillu E., 2010. Induction of CYP1A2 by heavy
coffee consumption is associated with the CYP1A2 -163C>A polymorphism. Eur
J Clin Pharmacol. 66(7):697-703.
Eap C.B., Bender S., Jaquenoud Sirot E., Cucchia G., Jonzier-Perey M., Baumann
P., Allorge D., Broly F., 2004. Nonresponse to clozapine and ultrarapid CYP1A2
![Page 53: UNIVERSIDADE FEDERAL DE GOIÁS INSTITUTO DE CIÊNCIAS ...€¦ · programa de pÓs-graduaÇÃo em ciÊncias biolÓgicas farmacogenÉtica em psiquiatria: influÊncia dos polimorfismos](https://reader033.fdocuments.in/reader033/viewer/2022042413/5f2db3abc003496c580b5cf0/html5/thumbnails/53.jpg)
36
activity: clinical data and analysis of CYP1A2 gene. J Clin Psychopharmacol.
24(2):214-9.
Englisch S., Zink M., 2012. Treatment-resistant Schizophrenia: Evidence-based
Strategies. Mens Sana Monogr. 10(1): 20–32.
Ferrari M., Bolla E., Bortolaso P., Callegari C., Poloni N., Lecchini S. et al., 2012.
Association between CYP1A2 polymorphisms and clozapine-induced adverse
reactions in patients with schizophrenia. Psychiatry Res. 30;200 (2-3):1014-1017.
Ghotbi R., Christensen M., Roh H.K., Ingelman-Sundberg M., Aklillu E., Bertilsson L.,
2007. Comparisons of CYP1A2 genetic polymorphisms, enzyme activity and the
genotype-phenotype relationship in Swedes and Koreans. Eur. J. Clin.
Pharmacol. 63(6):537-546.
Henna Neto J., Elkis H., 2007. Clinical aspects of super-refractory schizophrenia: a 6-
month cohort observational study. Rev. Bras. Psiquiatr. 29(3):228-232.
Jaquenoud Sirot E., Knezevic B., Morena G.P., Harenberg S., Oneda B., Crettol S.,
Ansermot N., Baumann P., Eap C.B., 2009. ABCB1 and cytochrome P450
polymorphisms: clinical pharmacogenetics of clozapine. J Clin Psychopharmacol.
29(4):319-26.
Kalow W, Tang BK., 1991. Use of caffeine metabolite ratios to explore CYP1A2 and
xanthine oxidase activities. Clin Pharmacol Ther. 50(5 Pt 1):508-19.
Kane JM, Honigfeld G, Singer J, Meltzer H., 1988. Clozapine in treatment-resistant
schizophrenics. Psychopharmacol Bull. 24(1):62-7.
Kohlrausch FB, Severino-Gama C, Lobato MI, Belmonte-de-Abreu P, Carracedo A,
Hutz MH., 2013. The CYP1A2 -163C>A polymorphism is associated with
clozapine-induced generalized tonic-clonic seizures in Brazilian schizophrenia
patients. Psychiatry Res. 30;209(2):242-5.
Nakajima M., Yokoi T., Mizutani M., Kinoshita M., Funayama M., Kamataki T., 1999.
Genetic polymorphism in the 5′-flanking region of human CYP1A2 gene: effect on
the CYP1A2 inducibility in humans. J. Biochem. 125:803–808.
Olsson E, Edman G, Bertilsson L, Hukic DS, Lavebratt C, Eriksson SV, Ösby U.,
2015. Genetic and Clinical Factors Affecting Plasma Clozapine Concentration.
Prim Care Companion CNS Disord. 19;17(1): 10.4088/PCC.14m01704.
Ozdemir V., Kalow W., Okey A.B., Lam M.S., Albers L.J., Reist C., Fourie J., Posner
P., Collins E.J., Roy R. 2001. Treatment-resistance to clozapine in association
with ultrarapid CYP1A2 activity and the C-->A polymorphism in intron 1 of the
![Page 54: UNIVERSIDADE FEDERAL DE GOIÁS INSTITUTO DE CIÊNCIAS ...€¦ · programa de pÓs-graduaÇÃo em ciÊncias biolÓgicas farmacogenÉtica em psiquiatria: influÊncia dos polimorfismos](https://reader033.fdocuments.in/reader033/viewer/2022042413/5f2db3abc003496c580b5cf0/html5/thumbnails/54.jpg)
37
CYP1A2 gene: effect of grapefruit juice and low-dose fluvoxamine. J Clin
Psychopharmacol. 21(6):603-7.
Romano F., Elkis H., 1996. Tradução e adaptação de um instrumento de avaliação
psicopatológica das psicoses: a Escala Breve de Avaliação Psiquiátrica-Versão
Ancorada (BPRS-A). J. Bras. Psiquiatr. 45(1):43-49.
Sachse C., Brockmöller J., Bauer S., Roots I., 1999. Functional significance of a C--
>A polymorphism in intron 1 of the cytochrome P450 CYP1A2 gene tested with
caffeine. Br. J. Clin. Pharmacol. 47(4):445-449.
Sharafi, M., 2005. Comparison of Classical and Clozapine Treatment on
Schizophrenia Using Positive and Negative Syndrome Scale of Schizophrenia
(PANSS) and SPECT Imaging. Int J Med Sci. 2(2):79-86.
Soyama A., Saito Y., Hanioka N., Maekawa K., Komamura K., Kamakura S. et al.,
2005. Single nucleotide polymorphisms and haplotypes of CYP1A2 in a
Japanese population. Drug. Metab. Pharmacokinet. 20(1):24-33.
Tantcheva-Poór I, Zaigler M, Rietbrock S, Fuhr U., 1999. Estimation of cytochrome
P-450 CYP1A2 activity in 863 healthy Caucasians using a saliva-based caffeine
test. Pharmacogenetics. 9(2):131-44.
Tsuda Y., Saruwatari J., Yasui-Furukori N., 2014. Meta-analysis: the effects of
smoking on the disposition of two commonly used antipsychotic agents,
olanzapine and clozapine. BMJ Open. 4;4(3).
van der Weide J., Steijns L.S., van Weelden M.J., 2003. The effect of smoking and
cytochrome P450 CYP1A2 genetic polymorphism on clozapine clearance and
dose requirement. Pharmacogenetics. 13(3):169-72.
Warnez S., Alessi-Severini S., 2014. Clozapine: a review of clinical practice
guidelines and prescribing trends. BMC Psychiatry. 14:102-
Yasar U, Babaoglu M.O., Balibey H., Cetin M., Lundgren S., Rane A., Bozkurt A.,
2007. Association of the cytochrome P450 1A2*1F polymorphism with clozapine
response in schizophrenic patients. The FASEB Journal. 21:392.6
Yu C-H, Ishii R, Yu S-C, Takeda M., 2014. Yokukansan and its ingredients as
possible treatment options for schizophrenia. Neuropsychiatric Disease and
Treatment. 10:1629-1634.
![Page 55: UNIVERSIDADE FEDERAL DE GOIÁS INSTITUTO DE CIÊNCIAS ...€¦ · programa de pÓs-graduaÇÃo em ciÊncias biolÓgicas farmacogenÉtica em psiquiatria: influÊncia dos polimorfismos](https://reader033.fdocuments.in/reader033/viewer/2022042413/5f2db3abc003496c580b5cf0/html5/thumbnails/55.jpg)
38
Table 1. Clinical and demographic characteristics of refractory and super-refractory groups. Data are presented as mean ± standard deviations (SD).
Refractory Super-Refractory
N 27 27
Age, yr (SD) 38.52 (8.41) 38.81 (11.04)
Age of onset, yr (SD) 21.86 (3.91) 22.60 (6.47)
Age of first hospitalization, yr (SD) 23.40 (6.09) 22.86 (3.91)
Male/Female ratio, N 21/6 14/13
Caucasian/American-African/Other ratio, N 7/2/18 8/1/18
Single/Married/Divorced ratio, N 25/1/1 25/1/1
Education, yr (SD) 10.8 (2.2) 11.2 (2.1)
Duration of disease, yr (SD) 9.2 (6.0) 9.9 (9.7)
Number of psychiatric hospitalizations, yr (SD) 5.0 (2.9) 13.4 (7.4)†
BPRS baseline (SD) 42.0 (16.7) 60.6 (14.0)###
BPRS at genotype testing (SD) 32.3 (14.7)* 47.7 (12.7)*; ###
Test used: T-test student for age, age of onset, age for first hospitalization, education, mean duration of disease, mean number of psychiatric hospitalizations, BPRS baseline and BPRS at genotype testing. Chi-square test was used for gender, race and marital status. Super-Refractory group had the highest scores of number of the psychiatric hospitalizations (†P=0.03) and of the BPRS (###P<0.001) than the refractory group. Both groups presented BPRS reduced in >20% after treatment (*P<0.05) (Mann-Whitney).
![Page 56: UNIVERSIDADE FEDERAL DE GOIÁS INSTITUTO DE CIÊNCIAS ...€¦ · programa de pÓs-graduaÇÃo em ciÊncias biolÓgicas farmacogenÉtica em psiquiatria: influÊncia dos polimorfismos](https://reader033.fdocuments.in/reader033/viewer/2022042413/5f2db3abc003496c580b5cf0/html5/thumbnails/56.jpg)
39
Table 2. Characteristics of the schizophrenia patients associated with the CYP1A2 *1F genotype. Data are presented as mean ± standard deviations (SD) and percentages [%].
*1A/*1A
(-163C/C)
*1A/*1F
(-163A/C)
*1F/*1F
(-163A/A) P
N [%] 7 [13] 18 [33.3] 29 [53.7]
Age, yr (SD) 39.1 (4) 38.6 (11.8) 38.6 (4) 0.827
Male/female ratio, N 5/2 12/6 18/11 0.856
Clozapine mg/day (SD) 500 (116.5) 558.3 (103.1) 572.4 (104.7) 0.659
Initial BMI (BMIi), Kg/m2 (SD) 23 (2.9) 25 (4.9) 27 (4.8) 0.582
Final BMI (BMIf), Kg/m2 (SD) 23 (2.2) 27 (4.9) 29 (4.9) 0.285
BMIf-BMIi, Kg/m2 (BMI change) 0 2 2 0.154
Caucasian/American-African/Other ratio, N 2/1/4 6/1/11 7/1/21 0.718
Time of use of treatment, yr 2.3 2.6 1.9 0.834
BPRS baseline (SD) 33.9 (8.4) 48.3 (16.2) 57.5(18.1)* 0.010
BPRS at genotype testing (SD) 23.7 (6.2) 37.8 (14.3) 45.3 (15.8)** 0.002
BPRS change (SD) -10.1 (2.7) -10.5(2.7) -12.1 (3.9) 0.152
Smokers, N [% to subgroup] 4 [57] 8 [44.4] 11 [38] 0.655
Coffee consumption, N [% to subgroup] 6 [85.7] 13 [72.2] 15 [51.7] 0.156
Refractory patients, N [%] 7 [26] 11 [40.7] 9 [33.3] 0.0002
Super-refractory patients, N [%] 0 [0] 7 [26] 20 [74]###
Test used: Analysis of variance and t-tests for age, mean duration of treatment and mean of Body Mass Index (BMI). Kruskal-Wallis was used for BPRS scores and clozapine dose. Chi-square test was used for gender, ethnicity and refractory/super-refractory patients. Logistic regression for smoking and coffee consumption.
![Page 57: UNIVERSIDADE FEDERAL DE GOIÁS INSTITUTO DE CIÊNCIAS ...€¦ · programa de pÓs-graduaÇÃo em ciÊncias biolÓgicas farmacogenÉtica em psiquiatria: influÊncia dos polimorfismos](https://reader033.fdocuments.in/reader033/viewer/2022042413/5f2db3abc003496c580b5cf0/html5/thumbnails/57.jpg)
40
Table 3 – Relation between clozapine dosage (mg/day), patient status (refractory or super-refractory) and genotype in smokers (S) and non-smokers patients (NS). Data are presented as the mean of clozapine dosage (SD; N).
CYP1A2 Genotype Refractory Super-Refractory
Smokers
*1A/*1A 550.0 (191.5; 4) -----
*1A/*1F 475.0 (91.7; 6) 600.0 (0; 2)
*1F/*1F 533.3 (115.5; 3) 512.5 (99.1; 8)
(*1A/*1A+*1A/*1F+*1F/*1F) 523.9 (110.6; 13) 530.0 (94.9; 10)
Non-smokers
*1A/*1A 533.3 (230.9; 3) -----
*1A/*1F 540.0 (89.4; 5) 640.0 (114.0; 5)
*1F/*1F 566.7 (51.6; 6) 625.0 (113.8; 12)
(*1A/*1A+*1A/*1F+*1F/*1F) 550.0 (109.2; 14) 629.4 (110.5; 17)
Test used: two-way ANOVA (clozapine dosage, refractoriness and genotype factors) followed by a post hoc analysis for multiple comparisons (Bonferroni test). No significance was observed (F=0.93; P= 0.43). SD= standard deviation; N= number of patients
Table 4 - Relation between clozapine dosage (mg/day), patient status (refractory or super-refractory) and genotype in caffeine consumers (C) and caffeine non-consumers patients (NC). Data are presented as mean of clozapine dosage (SD; N).
CYP1A2 Genotype Refractory Super-Refractory
Consumers
*1A/*1A 566.7 (196.6; 6) -----
*1A/*1F 494.4 (88.2; 9) 600.0 (0; 4)
*1F/*1F 580.0 (44.7; 5) 590.0 (137.0; 10)
(*1A/*1A+*1A/*1F+*1F/*1F) 537.5 (124.5; 20) 592.8 (114.1; 14)
Non-consumers
*1A/*1A 400.0 (0; 1) -----
*1A/*1F 600.0 (0; 2) 666.7 (152.7; 3)
*1F/*1F 525.0 (95.7; 4) 570.0 (105.9; 10)
(*1A/*1A+*1A/*1F+*1F/*1F) 528.6 (95.1; 7) 592.3 (118.7; 13)
Test used: two-way ANOVA (clozapine dosage, refractoriness and genotype factors) followed by a post hoc analysis for multiple comparisons (Bonferroni test). No significance was observed (F=1.37; P= 0.26). SD= standard deviation; N= number of patients.
![Page 58: UNIVERSIDADE FEDERAL DE GOIÁS INSTITUTO DE CIÊNCIAS ...€¦ · programa de pÓs-graduaÇÃo em ciÊncias biolÓgicas farmacogenÉtica em psiquiatria: influÊncia dos polimorfismos](https://reader033.fdocuments.in/reader033/viewer/2022042413/5f2db3abc003496c580b5cf0/html5/thumbnails/58.jpg)
41
4.2 ARTIGO DO ESTUDO NO TRANSTORNO DEPRESSIVO MAIOR
The Influence of CYP2C19*17 Polymorphism on the Remission of Major Depressive Disorder Symptoms with Escitalopram Treatment
Rodrigo Bernini de Brito, MD, MSc¹, Ayda Luz Malaver Salamanca, BSc¹, Rosana
Pereira Vianelo, PhD², Angela Adamski da Silva Reis, PhD¹, Raphaela de Castro
Georg, PhD¹, Rodrigo da Silva Santos, PhD¹, Aline Helena da Silva Cruz, PhD¹,
Paulo César Ghedini, PhD¹
Corresponding author: Paulo César Ghedini, Ph. D.
Department of Pharmacology,
Laboratory of Biochemistry and Molecular Pharmacology,
Institute of Biological Sciences, Federal University of Goiás,
Campus Samambaia, Sala 215, 74001-970,
Goiânia, GO, Brazil
Phone: 55 62 3521 1725, fax: 55 62 3521 1204
email:[email protected]
Running Title: CYP2C19*17 Influences Escitalopram Treatment
Conflicts of Interest and Source of Funding: The authors declare no conflict of
interest. This work was supported by grants from Fundação de Amparo à Pesquisa
do Estado de Goiás (FAPEG) and Conselho Nacional de Desenvolvimento Científico
e Tecnológico (CNPq).
INTRODUCTION
Major depressive disorder (MDD) is a mental disorder associated with an
elevated risk of suicide and with the onset, persistence, and severity of a wide range
of chronic physical disorders (1). Antidepressant medications remain a key mode of
treatment for moderate to severe MDD; however, 30–50% of patients do not respond
![Page 59: UNIVERSIDADE FEDERAL DE GOIÁS INSTITUTO DE CIÊNCIAS ...€¦ · programa de pÓs-graduaÇÃo em ciÊncias biolÓgicas farmacogenÉtica em psiquiatria: influÊncia dos polimorfismos](https://reader033.fdocuments.in/reader033/viewer/2022042413/5f2db3abc003496c580b5cf0/html5/thumbnails/59.jpg)
42
to antidepressant medication or experience significant drug side effects that result in
treatment discontinuation, non-adherence, and chronic illness (2).
The use of pharmacogenetic testing to prescribe antidepressant medication is
associated with a more effective improvement of symptoms, quicker responses to
antidepressant treatment, and an overall reduction in healthcare utilization costs (3).
Individual variability in the activity of drug-metabolizing enzymes is a major source of
the differences to drug exposure and, hence, a major contributor to variations in drug
responses (4). Therefore, potential biomarkers, as genetic polymorphisms of
cytochrome P450 (CYP) families, have been investigated as treatment response
predictors for a number of antidepressants (5).
Escitalopram (ESC) is one of the most commonly prescribed selective
serotonin reuptake inhibitors (SSRIs) used for the treatment of both depression and
anxiety disorders (6), which was demonstrated through an association between the
CYP2C19 genotype and steady state serum concentrations (7). Genetic variations in
the CYP2C19 gene may lead to changes in the metabolic activity of the CYP2C19
enzyme (increased or reduced function). CYP2C19*1 is the wild-type allele that
encodes a fully functional enzyme, whereas the majority of the CYP2C19 poor
metabolizers are carriers of the variant alleles *2 and *3, and the *17 variant is
associated with increased enzyme activity (8). In this way, the CYP2C19 genotype
has had an influence on ESC exposure; patients without allele CYP2C19*2 cleared
ESC faster than patients with the presence of these alleles (9), and the ESC serum
concentration was lower in subjects with CYP2C19*17 (10).
Considering that CYP2C19*2 and *17 polymorphisms are associated with
ESC plasma-level variations, we strove to determine if these polymorphisms would
influence the remission of depressive symptoms in a group of MDD patients receiving
ESC long-term.
MATERIAL AND METHODS
Patient Population
Patients for the CYP2C19 genotype testing included 31 caucasian subjects of
both genders, recruited from the Brain Institute in Goiânia, Goiás State, Brazil. These
subjects met the criteria for the remission of MDD for a period of at least twelve
months; they had received ESC long-term, and had no history of drop-out or non-
![Page 60: UNIVERSIDADE FEDERAL DE GOIÁS INSTITUTO DE CIÊNCIAS ...€¦ · programa de pÓs-graduaÇÃo em ciÊncias biolÓgicas farmacogenÉtica em psiquiatria: influÊncia dos polimorfismos](https://reader033.fdocuments.in/reader033/viewer/2022042413/5f2db3abc003496c580b5cf0/html5/thumbnails/60.jpg)
43
compliance to the depression treatment. Subjects were receiving ESC (10, 15, or 20
mg per day) alone or in combination with mirtazapine or bupropion (ESC
combination), in naturalistic conditions. The remission of depression symptoms was
assessed by measures of the Hamilton Depression Rating Scale (HDRS) (11);
remission was determined by a score ≤7. The data from each HDRS and the
patient’s weight, as recorded in his or her file, were collected and analysed. The
values at the baseline of the treatment with ESC were compared with those when
genotype testing was performed.
Patients were ineligible if they were pregnant or lactating women; if they were
younger than 18 years old; if they had received primary or comorbid diagnoses of
schizophrenia, schizoaffective disorder, bipolar disorder, dementia, or clinically
significant medical disorders; if they had received abnormal laboratory results at
screening; or if they had an alcohol or substance dependence, based on the
Diagnostic and Statistical Manual of Mental Disorders, Fourth Edition criteria, Text-
Revision (DSM-IV TR) criteria.
The subjects gave their consent to participate in the study and all procedures
were conducted using a standard methodology approved by the local Ethics in
Research Committee (Protocol CEP/UFG 204/2009).
DNA Genotyping for CYP2C19*2 and CYP2C19*17
DNA was extracted from the venous blood of each patient with a Purelink
Genomic DNA Mini Kit® (Invitrogen, San Diego, USA); the manufacturer’s
instructions were strictly followed. Genotyping was performed by using a polymerase
chain reaction (PCR), followed by a single primer extension. The PCR amplification
of CYP2C19*2 was performed with the 5´-CAACCAGAGCTTGGCATATTG-3’
forward primer and 5’-TAAAGTCCCGAGGGTTGTTG-3’ reverse primer. The PCR
amplification of CYP2C19*17 was performed according to Anichavezhi et al. (2012)
(12).
The PCR products of CYP2C19*2 and CYP2C19*17 were digested with
specific restriction endonucleases, SmaI and NsiI, respectively. The resulting DNA
fragments of PCR and PCR-RFLP were analyzed on ethidium bromide-stained
agarose (Table 1).
![Page 61: UNIVERSIDADE FEDERAL DE GOIÁS INSTITUTO DE CIÊNCIAS ...€¦ · programa de pÓs-graduaÇÃo em ciÊncias biolÓgicas farmacogenÉtica em psiquiatria: influÊncia dos polimorfismos](https://reader033.fdocuments.in/reader033/viewer/2022042413/5f2db3abc003496c580b5cf0/html5/thumbnails/61.jpg)
44
Statistical analysis
Tests for the Hardy-Weinberg equilibrium and linkage disequilibrium were
performed, using Arlequin version 3.5.1.2. Group comparisons were performed,
using X2 and Fisher´s exact test for categorical variables, the Kruskal Wallis and
Mann Whitney U tests for nonparametric continuous variables, and the T student test
or analysis of variance (ANOVA) for continuous data. A p-value of less than 0.05 was
considered statistically significant. Statistical analyses were performed, using the
SPSS software package (version 21.0; SPSS Inc., IL, US).
RESULTS
The study included 31 patients with MDD, receiving treatment with ESC alone
or in combination with other antidepressants. The mean (SD) age was 47 (13.9)
years, and most patients were women (22/9). The patients had been receiving ESC
for a mean of 3.3 (1.4) years; they had no or little alcohol use, were not smokers, and
did not use concomitant herbal medicines. At the baseline of the ESC treatment, the
HDRS scores were 23.6 (3.8) for all patients, and after remission of the symptoms,
both groups (ESC alone and ESC combination) presented a reduction in HDRS
scores (≤7) (P<0.001) (Table 2).
Among the 31 patients analyzed for both CYP2C19*2 and CYP2C19*17, 7
(22.6%) were heterozygous for *1/*2, 7 (22.6%) for *1/*17, and 3 (9.6%) were found
for *2/*17. Neither the homozygous *2/*2 nor the *17/*17 was found in this group. Of
these patients, 14 (45.1%) were homozygous wild-type (*1/*1). Both polymorphisms
were in the Hardy-Weinberg equilibrium (P=0.567 and P=0.568, respectively), and no
linkage disequilibrium was found (P = 0.84).
Based on the genotype frequencies observed, 7 (22.6%) subjects were
designated as heterozygous ultra-rapid metabolizers (UMs, *1/*17), 14
were CYP2C19 extensive metabolizers (EMs, *1/*1), and 10 were intermediate
metabolizers (IMs, *1/*2 or *2/*17). All of the patients using the ESC combination
were heterozygous ultra-rapid metabolizers (UMs, *1/*17) (Table 2). In addition, the
weight gain (increased BMI) was proportional to the ESC dosage (P<0.001) (Figure
1) and unrelated to genotype characteristic or drug combination.
![Page 62: UNIVERSIDADE FEDERAL DE GOIÁS INSTITUTO DE CIÊNCIAS ...€¦ · programa de pÓs-graduaÇÃo em ciÊncias biolÓgicas farmacogenÉtica em psiquiatria: influÊncia dos polimorfismos](https://reader033.fdocuments.in/reader033/viewer/2022042413/5f2db3abc003496c580b5cf0/html5/thumbnails/62.jpg)
45
DISCUSSION
In this study, we aimed to determine whether the CYP2C19 genotype
influences the ESC treatment response. We studied a group of patients who had
been receiving treatment with ESC for a long time, and whose symptoms had been in
remission for at least one year. Our aim was to evaluate subjects whose drug
treatment response was well established and whose genotype characteristic was
unknown.
According to genotype, we found the phenotype for three types of
metabolizers for CYP2C19: ultra-rapid, extensive, and intermediate metabolizers.
Based on this information, it was possible to observe that the MDD remission in the
ultra-rapid metabolizers group (*1/*17) was achieved with an ESC combination with
other drugs (mirtazapine or bupropion). The ultra-rapid CYP2C19 genotype has been
associated with lower serum concentrations of ESC, which might imply an increased
risk of therapeutic failure (10); the guidelines for pharmacogenetics-based
therapeutic dose recommendations suggest a dose increase to a maximum of 150%
in CYP2C19 UMs patients taking ESC (13). As the doses used in the UMs were not
different from other groups (EMs and IMs), it is possible to suggest that the
combination of drugs with ESC in the UMs was necessary for MDD remission, since
in the EMs and IMs groups, the monotherapy with ESC was sufficient for the
remission of symptoms. This is an important finding that can contribute to clarifying
the influence of the CYP2C19*17 polymorphism in the therapeutic response for ESC.
In addition to the CYP2C19 genotype, factors such as age and weight may
affect patient tolerance to ESC, as shown by a previous study (9). However, our data
provided no evidence that age and weight influenced the ESC combination, since
these variables were not different between the *1/*17, *1/*1, and *1/*2 groups. Our
results corroborate the observation that the *17 ultra-rapid allele seems to be the
factor responsible for the use of the ESC combination, achieving MDD remission in
UMs patients.
Another observation of this study was that weight gain was proportional to the
increase in the dosage of ESC, without any relation to genotype characteristic or
drug combination. It was reported that there was little weight increase during
treatment with ESC for 12 weeks of use (14). On the other hand, a significantly
![Page 63: UNIVERSIDADE FEDERAL DE GOIÁS INSTITUTO DE CIÊNCIAS ...€¦ · programa de pÓs-graduaÇÃo em ciÊncias biolÓgicas farmacogenÉtica em psiquiatria: influÊncia dos polimorfismos](https://reader033.fdocuments.in/reader033/viewer/2022042413/5f2db3abc003496c580b5cf0/html5/thumbnails/63.jpg)
46
increased body weight was observed in patients receiving ESC for a mean period of
approximately 12 months (15). Similar to that study, our results confirmed that ESC
causes significant weight gain and suggest that weight gain is related to the duration
of use of ESC.
The limitation of the present study was the small sample size. However, the
results obtained here are encouraging and contribute to better understanding the
influence of the CYP2C19 genotype on ESC treatment response. In particular, this
study helps us to clarify the influence of the CYP2C19*17 genotype on the
therapeutic efficacy of long-term ESC treatment.
Finally, these results challenge new researches to better understand the
influence of CYP2C19 polymorphisms on this issue, and they reinforce the
importance of pharmacogenetic testing prior to prescribing antidepressants, in order
to assist physicians in the selection of antidepressants and doses that are most
appropriate for each patient, thereby promoting quicker responses to MDD
treatments and, thus, an overall reduction in medication costs.
Author disclosure information The authors declare no conflict of interest.
Acknowledgement This work was supported by grants from Fundação de Amparo à Pesquisa do Estado
de Goiás (FAPEG) and Conselho Nacional de Desenvolvimento Científico e
Tecnológico (CNPq).
REFERENCES
(1) Kessler RC, Petukhova M, Sampson NA, et al. Twelve-month and lifetime prevalence and lifetime morbid risk of anxiety and mood disorders in the United States. Int J Methods Psychiatr Res 2012;21:169–184.
(2) Ng C, Sarris J, Singh A, et al. Pharmacogenetic polymorphisms and response to escitalopram and venlafaxine over 8 weeks in major depression. Hum Psychopharmacol 2013;28:516–522.
(3) Kennedy JL, Voudouris NC. Incorporating psychiatric pharmacogenetics into family practice. Pharmacogenomics 2013;14:1121–1124.
![Page 64: UNIVERSIDADE FEDERAL DE GOIÁS INSTITUTO DE CIÊNCIAS ...€¦ · programa de pÓs-graduaÇÃo em ciÊncias biolÓgicas farmacogenÉtica em psiquiatria: influÊncia dos polimorfismos](https://reader033.fdocuments.in/reader033/viewer/2022042413/5f2db3abc003496c580b5cf0/html5/thumbnails/64.jpg)
47
(4) Wilkinson GR. Drug metabolism and variability among patients in drug response. N Engl J Med 2005;352:2211–2221.
(5) Hodgson K, Tansey K, Dernovsek MZ, et al. Genetic differences in cytochrome P450 enzymes and antidepressant treatment response. J Psychopharmacol 2014;28:133–141.
(6) Maity N, Ghosal MK, Gupta A, et al. Clinical effectiveness and safety of escitalopram and desvenlafaxine in patients of depression with anxiety: a randomized, open-label controlled trial. Indian J Pharmacol 2014;46:433–437.
(7) Huezo-Diaz P, Perroud N, Spencer EP, et al. CYP2C19 genotype predicts steady state escitalopram concentration in GENDEP. J Psychopharmacol 2012;26:398–407.
(8) Spina E, de Leon J. Clinical applications of CYP genotyping in psychiatry. J Neural Transm 2015;122:5–28.
(9) Jin Y, Pollock BG, Frank E, et al. Effect of age, weight, and CYP2C19 genotype on escitalopram exposure. J Clin Pharmacol 2010;50:62–72.
(10) Rudberg I, Mohebi B, Hermann M, et al. Impact of the ultrarapid CYP2C19*17 allele on serum concentration of escitalopram in psychiatric patients. Clin Pharmacol Ther 2008;83:322–327.
(11) Hamilton M. A rating scale for depression. J Neurol Neurosurg Psychiatry 1960;23:56–62.
(12) Anichavezhi D, Chakradhara Rao US, Shewade DG, et al. Distribution of CYP2C19*17 allele and genotypes in an Indian population. J Clin Pharm Ther 2012;37:313–318.
(13) Swen JJ, van der Straaten T, Wessels JA, et al. Feasibility of pharmacy-initiated pharmacogenetic screening for CYP2D6 and CYP2C19. Eur J Clin Pharmacol 2012;68:363–370.
(14) Uher R, Mors O, Hauser J, et al. Changes in body weight during pharmacological treatment of depression. Int J Neuropsychopharmacol 2011;14:367–375.
(15) Uguz F, Sahingoz M, Gungor B, et al. Weight gain and associated factors in patients using newer antidepressant drugs. Gen Hosp Psychiatry 2015;37:46–48.
![Page 65: UNIVERSIDADE FEDERAL DE GOIÁS INSTITUTO DE CIÊNCIAS ...€¦ · programa de pÓs-graduaÇÃo em ciÊncias biolÓgicas farmacogenÉtica em psiquiatria: influÊncia dos polimorfismos](https://reader033.fdocuments.in/reader033/viewer/2022042413/5f2db3abc003496c580b5cf0/html5/thumbnails/65.jpg)
48
Figure Legend
Figure 1. Box plot chart comparing the changes in BMI (kg/m²; BMI at genotyping
test - BMI at ESC treatment baseline) and ESC doses (10, 15 or 20 mg). A) BMI
change in patients receiving ESC without combination. B) BMI change in patients
receiving ESC with and without combination.
n represents the number of subjects receiving the ESC dose. **P < 0.01 and ***P <
0.001 by one-way ANOVA with post hoc Tukey's test.
![Page 66: UNIVERSIDADE FEDERAL DE GOIÁS INSTITUTO DE CIÊNCIAS ...€¦ · programa de pÓs-graduaÇÃo em ciÊncias biolÓgicas farmacogenÉtica em psiquiatria: influÊncia dos polimorfismos](https://reader033.fdocuments.in/reader033/viewer/2022042413/5f2db3abc003496c580b5cf0/html5/thumbnails/66.jpg)
49
Table1. Details of product PCR size for CYP2C19*2 and CYP2C19*17 PCR and RFLP
characteristics
Allele Product
PCR Size (bp)
Enzyme wild type (size bp)
Heterozygous (size bp)
homozygous mutant (size bp)
2C19*2 223 SmaI 113-110 223-113-110 223
2C19*17 470 --- --- --- ---
Nested 143 NsiI 166 -27 143-116-27 143
![Page 67: UNIVERSIDADE FEDERAL DE GOIÁS INSTITUTO DE CIÊNCIAS ...€¦ · programa de pÓs-graduaÇÃo em ciÊncias biolÓgicas farmacogenÉtica em psiquiatria: influÊncia dos polimorfismos](https://reader033.fdocuments.in/reader033/viewer/2022042413/5f2db3abc003496c580b5cf0/html5/thumbnails/67.jpg)
50
Table 2. Clinical characteristics for the genotype groups
*1/*1 *1/*2 *1/*17 *2/*17 p-value
No of subjects (n) 14 7 7 3
Male/Female (n) 4 /10 2 / 5 3 / 4 0 / 3 0.650
Age (years), mean ± SD 47.3 ± 14.4a,b 48.7 ± 4.7a,b 36.0 ± 11.6b 66.8 ± 6.4a 0.020*
Dosage mg/day (SD) 15.7 ± 3.8 15.7 ± 3.4 17.1 ± 2.7 11.7 ± 2.9 0.203
BMIi at baseline, mean ± SD 24.0 ± 2.8 25.5 ± 5.6 23.3 ± 4.5 26.9 ±1.7 0.492
BMIf at genotype testing, mean± SD
24.9 ± 3.3 27.3 ± 6.4 25.5 ± 5.2 26.2 ± 0.7 0.717
BMIf-BMIi, Kg/m2 (BMI change-SD)
0.8 ± 1.3a,b 1.7 ± 1.7a,b 2.2 ± 1.6b - 0.7 ± 1.7a 0.039*
HDRS at genotype testing ≤ 7 ≤ 7 ≤ 7 ≤ 7 1.00
Time receiving ESC (years), mean± SD
3.3 ± 1.5 3.3 ± 1.6 3.6 ± 1.3 2.8 ± 1.2 0.822
ESC combination (n) 0 0 6a 0 0.001†
*ANOVA with Bonferroni adjustment, †Fisher´s exact test 4x2.
BMI = body mass index
![Page 68: UNIVERSIDADE FEDERAL DE GOIÁS INSTITUTO DE CIÊNCIAS ...€¦ · programa de pÓs-graduaÇÃo em ciÊncias biolÓgicas farmacogenÉtica em psiquiatria: influÊncia dos polimorfismos](https://reader033.fdocuments.in/reader033/viewer/2022042413/5f2db3abc003496c580b5cf0/html5/thumbnails/68.jpg)
51
Figure 1
-2
-1
0
1
2
3
4
5
10 n= 6
15 n= 11
20 n= 8
***
**
***
BM
I cha
nge
(Kg/
m2 )
-2
-1
0
1
2
3
4
5
10n= 6
15n= 15
20n= 10
***
***
***
A B
![Page 69: UNIVERSIDADE FEDERAL DE GOIÁS INSTITUTO DE CIÊNCIAS ...€¦ · programa de pÓs-graduaÇÃo em ciÊncias biolÓgicas farmacogenÉtica em psiquiatria: influÊncia dos polimorfismos](https://reader033.fdocuments.in/reader033/viewer/2022042413/5f2db3abc003496c580b5cf0/html5/thumbnails/69.jpg)
CONCLUSÕES
![Page 70: UNIVERSIDADE FEDERAL DE GOIÁS INSTITUTO DE CIÊNCIAS ...€¦ · programa de pÓs-graduaÇÃo em ciÊncias biolÓgicas farmacogenÉtica em psiquiatria: influÊncia dos polimorfismos](https://reader033.fdocuments.in/reader033/viewer/2022042413/5f2db3abc003496c580b5cf0/html5/thumbnails/70.jpg)
53
Os resultados obtidos no presente trabalho demonstraram que pacientes com
esquizofrenia, tratados com clozapina, e pacientes com transtorno depressivo maior,
tratados com escitalopram, apresentaram relação significativa entre a refratariedade
ao tratamento e os polimorfismos CYP1A2*1F e CYP2C19*17, respectivamente. As
principais observações podem assim serem definidas:
! Nos pacientes com esquizofrenia, o alelo CYP1A2*1F apresentou associação
com a resposta diminuída ao tratamento com clozapina, maior gravidade dos
sintomas psicopatológicos e maior número de internações hospitalares. Não foi
encontrada associação entre o alelo mutante com fumantes ou com consumidores
de café na resposta ao tratamento com clozapina.
Os dados sugerem que este polimorfismo possui relação direta e significativa
com a super refratariedade ao tratamento e, portanto, sua identificação pode ser útil
para auxiliar a conduta médica no tratamento de pacientes portadores de
esquizofrenia refratária e super-refratária.
! No transtorno depressivo maior, os metabolizadores ultra-rápidos, portadores
do alelo CYP2C19*17, não apresentaram remissão dos sintomas na monoterapia
com o escitalopram, sendo necessária a associação com outros antidepressivos
para atingi-lá. Por outro lado, não foi encontrada associação entre o alelo mutante
CYP2C19*2 e a resposta ao tratamento com escitalopram.
Estes dados sugerem que o polimorfismo CYP2C19*1/*17 tem relação
significativa com a eficácia terapêutica do escitalopram e sua identificação poderá
guiar na instituição de doses quando da prescrição deste medicamento.
Finalmente, o conjunto desses resultados demonstra a importância que os
testes farmacogenéticos podem apresentar na psiquiatria como ferramenta para a
medicina personalizada, corroborando e desafiando para que esta ciência continue a
evoluir, reduzindo os gastos públicos e privados em saúde e proporcionando melhor
qualidade de vida às pessoas. A psiquiatria está entre as especialidades a se
beneficiar significativamente pela farmacogenômica, de modo que é importante que
os psiquiatras se mantenham a par dos avanços dessa nova área da medicina do
século XXI.
![Page 71: UNIVERSIDADE FEDERAL DE GOIÁS INSTITUTO DE CIÊNCIAS ...€¦ · programa de pÓs-graduaÇÃo em ciÊncias biolÓgicas farmacogenÉtica em psiquiatria: influÊncia dos polimorfismos](https://reader033.fdocuments.in/reader033/viewer/2022042413/5f2db3abc003496c580b5cf0/html5/thumbnails/71.jpg)
REFERÊNCIAS BIBLIOGRÁFICAS
![Page 72: UNIVERSIDADE FEDERAL DE GOIÁS INSTITUTO DE CIÊNCIAS ...€¦ · programa de pÓs-graduaÇÃo em ciÊncias biolÓgicas farmacogenÉtica em psiquiatria: influÊncia dos polimorfismos](https://reader033.fdocuments.in/reader033/viewer/2022042413/5f2db3abc003496c580b5cf0/html5/thumbnails/72.jpg)
55
[1] Cordeiro Q, Shavitt RG, Cappi C, Sampaio AS, Morais IA, Hounie AG, Rosário MC, Nishioka SA, Miguel EC. Farmacogenômica e psiquiatria. Rev Fac Cienc Med Sorocaba. 2009;11(1):4-10. [2] Evans WE, Relling MV. Pharmacogenomics: translating functional genomics into rational therapeutics. Science. 1999 Oct 15;286(5439):487-91. [3] Griffiths AJF, Miller JH, Suzuki DT, Lewontin RC, Gelbart WM. Introdução à Genética. 7a. ed. Rio de Janeiro: Guanabara Koogan; 2002. [4] Chowbay B, Zhou S, Lee EJ. An interethnic comparison of polymorphisms of the genes encoding drug-metabolizing enzymes and drug transporters: experience in Singapore. Drug Metab Rev. 2005;37(2):327-78. [5] Weinshilboum R. Inheritance and drug response. N Engl J Med. 2003 Feb 6;348(6):529-37. [6] Thorisson GA, Stein LD. The SNP Consortium website: past, present and future. Nucleic Acids Res. 2003 Jan 1;31(1):124-7. [7] Ingelman-Sundberg M. Pharmacogenetics: an opportunity for a safer and more efficient pharmacotherapy. J Intern Med. 2001 Sep;250(3):186-200. [8] Michelon L, Cordeiro Q, Vallada H. Genética em psicofarmacologia. In: Oliveira IR, Sena EP, editores. Manual de psicofarmacologia clínica. Rio de Janeiro: Guanabara-Koogan; 2006. p110-17. [9] Miranda DM, Correa H, De Marco L, Romano-Silva MA. Psicofarmacogenética. 2006;39(4): 570-76. [10] O'Reilly RL, Bogue L, Singh SM. Pharmacogenetic response to antidepressants in a multicase family with affective disorder. Biol Psychiatry. 1994 Oct 1;36(7):467-71. [11] Kohlrausch FB. Estudos farmacogenéticos da resposta ao tratamento com antipsicóticos em esquizofrênicos. Tese [doutorado em Genética e Biologia Molecular] – UFRGS; 2008. [12] Winner J, Allen JD, Altar CA, Spahic-Mihajlovic A. Psychiatric pharmacogenomics predicts health resource utilization of outpatients with anxiety and depression. Transl Psychiatry. 2013 Mar 19;3:e242. [13] Kennedy JL, Voudouris NC. Incorporating psychiatric pharmacogenetics into family practice. Pharmacogenomics. 2013 Jul;14(10):1121-4. [14] van Os J, Kapur S. Schizophrenia. Lancet. 2009 Aug 22;374(9690):635-45. doi: 10.1016/S0140-6736(09)60995-8.
[15] McGrath J, Saha S, Chant D, Welham J. Schizophrenia: a concise overview of incidence, prevalence, and mortality. Epidemiol Rev, 2008;30:67-76.
![Page 73: UNIVERSIDADE FEDERAL DE GOIÁS INSTITUTO DE CIÊNCIAS ...€¦ · programa de pÓs-graduaÇÃo em ciÊncias biolÓgicas farmacogenÉtica em psiquiatria: influÊncia dos polimorfismos](https://reader033.fdocuments.in/reader033/viewer/2022042413/5f2db3abc003496c580b5cf0/html5/thumbnails/73.jpg)
56
[16] Maric NP, Svrakic DM. Why schizophrenia genetics needs epigenetics: a review. Psychiatr Danub, 2012 Mar;24(1):2-18.
[17] Kapur S, Mamo D. Half a century of antipsychotics and still a central role for dopamine D2 receptors. Prog Neuropsychopharmacol Biol Psychiatry, 2003 Oct;27(7):1081-90.
[18] Miyamoto S, Duncan GE, Marx CE, Lieberman JA. Treatments for schizophrenia: a critical review of pharmacology and mechanisms of action of antipsychotic drugs. Mol Psychiatry, 2005 Jan;10(1):79-104.
[19] Lieberman JA, Stroup TS, McEvoy JP, Swartz MS, Rosenheck RA, Perkins DO, Keefe RS, Davis SM, Davis CE, Lebowitz BD, Severe J, Hsiao JK; Clinical Antipsychotic Trials of Intervention Effectiveness (CATIE) Investigators. Effectiveness of antipsychotic drugs in patients with chronic schizophrenia. N Engl J Med. 2005 Sep 22;353(12):1209-23.
[20] Kahn RS, Fleischhacker WW, Boter H, Davidson M, Vergouwe Y, Keet IP, Gheorghe MD, Rybakowski JK, Galderisi S, Libiger J, Hummer M, Dollfus S, López-Ibor JJ, Hranov LG, Gaebel W, Peuskens J, Lindefors N, Riecher-Rössler A, Grobbee DE; EUFEST study group. Effectiveness of antipsychotic drugs in first-episode schizophrenia and schizophreniform disorder: an open randomised clinical trial. Lancet. 2008 Mar 29;371(9618):1085-97.
[21] Bauer M, Whybrow PC, Angst J, Versiani M, Möller HJ. World Federation of Societies of Biological Psychiatry (WFSBP) Guidelines for Biological Treatment of Unipolar Depressive Disorders, Part 1: Acute and continuation treatment of major depressive disorder. World J Biol Psychiatry, 2002 Jan;3(1):5-43.
[22] Kirchheiner J, Nickchen K, Bauer M, Wong ML, Licinio J, Roots I, Brockmöller J. Pharmacogenetics of antidepressants and antipsychotics: the contribution of allelic variations to the phenotype of drug response. Mol Psychiatry. 2004 May;9(5):442-73.
[23] Bauer M, Pfennig A, Severus E, Whybrow PC, Angst J, Möller HJ. World Federation of Societies of Biological Psychiatry (WFSBP) guidelines for biological treatment of unipolar depressive disorders, part 1: update 2013 on the acute and continuation treatment of unipolar depressive disorders. World J Biol Psychiatry, 2013 Jul;14(5):334-85.
[24] Lieberman JA, Kane JM, Johns CA. Clozapine: guidelines for clinical management. J Clin Psychiatry, 1989 Sep;50(9):329-38.
[25] National Institute for Health and Clinical Excellence. Schizophrenia: core interventions in the treatment and management of schizophrenia in adults in primary and secondary care [Internet] London: NICE; Mar, 2009(NICE clinical guideline 82). [26] Mortimer AM, Singh P, Shepherd CJ, Puthiryackal J. Clozapine for treatment-resistant schizophrenia: National Institute of Clinical Excellence (NICE) guidance in the real world. Clin Schizophr Relat Psychoses, 2010 Apr;4(1):49-55.
[27] Taylor D, Paton C, Kapur S. Prescribing guidelines in psychiatry. 11th edn. Chichester: Wiley-Blackwell; 2012a. The South London and Maudsley NHS Foundation Trust and Oxleas NHS Foundation Trust.
![Page 74: UNIVERSIDADE FEDERAL DE GOIÁS INSTITUTO DE CIÊNCIAS ...€¦ · programa de pÓs-graduaÇÃo em ciÊncias biolÓgicas farmacogenÉtica em psiquiatria: influÊncia dos polimorfismos](https://reader033.fdocuments.in/reader033/viewer/2022042413/5f2db3abc003496c580b5cf0/html5/thumbnails/74.jpg)
57
[28] Kuipers E, Yesufu-Udechuku A, Taylor C, Kendall T. Management of psychosis and schizophrenia in adults: summary of updated NICE guidance. BMJ, 2014 Feb 12;348:g1173.
[29] Kennedy JL, Altar CA, Taylor DL, Degtiar I, Hornberger JC. The social and economic burden of treatment-resistant schizophrenia: a systematic literature review. Int Clin Psychopharmacol, 2014 Mar;29(2):63-76.
[30] Taylor DM, Duncan-McConnell D. Refractory schizophrenia and atypical antipsychotics. J Psychopharmacol, 2000;14(4):409-18.
[31] Chakos M, Lieberman J, Hoffman E, Bradford D, Sheitman B. Effectiveness of second-generation antipsychotics in patients with treatment-resistant schizophrenia: a review and meta-analysis of randomized trials. Am J Psychiatry, 2001 Apr;158(4):518-26.
[32] Taylor DM, Smith L, Gee SH, Nielsen J. Augmentation of clozapine with a second antipsychotic - a meta-analysis. Acta Psychiatr Scand, 2012b Jan;125(1):15-24.
[33] Buckley PF, Dayem M, Parker G, Weisser L. Schizophrenia today: what do we know-and how sure are we? J Psychiatr Pract, 2001 Jul;7(4):244-6.
[34] Barnes TR, McEvedy CJ, Nelson HE. Management of treatment resistant schizophrenia unresponsive to clozapine. Br J Psychiatry Suppl, 1996 Dec;(31):31-40.
[35] Williams L, Newton G, Roberts K, Finlayson S, Brabbins C. Clozapine-resistant schizophrenia: a positive approach. Br J Psychiatry, 2002 Sep;181:184-7.
[36] Henna Neto J, Elkis H. Clinical aspects of super-refractory schizophrenia: a 6-month cohort observational study. Rev Bras Psiquiatr, 2007 Sep;29(3):228-32.
[37] Linnet K, Olesen OV. Metabolism of clozapine by cDNA-expressed human cytochrome P450 enzymes. Drug Metab Dispos, 1997 Dec;25(12):1379-82.
[38] Rasmussen BB, Brix TH, Kyvik KO, Brøsen K. The interindividual differences in the 3-demthylation of caffeine alias CYP1A2 is determined by both genetic and environmental factors. Pharmacogenetics. 2002 Aug;12(6):473-8.
[39] Bertilsson L, Carrillo JA, Dahl ML, Llerena A, Alm C, Bondesson U, Lindström L, Rodriguez de la Rubia I, Ramos S, Benitez J. Clozapine disposition covaries with CYP1A2 activity determined by a caffeine test. Br J Clin Pharmacol. 1994 Nov;38(5):471-3.
[40] Callaghan JT, Bergstrom RF, Ptak LR, Beasley CM. Olanzapine. Pharmacokinetic and pharmacodynamic profile. Clin Pharmacokinet. 1999 Sep;37(3):177-93.
[41] Spigset O, Hägg S, Söderström E, Dahlqvist R. Lack of correlation between fluvoxamine clearance and CYP1A2 activity as measured by systemic caffeine clearance. Eur J Clin Pharmacol, 1999 Feb;54(12):943-6.
![Page 75: UNIVERSIDADE FEDERAL DE GOIÁS INSTITUTO DE CIÊNCIAS ...€¦ · programa de pÓs-graduaÇÃo em ciÊncias biolÓgicas farmacogenÉtica em psiquiatria: influÊncia dos polimorfismos](https://reader033.fdocuments.in/reader033/viewer/2022042413/5f2db3abc003496c580b5cf0/html5/thumbnails/75.jpg)
58
[42] Carrillo JA, Christensen M, Ramos SI, Alm C, Dahl ML, Benitez J, Bertilsson L. Evaluation of caffeine as an in vivo probe for CYP1A2 using measurements in plasma, saliva, and urine. Ther Drug Monit. 2000 Aug;22(4):409-17.
[43] Otani K, Aoshima T. Pharmacogenetics of classical and new antipsychotic drugs. Ther Drug Monit, 2000 Feb;22(1):118-21. [44] Gonzalez JM, ThoMLson PM, Moore TA. Review of the safety, efficacy, and side effect profile of asenapine in the treatment of bipolar 1 disorder. Patient Prefer Adherence, 2011;5:333-41.
[45] Ghotbi R, Christensen M, Roh HK, Ingelman-Sundberg M, Aklillu E, Bertilsson L. Comparisons of CYP1A2 genetic polymorphisms, enzyme activity and the genotype-phenotype relationship in Swedes and Koreans. Eur J Clin Pharmacol, 2007 Jun;63(6):537-46.
[46] Relling MV, Lin JS, Ayers GD, Evans WE. Racial and gender differences in N-acetyltransferase, xanthine oxidase, and CYP1A2 activities. Clin Pharmacol Ther, 1992 Dec;52(6):643-58.
[47] Bartoli A, Xiaodong S, Gatti G, Cipolla G, Marchiselli R, Perucca E. The influence of ethnic factors and gender on CYP1A2-mediated drug disposition: a comparative study in Caucasian and Chinese subjects using phenacetin as a marker substrate. Ther Drug Monit, 1996 Oct;18(5):586-91.
[48] Chang WH, Lin SK, Lane HY, Hu WH, Jann MW, Lin HN. Clozapine dosages and plasma drug concentrations. J Formos Med Assoc, 1997 Aug;96(8):599-605.
[49] Aklillu E, Carrillo JA, Makonnen E, Hellman K, Pitarque M, Bertilsson L, Ingelman-Sundberg M. Genetic polymorphism of CYP1A2 in Ethiopians affecting induction and expression: characterization of novel haplotypes with single-nucleotide polymorphisms in intron 1. Mol Pharmacol. 2003 Sep;64(3):659-69.
[50] Nakajima M, Yokoi T, Mizutani M, Kinoshita M, Funayama M, Kamataki T. Genetic polymorphism in the 5'-flanking region of human CYP1A2 gene: effect on the CYP1A2 inducibility in humans. J Biochem, 1999 Apr;125(4):803-8.
[51] Chida M, Yokoi T, Fukui T, Kinoshita M, Yokota J, Kamataki T. Detection of three genetic polymorphisms in the 5'-flanking region and intron 1 of human CYP1A2 in the Japanese population. Jpn J Cancer Res, 1999 Sep;90(9):899-902.
[52] Soyama A, Saito Y, Hanioka N, Maekawa K, Komamura K, Kamakura S, Kitakaze M, Tomoike H, Ueno K, Goto Y, Kimura H, Katoh M, Sugai K, Saitoh O, Kawai M, Ohnuma T, Ohtsuki T, Suzuki C, Minami N, Kamatani N, Ozawa S, Sawada J. Single nucleotide polymorphisms and haplotypes of CYP1A2 in a Japanese population. Drug Metab Pharmacokinet. 2005 Feb;20(1):24-33.
[53] Skarke C, Kirchhof A, Geisslinger G, Lötsch J. Rapid genotyping for relevant CYP1A2 alleles by pyrosequencing. Eur J Clin Pharmacol, 2005 Dec;61(12):887-92.
[54] Czerwensky F, Leucht S, Steimer W. CYP1A2*1D and *1F polymorphisms have a significant impact on olanzapine serum concentrations. Ther Drug Monit. 2015 Apr;37(2):152-60.
![Page 76: UNIVERSIDADE FEDERAL DE GOIÁS INSTITUTO DE CIÊNCIAS ...€¦ · programa de pÓs-graduaÇÃo em ciÊncias biolÓgicas farmacogenÉtica em psiquiatria: influÊncia dos polimorfismos](https://reader033.fdocuments.in/reader033/viewer/2022042413/5f2db3abc003496c580b5cf0/html5/thumbnails/76.jpg)
59
[55] Sachse C, Brockmöller J, Bauer S, Roots I. Functional significance of a C-->A polymorphism in intron 1 of the cytochrome P450 CYP1A2 gene tested with caffeine. Br J Clin Pharmacol, 1999 Apr;47(4):445-9.
[56] Ozdemir V, Kalow W, Okey AB, Lam MS, Albers LJ, Reist C, Fourie J, Posner P, Collins EJ, Roy R. Treatment-resistance to clozapine in association with ultrarapid CYP1A2 activity and the C-->A polymorphism in intron 1 of the CYP1A2 gene: effect of grapefruit juice and low-dose fluvoxamine. J Clin Psychopharmacol. 2001a Dec;21(6):603-7.
[57] Eap CB, Bender S, Jaquenoud Sirot E, Cucchia G, Jonzier-Perey M, Baumann P, Allorge D, Broly F. Nonresponse to clozapine and ultrarapid CYP1A2 activity: clinical data and analysis of CYP1A2 gene. J Clin Psychopharmacol. 2004 Apr;24(2):214-9.
[58] Laika B, Leucht S, Heres S, Schneider H, Steimer W. Pharmacogenetics and olanzapine treatment: CYP1A2*1F and serotonergic polymorphisms influence therapeutic outcome. Pharmacogenomics J, 2010 Feb;10(1):20-9.
[59] Basile VS, Ozdemir V, Masellis M, Walker ML, Meltzer HY, Lieberman JA, Potkin SG, Alva G, Kalow W, Macciardi FM, Kennedy JL. A functional polymorphism of the cytochrome P450 1A2 (CYP1A2) gene: association with tardive dyskinesia in schizophrenia. Mol Psychiatry. 2000 Jul;5(4):410-7.
[60] Fu Y1, Fan CH, Deng HH, Hu SH, Lv DP, Li LH, Wang JJ, Lu XQ. Association of CYP2D6 and CYP1A2 gene polymorphism with tardive dyskinesia in Chinese schizophrenic patients. Acta Pharmacol Sin. 2006 Mar;27(3):328-32.
[61] Ivanova SA, Toshchakova VA, Filipenko ML, Fedorenko OY, Boyarko EG, Boiko AS, Semke AV, Bokhan NA, Aftanas LI, Loonen AJ. Cytochrome P450 1A2 co-determines neuroleptic load and may diminish tardive dyskinesia by increased inducibility. World J Biol Psychiatry. 2015 Apr;16(3):200-5.
[62] Kohlrausch FB, Severino-Gama C, Lobato MI, Belmonte-de-Abreu P, Carracedo A, Hutz MH. The CYP1A2 -163C>A polymorphism is associated with clozapine-induced generalized tonic-clonic seizures in Brazilian schizophrenia patients. Psychiatry Res, 2013 Sep 30;209(2):242-5.
[63] Alves TM, Elkis H. The psychopathology of treatment resistant schizophrenia: a factor analysis using the BPRS-A. Schizophr Res, 2003;60(2-3):10.
[64] Jann MW, Grimsley SR, Gray EC, Chang WH. Pharmacokinetics and pharmacodynamics of clozapine. Clin Pharmacokinet, 1993 Feb;24(2):161-76.
[65] Byerly MJ, DeVane CL. Pharmacokinetics of clozapine and risperidone: a review of recent literature. J Clin Psychopharmacol, 1996 Apr;16(2):177-87.
[66] Olesen OV, Linnet K. Contributions of five human cytochrome P450 isoforms to the N-demethylation of clozapine in vitro at low and high concentrations. J Clin Pharmacol, 2001 Aug;41(8):823-32. [67] Tugnait M, Hawes EM, McKay G, Eichelbaum M, Midha KK. Characterization of the human hepatic cytochromes P450 involved in the in vitro oxidation of clozapine. Chem Biol Interact, 1999 Apr 1;118(2):171-89.
![Page 77: UNIVERSIDADE FEDERAL DE GOIÁS INSTITUTO DE CIÊNCIAS ...€¦ · programa de pÓs-graduaÇÃo em ciÊncias biolÓgicas farmacogenÉtica em psiquiatria: influÊncia dos polimorfismos](https://reader033.fdocuments.in/reader033/viewer/2022042413/5f2db3abc003496c580b5cf0/html5/thumbnails/77.jpg)
60
[68] Doude van Troostwijk LJ, Koopmans RP, Vermeulen HD, Guchelaar HJ. CYP1A2 activity is an important determinant of clozapine dosage in schizophrenic patients. Eur J Pharm Sci. 2003 Dec;20(4-5):451-7.
[69] Ozdemir V, Kalow W, Posner P, Collins EJ, Kennedy JL, Tang BK, Albers LJ, Reist C, Roy R, Walkes W, Afra P. CYP1A2 activity as measured by a caffeine test predicts clozapine and active metabolite steady-state concentrationin patients with schizophrenia. J Clin Psychopharmacol. 2001b Aug;21(4):398-407.
[70] Lu ML, Lane HY, Chen KP, Jann MW, Su MH, Chang WH. Fluvoxamine reduces the clozapine dosage needed in refractory schizophrenic patients. J Clin Psychiatry. 2000 Aug;61(8):594-9. [71] Aitchison KJ, Jann MW, Zhao JH, Sakai T, Zaher H, Wolff K, Collier DA, Kerwin RW, Gonzalez FJ. Clozapine pharmacokinetics and pharmacodynamics studied with Cyp1A2-null mice. J Psychopharmacol. 2000;14(4):353-9.
[72] Mrazek DA. Psychiatric pharmacogenomic testing in clinical practice. Dialogues Clin Neurosci. 2010;12(1):69-76. [73] Melkersson KI, Scordo MG, Gunes A, Dahl ML. Impact of CYP1A2 and CYP2D6 polymorphisms on drug metabolism and on insulin and lipid elevations and insulin resistance in clozapine-treated patients. J Clin Psychiatry, 2007 May;68(5):697-704.
[74] Conley RR, Kelly DL. Management of treatment resistance in schizophrenia. Biol Psychiatry, 2001 Dec 1;50(11):898-911.
[75] McGlashan TH. A selective review of recent North American long-term followup studies of schizophrenia. Schizophr Bull, 1988;14(4):515-42.
[76] Terkelsen KG, Menikoff A. Measuring the costs of schizophrenia. Implications for the post-institutional era in the US. Pharmacoeconomics, 1995 Sep;8(3):199-222.
[77] Geller JL. A report on the "worst" state hospital recidivists in the U.S. Hosp Community Psychiatry, 1992 Sep;43(9):904-8.
[78] Arranz MJ, de Leon J. Pharmacogenetics and pharmacogenomics of schizophrenia: a review of last decade of research. Mol Psychiatry, 2007 Aug;12(8):707-47.
[79] Fleeman N, Dundar Y, Dickson R, Jorgensen A, Pushpakom S, McLeod C, Pirmohamed M, Walley T. Cytochrome P450 testing for prescribing antipsychotics in adults with schizophrenia: systematic review and meta-analyses. Pharmacogenomics J. 2011 Feb;11(1):1-14. d
[80] Bolla E, Bortolaso P, Ferrari M, Poloni N, Callegari C, Marino F, Lecchini S, Vender S, Cosentino M. Are CYP1A2*1F and *1C associated with clozapine tolerability?: a preliminary investigation. Psychiatry Res. 2011 Oct 30;189(3):483.
[81] Meyer UA. Pharmacogenetics and adverse drug reactions. Lancet, 2000 Nov 11;356(9242):1667-71.
[82] Alonso J, Angermeyer MC, Bernert S, Bruffaerts R, Brugha TS, Bryson H, de Girolamo G, Graaf R, Demyttenaere K, Gasquet I, Haro JM, Katz SJ, Kessler RC,
![Page 78: UNIVERSIDADE FEDERAL DE GOIÁS INSTITUTO DE CIÊNCIAS ...€¦ · programa de pÓs-graduaÇÃo em ciÊncias biolÓgicas farmacogenÉtica em psiquiatria: influÊncia dos polimorfismos](https://reader033.fdocuments.in/reader033/viewer/2022042413/5f2db3abc003496c580b5cf0/html5/thumbnails/78.jpg)
61
Kovess V, Lépine JP, Ormel J, Polidori G, Russo LJ, Vilagut G, Almansa J, Arbabzadeh-Bouchez S, Autonell J, Bernal M, Buist-Bouwman MA, Codony M, Domingo-Salvany A, Ferrer M, Joo SS, Martínez-Alonso M, Matschinger H, Mazzi F, Morgan Z, Morosini P, Palacín C, Romera B, Taub N, Vollebergh WA; ESEMeD/MHEDEA 2000 Investigators, European Study of the Epidemiology of Mental Disorders (ESEMeD) Project. Prevalence of mental disorders in Europe: results from the European Study of the Epidemiology of Mental Disorders (ESEMeD) project. Acta Psychiatr Scand Suppl. 2004;(420):21-7.
[83] Guze SB, Robins E. Suicide and primary affective disorders. Br J Psychiatry. 1970 Oct;117(539):437-8.
[84] Chisholm D, Sanderson K, Ayuso-Mateos JL, Saxena S. Reducing the global burden of depression: population-level analysis of intervention cost-effectiveness in 14 world regions. Br J Psychiatry. 2004 May;184:393-403.
[85] Buist-Bouwman MA, De Graaf R, Vollebergh WA, Alonso J, Bruffaerts R, Ormel J; ESEMeD/MHEDEA 2000 Investigators. Functional disability of mental disorders and comparison with physical disorders: a study among the general population of six European countries. Acta Psychiatr Scand. 2006 Jun;113(6):492-500.
[86] American Psychiatric Association. Diagnostic and statistical manual of mental disorders: DSM-IV [Internet]. 4th ed. Washington (DC): American Psychiatric Association; 1994 [cited 2010 Mar 8]. 866 p. Available from: http://www.psychiatryonline.com/DSMPDF/dsm-iv.pdf
[87] Trivedi MH, Daly EJ. Treatment strategies to improve and sustain remission in major depressive disorder. Dialogues Clin Neurosci. 2008;10(4):377-84.
[88] Uher R, Perroud N, Ng MY, Hauser J, Henigsberg N, Maier W, Mors O, Placentino A, Rietschel M, Souery D, Zagar T, Czerski PM, Jerman B, Larsen ER, Schulze TG, Zobel A, Cohen-Woods S, Pirlo K, Butler AW, Muglia P, Barnes MR, Lathrop M, Farmer A, Breen G, Aitchison KJ, Craig I, Lewis CM, McGuffin P. Genome-wide pharmacogenetics of antidepressant response in the GENDEP project. Am J Psychiatry. 2010 May;167(5):555-64.
[89] Hunter AM, Leuchter AF, Power RA, Muthén B, McGrath PJ, Lewis CM, Cook IA, Garriock HA, McGuffin P, Uher R, Hamilton SP. A genome-wide association study of a sustained pattern of antidepressant response. J Psychiatr Res. 2013 Sep;47(9):1157-65.
[90] Ji Y, Biernacka JM, Hebbring S, Chai Y, Jenkins GD, Batzler A, Snyder KA, Drews MS, Desta Z, Flockhart D, Mushiroda T, Kubo M, Nakamura Y, Kamatani N, Schaid D, Weinshilboum RM, Mrazek DA. Pharmacogenomics of selective serotonin reuptake inhibitor treatment for major depressive disorder: genome-wide associations and functional genomics. Pharmacogenomics J. 2013 Oct;13(5):456-63.
[91] Ohara K, Nagai M, Suzuki Y, Ohara K. Low activity allele of catechol-o-methyltransferase gene and Japanese unipolar depression. Neuroreport. 1998 May 11;9(7):1305-8.
[92] Preisig M, Bellivier F, Fenton BT, Baud P, Berney A, Courtet P, Hardy P, Golaz J, Leboyer M, Mallet J, Matthey ML, Mouthon D, Neidhart E, Nosten-Bertrand M, Stadelmann-Dubuis E, Guimon J, Ferrero F, Buresi C, Malafosse A. Association
![Page 79: UNIVERSIDADE FEDERAL DE GOIÁS INSTITUTO DE CIÊNCIAS ...€¦ · programa de pÓs-graduaÇÃo em ciÊncias biolÓgicas farmacogenÉtica em psiquiatria: influÊncia dos polimorfismos](https://reader033.fdocuments.in/reader033/viewer/2022042413/5f2db3abc003496c580b5cf0/html5/thumbnails/79.jpg)
62
between bipolar disorder and monoamine oxidase A gene polymorphisms: results of a multicenter study. Am J Psychiatry. 2000 Jun;157(6):948-55.
[93] Caspi A, Sugden K, Moffitt TE, Taylor A, Craig IW, Harrington H, McClay J, Mill J, Martin J, Braithwaite A, Poulton R. Influence of life stress on depression: moderation by a polymorphism in the 5-HTT gene. Science. 2003 Jul 18;301(5631):386-9.
[94] Lima VM, Sougey EV, Vallada Filho HP. Farmacogenética da depressão: busca de marcadoresmoleculares de boa resposta aos antidepressivos. Rev Psiq Clin 2004; 31(1):40-3.
[95] Fabbri C, Serretti A. Pharmacogenetics of major depressive disorder: top genes and pathways toward clinical applications. Curr Psychiatry Rep. 2015 Jul;17(7):594.
[96] Probst-Schendzielorz K, Viviani R, Stingl JC. Effect of Cytochrome P450 polymorphism on the action and metabolism of selective serotonin reuptake inhibitors. Expert Opin Drug Metab Toxicol. 2015 Aug;11(8):1219-32.
[97] Zhou H, Josephy PD, Kim D, Guengerich FP. Functional characterization of four allelic variants of human cytochrome P450 1A2. Arch Biochem Biophys, 2004 Feb 1;422(1):23-30.
[98] Ingelman-Sundberg M, Sim SC, Gomez A, Rodriguez-Antona C. Influence of cytochrome P450 polymorphisms on drug therapies: pharmacogenetic, pharmacoepigenetic and clinical aspects. Pharmacol Ther. 2007 Dec;116(3):496-526.
[99] Scott SA, Sangkuhl K, Gardner EE, Stein CM, Hulot JS, Johnson JA, Roden DM, Klein TE, Shuldiner AR; Clinical Pharmacogenetics Implementation Consortium. Clinical Pharmacogenetics Implementation Consortium guidelines for cytochrome P450-2C19 (CYP2C19) genotype and clopidogrel therapy. Clin Pharmacol Ther. 2011 Aug;90(2):328-32.
[100] Desta Z, Zhao X, Shin JG, Flockhart DA. Clinical significance of the cytochrome P450 2C19 genetic polymorphism. Clin Pharmacokinet. 2002;41(12):913-58. Review.
[101] Strom CM, Goos D, Crossley B, Zhang K, Buller-Burkle A, Jarvis M, Quan F, Peng M, Sun W. Testing for variants in CYP2C19: population frequencies and testing experience in a clinical laboratory. Genet Med. 2012 Jan;14(1):95-100.
[102] Bertilsson L. Metabolism of antidepressant and neuroleptic drugs by cytochrome p450s: clinical and interethnic aspects. Clin Pharmacol Ther. 2007 Nov;82(5):606-9.
[103] Jiang ZP, Shu Y, Chen XP, Huang SL, Zhu RH, Wang W, He N, Zhou HH. The role of CYP2C19 in amitriptyline N-demethylation in Chinese subjects. Eur J Clin Pharmacol. 2002 May;58(2):109-13.
[104] Thieme D, Rolf B, Sachs H, Schmid D. Correlation of inter-individual variations of amitriptyline metabolism examined in hairs with CYP2C19 and CYP2D6 polymorphisms. Int J Legal Med. 2008 Mar;122(2):149-55.
![Page 80: UNIVERSIDADE FEDERAL DE GOIÁS INSTITUTO DE CIÊNCIAS ...€¦ · programa de pÓs-graduaÇÃo em ciÊncias biolÓgicas farmacogenÉtica em psiquiatria: influÊncia dos polimorfismos](https://reader033.fdocuments.in/reader033/viewer/2022042413/5f2db3abc003496c580b5cf0/html5/thumbnails/80.jpg)
63
[105] Shimoda K, Someya T, Yokono A, Morita S, Hirokane G, Takahashi S, Okawa M. The impact of CYP2C19 and CYP2D6 genotypes on metabolism of amitriptyline in Japanese psychiatric patients. J Clin Psychopharmacol. 2002 Aug;22(4):371-8.
[106] Steimer W, Zöpf K, von Amelunxen S, Pfeiffer H, Bachofer J, Popp J, Messner B, Kissling W, Leucht S. Allele-specific change of concentration and functional gene dose for the prediction of steady-state serum concentrations of amitriptyline and nortriptyline in CYP2C19 and CYP2D6 extensive and intermediate metabolizers. Clin Chem. 2004 Sep;50(9):1623-33.
[107] van der Weide J, van Baalen-Benedek EH, Kootstra-Ros JE. Metabolic ratios of psychotropics as indication of cytochrome P450 2D6/2C19 genotype. Ther Drug Monit. 2005 Aug;27(4):478-83.
[108] de Vos A, van der Weide J, Loovers HM. Association between CYP2C19*17 and metabolism of amitriptyline, citalopram and clomipramine in Dutch hospitalized patients. Pharmacogenomics J. 2011 Oct;11(5):359-67.
[109] Spina E, Santoro V, D'Arrigo C. Clinically relevant pharmacokinetic drug interactions with second-generation antidepressants: an update. Clin Ther. 2008 Jul;30(7):1206-27.
[110] Yin OQ, Wing YK, Cheung Y, Wang ZJ, Lam SL, Chiu HF, Chow MS. Phenotype-genotype relationship and clinical effects of citalopram in Chinese patients. J Clin Psychopharmacol. 2006 Aug;26(4):367-72.
[111] Tsai MH, Lin KM, Hsiao MC, Shen WW, Lu ML, Tang HS, Fang CK, Wu CS, Lu SC, Liu SC, Chen CY, Liu YL. Genetic polymorphisms of cytochrome P450 enzymes influence metabolism of the antidepressant escitalopram and treatment response. Pharmacogenomics. 2010 Apr;11(4):537-46.
[112] Jin Y, Pollock BG, Frank E, Cassano GB, Rucci P, Müller DJ, Kennedy JL, Forgione RN, Kirshner M, Kepple G, Fagiolini A, Kupfer DJ, Bies RR. Effect of age, weight, and CYP2C19 genotype on escitalopram exposure. J Clin Pharmacol. 2010 Jan;50(1):62-72.
[113] Noehr-Jensen L, Zwisler ST, Larsen F, Sindrup SH, Damkier P, Nielsen F, Brosen K. Impact of CYP2C19 phenotypes on escitalopram metabolism and an evaluation of pupillometry as a serotonergic biomarker. Eur J Clin Pharmacol. 2009 Sep;65(9):887-94.
[114] Rudberg I, Mohebi B, Hermann M, Refsum H, Molden E. Impact of the ultrarapid CYP2C19*17 allele on serum concentration of escitalopram in psychiatric patients. Clin Pharmacol Ther. 2008 Feb;83(2):322-7.
[115] Wang JH, Liu ZQ, Wang W, Chen XP, Shu Y, He N, Zhou HH. Pharmacokinetics of sertraline in relation to genetic polymorphism of CYP2C19. Clin Pharmacol Ther. 2001 Jul;70(1):42-7.
[116] Liu ZQ, Shu Y, Huang SL, Wang LS, He N, Zhou HH. Effects of CYP2C19 genotype and CYP2C9 on fluoxetine N-demethylation in human liver microsomes. Acta Pharmacol Sin. 2001 Jan;22(1):85-90.
![Page 81: UNIVERSIDADE FEDERAL DE GOIÁS INSTITUTO DE CIÊNCIAS ...€¦ · programa de pÓs-graduaÇÃo em ciÊncias biolÓgicas farmacogenÉtica em psiquiatria: influÊncia dos polimorfismos](https://reader033.fdocuments.in/reader033/viewer/2022042413/5f2db3abc003496c580b5cf0/html5/thumbnails/81.jpg)
64
[117] Scordo MG, Spina E, Dahl ML, Gatti G, Perucca E. Influence of CYP2C9, 2C19 and 2D6 genetic polymorphisms on the steady-state plasma concentrations of the enantiomers of fluoxetine and norfluoxetine. Basic Clin Pharmacol Toxicol. 2005 Nov;97(5):296-301.
[118] Jan MW, ZumBrunnen TL, Kazmi YR, VanDenBerg CM, Desai HD, Weidler DJ, Flockhart DA. Pharmacokinetics of fluvoxamine in relation to CYP2C19 phenotype and genotype. Drug Metabol Drug Interact. 2002;19(1):1-11.
[119] Fukuda T, Nishida Y, Zhou Q, Yamamoto I, Kondo S, Azuma J. The impact of the CYP2D6 and CYP2C19 genotypes on venlafaxine pharmacokinetics in a Japanese population. Eur J Clin Pharmacol. 2000 May;56(2):175-80.
[120] Yu KS, Yim DS, Cho JY, Park SS, Park JY, Lee KH, Jang IJ, Yi SY, Bae KS, Shin SG. Effect of omeprazole on the pharmacokinetics of moclobemide according to the genetic polymorphism of CYP2C19. Clin Pharmacol Ther. 2001 Apr;69(4):266-73.
[121] Swen JJ, Nijenhuis M, de Boer A, Grandia L, Maitland-van der Zee AH, Mulder H, Rongen GA, van Schaik RH, Schalekamp T, Touw DJ, van der Weide J, Wilffert B, Deneer VH, Guchelaar HJ. Pharmacogenetics: from bench to byte--an update of guidelines. Clin Pharmacol Ther. 2011 May;89(5):662-73.
[122] Cipriani A, Furukawa TA, Salanti G, Geddes JR, Higgins JP, Churchill R, Watanabe N, Nakagawa A, Omori IM, McGuire H, Tansella M, Barbui C. Comparative efficacy and acceptability of 12 new-generation antidepressants: a multiple-treatments meta-analysis. Lancet. 2009a Feb 28;373(9665):746-58.
[123] Cipriani A, Santilli C, Furukawa TA, Signoretti A, Nakagawa A, McGuire H, Churchill R, Barbui C. Escitalopram versus other antidepressive agents for depression. Cochrane Database Syst Rev. 2009b Apr 15;(2):CD006532.
[124] Rao, N. The Clinical Pharmacokinetics of Escitalopram. Clin Pharmacokinet. 200746(4):281-290.
[125] Food and Drug Administration (FDA): center for drug evaluation and research; 2009 [cited 2009 Mar 19]. 127 p. Available from: http://www.accessdata.fda.gov/drugsatfda_docs/nda/2009/021323Orig1S030_s031.pdf
[126] Montgomery SA, Asberg M. A new depression scale designed to be sensitive to change. Br J Psychiatry. 1979 Apr;134:382-9.
[127] Wade A, Michael Lemming O, Bang Hedegaard K. Escitalopram 10 mg/day is effective and well tolerated in a placebo-controlled study in depression in primary care. Int Clin Psychopharmacol. 2002 May;17(3):95-102.
[128] Ng C, Sarris J, Singh A, Bousman C, Byron K, Peh LH, Smith DJ, Tan CH, Schweitzer I. Pharmacogenetic polymorphisms and response to escitalopram and venlafaxine over 8 weeks in major depression. Hum Psychopharmacol. 2013 Sep;28(5):516-22.
![Page 82: UNIVERSIDADE FEDERAL DE GOIÁS INSTITUTO DE CIÊNCIAS ...€¦ · programa de pÓs-graduaÇÃo em ciÊncias biolÓgicas farmacogenÉtica em psiquiatria: influÊncia dos polimorfismos](https://reader033.fdocuments.in/reader033/viewer/2022042413/5f2db3abc003496c580b5cf0/html5/thumbnails/82.jpg)
65
[129] Swen JJ, van der Straaten T, Wessels JA, Bouvy ML, Vlassak EE, Assendelft WJ, Guchelaar HJ. Feasibility of pharmacy-initiated pharmacogenetic screening for CYP2D6 and CYP2C19. Eur J Clin Pharmacol. 2012 Apr;68(4):363-70.
[130] Samer CF, Lorenzini KI, Rollason V, Daali Y, Desmeules JA. Applications of CYP450 testing in the clinical setting. Mol Diagn Ther. 2013 Jun;17(3):165-84.
[131] Hodgson K, Tansey K, Dernovsek MZ, Hauser J, Henigsberg N, Maier W, Mors O, Placentino A, Rietschel M, Souery D, Smith R, Craig IW, Farmer AE, Aitchison KJ, Belsy S, Davis OS, Uher R, McGuffin P. Genetic differences in cytochrome P450 enzymes and antidepressant treatment response. J Psychopharmacol. 2014;28(2):133-141.
[132] Romano F, Elkis H. Tradução e adaptação de um instrumento de avaliação psicopatológica das psicoses: a escala breve de avaliação psiquiátrica - versão ancorada (BPRS-A). J Bras Psiquiatr. 1996;45(1):43-9.
[133] Hamilton M. A rating scale for depression. J Neurol Neurosurg Psychiat. 1960;23(56):56-62.
[134] Anichavezhi D, Chakradhara Rao US, Shewade DG, Krishnamoorthy R, Adithan C. Distribution of CYP2C19*17 allele and genotypes in an Indian population. J Clin Pharm Ther. 2012 Jun;37(3):313-8.
![Page 83: UNIVERSIDADE FEDERAL DE GOIÁS INSTITUTO DE CIÊNCIAS ...€¦ · programa de pÓs-graduaÇÃo em ciÊncias biolÓgicas farmacogenÉtica em psiquiatria: influÊncia dos polimorfismos](https://reader033.fdocuments.in/reader033/viewer/2022042413/5f2db3abc003496c580b5cf0/html5/thumbnails/83.jpg)
ANEXOS
![Page 84: UNIVERSIDADE FEDERAL DE GOIÁS INSTITUTO DE CIÊNCIAS ...€¦ · programa de pÓs-graduaÇÃo em ciÊncias biolÓgicas farmacogenÉtica em psiquiatria: influÊncia dos polimorfismos](https://reader033.fdocuments.in/reader033/viewer/2022042413/5f2db3abc003496c580b5cf0/html5/thumbnails/84.jpg)
67
Termo de Consentimento Livre e Esclarecido para Participação no Estudo
“VARIAÇÕES GENÉTICAS ASSOCIADAS COM EFICÁCIA TERAPÊUTICA E EFEITOS
COLATERAIS DA CLOZAPINA EM PACIENTES COM ESQUIZOFRENIA”
Direito: Sua participação é inteiramente voluntária. Você pode decidir não participar deste estudo sem que nenhum prejuízo decorra desta sua decisão. Você tem a garantia expressa de liberdade do de se recusar a participar ou retirar seu consentimento, em qualquer fase da pesquisa, sem penalização alguma e sem prejuízo ao seu cuidado. Você tem direito de pleitear indenização em caso de danos decorrentes de sua participação nesta pesquisa. Em caso de dúvida sobre a pesquisa, você poderá entrar em contato com o(s) pesquisador(es) responsável(is), Paulo César Ghedini ou Rodrigo Bernini de Brito, nos telefones: 3521-1725 (UFG), 3520-3816 (Brain Institute) ou 8156-9001. Em casos de dúvidas sobre os seus direitos como participante nesta pesquisa, você poderá entrar em contato com o Comitê de Ética em Pesquisa da Universidade Federal de Goiás, nos telefones: 3521-1075 ou 3521-1076. Justificativa: Através desta pesquisa iremos analisar qual o seu perfil genético de resposta a clozapina de acordo com possíveis alterações genéticas do seu metabolismo, identificando a velocidade de seu metabolismo (lento, normal ou acelerado) para clozapina podendo prever uma melhor ou pior resposta terapêutica, bem como efeitos colaterais ausentes/discretos ou mais frequentes durante o estudo. Se você está sob tratamento ou irá iniciar o tratamento para a esquizofrenia com clozapina, este estudo poderá auxiliar seu médico a escolher a dosagem mais eficaz de clozapina que é mais indicada para o seu caso ou para casos futuros dependendo dos achados. Objetivos: Através das informações fornecidas por você e daquelas obtidas no laboratório e com a ajuda de seu médico, iremos sugerir o medicamento que melhor se adapta as suas características. O estudo também auxiliará a escolher as quantidades mais apropriadas do medicamento para tratar sua doença. Procedimento: Durante a consulta, o médico convidará o paciente que poderá se beneficiar com este estudo, a participar da pesquisa. Se aceito, será feita assepsia do local e será coletada uma amostra de 2 mL de sangue, através de punção a vácuo da braquial média ou outra de preferência do coletor. O processo é rápido e seguro. O sangue coletado será levado para o laboratório e analisado. Após a análise laboratorial, o material será armazenado por um período de até 5 anos. O armazenamento do material deve-se à eventual re-solicitação do exame se, no transcorrer do tratamento e do monitoramento terapêutico, o médico-clínico responsável assim achar necessário.
O material coletado, será utilizado única e exclusivamente para esta pesquisa. Na ocorrência de desenvolvimento de sub-projetos futuros e que possam se fazer do uso das amostras, haverá nova submissão à aprovação do paciente e à apreciação do Comitê de Ética, sendo as amostras utilizadas apenas se houver a aprovação de ambas as partes.
![Page 85: UNIVERSIDADE FEDERAL DE GOIÁS INSTITUTO DE CIÊNCIAS ...€¦ · programa de pÓs-graduaÇÃo em ciÊncias biolÓgicas farmacogenÉtica em psiquiatria: influÊncia dos polimorfismos](https://reader033.fdocuments.in/reader033/viewer/2022042413/5f2db3abc003496c580b5cf0/html5/thumbnails/85.jpg)
68
Após o período máximo de armazenamento estabelecido, as amostras serão descartadas conforme as especificações de segurança para descarte de material biológico. Garantia de Sigilo: As informações obtidas deste estudo serão publicadas, mas seu nome jamais será divulgado ou mencionado. Os dados são para fins de tese de dou torado e poderão ser usados em futuras produções cientificas por tempo indeterminado. Riscos: Poderá sentir um leve desconforto no momento da punção do vaso, mas que não representa nenhum risco adicional à sua comodidade e à sua saúde. Benefícios: A sua participação neste estudo será muito importante para que possamos auxiliar o seu médico na escolha de medicamentos e doses mais adequadas para tratar a sua doença. Isto trará maior satisfação, uma vez que diminuirá o tempo para que se descubra o medicamento mais eficaz e evitará os sintomas desagradáveis que alguns medicamentos podem ocasionar. Desta forma podemos contribuir também com a redução de gastos com medicamentos ineficazes, que não irão contribuir para tratar a sua doença e que podem trazer efeitos tóxicos. Custos e Pagamentos: Não haverá custos para o paciente e o mesmo não receberá qualquer pagamento pela sua participação neste estudo. Caso você tenha algum gasto com sua participação, por exemplo com transporte, você será ressarcido das despesas decorrentes da participação nesta pesquisa. Não haverá nenhum tipo de pagamento ou gratificação financeira pela sua participação nesta pesquisa. Após ter lido e ter retirado as suas dúvidas, por favor preencha os dados solicitados e assine se concordar em participar desta pesquisa. Eu,______________________________________________________________________________,
RG/ CPF/ n.º de prontuário/ n.º de matrícula ______________________________, abaixo assinado,
concordo em participar do estudo supracitado, como sujeito. Fui devidamente informado(a) e
esclarecido(a) pelo pesquisador(a) ____________________________________________________
sobre a pesquisa, os procedimentos nela envolvidos, assim como os possíveis riscos e benefícios
decorrentes de minha participação. Foi-me garantido que posso retirar meu consentimento a qualquer
momento, sem que isto leve a qualquer penalidade (ou interrupção de meu acompanhamento/
assistência/tratamento, se for o caso).
Local e data: Goiânia,____/____/______
Assinatura:________________________________________________________________________
![Page 86: UNIVERSIDADE FEDERAL DE GOIÁS INSTITUTO DE CIÊNCIAS ...€¦ · programa de pÓs-graduaÇÃo em ciÊncias biolÓgicas farmacogenÉtica em psiquiatria: influÊncia dos polimorfismos](https://reader033.fdocuments.in/reader033/viewer/2022042413/5f2db3abc003496c580b5cf0/html5/thumbnails/86.jpg)
69
Termo de Consentimento Livre e Esclarecido para Participação no Estudo
“GENOTIPAGEM DAS ISOFORMAS CYP2C19 E CYP2D6 COMO SUBSÍDIO PARA O MONITORAMENTO DA FARMACOTERAPIA NA DEPRESSÃO E NA
MIGRANEA”
Direito: Sua participação é inteiramente voluntária. Você pode decidir de não participar deste estudo sem que nenhum prejuízo decorra desta sua decisão. Em caso de dúvida sobre a pesquisa, você poderá entrar em contato com o(s) pesquisador(es) responsável(is), Paulo César Ghedini ou Rodrigo Bernini de Brito, nos telefones: 3521-1725 ou 8156-9001. Em casos de dúvidas sobre os seus direitos como participante nesta pesquisa, você poderá entrar em contato com o Comitê de Ética em Pesquisa da Universidade Federal de Goiás, nos telefones: 3521-1075 ou 3521-1076. Justificativa: Através desta pesquisa iremos analisar qual o melhor medicamento para tratar dois tipos de doenças que são muito freqüentes na população, a depressão e a migranea. Se você está sob tratamento ou irá iniciar o tratamento para a depressão ou para a migranea, este estudo irá auxiliar seu médico a escolher o medicamento que é mais indicado para o seu caso e com as doses mais adequadas. Assim, evitará que você desenvolva efeitos ruins ou a falta de efeito dos medicamentos. Objetivos: Através das informações fornecidas por você e daquelas obtidas no laboratório e com a ajuda de seu médico, iremos sugerir o medicamento que melhor se adapta as suas características. O estudo também auxiliará a escolher as quantidades mais apropriadas do medicamento para tratar sua doença. Procedimento: Durante a consulta, o médico convidará o paciente que poderá se beneficiar com este estudo, a participar da pesquisa. Se aceito, será feita assepsia do local e será coletada uma amostra de 2 mL de sangue, através de punção a vácuo da braquial média ou outra de preferência do coletor. O processo é rápido e seguro. O sangue coletado será levado para o laboratório e analisado. Após a análise laboratorial, o material será armazenado por um período de até 5 anos. O armazenamento do material deve-se à eventual re-solicitação do exame se, no transcorrer do tratamento e do monitoramento terapêutico, o médico-clínico responsável assim achar necessário.
O material coletado, será utilizado única e exclusivamente para esta pesquisa. Na ocorrência de desenvolvimento de sub-projetos futuros e que possam se fazer do uso das amostras, haverá nova submissão à aprovação do paciente e à apreciação do Comitê de Ética, sendo as amostras utilizadas apenas se houver a aprovação de ambas as partes.
Após o período máximo de armazenamento estabelecido, as amostras serão descartadas conforme as especificações de segurança para descarte de material biológico.
![Page 87: UNIVERSIDADE FEDERAL DE GOIÁS INSTITUTO DE CIÊNCIAS ...€¦ · programa de pÓs-graduaÇÃo em ciÊncias biolÓgicas farmacogenÉtica em psiquiatria: influÊncia dos polimorfismos](https://reader033.fdocuments.in/reader033/viewer/2022042413/5f2db3abc003496c580b5cf0/html5/thumbnails/87.jpg)
70
Garantia de Sigilo: As informações obtidas deste estudo serão publicadas, mas seu nome jamais será divulgado ou mencionado. Riscos: Poderá sentir um leve desconforto no momento da punção do vaso, mas que não representa nenhum risco adicional à sua comodidade e à sua saúde. Benefícios: A sua participação neste estudo será muito importante para que possamos auxiliar o seu médico na escolha de medicamentos e doses mais adequadas para tratar a sua doença. Isto trará maior satisfação, uma vez que diminuirá o tempo para que se descubra o medicamento mais eficaz e evitará os sintomas desagradáveis que alguns medicamentos podem ocasionar. Desta forma podemos contribuir também com a redução de gastos com medicamentos ineficazes, que não irão contribuir para tratar a sua doença e que podem trazer efeitos tóxicos. Custos e Pagamentos: Não haverá custos para o paciente e o mesmo não receberá qualquer pagamento pela sua participação neste estudo. Após ter lido e ter retirado as suas dúvidas, por favor preencha os dados solicitados e assine se concordar em participar desta pesquisa. Eu, _____________________________________________________________________________,
RG/ CPF/ n.º de prontuário/ n.º de matrícula ______________________________, abaixo assinado,
concordo em participar do estudo _____________________________________________________,
como sujeito. Fui devidamente informado(a) e esclarecido(a) pelo pesquisador(a)
______________________________ sobre a pesquisa, os procedimentos nela envolvidos, assim
como os possíveis riscos e benefícios decorrentes de minha participação. Foi-me garantido que
posso retirar meu consentimento a qualquer momento, sem que isto leve a qualquer penalidade (ou
interrupção de meu acompanhamento/ assistência/tratamento, se for o caso).
Local e data:_______________________________________________________________________
Assinatura : _______________________________________________________________________