Universidade de Lisboa Faculdade de Farmácia Departamento de...

Universidade de Lisboa

Faculdade de Farmácia

Departamento de Farmácia Galénica e Tecnologia Farmacêutica

Development of a Melanoma Therapeutic Vaccine Candidate by

the Coencapsulation of Melanoma Antigen Peptides and Toll-like Receptor Ligands as Adjuvants into Polymeric

Nanoparticles

Joana Catarina Mendão Azeitão da Silva

Doutoramento em Farmácia

Especialidade em Tecnologia Farmacêutica

2014

Universidade de Lisboa

Faculdade de Farmácia

Departamento de Farmácia Galénica e Tecnologia Farmacêutica

Development of a Melanoma Therapeutic Vaccine Candidate by

the Coencapsulation of Melanoma Antigen Peptides and Toll-like Receptor Ligands as Adjuvants into Polymeric

Nanoparticles

Joana Catarina Mendão Azeitão da Silva

Tese orientada pela Prof.ª Doutora Helena Isabel Fialho Florindo Ferreira, especialmente elaborada para a obtenção do grau de doutor no ramo de Farmácia, especialidade de Tecnologia Farmacêutica

This thesis was supervised by:

Prof. Dr. Helena F. Florindo (supervisor)

Assistant Professor

Instituto de Investigação do Medicamento (iMed.ULisboa), Faculdade de Farmácia,

Universidade de Lisboa, Lisbon, Portugal.

Prof. Dr. Mafalda Videira (co-supervisor)

Assistant Professor



Prof. Dr. Véronique Préat (co-supervisor)

Vice-Rector

Louvain Drug Research Institute, Advanced Drug Delivery & Biomaterials,

Université Catholique de Louvain, Brussels, Belgium.

This work was developed at:



&

Louvain Drug Research Institute, Advanced Drug Delivery & Biomaterials,

Université Catholique de Louvain, Brussels, Belgium.

Joana M. Silva was financially supported by Fundação para a Ciência e a Tecnologia,

Ministério da Educação e Ciência, Portugal (PhD Grant SFRH/BD/64295/2009). The work

reported in this thesis was financially supported by PTDC/SAU-FAR/119389/2010, Pest-

OE/SAU/UI4013/2011 and by Fonds de la Recherche Scientifique Médicale, Belgium.

Ao João

À minha família

Preface

v

Preface

“There is plenty of room at the bottom” was a lecture given by Richard Feynman at an

American Physical Society meeting at Caltech on December 29, 1959. Feynman considered

the possibility of direct manipulation of individual atoms as a more powerful form of

synthetic chemistry than those used at the time. The talk is considered to be a seminal event in

the history of nanotechnology, as it inspired the conceptual beginnings of the field decades

later. More than half a century before that (1890), the New York surgeon William B. Coley

successfully treated some patients with sarcoma using bacterial toxins, the so called Colley’s

toxins. Other medical pioneers including Robert Koch, Louis Pasteur, and Emil von Behring,

had recorded observations of erysipelas infection coinciding with cancer regression. In 1909,

Paul Ehrlich successfully carried out immunization in animals with tumor cells and suggested

that tumors are kept under control by the immune system. Paul Ehrlich's “magic bullet”

theory has inspired many generations of scientists to explore numerous molecular cancer

therapeutics.

Nowadays, more than a century after the important observations made by our scientist

ancestors, society is still struggling to beat cancer and both cancer immunotherapy and

nanomedicines are far from being at their highest potential. This research project results from

the desire to make a contribution to solve this public health problem through the convergence

of both fields.

This research work was developed between January 2010 and June 2014 in two main

research laboratories: Instituto de Investigação do Medicamento (iMed.ULisboa), Faculdade

de Farmácia, Universidade de Lisboa, Lisbon, Portugal; and Louvain Drug Research Institute,

Advanced Drug Delivery & Biomaterials, Université Catholique de Louvain, Brussels,

Belgium. The present research project resulted from the will to transpose a long expertise and

successful achievements in both the nanotechnology and vaccine fields to cancer vaccine

research. At that time, Dr. Helena Florindo had recently completed her PhD work where she

could demonstrate the successful use of biodegradable polymeric particulate systems as safe

adjuvants for a vaccine against the horse condition known as strangles. Dr. Véronique Préat

had conducted several research projects on particulate drug delivery systems and also on

mucosal and dermal vaccine delivery. As so, a very favorable scenario in terms of expertise

and scientific background was established to embrace a new challenge and start the research

in the cancer vaccine field.

http://en.wikipedia.org/wiki/Atom

http://en.wikipedia.org/wiki/Chemistry

http://en.wikipedia.org/wiki/History_of_nanotechnology

http://en.wikipedia.org/wiki/Robert_Koch

http://en.wikipedia.org/wiki/Louis_Pasteur

http://en.wikipedia.org/wiki/Emil_von_Behring

vi

Apart from the official institutions previewed at the moment of approval of the

doctoral grant of Joana M. Silva, the necessity to collaborate with other research groups from

other institutions emerged. Dr. Christine Jérôme and Dr. Hélène Freichels from the Center for

Education and Research on Macromolecules, Université de Liège, Liège, Belgium, provided

part of the functionalized polymers, without which the formulation of the nanoparticles would

not be possible. Dr. Carlos Afonso and Dr. Catarina Rodrigues from the Bioorganic

Chemistry group of iMed.UL synthesized a fluorophore-grafted polymer that allowed part of

the fluorescence studies with nanoparticles. Dr. Ana Viana from Centro de Química e

Bioquímica, Faculdade de Ciências da Universidade de Lisboa, Lisbon, Portugal, provided

further insight on the physicochemical characterization of the produced nanoparticles through

her expertise on atomic force microscopy. Dr. Manuel Prieto from Centro de Química-Física

Molecular & Institute of Nanoscience and Nanotechnology, Instituto Superior Técnico,

Universidade de Lisboa, Lisbon, Portugal, allowed Joana M. Silva to use the confocal

microscopy facilities of his laboratory, which were a crucial tool for great part of the studies

conducted on nanoparticle characterization. Moreover, one of his co-worker, Dr. Sandra

Pinto, provided important expertise and help in the development of the confocal microscopy

studies. Finally, Dr. Luís Graça and Dr. Vanessa Oliveira from Instituto de Medicina

Molecular, Faculdade de Medicina da Universidade de Lisboa, Lisbon, Portugal, provided

access to their facilities to develop in vitro and in vivo immunological characterization studies

and also contributed with valuable expertise on cellular immunology.

All the mentioned researchers and institutions were essential in the development of

this research. The interdisciplinary knowledge of the researchers involved contributed to the

enrichment of the developed work, proving once again that the success of science depends on

our effort to collaborate and our capacity to envision and accept different perspectives.

Abstract

vii

Abstract

Biodegradable polymeric nanoparticles (NPs) are promising vaccine delivery systems

due to their capacity to entrap antigens and immunoadjuvants, providing specific targeting to

antigen-presenting cells (APCs), protection from in vivo degradation and sustained release

over time. We hypothesized that the coentrapment of several melanoma-associated antigens

(MAAs) along with Toll-like receptor (TLR) ligands in mannose-functionalized aliphatic

polyester-based NPs could be an effective antitumor strategy. Untargeted PEGylated PLGA-

based and mannose-grafted NPs were formulated and physicochemically characterized.

Sperical 140 to 190 nm NPs were produced displaying mannose residues available for binding

at the surface. Different NP internalization patterns by immortalized and primary APCs were

verified. Multiple endocytic pathways demonstrated to be involved in NP internalization. NPs

demonstrate both endo-lysosomal and cytosolic localizations and a tendency to accumulate

nearby the endoplasmic reticulum. High entrapment efficiencies of several antigens and TLR

ligands adjuvants in NPs were obtained.

The type of immune response induced by NPs loaded with TLR ligands and the model

antigen ovalbumin (OVA) was primarily characterized in OT II mice. The coentrapment of

OVA and the TLR ligands Poly(I:C) and CpG was crucial to induce high levels of IFN-γ and

IL-2, as well as high IgG2c/IgG1 ratios. Mannose-functionalization of NPs potentiated the

Th1 immune response. The antitumor efficacy of the vaccine was then tested in a murine

melanoma model using therapeutic and prophylactic settings. Immunization of mice with the

NPs loaded with melanoma antigen peptides and the TLR ligands decreased the growth rate

of murine B16F10 melanoma tumors in both therapeutic and prophylatic settings. The

combination of MHC class I- and class II-restricted melanoma antigens in different mannose-

functionalyzed NPs containing TLR ligands induced the highest tumor growth delay. Overall,

the present work shows that the combination of the multifuctional properties in terms of

antigen and adjuvant delivery and active targeting of the immune system translate the great

potential of the developed NPs to be used as a cancer vaccine.

Keywords

Cancer vaccine, nanoparticles, PLGA, mannose receptor targeting, antigen presenting cells, melanoma.

Resumo

ix

Resumo

A utilização de nanopartículas (NPs) poliméricas biodegradáveis como sistemas de

veiculação de vacinas para cancro é uma estratégia promissora devido à capacidade destes

para veicular antigénios e adjuvantes, proporcionando a vetorização destas moléculas para as

células apresentadoras de antigénios, evitando a sua degradação in vivo e permitindo a

libertação controlada destas moléculas ao longo do tempo. O presente projeto de investigação

baseou-se na hipótese de que a veiculação simultânea de vários antigénios de melanoma e

ligandos dos recetores Toll-like em NPs de poliésteres alifáticos funcionalizadas com resíduos

de manose poderia exercer um efeito antitumoral.

Os poliésteres alifáticos ácido poliláctico-co-glicólico (PLGA) e policaprolactona,

assim como as suas formas Peguiladas (PEG-b-PLGA e PEG-b-PCL), foram utilizados para

formular NPs pelo método de dupla emulsão evaporação de solvente. Foram também

preparadas NPs funcionalizadas com resíduos de manose com o objetivo de vetorizar

ativamente as NPs para as células apresentadoras de antigénios através dos seus recetores de

manose. Para tal, o polímero PEG-b-PCL foi substituído na formulação pela sua forma

manosilada (man-PEG-b-PCL). Para a realização de ensaios em que se revelou necessária a

marcação das NPs com fluorescência foi introduzido na formulação o polímero PLGA

marcado com um fluoróforo (um derivado de fluoresceína ou um derivado de rodamina).

A caracterização físico-química das NPs preparadas consistiu na determinação do seu

diâmetro hidrodinâmico, potencial zeta e análise da morfologia por microscopia de força

atómica. Foi desenvolvido um ensaio de ligação de lectina para verificar a disponibilidade

para ligação dos resíduos de manose à superfície das NPs. A fim de analisar a interação das

NPs com células apresentadoras de antigénios, foram utilizadas duas linhas celulares

imortalizadas de células de murganho (células dendríticas e macrófagos) assim como células

dendríticas primárias derivadas de células da medula óssea de murganho. A viabilidade

celular em presença de crescentes concentrações de NPs foi avaliada através dos ensaios MTT

e AlamarBlue®. O perfil de internalização das NPs pelas diferentes células apresentadoras de

antigénios foi analisado a diferentes tempos de incubação e concentrações de NPs recorrendo

a citometria de fluxo e microscopia confocal. A identificação das vias endocíticas utilizadas

para a internalização das NPs foi realizada recorrendo à utilização de inibidores específicos de

cada via endocítica e analisando o seu efeito na internalização das NPs por citometria de fluxo

e microscopia confocal. O tráfego intracelular das NPs após a sua internalização foi analisado

x

por imunofluorescência em microscopia confocal, analisando o grau de colocalização das NPs

com organelos marcados.

Foram preparadas NPs contendo vários antigénios e adjuvantes. Como antigénios

foram utilizados dois péptidos com especificidade para o complexo major de

histocompatibilidade (MHC) classe I (Melan-A:26-35(27L) e gp100:209-217(2M))

correspondentes aos epítopos mais frequentemente encontrados nos melanomas humanos,

com afinidade aumentada para MHC classe I devido à modificação de um aminoácido. Foi

também testado um péptido específico para MHC classe II (gp100:44-59). A proteína

ovalbumina (OVA) foi utilizada como antigénio modelo. A capacidade de loading dos

antigénios nas NPs foi determinada utilizando o ensaio MicroBCA® e confirmada para a

OVA por HPLC. Como adjuvantes, foram testados dois ligandos dos recetores Toll-like, CpG

e Poly(I:C). Estas moléculas mimetizam os ácidos nucleicos bacterianos e virais e são

ligandos dos recetores Toll-like 3 e 9, respetivamente. A ativação destes recetores na

membrana endosomal de células dendríticas induz a sua ativação e a produção de interferões

do tipo 1, conduzindo a uma resposta do tipo T auxiliar 1 (Th1). A capacidade de loading

destas moléculas nas NPs foi avaliada através do ensaio Oligreen®.

Foram realizados vários ensaios em murganhos para avaliar o potencial antitumoral da

vacina preparada e avaliar o impacte de vários fatores na eficácia da mesma, como sejam (i) a

importância da utilização de NPs como veículo da vacina; (ii) o impacte da funcionalização

das NPs com manose; (iii) o possível efeito sinérgico resultante da associação de dois

ligandos dos recetores Toll-like; (iv) o impacte da combinação de dois antigénios peptídicos

na mesma NP ou em NPs separadas; e (v) o efeito da combinação de NPs contendo péptidos

específicos para MHC classe I ou MHC classe II. Foi realizado um ensaio preliminar no

modelo murino transgénico OT II para avaliar o perfil da resposta imunitária induzida pela

vetorização dos adjuvantes Poly(I:C) e CpG assim como do antigénio modelo OVA pelas

NPs, com ou sem funcionalização de manose. Para avaliar a eficácia antitumoral das NPs,

foram realizados dois ensaios utilizando um modelo murino de melanoma. As NPs contendo

os diferentes antigénios de melanoma e os ligandos dos recetores Toll-like, com ou sem

funcionalização de manose, foram administradas a murganhos antes ou após a administração

das células de melanoma B16F10. Foram realizadas três imunizações intervaladas de duas

semanas, antes da administração do tumor. A velocidade de crescimento tumoral foi avaliada

através da medição do volume tumoral. Após 21 dias da injeção do tumor, os animais foram

sacrificados e os baços e tumores foram recolhidos e pesados. Os esplenócitos foram

colocados em cultura e reestimulados com os péptidos durante 72 h após as quais os

Resumo

xi

sobrenadantes das culturas foram recolhidos para a quantificação das citocinas IFN-γ, IL-2,

IL-4, IL-5, IL-6 e IL-10 por ELISA. A produção de Granzima B foi igualmente avaliada por

ELISA após 4 h de reestimulação. A capacidade proliferativa dos esplenócitos foi avaliada

pelo ensaio AlamarBlue® e a percentagem de células CD3+CD4+ e CD3+CD8+ foi avaliada

por citometria de fluxo. Num esquema terapêutico, foram realizadas três imunizações com

intervalos de uma semana, após 7 dias da administração do tumor. A velocidade de

crescimento tumoral foi avaliada assim como a produção de citocinas pelos esplenócitos após

reestimulação antigénica.

As NPs foram preparadas de forma reprodutível com diâmetros hidrodinâmicos entre

140 e 190 nm, baixos índices de polidispersão (entre 0,11 e 0,28) e potencial zeta próximo da

neutraliade a pH 7,4. A observação das NPs por microscopia de força atómica revelou

morfologia esférica e superfície lisa e uniforme. O ensaio de ligação de lectina revelou que os

resíduos de manose estão à superfície das NPs disponíveis para ligação. Foram observados

diferentes perfis de internalização das NPs pelas linhas celulares imortalizadas e células

dendríticas primárias, sendo que as últimas revelaram internalizar as NPs de forma mais

imediata e independente do tempo de incubação e da concentração. A funcionalização das

NPs com manose aumentou a internalização das NPs pelas linhas celulares imortalizadas mas

não pelas células dendríticas primárias, provavelmente devido à elevada capacidade de

internalização destas. Macropinocitose, endocitose mediada por clatrina e endocitose

dependente de caveolina e de “rafts” lipídicos demonstraram mediar a internalização das NPs.

Uma vez internalizadas, as NPs demonstraram localização endolisosomal e citosólica e

tendência para acumulação próximo do retículo endoplasmático ao longo do tempo. Este

perfil de tráfego intracelular é favorável à indução da resposta imunitária desejada uma vez

que, não só permite o acesso aos recetores Toll-like 3 e 9 localizados na membrana

endosomal, assim como permite a apresentação de antigénios pelas vias MHC classe I e

classe II, uma vez que permite o acesso ao retículo endoplasmático e aos lisosomas,

respectivamente.

As NPs revelaram elevadas capacidades de loading dos vários antigénios e adjuvantes

testados (20 a 40 µg de antigénio e 7 a 11 µg de adjuvante por mg de polímero). O ensaio no

modelo murino transgénico OT II demonstrou que a utilização de NPs para a veiculação de

OVA e de ambos os adjuvantes CpG e Poly(I:C) é crucial para a indução de elevados níveis

de IFN-γ e IL-2, assim como elevadas razões IgG2c/IgG1. A funcionalização das NPs com

manose contribuiu para a indução da resposta imunitária Th1. Nos ensaios utilizando o

modelo murino de melanoma, comparando com a utilização dos antigénios e adjuvantes em

xii

solução, todas as vacinas baseadas em NPs testadas reduziram a velocidade de crescimento

tumoral, quer no regime profilátio quer no terapêutico. A maior redução do crescimento

tumoral foi obtida em animais imunizados com uma combinação de NPs manosiladas

contendo o péptido Melan-A:26-35(27L) (MHC classe I) ou gp100:44-59 (MHC classe II)

associado a ambos os adjuvantes Poly(I:C) e CpG.

Os resultados dos ensaios in vivo realizados, tanto de velocidade de crescimento

tumoral como do perfil de produção das citocinas, de Granzima B e de capacidade de

proliferação dos esplenócitos, conduziram às seguintes conclusões:

• A indução de uma resposta duradoura do tipo Th1 depende da veiculação

simultânea de antigénios e adjuvantes na mesma NP;

• A funcionalização das NPs com manose demonstrou melhorar a eficácia das

mesmas relativamente à capacidade de indução da resposta Th1/antitumoral;

• Os adjuvantes CpG e Poly(I:C) demonstraram exercer um efeito sinérgico quando

veiculados na mesma NP;

• A imunização com dois antigénios específicos para MHC classe I veiculados

separadamente em NPs demonstrou ser superior à utilização de apenas um péptido;

• A veiculação simultânea de dois péptidos específicos para MHC classe I (Melan-

A:26-35(27L) e gp100:209-217(2M)) na mesma NP demonstrou um efeito negativo na

resposta antitumoral, possivelmente devido à competição de ambos os péptidos para as

moléculas MHC classe I;

• A combinação de NPs funcionalizadas com manose contendo ambos os adjuvantes

CpG ou Poly(I:C) e um péptido específico para MHC classe I (Melan-A:26-35(27L) ou classe

II (gp100:44-59) demonstrou a resposta antitumoral mais potente, sugerindo a importância da

ativação simultânea das células T CD4+ e CD8+ na eficácia da resposta antitumoral.

Em suma, o presente trabalho demonstra o potencial da utilização de NPs em

imunoterapia para cancro devido à combinação das suas propriedades de vectorização ativa

para o sistema imunitário assim como da sua capacidade de veiculação simultânea de diversos

antigénios tumorais e adjuvantes da resposta imunitária.

Palavras-chave

Vacinas para cancro, nanopartículas, PLGA, recetor da manose, células apresentadoras de

antigénios, melanoma.

Acknowledgments/Agradecimentos

xiii


Há pequenos momentos que mudam as nossas vidas para sempre. O momento em que

decidi responder ao anúncio de uma vaga para um aluno de doutoramento no Departamento

de Tecnologia Farmacêutica e Farmácia Galénica da Faculdade de Farmácia da Universidade

de Lisboa foi um desses momentos. Na altura pouco sabia sobre nanotecnologia ou sobre o

grupo de investigação e já tinha passado mais de um mês da data limite de resposta ao

anúncio. Mas um impulso levou-me a tentar a minha sorte e decidi escrever à prof. Doutora

Helena Florindo a perguntar se haveria alguma hipótese de ainda considerarem a minha

candidatura. Parece que o meu email chegou no momento certo.

Ao longo do meu doutoramento tive a oportunidade de conhecer pessoas fantásticas

que me marcaram e que vou recordar para sempre. Foi uma jornada que, como todas as outras

na vida, me proporcionou momentos muito bons e momentos muito difíceis. Os momentos

bons vão ser recordados para sempre com muito carinho e saudade. Os momentos mais

difíceis vão ser recordados com orgulho, pois certamente contribuíram para o meu

crescimento pessoal e profissional. Na reta final desta etapa sinto que me tornei uma pessoa

mais resiliente, confiante, tolerante e preserverante. Não podia deixar de agradecer a todas as

pessoas que contribuíram para o sucesso deste meu percurso.

As minhas primeiras palavras de agradecimento não poderiam deixar de ser para a

minha orientadora e amiga prof. Doutora Helena Florindo. Quero agradecer-lhe por ter

aceitado a minha candidatura no verão de 2009 para ser a sua primeira aluna de

doutoramento. Não podia estar mais agradecida por ter tido o privilégio de a ter como minha

orientadora. Quero agradecer-lhe pelo facto de nunca ter ouvido da sua parte uma palavra

negativa. Sempre que as dificuldades apertaram e o caminho pareceu mais tenebroso, ou

mesmo quando cometi os erros mais injustificáveis por distração ou teimosia, sempre recebi

palavras de encorojamento e preserverança. Quero agradecer-lhe o facto de me ter dado

espaço e liberdade para tentar e errar, para decidir e arriscar, sem julgamentos ou acusações.

Sempre me senti confortável com as minhas decisões porque a Helena assim o permitiu. Não

poderia estar mais agradecida por poder ter trabalhado consigo e vou recordar para sempre

com carinho e saudade estes anos de trabalho e amizade.

I am also very grateful for having prof. Véronique Préat as my co-supervisor. I would

like to express my gratitude for having been supervised by such an outstanding scientist and

xiv

to have had the opportunity to work in such an amazing team. I would like to thank you for all

the fruitful discussions and wise advices and also for the recognition that I am receiving for

working with you. I also thank you for the encouragement to continue my carrier as a

researcher.

Quero agradecer à minha co-orientadora prof. Doutora Mafalda Videira por me ter

acompanhado nos meus primeiros passos no laboratório. Recordo especialmente o mês de

agosto de 2010 em que trabalhámos juntas na bancada como duas colegas.

Agradeço também à prof. Doutora Matide de Castro e ao prof. Doutor José Morais na

qualidade de directora e ex-director da Faculdade de de Farmácia da Universidade de Lisboa

por possibilitarem a realização do meu doutoramento nesta nobre casa.

Quero agradecer ao prof. Doutor Rogério Gaspar na qualidade de líder do grupo

Intracell_ADD e ex-líder do grupo Nanomedicines and Drug Delivery Systems pelo

dinamismo que implementou em ambos os grupos de investigação e por despertar o nosso

espírito crítico.

Agradeço também a todos os investigadores que me ajudaram e possibilitaram a

realização deste projecto. Agradeço à investigadora Liana Silva pelos conselhos e orientação e

por possibilitar a colaboração entre o nosso grupo de investigação e o grupo de Molecular

Biophysics and Biological Fluorescence do Centro de Química-Física Molecular & Institute

of Nanoscience and Nanotechnology do Instituto Superior Técnico. Agradeço ao prof. Doutor

Manuel Prieto por me possibilitar o acesso às instalações de microscopia confocal do Centro

de Química-Física Molecular & Institute of Nanoscience and Nanotechnology do Instituto

Superior Técnico. Agradeço à Sandra Pinto por todo o tempo que despendeu em ensinar-me

tudo o que sei sobre microscopia confocal e estudos de colocalização e por estar sempre

disponível para esclarecer as minhas dúvidas. Agradeço a todo o grupo de Biophysics and

Biological Fluorescence do Centro de Química-Física Molecular & Institute of Nanoscience

and Nanotechnology do Instituto Superior Técnico pelo interesse no meu trabalho, pelas

críticas e sugestões e por se mostrarem disponíveis em me ajudar. Agradeço à Doutora

Manuela Gaspar por toda a ajuda que me prestou nos ensaios in vivo, sempre com muita

energia e boa disposição. Agradeço à prof. Doutora Ana Viana pela ajuda no microscópio de

força atómica e pela disponibilidade e prontidão em ajudar-me. Agradeço ao prof. Doutor

Luís Graça da Unidade de Imunologia Celular do Instituto de Medicina Molecular por aceitar

colaborar connosco e me receber no seu laboratório, colocando à minha disposição todos os

recursos necessários para a realização de parte do meu trabalho experimental. Agradeço

também o interesse no meu trabalho e a disponibilidade demonstrada por todos os elementos


xv

do seu grupo (Ana Água-Doce, Sílvia Almeida, Marta Monteiro, Alexandre, Raquel e em

especial Vanessa Oliveira) em me ajudarem e me transmitirem os seus conhecimentos de

imunologia. Agradeço ao prof. Doutor Carlos Afonso e à Catarina Rodrigues do grupo

Bioorganic Chemistry group do iMed.UL aceitarem colaborar connosco e sintetizarem tão

prontamente o polímero marcado com fluorescência, sem o qual parte dos estudos não

poderiam ter sido realizados.

I would like also to acknowledge Dr. Christine Jérôme and Dr. Hélène Freichels from

the Center for Education and Research on Macromolecules, Université de Liège, Liège,

Belgium, for providing part of the functionalized polymers, without which the formulation of

the nanoparticles would not be possible.

I would like to acknowledge the team at FARG for receiving me so well and helping

me in everything they could. Thank you for making me feel that I was part of the team and

never miss home and for everything I have learnt. I will never forget how Bernard, Nathalie

L., Malory, Jean Pierre, Eduardo, Anne des Rieux, Julie T., Salomé, Eloise, Edith, Claúdia,

Nicholás, Régis, Damien, Nathalie S., Aude, Patrick, Vanessa, Pauline, and specially Gaëlle

welcome me. Un grand MERCI à tous!

Não poderia deixar de agradecer aos meus colegas e amigos do Intracell_ADD. Foi

com muita alegria que vos fui vendo chegar ao grupo e que juntos construímos esta equipa

onde foi tão agradável trabalhar independentemente de todas as dificuldades que possamos ter

passado. Sinto-me uma sortuda por poder ter partilhado estes anos da minha vida convosco!

Não posso deixar de agradecer a cada um de vós. Raquel, obridaga por me contagiares com a

tua alegria, energia e curiosidade cinetífica e por estares sempre disponível para ouvires as

minhas lamúrias. Eva, obrigada pela tua amizade, por estares sempre disponível para me

ajudar e por teres sempre uma palavra amiga e positiva nos momentos mais difícieis. Carina,

obrigada pela boa energia que trouxeste ao laboratório e pelo bom ambiente que manténs, por

estares sempre disponível para ajudar e pela tua amizade. Obrigada às minhas meninas

cassulas Ana Matos e Melissa pela frescura que trouxeram ao laboratório e amizade que

demonstraram em tão pouco tempo. Obrigada aos meninos do laboratório João, Nuno e André

(são poucos mas bons) por nos farerem rir e por acartarem o material pesado. Agradeço

também à Andreia, Ana Carreira e Vanessa, porque apesar de ter tido menos contacto

convosco, não deixámos de partilhar vários bons momentos que vou recordar com carinho.

Ana Saraiva, obrigada pela amizade, pelos teus ensinamentos sábios e por ser sempre tão

agradável estar contigo. Natércia, obrigada pela tua alegria e espontaneadade.

xvi

Não posso deixar de agradecer aos colegas que me receberam quando cheguei ao

laboratório Sara, Joana Marto, Andreia Ascenso, Rui Lopes, Lara, Giuliana e Gonçalo.

Obrigada por me receberem tão bem e pelos bons momentos que partilhámos ao longo destes

anos. Deixo também um agradecimento especial à Ana Salgado, à Carla, à D. Fernanda e à

Alexandra pelo apoio e disponibilidade que sempre demonstraram em me ajudar no que fosse

preciso.

Deixei para o fim as pessoas mais importantes da minha vida, a minha família e o

João. Pai e mãe, qualquer agradecimento que eu escreva aqui nunca será suficiente para

exprimir todo o orgulho que tenho em ser vossa filha e o quão vos estou agradecida pela

educação que me deram e por todo o esforço que ao longo das vossas vidas fizeram para

garantir o melhor para mim. Se hoje estou a terminar esta tese devo-lo a vocês e aos valores

que me ensinaram. Muito obrigada por tudo. Mana, tu sabes que és e sempre serás o modelo

que eu tento seguir. Tal como os pais tu educaste-me e ensinaste-me tudo o que sei hoje.

Muito obrigada por estares sempre presente e teres sempre um conselho sabio para me dar.

Cunhadinho, tu sabes que és como um irmão para mim e o quanto me inspiraste em cumprir

esta etapa da minha carreira. Muito obrigada pelos teus ensinamentos e conselhos e pela tua

amizade. Muito obrigada às minhas queridas sobrinhas Andreia e Ritinha por tantos

abracinhos e beijinhos que derretem o coração da tia. Desculpem se a tia não esteve tão

disponível para as nossas brincadeiras e pinturas nos últimos tempos.

Por fim, a pessoa mais especial com quem partilhei os últimos treze anos da minha

vida. João, não tenho palavras que possam exprimir o quanto te quero agradecer por estares

sempre ao meu lado e me apoiares incondicionalmente nas minhas decisões. Obrigada por

rires comigo nos bons momentos. Obrigada por chorares comigo nos momentos mais difíceis

e por enxugares as minhas lágrimas e me mostrares o caminho. Obrigada pela tua panciência

quando eu me torno insuportável. Obrigada por esperares por mim.

List of abbreviations

xvii


α-GalCer Alpha-galactosylceramide

β-BL β-butyrolactone

ε-CL ε-caprolactone

ABC Amphiphilic block copolymers

Abs Antibodies

ADO Adenosine

AFM Atomic force microscopy

AICD Activation-induced cell death

APCs Antigen-presenting cells

APLs Altered peptide ligands

BSA Bovine serum albumin

CD1 Cluster of differentiation 1

CLRs C-type lectin receptors

CMPs Carbohydrate mimetic peptides

Con A Concanavalin A

CSC Cancer stem cells

CTLs Cytotoxic T lymphocytes

CTLA-4 Cytotoxic T-lymphocyte antigen-4

DCM Dichloromethane

DCs Dendritic cells

DC-SIGN Dendritic cell-specific intracellular adhesion molecule-3-grabbing non-

integrin

DD Differential display

DDSs Drug delivery systems

DLS Dynamic light scattering

DMSO Dimethilsulfoxide

DPBS Phosphate buffer containing Ca2+ and Mg2+

dsRNA Double stranded RNA

DT Diptheria and Tetanus

DXO 1,5-dioxepan-2-one

EMA European Medicines Agency

EPR Enhanced permeability and retention

ER Endoplasmic reticulum

F-PLGA Fluorescein derivative-grafted poly(lactic-co-glycolic) acid

FDA Food and Drug Administration

FITC Fluorescein isothiocyanate

GA Glycolide/glycolic acid

xviii

GM-CSF Granulocyte macrophage colony-stimulating factor

Grz B Granzyme B

IAP Inhibitor of apoptosis proteins

IFN-γ Interferon gamma

HA Hemagglutinin

HAV Hepatitis A virus

HBsAg Hepatitis B surface antigen

HBV Hepatitis B virus

HCV Hepatitis C virus

HIB Haemophilus influenza type B

HLA Human leukocyte antigen

HPLC High performance liquid chromatography

HPV Human papilloma virus

HRP Horseradish peroxidase

HSV Herpes simplex virus

hTERT Human telomerase reverse transcriptase

i.d. Intradermal

IFN-α Interferon alpha

IL Interleukin

i.m. Intramuscular

iDCs Immature dendritic cells

IRF3 Interferon regulatory factor 3

ISCOM Immune stimulating complexes

LA Lactide/lactid acid

LCs Langerhans cells

LDV Laser Doppler Velocimetry

LNs Lymph nodes

LPS Lipopolysaccharide

MALT Mucosal-associated lymphoid tissue

man-PEG-b-PCL Mannose-grafted poly(ε-caprolactone-b-ethylene glycol)

mDCs Mature dendritic cells

MDSCs Myeloid-derived suppressor cells

MHC Major histocompatibility complex

MIIC Major histocompatibility complex class II compartment

MPLA Monophosphoryl lipid A

MPs Microparticles

MPS Mononuclear phagocytic system

MR Mannose receptor

MSs Microspheres

MTT 3-(4,5-dimethylthiazol-2-yl)-2,3-(4,5-dimethylthiazol-2-yl)-2,5-


xix

diphenyltetrazolium bromide

MUC1 Human milk mucin

NF-κB Nuclear factor-κB

NK Natural killer

NKT Natural killer T

NOD Nucleotide oligomerization domain

NP-F Fluorescent NPs in which one tenth of the PLGA mass was replaced by

fluorescein derivative-grafted PLGA

NP-R Fluorescent NPs in which one tenth of the PLGA mass was replaced by

rhodamine 6G derivative-grafted PLGA

NPs Nanoparticles

NSs Nanospheres

ODN Oligodeoxynucleotides

OVA Ovalbumin

P3HB Poly(3-hydroxybutyrate)

PALS Phase Analysis Light Scattering

PAMPs Pathogen-associated molecular patterns

PAP Prostatic acid phosphatase

PBMCs Peripheral blood mononuclear cells

PCL Polycaprolactone

PD-1 Programmed death-1

pDCs Plasmacytoid DCs

PdI Polydispersity Index

PDLA Poly(D-lactic acid)

PDLLA Poly(D,L-lactic acid)

PDXO Poly(1,5-dioxepan-2-one)

PEA Polyethylene adipate

PEG Poly(ethylene glycol)

PEG-b-PLGA Poly(D,L-lactic-co-glycolide-b-ethylene glycol)

PEI Polyethylenimine

PEST Penicillin - streptomycin

PGA Polyglycolide/polyglycolic acid

PHBV Poly(3-hydroxybutyrate-co-3-hydroxyvalerate)

PLA Polylactide/polylactic acid

PLGA Poly(lactic-co-glycolide) or poly(lactic-co-glycolic) acid

PLGA-α-Cl-ε-PCL Poly(lactide-co-glycolide-co-α-cloro-ε-caprolactone)

PLLA Poly(L-lactic acid)

PPF Poly(propylene fumarate)

PGE2 Prostaglandin E2

PRRs Pattern recognition receptors

http://en.wikipedia.org/w/index.php?title=Polyethylene_adipate&action=edit&redlink=1

xx

PSA polysialic acid

PTMC Poly(trimethylene carbonate)

R-PLGA Rhodamine 6G derivative-grafted poly(lactic-co-glycolide)

RDA Representational difference analysis

RES Reticuloendothelial system

RGD Arg-Gly-Asp

RIG Retinoic-acid inducible gene

RLRs Retinoic-acid inducible gene-like receptors

ROP Ring opening polymerization

SAGE Serial analysis of gene expression

s.c. Subcutaneous

scFv Single-chain Fv antibody

SeM Streptococcus equi M-like protein

Siglec Sialic acid-binding immunoglobulin-like lectin

siRNA Small interfering RNA

SSH Suppression subtractive hybridization

ssRNA Single-stranded RNA

S. equi Streptococcus equi

TAAs Tumor-associated antigens

TACA Tumor associated carbohydrate antigens

TAP Transporter associated with antigen processing

TCR T cell receptor

TGF Tumor growth factor

TILs Tumor-infiltrating lymphocytes

Tg Glass transition temperature

Tm Melting temperature

TMC N-trimethyl chitosan

Th T helper

TICAM Toll-interleukin 1 receptor domain-containing adaptor molecule

TIR Toll-interleukin 1 receptor domain

TLRs Toll-like receptors

TRP2 Tyrosinase-related protein 2

TT Tetanus toxoid

TNF Tumor necrosis factor

VLP Virus-like particle

VSSP Very small size proteoliposome

WGA Wheat germ agglutinin

W/O Water-in-oil

W/O/W Water-in-oil-in-water

List of figures

xxi

List of figures

Figure 1.1. Recommended primary and adjuvant treatment for melanoma (stage 0 to IV),

according to National Comprehensive Cancer Network (NCCN) guideline,

v1.2014. The box in the lower right presents the systemic therapy recommended

for metastatic or advanced melanoma (widespread stage IV). Adapted from

National Comprehensive Cancer Network (NCCN) Guideline for Patients,

v1.2014.

6

Figure 1.2. Antigen presentation by dendritic cells to T cells. A. Activated DCs presenting

extracellular antigens on MHC class II complexes to CD4+ T cells induce the

differentiation of CD4+ T cells into T helper (Th) 1 or Th2 CD4+ T cells,

depending on the cytokines produced by DCs upon activation. IL-2, IL-3, IFN-γ,

TNF-α and GM-CSF induce a Th1 profile while IL-4, IL-5, IL-6, IL-10 and IL-13

induce a Th2 profile. Other secondary Th profiles, which are not represented in

the figure, can also be induced (Th17, Th9, Th22, Treg). Th1 cells enhance the

activation of CD8+ T cells and CTL functions through the secretion of cytokines

(such as IL-2, IL-12 and IFN-γ) and Th2 stimulate the secretion of antibodies by

B cells. The recruitment of cells of the innate immune system, such as NK cells,

granulocytes and macrophages, plays also an important role in the immune

response against both extracellular and intracellular pathogens. B. Intracellular

antigens are presented through MHC class I to CD8+ T cells inducing the

differentiation of CTLs, which are the main effector cells in pathogen-infected

cell lysis and tumor cell lysis. CD8+ T cells can also develop a memory

phenotype that will allow a prompt response in the case of a second infection or

tumor relapse or metastasis. Extracellular antigens can also induce this kind of

response through their cross-presentation by the MHC class I pathway to CD8+ T

cells.

10

Figure 1.3. DC role in T cell activation and DC-T cell synapse. DCs play a major role in

immunosurveillance and immune response initiation, placing a bridge between

the innate and the adaptive branches of the immune system. Upon contact with

pathogens or tumor cells/apoptotic tumor bodies, iDCs start the processing of

antigens for further presentation to T cells. The recognition of pathogen

associated molecular patterns (PAMPs) from pathogens by the pattern recognition

receptors (PRRs) on DCs plays an essential role for proper DC maturation. After

migration from the periphery to the lymph nodes, mDCs have contact to naïve T

cells. In the DC-T cell synapse, three signals are essential for T cell activation.

Signal 1 is the antigen-specific signal and results from the presentation of MHC-

12

xxii

antigen complexes by DCs and their recognition by the antigen-specific TCR.

Signal 2 is the co-stimulatory signal, mainly mediated by the trigger of CD28 and

CD40L on T cells by CD80, CD86 and CD40 expressed by mDCs. Signal 3 is the

cytokine priming signal which is mediated by many cytokines and interferons

secreted by mDCs and determines polarization of the activated T cells and

consequently the profile of the initiated immune response.

Figure 1.4. Desired immune response elicited by a therapeutic cancer vaccine. Cancer

vaccines must target antigens and immunoadjuvants to iDCs either in the skin or

in the lymph nodes. After processing, antigens will be presented through MHC

class I or MHC class II complexes to CD8+ or CD4+ T lymphocytes, respectively.

Simultaneously, immunoadjuvants promote the activation and maturation of DCs,

which consequently express costimulatory factors and secrete cytokines, such as

INF-γ and IL-12, which are crucial in the effective stimulation of T cells and in

determining the CD4+ phenotype. CD8+ lymphocytes acquire a cytotoxic

phenotype, known as CTLs, able to cause tumor cell lysis directly. Some of these

CD8+ lymphocytes also acquire a memory phenotype which is crucial to the

maintenance of immunity. Th1 cells enhance the action of CTLs by enhancing

clonal expansion at the tumor site and promoting the generation and maintenance

of the memory phenotype. Th1 cells secrete IFN-γ, which can further sensitize

tumor cells to CTL action by upregulating MHC class I and other components of

the antigen-processing machinery and promoting the recruitment of cells from the

innate immune system such as the NK cells, granulocytes or macrophages that

also contribute to tumor cell lysis. Adapted from Silva J.M. et al. (2013) J Control

Release; 168:179–199.

14

Figure 1.5. Melanoma altered peptide ligands Melan-A:26-35(27L) and gp100:209-217(2M).

The substitution of the native alanine by lysine in the position 2 of the peptide

Melan-A:26-35 renders it more immunogenic and more resistent to peptidases.

The substitution of threonine in the wild type form of the peptide gp100:209-217

by methionine in the position 2 improves the binding of the peptide to the MHC

class I molecule groove, increasing its immunogenicity.

20

Figure 1.6. TLR cellular location and respective ligands. Mammalian TLRs are classified into

several groups based on the type of PAMP they recognize. TLR1, 2, 4 and 6

recognize lipids, such as lipopolysaccharide (LPS) from Gram-negative bacteria,

lipoteichoic acid from Gram-positive bacteria and lipoarabinomannan from

mycobacteria. TLR5 senses bacterial flagellin. TLR3, 7, 8 and 9 detect nucleic

acids derived from viruses and bacteria. TLR3 recognize double stranded RNA

(dsRNA), which is produced by many viruses during replication. TLR7

recognizes synthetic imidazoquinoline-like molecules, guanosine analogs such as

loxoribine, viral single-stranded RNA (ssRNA) and small interfering RNA

29

List of figures

xxiii

(siRNA). Human TLR8, which has high homology to mouse TLR7, participates

in the recognition of imidazoquinolines and ssRNA. TLR9 recognizes non-

methylated CpG DNA motifs present in bacterial and viral genomes, as well as

non-nucleic acids, such as hemozoin from the malaria parasite. TLRs can also be

divided into two subfamilies distinguished by their subcellular localization:

TLR1, 2, 4, 5, 6 and also TLR10 in humans and TLR11 in mice are expressed at

the cell surface while TLR3, 7, 8 and 9, are localized in the endosomal

membrane. From Silva JM. et al. (2014) Encyclopedia of Biomedical Polymers

and Polymeric Biomaterials, Taylor & Francis Editorial Group, London, UK,

2014 [In Press].

Figure 1.7. TLR signaling. Following stimulation, all TLRs except TLR3 recruit MyD88,

IRAKs and TRAF6 to activate the Ubc13/TAK1 pathway, allowing NF-ĸB to

translocate to the nucleus. TAK1 also activates the MAPK pathway, which

mediates AP-1 activation. IRF5 is recruited by the MyD88-IRAK4-TRAF6

complex, phosphorylated and translocated to the nucleus. NF-ĸB, AP-1 and IRF5

control the expression of genes encoding inflammatory cytokines. TIRAP is

recruited by TLR4, TLR1/2 and TLR2/6, activating the MyD88-dependent

pathway. TRIF is recruited by TLR3 and TLR4, and interacts with TBK1 and

IKKi, which mediate phosphorylation of IRF3. Phosphorylated IRF3 dimerizes

and is translocated to the nucleus to induce expression of type I IFN and IFN-

inducible genes. TRAF3 forms a complex with TBK1 and IKKi. TRIF interacts

with TRAF6 and RIP1, which mediate NF-ĸB activation. TLR4, but not TLR3,

utilizes TRAM for activation of the TRIF-dependent pathway. Adapted from

Kawai T. & Akira S. (2007) Semin Immunol; 19: 24–32.

30

Figure 1.8. Mechanisms of bulk and surface erosion of polymers. From Peppas N. and

Narasimah B. (2014) J Control Release; pii: S0168-3659(14)00450-7.

47

Figure 1.9. Typical cargo release curve from aliphatic polyester-based particulate vaccine

delivery systems. An exemplificative curve of the release behavior of a

macromolecule from an aliphatic polyester-based particulate delivery system is

represented. The release from aliphatic polyester particulate delivery systems

normally happens in three phases. It starts with a “burst release phase” (1.) that

can function as the vaccine priming dose. The following “lag phase” (2.) and the

final “sustained final phase” (3.) can provide controlled release of the antigens

and adjuvants and mimic vaccine boosting doses. From Silva JM. et al. (2014)

Encyclopedia of Biomedical Polymers and Polymeric Biomaterials, Taylor &

Francis Editorial Group, London, UK, 2014 [In Press].

49

Figure 1.10. Schematic representation of a functionalized particle intended to function as a

vaccine delivery system. NPs can be functionalized with antibodies directed to

receptors expressed on cells of the immune systems (e.g. anti-DEC205 to target

57

xxiv

DCs). Carbohydrates are frequently used for active targeting of NPs. Simple

carbohydrate residues, such as mannose or fucose, are used to target C-type

lectins expressed on DCs. More complex carbohydrates can be also used, such as

hyaluronic acid which targets CD44 receptors on several tumor cell types. NPs

can be equipped with an immunogenic coating in order to increase their

recognition by the immune system (e.g. coating with immunogenic polymers such

as chitosan or pluronic block copolymers). The cargo to be delivered by NPs can

be either adsorbed at NP surface or/and entrapped in the polymeric matrix.

Figure 1.11. Desired immune responses against extracellular and intracellular pathogens. A.

Once recognized and internalized by DCs, extracellular pathogens are digested in

endo-lysosomal organelles and resultant peptides are loaded on MHC class II

molecules. MHC-antigen complexes are presented on DC surface to CD4+ T

cells. The recognition of the antigens happens through the TCR on T cells. The

costimulatory environment resultant from pathogen infection and DC maturation

causes T cell activation, differentiation and proliferation. Upon extracellular

pathogen infection, the cytokine priming by DCs favors a Th2 profile, which

results in the activation of B cells and secretion of antibodies against the

pathogen. These antibodies can act through direct pathogen neutralization,

complement activation and/or signaling the pathogen to phagocytic cells through

opsonization. The recruitment of cells of the innate immune system, such as NK

cells, granulocytes and macrophages, plays also an important role in the immune

response against extracellular pathogens. Memory Th1 and Th2 cells are also

induced and rapidly reacquire their lineage-specific effector functions upon

antigen reencounter. B. Intracellular pathogens seem to need a much more

complex immune response with the involvement of cellular and humoral branches

of the immune system. Antigens from intracellular pathogens are presented

through MHC class I complexes to CD8+ T cells inducing the differentiation of

CTLs, which are the main effector cells in pathogen-infected cell lysis. CD8+ T

cells can also develop a memory phenotype that will allow a prompt response in

the case of a second infection. The presentation of pathogen antigens through

MHC class II to CD4+ T cells is crucial for the enhancement of CTL functions

through the auxiliary action of Th cells. Th1 cells enhance CTL functions through

the secretion of cytokines (such as IL-2, IL-12 and IFN-γ) and Th2 cells stimulate

the secretion of antibodies by B cells. Players from the innate immune system,

such as NK cells, granulocytes and macrophages, are also recruited in the

destruction of intracellular pathogens.

63

Figure 2.1. Zeta potential of NPs and man-NPs at three pH values mimicking intracellular

compartments: DPBS at pH 7.4 (mimicking cytosol) and in 200 mM

phosphate/citrate buffer at pH 6.0 (mimicking early endosomes) or pH 5.0

84

List of figures

xxv

(mimicking lysosomes). Mean ± SD; N = 3, n = 3. Statistics: one-way ANOVA

and Tukey’s post test. Relative to zeta potential at pH 7.4: ** p < 0.01. NS,

statistically non-significant. Two-way ANOVA and Bonferroni’s post test were

used to compare NPs and man-NPs.

Figure 2.2. Analysis of NP morphology and size by atomic force microscopy. 3D images of

NPs (A) and man-NPs (C), as well as section analysis of NPs (B) and man-NPs

(D) where mean diameters are presented. Mean diameters ± SD were calculated

from fifty individual NPs from section analysis of five different areas imaged for

each type of NP.

85

Figure 2.3. Detection of mannose residues at man-NP surface using a lectin recognition

assay. A. Schematic representation of man-NP aggregation in the presence of Con

A due to the binding of mannose residues to one of the four binding sites in Con

A tetramers. B. NP size distribution represented as frequency curves of Intensity

(%) in function of diameter determined by DLS for man-NPs (upper graph) and

NPs (lower graph), before and after the incubation with Con A. C. Confocal

microscopy images of the NP-Con A-FITC aggregates (scale bars = 20 µm). D.

Fluorescence given in arbitrary units (a.u.) of NP-Con A-FITC aggregates. Mean

± SD; N = 3, n = 3. Statistical analysis: one-way ANOVA and Tukey’s post test.

86

Figure 2.4. The effect of temperature (4 °C, 25 °C and 37 °C) in DPBS (A), the effect of pH

(DPBS at pH 7.4 or phosphate/citrate buffer 200 mM at pH 6.0 or 5.0) at 37 °C

(B) and the effect of fluid constitution (DPBS or cell culture medium, CCM) at 37

°C on NP size are represented as the overlay of frequency curves of Intensity (%)

as a function of the diameter over time determined by DLS (histograms). The

variation of mean hydrodynamic diameter and zeta potential of NPs over time is

represented in the graphics on the right. The analysis of a representative batch of

NPs out of four is presented. (N = 4, n = 3). Statistics: two-way ANOVA and

Bonferroni’s post test. * p < 0.05, *** p < 0.001.

87

Figure 2.5. Determination of cell viability by the MTT assay of JAW SII DCs and J744.1

macrophage-like cells incubated for 42 h with man-NPs and NPs, respectively

(A). Determination of cell viability by the AlamarBlue® assay of BMDCs

incubated for 24, 42 and 48 h with NPs (B). Cell culture medium and 0.5 % (v/v)

triton X-100 were used as negative and positive control, respectively. Mean ± SD;

N = 3, n = 3. Statistics: one-way ANOVA and Tukey’s post test. Relative to cell

culture medium: * p < 0.05, ** p < 0.01 and *** p < 0.001. Two-way ANOVA

and Bonferroni’s post test were used to compare JAW SII and J744.1 cell lines

(A) and incubation times (B). ### p < 0.001.

88

Figure 2.6. Internalization of NPs by JAW SII murine immature DCs (A), J744.1 murine

macrophage-like cells (B) and BMDCs (C), expressed by percentage of positive

89

xxvi

cells in the population sorted by a flow cytometer. Mean ± SD; N = 3, n = 3. One-

way ANOVA and Tukey’s post test were used to compare uptake at any time

point to 3 h of incubation in the respective NP concentration: NS, statistically

non-significant; * p < 0.05, ** p < 0.01 and *** p < 0.001. Two-way ANOVA

and Bonferroni’s post test were used to compare uptake at 100 µg/ml vs. 250

µg/ml: # p < 0.05, ## p < 0.01 and ### p < 0.001.

Figure 2.7. Confocal microscopy images obtained after 18 h of incubation of BMDCs with

three different concentrations of NPs (250, 500 and 1000 µg/ml). Plasma

membrane was stained with WGA-Alexa Fluor® 594. Representative images of

three independent experiments are shown. Scale bars = 15 µm.

90

Figure 2.8. Effect of endocytic inhibitors on the internalization of NPs by BMDCs. A.

Energy-dependency of NP internalization by BMDCs. Clathrin-mediated

endocytosis (CME) involvement was analyzed by confocal microscopy (B) and

flow cytometry (C) after treatment with dynasore, chlorpromazine and hypertonic

sucrose solution. For colocalization analysis of NPs and OVA in BMDCs (D),

NP-R (green) were added to BMDCs at 500 µg/ml and incubated for 30 min or 18

h. OVA-Alexa Fluor® 647 (red) were simultaneously added at 10 µg/ml and

incubated for 30 min. Hoescht® 342 was used for nucleus contrast (blue).

Colocalized pixels from red and green channels, obtained through WCIF ImageJ

software, appear in white (right). This software was also used to quantify the

percentage of colocalization of the NPs with OVA (%ColNP) and OVA with NPs

(%ColOVA), the Mander’s coefficients for both entities (MNPs and MOVA) and the

Pearson’s correlation coefficient (Rr). Mean ± SD from at least 25 cells from six

independent images is represented. Macropinocytosis involvement analyzed by

confocal microscopy (E) and flow cytometry (F) after treatment with rottlerin and

cytochalasin D. G. Caveolin and lipid raft involvement analyzed by flow

cytometry after treatment with genistein and nystatin. DMSO was tested as the

vehicle control. Scale bars = 25 µm. Results from flow cytometry analysis are

expressed as normalized median fluorescence intensity relative to untreated

samples (mean ± SD; N = 3, n = 3). Statistics: one-way ANOVA and Tukey’s

post test. *** p < 0.001. Two-way ANOVA and Bonferroni’s post test were used

to compare uptake at 4 °C and 37 °C at different time points (A).

92

Figure 2.9. Intracellular trafficking and colocalization analysis of NPs in BMDCs. A.

Confocal microscopy images obtained after 30 min, 1, 2, 3 and 18 h of BMDCs

incubation with NP-R (red). Cells were incubated with rabbit anti-mouse anti-

EEA1 for early endosomes (EE), anti-Rab7a for EE and late endosomes (EE +

LE), anti-LAMP1 for LE and lysosomes (LE + Lys) and anti-calnexin for the

endoplasmic reticulum (ER) and then labeled with goat anti-rabbit IgG Alexa

Fluor® 488 (green). Hoescht® 342 was used for nuclei contrast (blue). Scale bars

94

List of figures

xxvii

= 15 µm. Colocalized pixels from red and green channels, obtained through

WCIF ImageJ software, appear in white below the respective image. This

software was also used to quantify the percentage of colocalization of NPs with

each organelle-labeling protein (B), the Mander’s coefficient values for the red

channel (M1) (C) and the Pearson’s correlation coefficient (Rr) (D). Mean ± SD

from at least 25 cells from six independent images is represented.

Figure 2.10. Percentage of colocalization of organelles (green pixels) with NPs (red pixels)

(A). Mander’s coefficient of green channel (M2) (B). Mean ± SD from at least 25

cells from six independent images is represented.

95

Figure 2.11. Comparison of the cellular uptake of mannose-grafted NPs containing 15 %

(w/w) (man(15%)-NPs) or 30 % (w/w) (man(30%)-NPs) of mannose-grafted

PEG-b-PCL polymer with non-functionalized NPs (NPs). NPs at 100 or 250

µg/ml were added to JAW SII DCs (A) or BMDCs (C) and incubated for 24 h.

NPs at 250 µg/ml were added to J744.1 macrophage-like cells and incubated for 3

h (B). NP internalization levels are expressed by percentage of positive cells in

the population sorted by a flow cytometer (mean ± SD, N = 3, n = 3). Statistics:

two-way ANOVA and Bonferroni’s post test. Relative to non-functionalized NPs:

NS, statistically non-significant; * p < 0.05, *** p < 0.001. One-way ANOVA

and Tukey’s post test were used in B.

96

Figure 2.12. Surface expression of the mannose receptor (MR/CD206) and the costimulatory

molecule CD80 by BMDCs before and after treatment with LPS. Black lines:

untreated BMDCs. Colored lines: BMDCs treated with 100 ng/ml LPS from

E.coli for 24 h. Tinted curves: isotype antibody control. Numbers correspond to

median fluorescence intensity levels. One representative experiment out of three

is represented.

97

Figure 2.13. Schematic representation of the hypothetical intracellular trafficking of the

developed NPs in DCs. NPs are internalized by DCs and contained within early

endosomes (EE), where NPs start to degrade and release some of their cargo.

Immunoadjuvants with receptors located in the endosomal membrane might get

access to them. As endosomes start to mature, their pH drops and NPs become

neutral or positively charged, being able to interact with endo-lysosomal

membranes and escape to cytosol. Here, NPs accumulate nearby the endoplasmic

reticulum (ER), where the loading of antigens on MHC class I molecules

happens. MHC class I-peptide complexes are transported to the cell surface in

exocytic vesicles to be presented to CD8+ T cells. Some NPs continue to degrade

in the lysosomes, releasing their cargo. Here, peptides can be loaded on MHC

class II molecules. MHC class II-peptide complexes are then transferred to cell

surface to be presented to CD4+ T cells.

101

xxviii

Figure 3.1. SDS-PAGE (12 % gel) of NPs entrapping OVA and the adjuvants Poly(I:C) and

CpG. Lanes: (1) Standard molecular weight markers; (2) Standard OVA solution

(4 µg); (3) NP blank; (4) NP[OVA]; (5) NP[OVA+CpG]; (6)

NP[OVA+Poly(I:C)] and (7) NP[OVA+Poly(I:C)+CpG]. A representative image

of three independent experiments is presented.

122

Figure 3.2. Anti-OVA specific immunoglobulin sera titers from OT II mice immunized with

OVA- and adjuvant-loaded NPs. OT II mice were immunized with OVA and the

adjuvants CpG and Poly(I:C) in solution, NP[OVA], NP[OVA+P+C] or man-

NP[OVA+P+C] on weeks 0, 2 and 4. The production of anti-OVA total IgG (A),

IgG1 (B) and IgG2c (C) in sera collected on weeks 1,3,5,7,9 and 12 after the first

immunization were evaluated by ELISA. Sera from naїve OT II mice were used

as control. The titres reported are the reciprocal of serum dilution that gave an

optical density 5 % higher than the control at the same dilution. D. Th1/Th2

indexes in OT II mice immunized with OVA and adjuvant-loaded NPs, calculated

as a ratio of the obtained mean IgG2c and IgG1 titers for each group at each time

point. The grid line at Th1/Th2 = 1 separates the Th1-biased indexes (> 1) from

the Th2-biased ones (< 1). The bars correspond to mean ± SD; n = 3. Statistics:

two-way ANOVA and Bonferroni’s post test. Relative to levels determined on

naїve mice: * p < 0.05, ** p < 0.01 and *** p < 0.001.

123

Figure 3.3. Cytokine levels in supernatants of cultured splenocytes from immunized OT II

mice. Twelve weeks after the first immunization mice were sacrificed, spleens

were collected and splenocytes were put in culture and restimulated with 20

μg/ml of OVA for 72 h. Cytokine titers (A. IL-2, B. IFN-γ, C. IL-4, D. IL-6) were

determined by ELISA and compared to the respective standard. Mean ± SD; n =

3. Statistics: one-way ANOVA and Tukey’s post test. Relative to levels

determined on naїve mice: * p < 0.05, ** p < 0.01 and *** p < 0.001.

125

Figure 3.4. Antitumor therapeutic efficacy of the nanoparticulate vaccines. A. Schedule of the

therapeutic assay. B. Mean tumor growth curves given by mean tumor volume

over time, determined by V = ½ × (L × W2), where L (length) is the longest

dimension and W (width) is the perpendicular dimension to the length. C. Mean

final tumor weight per 100 g of final body weight. D. Mean final spleen weight

per 100 g of initial body weight. Mean ± SD, N = 6, n = 3. Statistics: two-way

ANOVA and Bonferroni’s post test (B) or one-way ANOVA and Tukey’s post

test (C & D); * p < 0.05, ** p < 0.01 and *** p < 0.001.

126

Figure 3.5. Cytokine levels in the supernatants of cultured splenocytes from mice in the

therapeutic study. Splenocytes were restimulated with 20 μg/ml of Melan-A:26

(A) or gp100:209 (B) for 72 h, and cytokines were measured in culture

supernatants by ELISA. Mean ± SD, n = 3. Statistics: one-way ANOVA and

Tukey’s post test. Relative to the saline control group: * p < 0.05, ** p < 0.01 and

127

List of figures

xxix

*** p < 0.001.

Figure 3.6. Efficacy of the nanoparticulate vaccines in the protection against tumor challenge.

A. Schedule of the prophylactic assay. B. Mean tumor growth curves given by

tumor volume. C. Representative images of excised tumors from each treatment

group by the end of the assay. D. Mean final tumor weight per 100 g of final body

weight. E. Mean final spleen weight per 100 g of initial body weight. Mean ± SD,

N = 6, n = 3. Statistics: one-way ANOVA and Tukey’s post test. Relative to the

saline control group: * p < 0.05, ** p < 0.01 and *** p < 0.001.

129

Figure 3.7. Cytokine levels in the supernatants of cultured splenocytes from mice in the

prophylactic study. Splenocytes were restimulated with 20 μg/ml of Melan-A:26

(A) or gp100:209 or gp100:44 for group (9) (B) for 72 h, and cytokines were

measured in culture supernatants by ELISA. Mean ± SD, n = 3. Statistics: one-

way ANOVA and Tukey’s post test. Relative to the saline control group: * p <

0.05, ** p < 0.01 and *** p < 0.001.

130

Figure 3.8. Relative granzyme B (Grz B) production by splenocytes collected from mice in

the protection study. Splenocytes (effector cells, E) were cultured with B16F10

cells (target cells, T) or breast cancer MDA-MB-231 cells as unspecific target

control (unsp T). After 4 h of incubation, Grz B levels were measured in culture

supernatants by ELISA. Relative ratios of the Grz B production were determined

by comparing the production in the presence or absence of target cells. Mean ±

SD, n = 3. Statistics: one-way ANOVA and Tukey’s post test. Relative to levels

of the saline control group: * p < 0.05, ** p < 0.01 and *** p < 0.001.

131

Figure 3.9. Splenocyte proliferation assay from mice in the protection study. Splenocytes

were restimulated with 20 µg/ml of each antigen (Melan-A:26, gp100:209 or

gp100:44), 1 μg/ml of the mitogen LPS from E. coli, Triton X-100 0.025 % (v/v)

as a negative control, or left untreated for 48 h. Splenocyte proliferation was

measured using the AlamarBlue® reagent. Stimulation Index (SI) was calculated

as the ratio of the proliferation in each sample to the proliferation of the untreated

splenocytes for each immunization group. Mean ± SD, n = 3. Statistics: two-way

ANOVA and Bonferroni’s post test; * p < 0.05, ** p < 0.01 and *** p < 0.001.

132

Figure 3.10. Representative flow cytometry histograms of the percentages of CD3+ versus

CD4+ and CD3+ versus CD8+ T cells for each group in the protection study, after

restimulation with Melan-A:26 (A), gp100:209 (C) or gp100:44 (D). Mean

percentages of each T cell subset after restimulation Melan-A:26 (B), gp100:44

(E) or gp100:209 (F) are presented. Mean ± SD, n = 3. Statistics: one-way

ANOVA and Tukey’s post test. Relative to the saline control group: * p < 0.05,

** p < 0.01 and *** p < 0.001.

133

Figure 3.11. Tolerability to the vaccines. The tolerability to vaccine formulations was 134

xxx

evaluated by monitoring body weight of the animals throughout the therapeutic

(A) and the protection (B) studies, given by the mean ratio of body weight to the

initial body weight of all animals. Mean ± SD, N = 6, n = 3.

Figure 3.12. Expression of the costimulatory molecules CD40 and CD86 by BMDCs upon

incubation with NPs. BMDCs were incubated for 24 h with OVA 2.5 µg/ml, LPS

100 ng/ml, Poly(I:C) 5 µg/ml, NP[blank], NP[OVA], NP[OVA+P],

NP[OVA+P+C] and man-NP[OVA+P+C)] or left untreated. After staining with

anti-mouse fluorescently labeled monoclonal antibodies for flow cytometry (PE-

CD11c, FITC-CD86 and APC-CD40) 10,000 cells were analyzed in a flow

cytometer. A. Upregulation of CD40 and CD86 presented in histograms. Each

histogram presents the isotype control (blue line), untreated cells (red line) and

treated cells (orange or green line for CD40 or CD86, respectively). B. Median

fluorescence intensity translating the expression of CD40 or CD86 for each

condition tested. Mean ± SD, N = 3, n = 3. Statistics: one-way ANOVA and

Tukey’s post test. * p < 0.05, ** p < 0.01, *** p < 0.001, NS, statistically non-

significant.

141

List of tables

xxxi

List of tables

Table 1.1. Pros and cons of universal antigen-based and personalized cancer vaccines. 17

Table 1.2. Main barriers to cancer vaccine efficacy and possible strategies for their

overcoming.

18

Table 1.3. Classification, mechanism of action and current application of several adjuvants

for human vaccines.

25

Table 1.4. Examples of studies demonstrating superiority in the combination of several TLR

ligands (A), in the association of TLR ligands to antigens (B), and in the use of

nanoparticulate vaccines (C).

33

Table 1.5. Examples of synthetic aliphatic polyesters and their manufacturing methods. 40

Table 1.6. Main advantages and disadvantages of PLGA as a particulate vaccine delivery

system component.

43

Table 1.7. Schematic representation of the main classes of particulate vaccine delivery

systems that can be prepared with aliphatic polyesters.

45

Table 1.8. Polymer properties related with in vivo degradation. 46

Table 1.9. Inherent adjuvanticity of aliphatic polyester particulate delivery systems for

vaccines.

50

Table 1.10. Pattern Recognition Receptors (PRRs) targeted by functionalized PLGA NPs. 58

Table 1.11. Examples of aliphatic polyester particulate delivery systems applied to

prophylactic vaccination, cancer therapeutic vaccines and immunotherapy.

65

Table 2.1. Nanoparticle size and polydispersity index (PdI) (mean ± SD; N ≥ 5, n = 3). 84

Table 3.1. Nanoparticle size, polydispersity index (PdI) and zeta potential (mean ± SD; N ≥

5, n = 3).

119

Table 3.2. Entrapment Efficiency (EE %) and Loading Capacity (LC µg/mg) of antigens and

immunoadjuvants in NPs (mean ± SD; N ≥ 5, n = 3).

121

Aim and outline of the thesis

xxxiii

Aims and outline of the thesis

The main goal of the research work presented in this thesis was to develop a

melanoma therapeutic vaccine by using biodegradable polymeric nanoparticles to deliver

melanoma-associated antigens and immunoadjuvant molecules and induce an antitumor

immune response.

To achieve the main goal of this research, several questions were addressed:

1. Is it possible to produce biodegradable polymeric nanoparticles with the desired

physicochemical characteristics in a reproducible way?

2. Can biodegradable polymeric nanoparticles entrap melanoma-associated antigens

and immunoadjuvant molecules?

3. Can biodegradable polymeric nanoparticles target and be internalized by antigen-

presenting cells?

4. Which endocytic mechanisms are involved in the internalization of the

nanoparticles?

5. Once internalized by antigen-presenting cells, which is the intracellular pathway

and final fate of the nanoparticles?

6. Which is the profile of the immune response induced by nanoparticles entrapping

antigens and immunoadjuvants?

7. Can nanoparticles induce an antitumor immune response?

8. Which is the impact of the coentrapment of different melanoma-associated

antigens and immunoadjuvant molecules in the antitumor response induced by the

nanoparticles?

The developed research work sought to answer these questions in order to provide

sufficient information to achieve the main goal of this research. Some of these questions were

well established from the beginning of the research. Others were raised during the

development of this project as a consequence of the observations made and the reading of

peer reviewed international publications from another scientific research groups that were

published in the meanwhile.

The developed research work can be divided in two main parts, presented in this thesis

in chapter 2 and chapter 3. The first part (chapter 2) is directed to the development of

xxxiv

biodegradable polymeric nanoparticles as a platform for vaccine delivery. A mechanistic

approach was taken in order to characterize the produced nanoparticles in terms of

physicochemical properties, cellular interaction profiles, endocytic mechanisms involved in

nanoparticle internalization as well as the intracellular traffic followed. This work has been

accepted to be published in the special issue “Nanotechnology for Vaccine Development” of

the peer review international journal Nanomedicines (IF 2012 5.26).

The second part of the research work (chapter 3) sought to apply the produced and

characterized nanoparticles as a cancer vaccine delivery system in vivo in murine models. In a

preliminary phase, a transgenic murine model was used in order to characterize the profile of

the immune response induced by the nanoparticulate vaccine. In a second phase, nanoparticles

entrapping melanoma-associated antigens and immunoadjuvant molecules were used in a

murine melanoma model in order to verify the antitumor efficacy of the developed vaccine.

Both therapeutic and prophylactic settings were tested. In all the in vivo assays performed,

several factors that were hypothesized to affect the antitumor performance of the vaccine were

evaluated, including the nanoparticle functionalization with targeting moieties, the

combination of two different immunoadjuvant molecules, the combination of different

melanoma-associated antigens and the impact of the delivery of the antigens in separated

nanoparticles. This second part of the research work has been submitted in the peer review

international publication Journal of Controlled Release (IF 2012 7.63).

The research work presented in chapter 2 and chapter 3 is preceded by a general

introduction that sets the scenario to the reader concerning several important aspects that

served as the foundation for the development of this research work. Chapter 4 consists on an

integrative discussion where the present research work is integrated in an historical context.

Also, the answers to the questions presented in this section are summarized and discussed.

Finally, a conclusion and future perspective remark is presented on chapter 5, where a balance

of the difficulties for cancer vaccine efficacy that have been overcome and those that remain

to be solved is presented, including the regulatory issues regarding this area.

Table of contents

xxxv

Table of contents

Preface vi

Abstract vii

Resumo ix

Acknowledgments/Agradecimentos xiii

List of abbreviations xvi

List of figures xxi

List of tables xxxi

Aims and outline of the thesis xxxiii

Table of contents xxxv

Chapter 1 - General introduction 1

1. Cancer immunotherapy: towards a cancer vaccine 3

1.1. Cancer immunotherapy 3

1.2. Immunotherapy of melanoma 5

2. Desired immune response for a cancer vaccine 7

2.1. Cancer vaccines must activate cytotoxic T lymphocytes (CTLs) and T

helper (Th) 1 cells

7

2.2. Reaching CTLs and Th1 cells through dendritic cells (DCs) – the

bridge between adaptive and innate immune system

8

3. Vaccine basic components 14

3.1. Antigens 15

3.1.1. Peptide cancer antigens 15

3.1.2. Non-peptide cancer antigens 21

3.2. Adjuvants 24

3.2.1. TLR ligands 28

3.3. Delivery system 36

4. Reaching the immune system with nanoparticles as a cancer vaccine 38

4.1. Aliphatic polyesters-based particulate delivery systems: classification

and characterization of the different aliphatic polyesters

38

4.2. Biocompatibility and biodegradability of aliphatic polyesters:

degradation and elimination mechanisms

46

4.3. Inherent adjuvanticity 50

xxxvi

5. The influence of physicochemical factors on NP performance 51

5.1. Influence of size 51

5.2. Influence of chemical constitution and hydrophilicity/hydrophobicity 54

5.3. Influence of charge 54

5.4. Influence of shape 55

6. Targeting NPs to the immune system 55

6.1. Passive targeting 55

6.2. Active targeting 52

7. Current status of the use of aliphatic polyester-based NPs for cancer

vaccines

61

8. Translational aspects and regulatory requirements 68

Chapter 2 - Development of Functionalized Nanoparticles for Vaccine

Delivery to Dendritic Cells: a Mechanistic Approach

71

Abstract 75

Keywords 75

1. Introduction 77

2. Materials and Methods 78

2.1. Materials 78

2.2. Preparation of NPs 79

2.3. Physicochemical characterization of NPs 79

2.4. Detection of mannose on functionalized NPs by Lectin Recognition

Assay

80

2.5. Cell culture conditions 81

2.6. Generation of murine bone marrow derived DCs 81

2.7. In vitro cell viability in the presence of NPs 81

2.8. Nanoparticle uptake by flow cytometry analysis 81

2.9. Confocal microscopy imaging analysis 82

2.10. Study of endocytic pathways involved in NP internalization 83

2.11. Statistics 83

3. Results 83


3.2. Detection of mannose residues at man-NP surface by lectin-

recognition assay

85

Table of contents

xxxvii

3.3. Effect of pH, temperature and medium composition on NP stability 86

3.4. Effect of NPs on viability of APCs 88

3.5. Uptake of NPs by APCs 89

3.6. Endocytic pathways involved in NP internalization 90

3.7. Intracellular trafficking followed by NPs in BMDCs 93

3.8. In vitro targeting of APCs with mannose-grafted NPs 95

4. Discussion 97

5. Conclusions & future perspective 101

6. Executive Summary 102

Acknowledgments 103

Financial & competing interests disclosure 103

Ethical conduct of research 103

Chapter 3 - Combination of peptides and adjuvants in mannose-

functionalized nanoparticles for melanoma immunotherapy

105

Abstract 109

Graphical abstract 109

Keywords 109

1. Introduction 111

2. Materials and methods 112

2.1. Materials 112

2.2. Mice 113

2.3. Preparation of NPs 114


2.5. Determination of the loading of antigens and adjuvants 114

2.6. Integrity of the NP-entrapped OVA 115

2.7. Cell line culture conditions 115

2.8. Characterization of the immune response induced by the

nanoparticulate vaccines in OT II mice

116

2.9. Therapeutic efficacy of the nanoparticulate vaccines 116

2.10. Protection efficacy of the nanoparticulate vaccines against tumor

challenge

116

2.11. Cytokine and Granzyme B quantification 117

2.12. Splenocyte proliferation assay 118

xxxviii

2.13. Analysis of spleen T lymphocyte subsets 118 2.14. Statistics 118

3. Results 119

3.1. NP physicochemical characterization 119

3.1.1. NP size and zeta potential 119

3.1.2. Loading of antigens and adjuvants 120

3.1.3. Ovalbumin integrity after NP formulation 121

3.2. Immune response characterization induced in OT II mice by the

nanoparticulate vaccines

122

3.2.1. Antibody production 122

3.2.2. Cytokine secretion 124

3.3. Antitumor therapeutic efficacy of the nanoparticulate vaccines 125

3.3.1. Tumor growth 125


3.4. Protection efficacy of the nanoparticulate vaccine against tumor

challenge

128

3.4.1. Tumor growth 128


3.4.3. Granzyme B production 130

3.4.4. Splenocyte proliferation assay 131

3.4.5. Spleen T lymphocytes subset analysis 132

3.5. Vaccine tolerability 134

4. Discussion 134

5. Conclusions 137

Acknowledgments 138

Appendix 139

1. Induction of DC maturation by NPs 139

1.1. Method 139

1.2. Results 139

2. Results & conclusions 141

Chapter 4 - Integrative discussion 145

Chapter 5 - Concluding remarks & future perspectives 157

References 163

Table of contents

xxxix

Curriculum vitae 193

Chapter 1

Part of this chapter is adapted from the following published manuscripts:

Scientific publications in peer review international journals:

1. Silva JM, Videira M, Gaspar R, Préat V, Florindo HF, Immune System Targeting by

Nanoparticles for Cancer Vaccines. J Control Release, 2013, 168(2):179-99.

http://dx.doi.org/10.1016/j.jconrel.2013.03.010. (IF 2012 7.63)

2. Danhier F, Ansorena E, Silva JM, Coco R, Le Breton A, Préat V, PLGA-based

nanoparticles: an overview of biomedical applications, J Control Release, 2012, 161(2):505-

22. http://dx.doi.org/10.1016/j.jconrel.2012.01.043. (IF 2012 7.63)

Book chapters:

1. Silva JM, Zupancic E, Peres C, Silva LC, Gaspar R, Préat V and Florindo HF,

Immunomodulation against microbial pathogens through dendritic cells, In: Microbial

pathogens and strategies for combating them: science, technology and education (A. Méndez-

Vilas, Ed., Formatex Research Center, Badajoz, Spain, 2013, pp. 1686-1705. ISBN (13)

Volume 3: 978-84-942134-1-0.

2. Silva JM, Préat V, Florindo HF, Role of the Aliphatic Polyesters as Particulate

Vaccine Delivery Systems, Encyclopedia of Biomedical Polymers and Polymeric

Biomaterials, Taylor & Francis Editorial Group, London, UK, 2014 [In Press].

http://dx.doi.org/10.1016/j.jconrel.2013.03.010

http://dx.doi.org/10.1016/j.jconrel.2012.01.043

General introduction

3

Chapter 1 – General introduction

Sseveral strategies are being used by immunologists and engineers to design new

materials, molecules and carriers to manipulate the type of immune response for therapeutic

and prophylactic purposes, but also to study and comprehend the immune system. Some

examples include the engineering of microenvironments to clarify the interaction kinetics

between mature DCs and naïve T cells, the modification of material surfaces to induce or

prevent complement activation and the engineering of adjuvants, antigens and carriers to

promote host immune responses (1). These strategies not only will contribute to prophylactic

vaccine development against infectious diseases but also are likely to contribute to the

development of immunotherapeutics for cancer, allergies and autoimmune diseases.

In the last decades, convergence of many scientific disciplines exploring

nanotechnology and nanomedicine has successfully driven the first generation of

nanomedicines to the clinic (2). A great number of promising nano-sized tools for biomedical

applications have been emerging. Among them, biodegradable nanoparticles (NPs) are

gaining increased attention for their ability to serve as specialized biocompatible delivery

systems of a multitude of molecules, including proteins, peptides, nucleic acids and

oligonucleotides that usually constitute the main vaccine components. There are a

considerable number of advantages in using biodegradable NPs as vaccine delivery systems

that will be presented throughout this chapter. One aspect that stands out is their unique

capacity of targeting the immune system and co-deliver antigens and adjuvants

simultaneously to the same cell, enabling the generation of effective immune responses (3).

1. Cancer immunotherapy: towards a cancer vaccine

1.1. Cancer immunotherapy

It is well known that the immune system is able to mount antitumor responses that can

be enhanced using a number of strategies (4). Cancer immunotherapy takes advantage of the

specificity of the immune system to provide a more efficacious and better tolerated therapy

than the conventional treatments, such as chemotherapy and radiotherapy. Current approaches

to cancer immunotherapy can be categorized as those that attempt to enhance the host’s own

immune response to a tumor, such as the development of prophylactic and therapeutic cancer

vaccines, cytokine therapy, administration of immune activating antibodies and

radioimmunotherapy, and those that use adoptive cell therapies from a non-tumor-bearing

Chapter 1

4

syngeneic or, more often, allogeneic donor (5). The identification of defined T cell tumor-

associated antigens (TAAs) at the molecular level and the demonstration that T cells of well-

defined specificity can mediate the complete elimination of large solid tumors have promoted

interest in cancer vaccine development (6).

Despite the challenges in the development of cancer vaccines and the many

mechanisms by which tumors can evade or subvert immune responses (which will be

discussed in section 3.), immunotherapy is an attractive strategy for cancer therapy and cancer

vaccines are one of the most ambitious but promising tools in this field. In contrast to

vaccines that induce protective immunity against viral pathogens associated with the

induction of cancer, such as high risk serotypes of the human papillomavirus (HPV) and the

hepatitis B virus (HBV), it is envisioned that general cancer vaccines would be administered

after the onset or detection of disease. Thus, they would be considered therapeutic rather than

prophylactic vaccines. Another critical aspect of cancer vaccines is that they are more

effective in the adjuvant setting for the treatment of minimal residual disease than in the

treatment of larger bulky primary tumors. Human leukocyte antigen (HLA) expression can

also influence the efficacy of cancer vaccines, which must, therefore, either have sufficient

antigen complexity to provide broad immunological coverage of the treated patient population

either be personalized according to the host’s HLA profile (7). Most important, cancer

vaccines must be constructed taking into account the desired immune response that will

effectively enhance patient’s defenses against the tumor and also abrogate the mechanisms of

tumor evasion and tolerance.

Some of the clinical trials of the first cancer vaccines have provided evidence of

clinical benefit thus encouraging the development of other vaccines. Diverse vaccine

platforms evaluated in clinical trials for cancer therapy include injection of peptides and

proteins in adjuvants, recombinant viruses or other recombinant microorganisms, delivery of

killed tumor cells, or infusion of protein- or peptide-activated DCs to the patient (8). US Food

and Drug Administration (FDA) and European Medicines Agency (EMA) have recently

approved the Sipuleucel-T vaccine (Provenge®, Dendreon Corp.) for the therapy of asymp-

tomatic metastatic castrate-resistant prostate cancer (9). This vaccine consists of leukapheresis

and reinfusion of APCs obtained from peripheral blood mononuclear cells (PBMCs), after

incubation with the prostate antigen prostatic acid phosphatase (PAP) fused to granulocyte

macrophage colony-stimulating factor (GM-CSF). The requirement of leukapheresis and cell

culture processing of PBMCs are pointed out as drawbacks of this strategy, since a limited

number of vaccinations can be used.


5

Challenges to the development of cancer vaccines still include the identification and

characterization of the antigen(s) to be targeted, the definition of the desired immune response

to be elicited by the vaccine, and the choice of the appropriate vaccine delivery system.

1.2. Immunotherapy of melanoma

Malignant melanoma is an aggressive, therapy-resistant malignancy of melanocytes,

the skin cells responsible for the production of the skin pigment melanin (10). Melanoma

starts in the epidermis but it can easily grow to the dermis, reach the lymphatic system and

spread to other organs such as the lymph nodes, brain, lungs, liver and bones (11). Incidence

rates for melanoma have been rising in the last 30 years, resulting in an increasing public

health problem. The American Cancer Society estimates that about 76,100 new melanoma

cases will be diagnosed in 2014. It is one of the most common cancers in young adults and the

5-year survival rate for stage IV is range from 15 % to 20 % (12). In a near past, treatment

options for patients with advanced or metastatic melanoma were limited by modest response

rates and failure to improve overall survival (13,14). The scenario slightly changed in 2011

with the approval of ipilimumab and vemurafenib, both of which improved overall survival in

phase III clinical trials. More recently, the targeted inhibitors dabrafenib and trametinib have

demonstrated similar therapeutic profiles and have also been approved. Ipilimumab, a fully

human monoclonal antibody, exploits the natural ability of the immune system to eradicate

primary cancer cells by inhibiting the binding of cytotoxic T-lymphocyte antigen-4 (CTLA-4)

to its ligands, thereby potentiating antitumor T-cell response. Vemurafenib and dabrafenib

inhibit the BRAF V600 mutation which affects up to 50 % of melanoma patients. These drugs

prevent oncogenic activities such as uncheck proliferation and evasion of immune response.

Trametinib, another targeted-therapy approach, inhibits the MEK protein, the only known

substrate of the BRAF V600 protein, which leads to decreased cell signaling and proliferation

in cancer cells (15). Although these new agents have demonstrated long-term improvement in

patient outcome, the inclusion in clinical trials is always encouraged as first choice treatment

for melanoma patients in stages IB to IV after surgery in the hope of providing advantages

from new combinatory regimens or innovative therapies (Fig. 1.1.) (11). Thus, there is still

critical need of new therapeutic strategies for melanoma.

Melanoma is one of the most immunogenic tumors and has been one of the main

targets of cancer immunotherapy research (16). In fact, there are strong arguments to expect

good outcomes from therapeutic melanoma vaccines, including the absence of the primary

Chapter 1

6

melanoma in 5 % of patients with metastatic melanoma, documented spontaneous remissions,

lymphocytic infiltration of tumors, expression of developmental and melanoma-specific

antigens on tumor tissue, and responses to immunotherapeutic agents, such as interleukin

(IL)-2, interferon alpha (IFN-α) and ipilimumab (17–20). Clinical trials have been ongoing for

decades testing several vaccination strategies, including whole tumor cells, cell lysates, and

proteins or specific peptide fragments (21,22). Nevertheless, the therapeutic benefit of these

strategies remains unclear since few clinical trials have demonstrated significant benefit (23).

Figure 1.1. Recommended primary and adjuvant treatment for melanoma (stage 0 to IV), according to

National Comprehensive Cancer Network (NCCN) guideline, v1.2014. The box in the lower right presents

the systemic therapy recommended for metastatic or advanced melanoma (widespread stage IV). Adapted

from National Comprehensive Cancer Network (NCCN) Guideline for Patients, v1.2014.


7

2. Desired immune response for a cancer vaccine

2.1. Cancer vaccines must activate cytotoxic T lymphocytes (CTLs) and T

helper (Th) 1 cells

Most TAAs are not cell surface proteins but rather intracellular ones. Peptide

fragments of these antigens are bound by newly synthesized class I major histocompatibility

complex (MHC) molecules, or HLA in humans, and shuttled to the cell surface for

immunological recognition. Thus, in order to be effective, it is critical that cell-mediated

immunity, particularly cytotoxic T lymphocytes (CTLs), is the focus of the immune response

elicited by a cancer vaccine (7). In the presence of the appropriate stimulation, CD8+ T cells

undergo proliferation and differentiate into CTLs (24). Activated CTLs can migrate to

peripheral tissues and exert two main effector functions: direct contact-mediated cytotoxicity

and secretion of effector cytokines, such as interferon gamma (IFN-γ) and tumor necrosis

factor (TNF)-α, which can mediate local inflammation. Another essential function of

activated CD8+ T cells is the acquisition of memory. Memory CD8+ T cells can be maintained

for long periods of time without antigenic stimulation and potentiate a better and faster

immune response upon relapse or metastasis (25).

In recent years, it has become evident that CD4+ T cells also play a critical role in the

development of effective antitumor immunity. Indeed, CD8+ lymphocytes can fail to maintain

functionality in the absence of CD4+ T helper cells. These cells can enhance antitumor CTL

responses by increasing clonal expansion at the tumor site, promoting the generation and

maintenance of memory CTL phenotypes, preventing activation-induced cell death (AICD)

and functioning as antigen-presenting cells (APCs) for CD8+ T cells (26). Classically, effector

CD4+ cells are considered to differentiate into T helper (Th)1 or Th2 cells, even that other

subsets have been described such as the IL-17-secreting Th17, the IL-9-secreting Th9, the IL-

22-secreting Th22 and the tumor growth factor (TGF)-β-producing regulatory T (Treg) cells

are now also well described (27). Although Th1 and Th2 subtypes can both mediate

anticancer functions, IFN-γ-secreting Th1 cells are more effective in this role (28). Becker

(2006) reviewed the relationship of the Th1/Th2 imbalance with tumor presence and

prognosis, highlighting that tumor cells induce increased Th2 cytokine serum levels, namely

IL-4, IL-6 and IL-10, which suppress the production of Th1 cytokines, such as IL-2, IL-12

and IFN-γ, resulting in the prevention of the activation of CD8+ cytotoxic T cell precursors

(29). Acting together in the process of tumor eradication, the combined action of CD8+ and

Chapter 1

8

IFN-γ-secreting Th1CD4+ T cells starts with activation of tumor-specific CD8+ T cells that

can kill tumor cells directly. The survival and persistence of CD8+ T cells as memory cells are

also regulated by tumor-specific CD4+ T cells. Both CD8+ and, especially, Th1 CD4+ T cells,

secrete IFN-γ, which can further sensitize tumor cells to CD8+ T cells by upregulating MHC

class I and other components of the antigen-processing machinery. This promotes the

recruitment of cells from the innate immune system such as natural killer (NK) cells,

granulocytes or macrophages, and interfering with crucial functions of the tumor stroma,

namely, angiogenesis (30).

2.2. Reaching CTLs and Th1 cells through DCs – the bridge between

adaptive and innate immune system

Naïve CD8+ T cells, located in secondary lymphoid organs, constantly survey and

sample APCs searching for cognate peptide-MHC complexes for which their T cell receptors

(TCRs) have specific affinity. APCs, DCs by excellence, but also macrophages and B cells,

are known for their specialized capacity for antigen presentation to T cells, leading to

activation of innate and adaptive immune responses or tolerance to innocuous antigens (31).

Among APCs, DCs are considered as the main APC population due to several intrinsic

characteristics that are not present on macrophages or B cells. DCs take advantage of their

strategic location in peripheral tissues, such as skin and mucosal surfaces, wich are the most

frequent routes of pathogen entry (32). Moreover, after internalization of antigens, DCs are

able to migrate towards T cell-rich areas, such as sentinel lymph nodes (LNs), where they can

activate naїve T cells in an antigen-specific manner, placing a bridge between innate and

adaptive immune system. This activation comprises the presentation of antigen-MHC

complexes, and the upregulation of costimulatory and soluble molecules, such as cytokines

and chemokines (e.g., IL-12 and type I IFNs) which affect T cells in a paracrine way (33). In

fact, type I IFN production by host DCs is an important step during the innate immune

recognition of tumors and has demonstrated to correlate with positive prognostics in early

stage disease (34).

Compared to macrophages, DCs have a similar capacity for endocytosis and an

equivalent number of lysosomes but less proteolytic activity, which limits full degradation of

antigens, and increases the effectiveness of antigen presentation (35). DCs, therefore,

constitute a preferential target of vaccines since they can function as a route of entry to the

immune system and a means of controlling both innate and adaptive immune responses.


9

Immature DCs (iDCs), located in peripheral tissues, function as sentinel cells of the

immune system by detecting and incorporating pathogens and becoming activated in response

to specific signals or proinflammatory cytokines in the microenvironment (36). Once DCs

have taken up antigens, they start to migrate in a chemokine-dependent manner into naïve T-

cell regions. DCs begin to express a lymph node-homing chemokine receptor, CCR7, which

enables them to enter afferent lymphatic vessels and migrate into LNs, where CCL19 and

CCL21, the ligands for CCR7, are expressed (37). During their migration, DCs will process

the antigens they have taken up and transfer them to surface complexes by one of three

pathways: through MHC class I (or HLA-A, -B or -C in humans), MHC class II (or HLA-D in

humans), or lipid antigen-presenting cluster of differentiation 1 (CD1) molecules (38).

Extracellular antigens are taken up by APCs by one of the endocytic mechanisms - receptor-

dependent endocytosis (clathrin-mediated, caveolae-mediated, lipid-raft-mediated or

phagocytosis) or receptor-independent endocytosis (fluid phase

endocytosis/macropynocytosis) - and placed into a membrane-delimited compartment of the

endocytic pathway (39). This compartment undergoes a series of modifications and finally

fuses with lysosomes or MHC class II compartments (MIIC). Peptide-loaded MHC class II

molecules are then transported to the cell surface where they engage antigen-specific CD4+ T

cells. Antigenic peptides derived from cytosolic proteins (endogenously synthesized antigens)

are processed in the proteasome into peptides and transported from the cytoplasm into the

endoplasmic reticulum (ER) via the transporter associated with antigen processing (TAP)

molecular complex, where they associate with nascent produced MHC class I molecules and

are delivered to the cell surface, becoming available to be recognized by CD8+ T cells (1).

The antigen presentation by DCs to T cells is schematically represented in Figure 1.2..

Chapter 1

10

Figure 1.2. Antigen presentation by dendritic cells to T cells. A. Activated DCs presenting

extracellular antigens on MHC class II complexes to CD4+ T cells induce the differentiation of CD4+

T cells into T helper (Th) 1 or Th2 CD4+ T cells, depending on the cytokines produced by DCs upon

activation. IL-2, IL-3, IFN-γ, TNF-α and GM-CSF induce a Th1 profile while IL-4, IL-5, IL-6, IL-10 and

IL-13 induce a Th2 profile. Other secondary Th profiles, which are not represented in the figure,

can also be induced (Th17, Th9, Th22, Treg). Th1 cells enhance the activation of CD8+ T cells and

CTL functions through the secretion of cytokines (such as IL-2, IL-12 and IFN-γ) and Th2 stimulate


11

the secretion of antibodies by B cells. The recruitment of cells of the innate immune system, such

as NK cells, granulocytes and macrophages, plays also an important role in the immune response

against both extracellular and intracellular pathogens. B. Intracellular antigens are presented

through MHC class I to CD8+ T cells inducing the differentiation of CTLs, which are the main

effector cells in pathogen-infected cell lysis and tumor cell lysis. CD8+ T cells can also develop a

memory phenotype that will allow a prompt response in the case of a second infection or tumor

relapse or metastasis. Extracellular antigens can also induce this kind of response through their

cross-presentation by the MHC class I pathway to CD8+ T cells.

An alternative antigen presentation pathway, designated cross-presentation or cross-

priming, has also been described. The term cross-presentation describes the process whereby

APCs acquire exogenous soluble or cell-associated antigens (from infected or tumor cells)

and then present them bound to MHC class I molecules. This mechanism insures the

activation of CD8+ T cells in response to a virus that does not infect APCs or against tumor

cells, and consequently is highly relevant for antitumor vaccines. Cross-presentation seems to

occur through retrotranslocation of antigens from endosomal compartments into the cytosol,

followed by re-importation of proteasomally processed peptides back into endosomes via

TAP, where peptide loading of recycled MHC class I molecules occurs (1,40). In the absence

of stimulus, steady-state APCs constantly present self-antigens to T cells, inducing T cell

tolerance to these antigens in order to avoid autoimmune reactions. However, in the presence

of a foreign antigen, additional stimuli, apart from the simple presentation of the antigen, are

necessary to induce T cell expansion and acquisition of effector functions.

For T cells to be effectively activated by DCs, three signals are provided in a DC-T

cell synapse (Fig. 1.3.). Firstly, T cells need to recognize the processed antigen in the context

of MHC class I (for CD8+ T cells) or MHC class II (for CD4+ T cells). Each T cell carries a

unique TCR and only those cells that recognize the antigens presented by DCs in the form of

a MHC-antigen complex will become activated. Secondly, during maturation, DCs also

upregulate other cell surface molecules, such as MHC class I and II, and costimulatory

molecules, such as CD40, the receptor for CD40L expressed by naïve T cells, and also CD80

and CD86 (B7-1 and B7-2 in humans, respectively), which are the ligands for the

immunoglobulin superfamily member CD28, also expressed by naïve T cells. This is the

reason why iDCs in the periphery cannot efficiently activate T cells. Thirdly, T cells need

cytokines and chemokines, such as IL-12 and type I IFNs, which are produced by DCs and

Chapter 1

12

directly affect T cells in a paracrine fashion (41,42). These three signals promote T cell

expansion, survival and acquisition of effector functions.

Figure 1.3. DC role in T cell activation and DC-T cell synapse. DCs play a major role in

immunosurveillance and immune response initiation, placing a bridge between the innate and the

adaptive branches of the immune system. Upon contact with pathogens or tumor cells/apoptotic tumor

bodies, iDCs start the processing of antigens for further presentation to T cells. The recognition of

pathogen associated molecular patterns (PAMPs) from pathogens by the pattern recognition receptors

(PRRs) on DCs plays an essential role for proper DC maturation. After migration from the periphery to

the lymph nodes, mDCs have contact to naïve T cells. In the DC-T cell synapse, three signals are essential

for T cell activation. Signal 1 is the antigen-specific signal and results from the presentation of MHC-

antigen complexes by DCs and their recognition by the antigen-specific TCR. Signal 2 is the costimulatory

signal, mainly mediated by the trigger of CD28 and CD40L on T cells by CD80, CD86 and CD40

expressed by mDCs. Signal 3 is the cytokine priming signal which is mediated by many cytokines and

interferons secreted by mDCs and determines polarization of the activated T cells and consequently the

profile of the initiated immune response.

As mentioned, cancer vaccines should predominantly activate CD8+ T cells. A

schematic representation of the desired immune response that a cancer vaccine must induce is

shown in Figure 1.4.. CD8+ T cells predominantly recognize endogenous intracellular


13

antigens that are presented by MHC class I molecules, which are ubiquitously expressed by

the majority of normal and tumor tissues. Unfortunately, cancer cells are notoriously

unreliable as antigen presenters. They lack activating costimulatory molecules, produce

immunosuppressive soluble factors, and have unstable genomes that are prone to losing key

molecules required for antigen processing and presentation (43). On the other hand, most

conventional vaccines elicit antibody and CD4+ helper T cells responses rather than CTL

responses. For a vaccine to induce CTL responses, the antigen of interest needs to reach the

cytoplasm of DCs to be cross-presented through MHC class I to CD8+ T cells. As key players

orchestrating immunity, DCs are a natural focus for immunotherapy. Basically, two strategies

have been studied to target these cells and to use them in cancer immunotherapy:

administration of ex vivo tumor-peptide pulsed DCs or in vivo direct delivery of tumor

peptides (38). For both strategies, there are a number of vaccine delivery systems that are

being evaluated to more efficiently load antigens into DCs, including recombinant viral

vectors, virus-like particles, liposomes, microparticles (MPs) and NPs to name a few (7).

Figure 1.4. Desired immune response elicited by a therapeutic cancer vaccine. Cancer vaccines must

target antigens and immunoadjuvants to iDCs either in the skin or in the lymph nodes. After processing,

antigens will be presented through MHC class I or MHC class II complexes to CD8+ or CD4+ T

lymphocytes, respectively. Simultaneously, immunoadjuvants promote the activation and maturation of

DCs, which consequently express costimulatory factors and secrete cytokines, such as INF-γ and IL-12,

which are crucial in the effective stimulation of T cells and in determining the CD4+ phenotype. CD8+

lymphocytes acquire a cytotoxic phenotype, known as CTLs, able to cause tumor cell lysis directly. Some

Chapter 1

14

of these CD8+ lymphocytes also acquire a memory phenotype which is crucial to the maintenance of

immunity. Th1 cells enhance the action of CTLs by enhancing clonal expansion at the tumor site and

promoting the generation and maintenance of the memory phenotype. Th1 cells secrete IFN-γ, which can

further sensitize tumor cells to CTL action by upregulating MHC class I and other components of the

antigen-processing machinery and promoting the recruitment of cells from the innate immune system

such as the NK cells, granulocytes or macrophages that also contribute to tumor cell lysis. Adapted from

Silva J.M. et al. (2013) J Control Release; 168:179–199.

3. Vaccine basic components

Vaccines have had a significant impact in global heath as they permitted the control of

many infectious diseases and the eradication of smallpox (44,45). After the observation by

Edward Jenner in 1796 that milkmaids were generally immune to smallpox, he tested a

primordial way of vaccination by installing subcutaneously material from milkmaids’ lesions

containing cowpox in a healthy individual and confirmed protection against smallpox (46).

Later, Pasteur developed techniques for inactivation of microorganisms and demonstrated for

the first time that the rationale behind smallpox vaccination could be extended to several other

infectious diseases (47). Since then, remarkable progresses have been made and many tools

are now available for the production of successful vaccines. The idea of employing vaccines

to treat cancer arose one century later with the work of Paul Ehrlich and William Coley.

Ehrlich attempted to generate immunity against cancer by injecting weakened tumor cells,

however with no success (48). Coley developed a mixture of heat-killed Streptococcus

pyogenes and Serratia marcescens bacteria (the Coley’s toxin), and tested it in cancer patients

obtaining successful results due to the adjuvant effect of the toxin in the immune response

(49). However, it soon became clear that anticancer vaccines would have to be therapeutic

rather than prophylactic and the poor induction of immune responses by tumor cells had to be

circumvented (50).

Three critical elements are considered to be essential in the composition of an

effective vaccine: antigen, adjuvant, and delivery system (51). Antigens are molecules

(proteins, peptides, lipids, etc) recognized by the immune system that are able to induce an

adaptive immune responses. An adjuvant is a factor that is able to stimulate the innate

immune system and influence the profile of the elicited immune response. A vaccine delivery

system is defined as a platform that insures optimal delivery of both antigen and adjuvant for

the effective activation of both innate and adaptive branches of the immune system. It has

been demonstrated that antigens and adjuvants must act concomitantly on the same APC to

obtain its full activation (3). Indeed, the administration of an isolated antigen can induce a


15

Th2-predominant immune response or even tolerance to the antigen. As a result, the efficacy

of a cancer vaccine formulation can be considerably improved by the development of delivery

systems able to protect and deliver antigens and adjuvants simultaneously (52).

3.1. Antigens

3.1.1. Peptide cancer antigens

The selection of the appropriate TAAs is one of the main hurdles of cancer vaccine

development. In a general way, TAAs for anticancer vaccines must fulfill the following

criteria: (i) include peptide sequences that bind to MHC class I, (ii) be processed by tumor

cells and become available for binding to MHC class I molecules, (iii) be recognized by the T

cell repertoire in a MHC class I-restricted way, and (iv) drive the expansion of CTL

precursors expressing TAA-specific TCRs (53). Since the molecular cloning of the first gene

reported to encode a CTL-defined human tumor antigen (MAGE-A1), and with the

development of new technologies, many other TAAs that are recognized by T cells on human

cancers have been identified and characterized (54,55). This process has clearly beneficiated

from the integration of molecular cloning by screening tumor-derived cDNA libraries with

autologous tumor-specific T lymphocytes with novel strategies such as (i) reverse

immunology (epitope prediction on the basis of known HLA-binding motifs performed by

dedicated software); (ii) biochemical methods associated with chromatography and mass

spectrometry to fractionate TAA peptides naturally expressed on tumor cells in the context of

HLA molecules, and (iii) DNA microarray technology which allows comparison of gene

expression profiles in normal and tumor tissues, such as representational difference analysis

(RDA), differential display (DD), suppression subtractive hybridization (SSH), and serial

analysis of gene expression (SAGE) (55). Apart from the epitopes recognized by CD8+ or

CD4+ T cells, other types of tumor antigens have been identified or created. These include

analogs or artificially modified epitopes, antigens identified by antibodies (mimotopes),

immunogenic fusion proteins (new T-cell epitopes resultant from translocation of

chromosomes during carcinogenesis resulting in fusion of distant genes), splicing aberrations,

point mutations, fusion junctions in epitopes and antigens detected by the SEREX technology

(55–57).

TAAs can be broadly classified in two categories: (i) shared tumor antigens, and (ii)

unique tumor antigens. The first group is expressed by many tumor types and its expression

on normal tissues is either absent or quantitatively and qualitatively different. Examples are

the cancer-testis antigens (MAGE, GAGE and NY-ESO1). The second group comprises

Chapter 1

16

antigens that are expressed uniquely by individual tumors and correspond to new epitopes that

are products of point mutations or splicing alterations (58,59). An additional group of TAAs

includes those that might be expressed by cancer stem cells (CSCs), a minor population of

tumor cells which shows the features of stemness and, therefore, may represent an important

target for most tumors (60). TAAs can also be defined as dispensable and indispensable for

tumor growth and survival. Indispensable TAAs, also called universal TAAs, have the

remarkable feature of being necessary for tumor growth and progression. These antigens are

overexpressed by neoplastic and fetal cells, but weakly expressed or expressed in a phase-

specific way in normal cells. Normally they have limited generation of antigen-loss variants

and, therefore, they are attractive targets for cancer vaccines (53). Examples are the inhibitors

of apoptosis proteins (IAP) and the human telomerase reverse transcriptase (hTERT) (61,62).

Studies on universal TAAs demonstrate that such antigens are, more than any other TAA,

frequently expressed in many different human tumors and, therefore, they apparently provide

the most common neoplasia-related and easily identifiable immune target. Besides their

attractiveness as antigens for cancer vaccines, universal TAAs have several drawbacks that

obviate this hypothesis. For instance, it remains to be established whether they are more

immunogenic when compared with other TAAs obtained from the same tumor (63). Also, the

frequency of peptide-specific CTL precursors in PBMCs, which is determinant for the

generation of the final number of effector T cells, can be very low and not overcome tumor

escape from immune surveillance (64).

An alternative strategy to overcome the inherent problems of using universal antigens

is the application of personalized vaccination. This approach takes into account the

immunological diversity of individual patients by measuring CTL precursors in PBMCs prior

to vaccination to select the antigens with higher CTL precursor frequency (65,66). Unique

tumor antigens constitute a growing class of T cell-defined epitopes that exhibit strong

immunogenicity. Some of these antigens, which often derive from mutation of genes that

have relevant biological functions, are less susceptible to immunoselection and may be

retained even in advanced tumors. Immunogenicity and constitutive expression of unique

tumor antigens provide strong incitement for the design of novel patient-tailored therapies that

target such determinants (67,68). Pros and cons of both strategies of cancer vaccination are

listed on Table 1.1.. The next step in the development of vaccines is to identify biomarkers of

the immune response that allow not only in the identification of vaccine responders but also

new vaccine development. It is not certain if personalized vaccinology will lead us to abandon

the universal empiric vaccine approach but it is likely that the future of vaccinology passes by


17

more accurate prediction of vaccine responses, adverse reactions, number of doses needed to

induce an effective response, and direct us toward a new paradigm of vaccine development

(69).

Table 1.1. Pros and cons of universal antigen-based and personalized cancer vaccines.

UNIVERSAL ANTIGEN-BASED CANCER VACCINES

Pros Cons

• Frequently expressed in many different human tumors;

• can be easily identified; • since they are indispensable for tumor growth

and progression, the generation of antigen-loss variations is limited or even absent and the tumor growth control is more efficient.

• Antigen processing-related problems; • antigen-specific T cells have low frequencies; • risk of low immunogenicity; • in some cases, these molecules might be more

easily targeted by antibodies rather than by antigen-specific T cells as some antigens are normal molecules involved in migration and cell adhesion;

• delayed and weak primary CTL responses.

PERSONALIZED CANCER VACCINES Pros Cons

• Generally highly immunogenic antigens; • memory CTLs are able to start rapid and

strong secondary responses; • reduced chances of inducing regulatory T

(Treg) cells.

• Their production is time-consuming and expensive;

• the primary response is absent; • the selection of high CTL precursor frequencies

does not ensure tumor regression; • risk of failure of antigen presentation.

From Silva J.M. et al. (2013) J Control Release; 168:179–199.

Apart from the problems related to different vaccine modalities, cancer vaccines have

additional barriers deeply related to tumor immunology that need to be overtaken. Clinical

trials of cancer vaccines demonstrated very low overall objective response rates (21,22).

Table 1.2. presents some of the barriers that can contribute to explain these disappointing

results. These can be either tumor escape mechanisms and/or difficulties related to T-cell

constraints (70,71). Such processes can compromise the efficacy of any vaccine targeting

shared or unique tumor antigens. Another set of hurdles in the development of therapeutic

vaccines as a treatment modality for cancer includes difficulties in the selection the optimal

dose and schedule and the validation of methods for the evaluation of the efficacy of the

vaccine. Obstacles in the patentability of many immunotherapeutic strategies, which have

resulted in a lack of interest and a subsequent lack of funding by the pharmaceutical industry,

have also hampered clinical development (72).

Chapter 1

18

Table 1.2. Main barriers to cancer vaccine efficacy and possible strategies for their overcoming.

DESCRIPTION HOW TO OVERCOME T-CELL BIOLOGY-RELATED MECHANISMS

Low Affinity T-cell receptor (TCR)

“Self- reactive” T cells that are not centrally deleted are kept in periphery with low affinity to the “self-antigen” (73).

Improve affinity of the TCR through appropriate substitution and use of T cells grafted with high-affinity engineered TCR (74).

Ignorance of self-antigens

Self-reactive T cells that have gained access to the periphery remain ignorant and do not respond to their respective antigens. Tumor cells themselves might keep them nonreactive (75).

The threshold of ignorance can be overcome by T cell activation and ignorant T cells can be made to exhibit effector responses in the form of cytolysis or cytokine synthesis (76).

Activation-induced cell death (AICD)

Suicidal death of a fraction of the responding cells at the amplification phase compromising the immune response (77).

A c-Jun N-terminal kinase inhibitor has demonstrated to rescue CTLs from AICD (78).

T-cell exhaustion

The chronic presence of tumor antigens can induce T cell exhaustion by activation of the programmed death-1 (PD-1) molecule on T cells that ultimately leads to T cell death (79).

PD-1 and CTLA-4 blockade are examples of how T cell exhaustion can be reversed and exhausted T cells can be rejuvenated (80).

Regulation of the immune system

Cell-mediated regulation of antitumor immunity involves multiple players and many different modes of action. Treg and myeloid-derived suppressor cells (MDSCs) are the major responsible in the promotion of T cell dysfunction in the tumor microenvironment (81).

Daclizumab is a FDA-approved humanized anti-CD40 antibody for the regulation of Treg cells (82). Another potential strategy is disarming the adenosine (ADO)/prostaglandin E2 (PGE2) pathway (involved in the inhibition of effector T cells by Treg) (83).

Helpless CTL

CD4+ helper T cells are essential for the generation of a robust and long-lasting memory CTL response. In their absence, “helpless” CTL are not long lasting and they die early (26).

Use MHC class II–determined helper epitopes as “cognate help” for CD8+ activation (84). CD8+ as well as CD4+ T cells can be engineered to express a MHC class I–restricted TCR of interest (85). PLGA particles have demonstrated to be able to induce antigen presentation through both MHC class I and class II complexes (86).

TUMOR CELL-RELATED MECHANIMS

MHC class I down-regulation

The most frequent mechanism of tumor evasion consists in MHC class I-down regulation on tumor cells, decreasing the possibilities of tumor antigen recognition by T cells (87,88).

This is one of the main reasons to use particulate delivery systems for cancer immunotherapy as a way to obviate the low presentation of tumor antigens by tumor cells (52).

T-cell relevant antigen down-regulation

Tumor cells can edit their immunologic print to avoid immunosurveillance and recognition by T cells (87).

Use personalized vaccination by measuring CTL precursors in PBMCs of individual patients in pre-vaccination to select the antigens with higher CTL precursor frequency (65,66).

Expression of immunosuppressive

molecules

Tumor cells can secrete immunosuppressive factors such as IL-10, TGF-β, galectin-1,gangliosides, PGE2 and other molecules to counteract effective immune responses (89).

TGF-β blockade, for instance through the overexpression of sTβRII (a soluble TGF-β type II receptor) or by using a TGF-β neutralizing antibody (1D11), significantly decreased tumor growth and metastasis in two orthotopic mammary carcinoma models (90).

Tolerization of host T cells by cross-

presentation of tumor-derived antigens.

Tumor cells can present directly their antigens to T cells and induce tolarization of T cells due to the lack of effective costimulation (75).

Transfer genes encoding costimulatory molecules into tumor cells to improve their ability to provide costimulation during antigen presentation to activate T cells (91).

Creation of hostil tumor microenvironment

Tumor microenvironment in solid tumors is an immunoregulatory network composed by malignant cells surrounded by a tumor-conditioned stroma that contains extracellular matrix and a variety of nonmalignant populations, including myeloid cells, lymphocytes, fibroblasts, and endothelial cells (71).

Effector cell recruitment into metastases, transduction of tumor cells to express specific chemokines, ligands that target tumor-expressed receptors or antibody conjugates complexed with specific chemokines that selectively recognize tumor markers are potential strategies to get access to the tumor microenvironment (92).



19

Many melanoma antigens, which are recognized by T cells in the context of class I and

II MHC molecules, have been molecularly characterized. These antigens are mostly normal

proteins which include the following:

• differentiation antigens (e.g. Melan-A/MART-1, tyrosinase, gp100) expressed

both on normal and neoplastic melanocytes;

• the so-called cancer/testis antigens, expressed on different tumors and on

spermatocytes/spermatogonia of testis (MAGE-A, BAGE and GAGE);

• ubiquitous antigenic proteins;

• tumor-restricted antigens derived from point mutations (individual antigens) or

splicing alterations which generate new epitopes (93).

A systematic screening has been reported by Banlalam et al., who examined tumor-

infiltrating T lymphocytes (TILs) of 59 metastatic melanoma lesions. The authors concluded

that the two antigens most frequently recognized by TILs of patients having the appropriate

HLA-I allele were Melan-A/MART-1 (mainly in association with HLA-A*0201) and gp100

(associated with several HLA contexts: HLA-A*0101, *0201, *0301, *1101, *6801; HLA-

B*3501; HLA-Cw*0501, *0602 and *0802), while tyrosinase and MAGE were much less

frequently targeted. Melan-A was clearly the MAA most frequently recognized by HLA-

A*0201 TILs, with recognition observed by 30% of these TIL lines directed against the

epitopes Melan-A:26–35 and/or Melan-A:27–35. Other studies reinforce these facts

(16,94,95).It has been reported that Melan-A is expressed by 90 % of primary melanomas and

80 % of metastatic ones. The antigen gp100 is a glycoprotein expressed at low levels in

melanocytes but also strongly expressed in most melanomas (96) As so, these antigens are

attractive targets to anti-melanoma vaccine.

Analogs of immunogenic peptides modified at TCR contact sites but, nevertheless,

maintaining the capacity of activating some TCR-mediated functions are defined as altered

peptide ligands (APLs). A particular class of APLs, termed superagonist peptides, has been

identified as capable of enhancing T-cell stimulation by inducing immunological functions

not detected with the cognate wild type peptide (97). Different tumor-optimized peptide

analogs have been identified and can be divided in three major groups on the basis of the

strategy used for their identification: (i) epitopes bearing amino acid substitutions associated

with improved TCR interaction, such as conservative/semiconservative substitutions at odd

number positions in the middle of peptide for HLA-A*0201-restricted epitopes or in some

cases in position 1 or 6; (ii) epitopes designed to have a better HLA binding affinity through

Chapter 1

20

introduction of specific amino acid substitutions in positions involved in class I HLA binding

(mostly positions 2 and 9); (iii) epitopes modified for enhancing stability in biological

systems (93). In this context, a modified form of the Melan-A:26-35 peptide, in which lysine

substitutes for the native alanine (Melan-A:26-35(27L); ELAGIGILTV), has been noted to be

more immunogenic than the native form by eliciting tumor-reactive CTLs more efficiently

both in vitro and in vivo, and also to have higher peptidase resistance (98,99). Similarly, an

equivalent modified peptide has also been developed for the gp100:209-217 antigen (Fig.

1.5.). In a pilot study in which patients with metastatic melanoma were vaccinated with either

the native class I-restricted gp100:209-217 peptide or a peptide with a methionine substitution

for threonine at the second position (gp100:209-217(2M); IMDQVPFSV), the modified

peptide was superior to the native form in eliciting immune reactivity (91 % vs. 25 % of

patients, P = 0.006) (100). The increased immunogenicity of both Melan-A:26-35(27L) and

gp100:209-217(2M) peptides can be explained by the incorporation of one of the two

dominant anchor amino acid residues (leucine or methionine) at position 2, which can lead to

enhanced stability of peptide-MHC complexes (101).

Figure 1.5. Melanoma altered peptide ligands Melan-A:26-35(27L) and gp100:209-217(2M). The

substitution of the native alanine by lysine in the position 2 of the peptide Melan-A:26-35 renders it more

immunogenic and more resistent to peptidases. The substitution of threonine in the wild type form of the

peptide gp100:209-217 by methionine in the position 2 improves the binding of the peptide to the MHC

class I molecule groove, increasing its immunogenicity.

Both Melan-A:26-35(27L) and gp100:209-217(2M) antigen peptides have been being

successfully studied in preclinical and clinical trials, as part of several immunization

strategies against melanoma. The analysis of 684 consecutive patients with metastatic

melanoma treated with a high-dose intravenous bolus of IL-2, either alone or in combination

with a variety of melanoma vaccines, showed that patients who received the gp100:209-

217(2M) peptide plus IL-2 showed a stronger trend to increased objective responses


21

compared with IL-2 alone (22 % vs. 12.8 %; p= 0.009) and also compared with patients who

received a variety of vaccines that did not include this immunogenic peptides (13.8 %; p =

0.009) (102). A study where 35 HLA-A2+ patients with completely resected stage I-III

melanoma were vaccinated multiple times over 6 months with gp100:209-217(2M),

emulsified in the adjuvant montanide, demonstrated by direct ex vivo tetramer analysis and

IFN-γ cytokine flow cytometry quantification a significant antigen-specific CD8+ T-cell

immune response with a functional intact memory component (103). Immunological

responses were also obtained with DNA vaccines encoding for the antigenic peptides in

question (104–106).

Most MAAs that have been defined and have so far been moved to translational

research are self-epitopes that are predominantly restricted to MHC class I molecules (HLA-

A, -B or -C). Even that high levels of CD8+ T cells might be achieved with the immunization

of MHC class I-restricted peptides, the immune responses induced might not be enough to

eradicate the tumor as they will fail on the induction of CD4+ T lymphocytes. Several MHC

class II-restricted epitopes from melanoma antigens have been identified and have

demonstrated to induce CD4+ T cell-responses (107). The combination of MHC class I- and

class II-restricted peptides might contribute to the development of stronger antitumor immune

responses. The use of multiple peptides can also help to overcome the HLA-independent

heterogeneity of immune responses to individual peptides and antigens in patients with the

same haplotype, and maximize the proportion of responding patients (108).

3.1.2. Non-peptide cancer antigens

For a long time, proteins and peptides were seen as the only primary targets of

adaptive immune responses, and so were called T cell-dependent antigens, whereas

carbohydrates and lipids were considered not to be recognized by the complete adaptive

machinery and seen as T cell-independent antigens (109). Now it is known that lipid antigen

recognition is also an important component of host defense. APCs also display a pathway of

antigen presentation for lipid-based antigens where those are recognized by members of the

MHC class I-like CD1 family. The CD1 family, which is constitutively expressed on APCs,

consists of five isoforms that, based on sequence similarity, have been classified into three

groups: group 1 (CD1a, CD1b and CD1c) and group 2 (CD1d), both involved in antigen

presentation, and group 3 (CD1e), involved in lipid processing and trafficking (110,111).

Similar to what happens with peptide antigens, lipid antigens can be synthesized outside

APCs by microorganisms or by other cells and be internalized, or can be synthesized within

Chapter 1

22

APCs as self- or microbial lipids generated by invading pathogens. Exogenous lipids gain

access to the organelles of the endocytic pathway after an internalization process facilitated by

lipoproteins or by fusion with the plasma membrane (112). These lipids are then transported

into the cellular compartments where CD1 molecules traffic to form antigenic complexes.

Group 1 CD1 molecules present lipid antigens to clonally diverse T cells, either CD4+, CD8+

or CD4-CD8 double negative T cells, and preferentially release different types of cytokines

according to their profile. In contrast, group 2 CD1d molecules present lipid antigens to

natural killer T (NKT) cells, a unique subset of the T lineage that coexpress TCRs and

receptors of the NK cell lineage (110). Stimulation of NKT cells induces rapid secretion of

large amounts of immune regulatory Th1 and Th2 cytokines, such as IFN-γ and IL-4,

respectively (113). A wide range of self and foreign lipid antigens is known to be presented

by CD1 molecules, including lipopeptides, diacylglycerolipids, sphingolipids, mycolates and

osphomycoketides (114). The most extensively studied CD1d antigen is alpha-

galactosylceramide (α-GalCer). This synthetic glycolipid is an extremely potent stimulatory

ligand eliciting the secretion of cytokines by NKT cells, leading these cells to enhance the

activation of DCs and up-regulate costimulatory molecules and cross-priming of tumor and

viral antigens, thus acting as a strong adjuvant for Th1 and CTL responses (115).

Aberrant glycosylation is known to be a hallmark of cancer cell transformation

defining stage, direction and tumor progression (116). As such, another class of tumor

antigens that is a promising target in cancer immunotherapy is the Tumor Associated

Carbohydrate Antigens (TACA). A number of TACA have been identified and tested as

tumor vaccine targets, including mucin-related (O-linked) (Tn, Sialyl Tn, and Thomsen–

Friedenreich antigens), blood group Lewis-related (LewisY, Sialyl LewisX, Sialyl LewisA, and

LewisX), glycosphingolipids [Globo H, stage-specific embryonic antigen-3 (SSEA-3)], and

sialic acid containing glycosphingolipids or gangliosides [GM2, GD2, GD3, fucosyl GM1,

the NeuGcGM3 variant of GM3 and the polysialic acid (PSA)] [reviewed in (117)]. A great

advantage of targeting TACA is the potential to broaden the spectrum of antigens recognized

by the immune response, and thereby reduce the risk of developing resistant tumors because

of antigen loss or mutation of a given protein or lipid antigen. The expression of TACA on

normal tissues and the low immunogenicity of the carbohydrate antigens are the main

drawbacks in the use of TACA as cancer vaccine targets because these effects can result in

tolerance or autoimmunity responses (118). Despite the poor immunogenicity of pure

carbohydrates, as they seem not to be able to recruit an adaptive immune response, a new

generation of TACA-based vaccines that can produce not only antitumor antibodies but also


23

cellular immune responses is emerging, based on three main approaches: (i) glycoprotein- and

glycopeptide-based vaccines to facilitate antitumor cellular responses; (ii) targeting of pattern

recognition receptors (PRRs) to enhance antigen internalization and DC activation, as

molecules containing carbohydrates (e.g., lipopolysaccharide) are recognized by some Toll-

like receptors (TLRs) and C-type lectins; and (iii) substitution of carbohydrate epitopes with

protein or peptide surrogates to overcome the T-cell independent nature of the “anti-

carbohydrate” response, for example, by using Carbohydrate Mimetic Peptides (CMPs),

which can induce antitumor antibodies and contribute to cellular immune responses

(118,119). One example of a glycoprotein that can be modified to yield highly immunogenic

TACA is the human milk mucin (MUC1), which is one of most promising TAAs since it is

overexpressed on tumor cells with an altered glycosylation pattern (120). Since these

endogenous structures are usually tolerated by the immune system and owing to the biological

micro-heterogeneity of glycoproteins, MUC1 isolated from tumor cells is not suitable for

vaccination (121). Synthetic glycopeptide antigens have been conjugated to immune

stimulating components in order to generate sufficient immunogenicity. Fully synthetic two-

component vaccines either with T-cell peptide epitopes or with TLR ligands or three-

component vaccines with both these stimulants have been synthesized (122). For instance,

MUC1 glycopeptide antigens have been coupled to tetanus toxoid (TT), resulting in the

induction of a strong and highly selective immune response (123). Later on, it has been

demonstrated that bovine serum albumin (BSA) could replace the very expensive TTox as the

immune-stimulating carrier protein in exploratory immunization studies of synthetic MUC1

antitumor vaccines (124).

TACA-based cancer vaccines can also be used with nanoparticulate delivery systems

to enhance their efficacy. For example, Mazorra et al. (2008) demonstrated that the

conjugation of GM3, a ubiquitous antigen overexpressed in several epithelial tumor types, to

very small size proteoliposomes (VSSP) derived from Neisseria meningitides membrane

proteins, induced protective antitumor antibodies in a mice melanoma model, which were

dependent on the activation of CD8+ T cells, showing the direct involvement of the cellular

immune response in the induced antitumor protection (125). Pejawar-Gaddy et al. (2010) used

virus-like particles (VLP) decorated with MUC1, and obtained MUC1-specific CD8+

cytotoxic T cells that significantly delayed tumor growth in immunized mice (59).

Overall, the selection of a cancer vaccine target antigen should be based not only on

the presence of the antigen in a variety of tumor tissues but also on the role that this antigen

Chapter 1

24

plays in tumor growth and metastasis. As such, lipid and carbohydrate-based tumor antigens

may be suitable alternatives to peptide tumor antigens.

3.2. Adjuvants

Adjuvants have been simply defined as components that are added to vaccine antigens

to make them more immunogenic. The imprecision of this definition has lead to the inclusion

of several different agents and strategies in this class, from “antigen delivery systems” to

“immune potentiators” (126). Only a small number of approved adjuvants for human vaccines

is currently available, besides not being able to elicit always the desired protective and

sustained immune response. In fact, for many years, aluminum salts were the only acceptable

adjuvants and are present in many marketed vaccines. Apart from the good track record of

safety, these adjuvants have some limitations such as local reactions, augmentation of IgE

responses, ineffectiveness for some antigens and inability to augment cell-mediated immune

responses, especially CTL responses which are crucial for the development of cancer

therapeutic vaccines and vaccines against intracellular pathogens (127). As so, the

development of new adjuvants is needed. Lower antigen dose in vaccine, increase breadth of

response, enable complex combination vaccine by overcoming antigenic competition,

overcome limited immune response in some populations such as the elderly, young children,

chronic disease and immunocompromised patients, increase effector T cell response and

antibody titers, induce protective responses more rapidly, extend the duration of response by

enhancing memory B and T cell responses and shift the immune response toward a specific T

cell phenotype to mount the appropriate response against defined pathogens are some of the

reasons for including an adjuvant in a vaccine formulation (126,128). Some of the known

adjuvants either licensed or under investigation for human vaccines, are presented in Table

1.3..


25

Table 1.3. Classification, mechanism of action and current application of several adjuvants for human

vaccines.

Adjuvant Class Mechanism of action Application Licensed adjuvants

Alum Aluminium salt

• Induces Th2 immune responses and effective humoral immunity;

• increases stability and immunogenicity of antigens due to their adsorption onto the alum particles creating a depot effect;

• induces activation of the innate immune system with influx of neutrophils, eosinophils, NK cells, CD11b+ monocytes and DCs to the site of injection;

• induces activation of several molecular mechanisms in DCs and macrophages, such as activation of cytosolic phospholipase A2 with release of araquidonic acid, activation of the NLRP3 inflammasome through uric acid release and induction of the release of dsDNA that activates monocytes (127).

The only adjuvant available for more than 80 years. Is currently present in several human prophylactic vaccines: hepatitis A virus (HAV), hepatitis B virus (HBV), human papiloma virus (HPV), Diptheria and Tetanus (DT), Haemophilus influenza type B (HIB) and pneumococcal conjugate vaccines.

MF59 Oil-in water (O/W) emulsion

• This squalene-based O/W emulsion induces a local immunostimulatory environment at the injection site characterized by the up-regulation of cytokines, chemokines and other innate immunity genes, which promote the recruitment of CD11b+ and MHCII+ cells; • enhances antigen uptake by DCs.

Flu/Pandemic flu (EU)

Virosomes Lipid vesicles

• Virosomes are virus-like particles (VLPs) that retain the cell binding and membrane fusion properties of the native virus but lack the viral genetic material;

• virosomes interact efficiently with APCs resulting in activation of T cells;

• the repetitive arrangement of the viral envelope on the virosomal surface mediates a co-operative interaction with IgG receptors on B lymphocytes, stimulating strong antibody responses;

• fusion of the virosomes with the endosomal membrane getting access to the MHC class I presentation pathway, priming also CTL activity and a balanced Th1/Th2 response;

• possibility of inclusion of lipophilic adjuvants (129).

HAV and Flu (EU)

AS03

O/W emulsion +

Squalene +

α-tocopherol

• Triggers a transient production of cytokines at the injection site and in the draining lymph nodes; • enhances recruitment of granulocytes

and antigen-loaded monocytes in the draining lymph nodes; • α-tocopherol increases antibody

response, modulates cytokine expression, increases antigen loading and the recruitment of granulocytes to the draining lymph nodes (130).

Pandemic flu (EU)

AS04 MPL + Alum

• Consists in a combinatory adjuvant composed by monophosphoryl lipid A (MPLA) adsorbed to alum; • MPLA is a detoxified derivative of

lipopolysaccharide isolated from Gram-negative bacteria that acts as an agonist of TLR4; • TLR4 activation by MPLA induces local

activation of NF-kB activity and cytokine production, thus providing an innate immune

HBV and HPV (EU, USA)

Chapter 1

26

signal for optimal activation of APCs; • the combination of MPLA with alum in

this adjuvant system prolongs its effect in the site of injection (131)

AS01

MPLA +

Liposome +

QS21

• QS21 is a highly purified saponin extracted from the bark of a South American tree, Quillaja saponaria Molina; • combination of QS21 with emulsion or

liposome has the objective of decreasing its intrinsic lytic activity while retaining its adjuvanticity; • QS21 is a potent adjuvant for CTL

induction and promotes Th1 cytokine secretion (IL-2 and IFN-γ) and antibodies of the IgG2a isotype; • QS21 improves antigen presentation by

APCs and therefore optimize T cell response; • QS21 also improves B cell response

although it remains to be established if this is through a direct effect or via APC/T cell stimulation; • the combination of MPLA and QS21

induces both cellular and humoral immune responses (132).

HAV and Flu (EU)

Adjuvants under clinical development

Montanide W/O emulsion

• W/O emulsion where the oil phase can be from mineral (Montanide ISA 51) or non-mineral (Montanide ISA720) nature; • a multiple water-in-oil-in-water

(W/O/W) emulsion is also under study (Montanide 206D); • depot effect where the type of emulsion

controls the antigen release rate; • protection of the antigen from

degradation; • inflammation at the site of injection; • enhances uptake of antigens by APCs

due to interactions of the surfactant and the cellular membrane; • specific cytokines can be induced

according to the type of emulsion; • microdiffusion of the oil droplets to the

draining lymph nodes with stimulation of the lymphocyte accumulation and alteration of their recirculation, facilitating cell association; • have been extensively used as a

veterinary vaccine adjuvant (133).

Cancer, Malaria

AS02

MPLA +

W/O emulsion +

QS21

• Similar to the approved adjuvant AS01 with the difference that in AS02, MPLA and QS21 are transported in a W/O emulsion instead of a liposome (132).

Malaria

Immune-stimulating complexes (ISCOM)

Saponins +

cholesterol

+ phospholipids

• Spherical particles of ~ 40 nm diameter with remarkable stability, held together by the strong affinity between saponin and cholesterol; • based on the principle of coformulation

of antigen and adjuvant; • manufacturing difficulties related to the

physical incorporation of the antigen, mainly with recombinant DNA proteins; • the amount of saponin required for the

actual construction is often considerably higher than that needed to achieve a potent adjuvant effect with risk of side effects.

Approved for veterinary use.


27

RC529 Synthetic MPLA

• Synthetic mimetic of MPLA (aminoalkyl glucosaminide 4-phosphate - AGPs);

• like MPLA, it is a TLR4 agonist and activates cells of the innate immune system, including macrophages, DCs and B cells (134).

HBV

IC31 Peptide

+ oligonucleotides

• TLR9 agonist oligodeoxynucleotide containing deoxy-Inosine/deoxy-Cytosine (ODN1a) and the antimicrobial cationic peptide KLKL5KLK;

• the peptide induces potent Th2 responses while ODN1 induces efficient Th1 responses;

• the combination of both agents showed synergistic effects on the induction of cellular and humoral immune responses involving the TLR9/MyD88 signaling pathway;

• depot effect at the injection site, thus contributing to prolonged retention of the antigen-adjuvant formulation and subsequent amplification of an immune response (135).

Tuberculosis

Immunostimulatory sequences (ISS)

Bacterial DNA or synthetic

oligonucleotides

• Bacterial DNA or synthetic oligonucleotides that stimulate the innate immune system through TLR9;

• syntetic oligonucleotides are commonly referred as CpG oligodeoxynuckleotides that mimic bacterial DNA with unmetilated cytosine-guanosine dinucleotides;

• TLR9 activation leads to upregulation of MHC class I and II molecules and costimulatory molecules on DCs, and also the secretion of inflammatory cytokines such as IFN-α, IL-12, IL-6 and TNF-α. and induction of an innate immune response with a Th1-predominant profile (136,137).

HBV

Inerleukin (IL)-12 Cytokines

• Promotes an effective destruction of cancer cells; • it has anti-angiogenic activity and is able

to dramatically decrease tumor-supportive activities of tumor-associated macrophages (138).

Several cancer types, HIV

Granulocyte-macrophage colony-stimulating factor

(GM-CSF)

Cytokines

• Influences granulocyte and macrophage maturation from hematopoietic precursors, and help on the maturation of the immune system responses to antigens;

• induces the expression of the T-cell costimulatory molecule B7-1 and B7-2;

• increases the expression of MHC class II molecules in APCs (139).

HBV, HIV

Imiquimod TLR7 agonist

• Enhancement of the antigen-specific CD8+ T cell immune responses; • decreases the number of MDSCs in the

tumor microenvironment; • increases the number of macrophages

and NK cells in the tumor microenvironment (140).

Licensed as a topical therapy for malignant and non-malignant skin cell disorders, demonstrating a safety and efficacy track record for this class of TLR agonists as therapeutics. Under clinical trials for several types of cancer and HPV.

Resiquimod TLR7/8 agonist

• More potent and soluble analog of imiquimod (induces a 50- to 100-fold stronger cytokine response); • stimulates immune cells through the

TLR7-MyD88-dependent pathway and TLR8 inducing immune cells to produce cell-mediated or Th1 cytokines (141).

Herpes simplex virus (HSV), Hepatitis C virus (HCV).

Chapter 1

28

Poly(I:C) TLR3 agonist

• Synthetic analog of double-stranded RNA;

• TLR3 is the only TLR known which signaling cascade does not start with MyD88 but with TIR domain-containing adaptor (TRIF), which finally activates IRF3, NF-κB and AP-1 transcription factors;

• TLR3 is expressed in myeloid DCs but not in plasmacytoid DCs, which raises the possibility of a key role in cross-presentation and anti-viral responses;

• induction of type I IFN and the production of inflammatory cytokines that can activate NK cells, promote DC maturation and enhance antigen-specific CD8+ T cell responses (142)

Several types of cancer

Flagellin TLR5 agonist

• Major structural protein of Gram-negative flagella; • induction of proinflammatory cytokines

and chemokines by lymphoid and nonlymphoid cells, • generalized recruitment of T and B

lymphocytes to secondary lymphoid sites, DC activation, and direct activation of T cells (143).

The verification that heterologous peptide sequences could be inserted into flagellin to create vaccines that were effective at eliciting humoral immunity in the absence of an adjuvant conducted to the generation of a range of flagellin–antigen fusion proteins, mainly with viral antigens, and have proven to be effective vaccines in animal models.

From Silva JM. et al. (2014) Encyclopedia of Biomedical Polymers and Polymeric Biomaterials,

Taylor & Francis Editorial Group, London, UK, 2014 [In Press].

A strategy currently used to develop new adjuvants results from the recognition that

the innate immune system is the first line of defense against pathogens. Several PRRs, which

are involved in the initiation, promotion and execution of immune responses, have been

identified (33). TLRs, nucleotide oligomerization domain (NOD)-like receptors, scavenger

receptors, retinoic-acid inducible gene (RIG)-like receptors (RLRs) and C-type lectin

receptors recognize some conservative elements exclusively expressed on pathogens, known

as pathogen-associated molecular patterns (PAMPs), including unique lipids, lipoproteins,

proteins, carbohydrates and nucleic acids (144). Recognition of PAMPs by PRRs activates

intracellular signaling pathways that induce activation of DCs, which thus acquire a mature T

cell-stimulating phenotype culminating in the secretion of inflammatory cytokines,

chemokines, IFNs and upregulation of costimulatory molecules (145).

3.2.1. TLR ligands

In mammals, the family of TLRs (the main members are represented on Figure 1.6.) is

the largest and most extensively studied PRR class. TLR activation can engage not only the

innate immune system but can also induce adaptive immune responses, either through direct


29

engagement of TLRs with their ligands on B and T cells, or through indirect mechanisms

mediated by TLR-activated DCs (146).

Figure 1.6. TLR cellular location and respective ligands. Mammalian TLRs are classified into several

groups based on the type of PAMP they recognize. TLR1, 2, 4 and 6 recognize lipids, such as

lipopolysaccharide (LPS) from Gram-negative bacteria, lipoteichoic acid from Gram-positive bacteria

and lipoarabinomannan from mycobacteria. TLR5 senses bacterial flagellin. TLR3, 7, 8 and 9 detect

nucleic acids derived from viruses and bacteria. TLR3 recognize double stranded RNA (dsRNA), which is

produced by many viruses during replication. TLR7 recognizes synthetic imidazoquinoline-like molecules,

guanosine analogs such as loxoribine, viral single-stranded RNA (ssRNA) and small interfering RNA

(siRNA). Human TLR8, which has high homology to mouse TLR7, participates in the recognition of

imidazoquinolines and ssRNA. TLR9 recognizes non-methylated CpG DNA motifs present in bacterial

and viral genomes, as well as non-nucleic acids, such as hemozoin from the malaria parasite. TLRs can

also be divided into two subfamilies distinguished by their subcellular localization: TLR1, 2, 4, 5, 6 and

also TLR10 in humans and TLR11 in mice are expressed at the cell surface while TLR3, 7, 8 and 9, are

localized in the endosomal membrane. From Silva JM. et al. (2014) Encyclopedia of Biomedical Polymers

and Polymeric Biomaterials, Taylor & Francis Editorial Group, London, UK, 2014 [In Press].

Recognition of ligands by TLRs induces recruitment of different cytoplasmic adaptor

molecules and can initiate two major independent but complementary signaling pathways

(Fig. 1.7.): (i) recruitment of the adaptor MyD88 upon activation of TLR2, 4, 7, 8, and 9 or of

Toll-interleukin 1 receptor domain (TIR)-containing adaptor molecule (TICAM)-1 upon

Chapter 1

30

activation of TLR3, both resulting in activation of the nuclear factor-κB (NF-κB) and

production of inflammatory cytokines, such as IL-1, IL-6, TNF-α, and IL-12; and (ii)

activation of IFN regulatory factor 3 (IRF3) through TRIF–TICAM-1 recruitment by TLR3

and TLR4 engagement leading to type I IFN production and subsequently induction of IFN-

responsive genes, such as antiviral genes and the CXC–chemokine, IP-10/CXCL10 (147,148).

The involvement with the humoral branch for the production of antigen-specific antibodies

has also been reported (149). From these observations, one can predict that TLR ligands may

act as very potent immune modulators and vaccine adjuvants and, given the preferential Th1-

profile involved, these molecules could have a huge impact on cancer immunotherapy. Some

examples of TLR agonists that are under investigation for use as adjuvants in human vaccines

were presented on Table 1.3..

Figure 1.7. TLR signaling. Following stimulation, all TLRs except TLR3 recruit MyD88, IRAKs and

TRAF6 to activate the Ubc13/TAK1 pathway, allowing NF-ĸB to translocate to the nucleus. TAK1 also

activates the MAPK pathway, which mediates AP-1 activation. IRF5 is recruited by the MyD88-IRAK4-

TRAF6 complex, phosphorylated and translocated to the nucleus. NF-ĸB, AP-1 and IRF5 control the

expression of genes encoding inflammatory cytokines. TIRAP is recruited by TLR4, TLR1/2 and TLR2/6,

activating the MyD88-dependent pathway. TRIF is recruited by TLR3 and TLR4, and interacts with


31

TBK1 and IKKi, which mediate phosphorylation of IRF3. Phosphorylated IRF3 dimerizes and is

translocated to the nucleus to induce expression of type I IFN and IFN-inducible genes. TRAF3 forms a

complex with TBK1 and IKKi. TRIF interacts with TRAF6 and RIP1, which mediate NF-ĸB activation.

TLR4, but not TLR3, utilizes TRAM for activation of the TRIF-dependent pathway. Adapted from Kawai

T. & Akira S. (2007) Semin Immunol; 19: 24–32.

Even that TLR activation is prone to the induction of a Th1 profile, structural

differences on TLR agonists seem to induce slightly distinct immune responses. This

differences are mainly related to the induction of antibody secretion, the activation of NK and

CTLs and the secretion of different cytokines [reviewed by Duthie et al. (2011) (150)].

Engagement of TLR2, 4 and 5 seems to correlate to the enhancement of the suppressive

function of Treg which might be related to the expression of these PRR on CD4+CD25+ Treg

cells, while the other TLRs have a broader expression on CD4+ T cells and are related to the

reversion of the suppressive action of Treg (151). A well known example of the dependence

on an agonist structure is the case of the TLR9 agonists CpG oligodeoxynucleotides (ODN),

where different classes can be defined according to their structural characteristics. Class A

CpG ODN are generally 20-21 bases in length with a single CpG motif within a hair-pin-

forming palindromic phosphodiester region and induce IFN-γ production by plasmacytoid

DCs (pDCs), by NK cells, and monocyte maturation into DCs, but are poor inducers of B cell

activation. In contrast, class B CpG ODN, which incorporate one or more CpG motifs within

a fully phosphorothioate backbone, fail to induce IFN-γ production by pDCs but trigger their

expression of costimulatory molecules and TNF-α secretion, B cell proliferation, and IgM

production, as well as up-regulation of activation markers and IL-6 production by both B cells

and monocytes (152). Class C CpG ODN consist of a stimulatory hexameric CpG motif

linked by a T spacer to GC-rich palindromic sequences and are very strong in the stimulation

of B cells as well as type I IFN secretion (153).

Synthetic molecules mimicking original PAMPs, for example the TLR9 ligand

unmethylated CpG ODN and the TLR3 ligand polyribosinic:polyribocytidic acid [Poly(I:C)],

are also recognized by TLRs, which increases their potential for clinical investigation (154).

Molecular dynamic simulation using computational approaches has been demonstrated to be

an important tool to improve understanding of the interactions between TLRs and their

ligands and to identify key structural issues that potentiate the rational design of new

molecules with pre-defined agonist or antagonist action on these receptors (155,156). Several

TLR ligands have been tested as adjuvants of cancer vaccines in clinical trials, including for

Chapter 1

32

melanoma (157), lymphoma (158), glioblastoma (159), breast, prostate, ovarian and lung

cancers (160), with quite promising results, supporting the broad conclusion that they can be

safe and effective vaccine adjuvants [reviewed by Engel et al. (2011) (161)].

Combined TLR ligation on DCs has been demonstrated to trigger distinct signaling

pathways that resulted in activation of these cells in a synergistic manner in terms of

proinflammatory cytokine and chemokine production and also expression of costimulatory

factors (Table 1.4.A). For example, Warger et al. (2006) observed that DCs activated by the

combined use of TLR7 and TLR3 ligands induced CD4+ and CD8+ T cells that were

insensitive to the inhibitory effects of Treg. These DCs demonstrated a faster and more

sustained secretion of proinflammatory cytokines and expression of costimulatory molecules,

resulting in a marked increase in CTL effector functions in wild-type mice (162). Gautier et

al. (2005) demonstrated that the different TLR signaling pathways cooperate in the secretion

of IL-12p70 through an autocrine loop of type I IFN, and that different TLR ligands are likely

to be necessary for inducing an optimal response to pathogens (148). Kasturi et al. (2011)

demonstrated that immunization of mice with synthetic NPs containing antigens and ligands

for TLR4 (MPLA) and TLR7 (R837) induced synergistic increases in antigen-specific

neutralizing antibodies compared to immunization with a single TLR ligand. Moreover, these

investigators demonstrated that direct triggering of TLRs on B cells was essential for antibody

responses and that co-activation of both TLRs on the same B cell was needed (163). The

synergistic effect observed with the simultaneous stimulation of MyD88-independent and

MyD88-dependent pathways by distinct TLR ligands can be explained by an enhanced

activation of DCs in terms of proinflammatory cytokine and chemokine production and also

expression of costimulatory molecules resulting from the greater induction of gene expression

because two independent signaling pathways are activated in parallel (164).


33

Table 1.4. Examples of studies demonstrating superiority in the combination of several TLR ligands (A),

in the association of TLR ligands to antigens (B), and in the use of nanoparticulate vaccines (C).

A. SUPERIORITY OF COMBINATION OF SEVERAL TLR LIGANDS

Nanocarrier Compared groups Study design Outcome Ref.

PLGA NPs NP[OVA+Poly(I:C)a] or NP[OVA+CpGb] vs NP[OVA+Poly(I:C)] + NP[OVA+CpG] In vitro

• ~2-fold increase in MHC class I-restricted antigen presentation; • ~3-fold increase antigen-specific

CD8+ T cell proliferation.

(165)

PLGA NPs NP[Agc+MPLAd] or NP[Ag+R837e] vs NP[Ag] + NP[Ag+MPLA+R837]

Preclinical (mice)

• ~2-fold increase in antigen-specific IgG titers with ~1.5-fold increase in avidity; • enhanced and more sustained

germinal center response; • 2 to 3-fold increase in

frequencies of antigen specific memory CD4+ and CD8+ T cells.

(163)

None

Poly(I:C) vs R848f vs LPSg vs CpG vs P3Ch

vs R848+P3C vs R848+LPS vs Poly(I:C)+R848 vs Poly(I:C)+LPS vs

Poly(I:C)+CpG vs Poly(I:C)+P3C

In vitro

• All TLR combinations induced higher secretion of IL-6 and RANTES and enhanced upregulation of CD40, CD86, CD70 and Ox40 ligand; • most prominent synergy for

the combination of Poly(I:C)+R848.

(162)

SIINFEKLi+Poly(I:C) or R848 vs SIINFEKL+Poly(I:C)+R848

In vitro

• ~3-4-fold faster release of IL-6 and RANTES; • ~4-fold higher levels of IL-6

after 20 h of TLR agonist removal; • higher CD4+ and CD8+ T cell

proliferation; • ~3-4-fold increase in IFN-γ

production; • ~2.5-fold increase in resistance

to Treg inhibitory action.

Preclinical (mice)

• Higher CD4+ and CD8+ T cell proliferation; • Higher target cell lysis and IFN-γ

production.

None LPS vs R848 vs Poly(I:C) vs

LPS+R848 vs LPS+Poly(I:C) vs R848+Poly(I:C)

In vitro • All TLR combinations induced

higher IL-12p40 and IL-12p70 secretion.

(148)

PEI or C32 NPs

NP[pSP-D-CD40Lj+CpG] vs NP[pSP-D-CD40L+CpG+Poly(I:C)]

Preclinical (mice)

• Lower tumor growth; • higher tumor-free survival.

(166)

B. SUPERIORITY OF ANTIGEN + TLR LIGANDS OVER ANTIGEN ALONE


PLGA NPs NP[TRP2] vs NP[TRP2+7-acyl lipid Ak] Preclinical (mice)

• 12-fold increase in IFN-γ-secreting CD8+ T cells; • 2-fold increase in the percentage

of mice with controlled tumor growth.

(167)

PLGA NPs NP[OVA] vs NP[OVA+LPS] In vitro

• ~1.4-fold increase in IFN-γ secretion by antigen-specific CD8+ T cells. (168)

Preclinical

(mice) • ~2-fold increase in antigen-

specific IgG titer and IFN-γ secretion.

Chapter 1

34

PLGA NPs NP[OVA] vs NP[OVA+Poly(I:C)]

In vitro • ~2-fold increase in MHC I-restricted antigen presentation. (165)

NP[OVA] vs NP[OVA+CpG]

PLGA Nanospheres

(NSs) NP[TT] vs NP[TT+CpG]

Ex vivo

• 1.5-fold increase in antigen-specific T-cell proliferation; • ~2.5-fold increase in IFN-γ

production. (169)

Preclinical (mice)

• ~8-fold increase in antigen-specific IgG titers; • ~20-fold increase in antigen-

specific IgG2b (Th1-related).

None pSP-D-CD40L vs pSP-D-CD40L+CpG or pSP-D-CD40L+Poly(I:C)

Preclinical (mice)

• Lower (n.d) tumor growth; • Higher (n.d.) tumour-free

survival. (166)

TMC NPs NP[OVA] vs NP[OVA+CpG] Preclinical (mice)

• ~2.5-fold increase in antigen-specific IgA titer in nasal washes; • ~3-fold increase in IFN-γ

secretion.

(170)

C. SUPERIORITY OF NANOPARTICULATE VACCINES OVER SOLUBLE COUNTERPARTS


PLGA NPs OVA+LPS vs NP[OVA+LPS] In vitro • ~5-fold increase in IFN-γ

secretion by antigen-specific CD8+ T cells.

(168)

PLGA NSs TT+CpG vs NS[TT+CpG]

Ex vivo

• ~1.4-fold increase in antigen-specific T-cell proliferation; • ~3.3-fold increase in IFN-γ

production. (169)

Preclinical (mice)

• ~12.5-fold increase in antigen-specific IgG titers; • 5-fold increase in antigen-

specific IgG2b (Th1-related).

PLGA Microspheres

(MSs)

OVA+Poly(I:C) vs MS[OVA+Poly(I:C)] or

OVA+CpG vs MS[OVA+CpG]

Preclinical (mice)

• 2-fold increase in antigen-specific CD8+ T cell proliferation and IFN-γ production.

(3)

PLA NSs SeM+CpG vs NS[SeM]+CpG Preclinical (mice)

• ~100 to 1000-fold increase in antigen-specific IgG titer at 4 weeks post-immunization; • ~10-fold increase in IL-2, IL-4,

IL-6 and IFN-γ secretion.

(171)

PLGA NPs Hp91l vs NP-Hp91 (conjugated at NP surface) In vitro

• 47-fold increase in IL-6 secretion by DCs; • ~3- and ~4-fold increase in CD40

and CD80 expression, respectively, by DCs.

(172)

Abbreviations: n.d., not defined; OVA, ovalbumin; PEI, polyethylenimine; PLA, polylactic acid; PLGA, poly(lactic-co-glicolic) acid; RANTES, regulated on activation, normal T cell expressed and secreted chemokine; SeM , Streptococcus equi M-like protein; TMC, N-trimethyl chitosan crosslinked; TRP2, Tyrosinase-related protein 2; TT, Tetanus Toxin. aTLR3 ligand; bTLR9 ligand; cOvalbumin or protective antigen (PA) from Bacillus anthracis or hemagglutinin (HA) from avian influenza H5N1 virus; dTLR4 ligand; eImiquimod, TLR7/8 ligand; fResiquimod, TLR7/8 ligand; gLipopolysacharide, TLR7 ligand; hPam3CysSKKK, TLR2 ligand; iMHC class I-restricted epitope 257-264 from ovalbumin; jCD40L-expressing plasmid; kTLR4 ligand; lEighteen-aminoacid immunostimulatory peptide (ISPs) derived from the endogenous protein HMGB.

Adapted from Silva J.M. et al. (2013) J Control Release; 168:179–199.


35

One of the main hurdles in cancer immunotherapy is the difficulty to abrogate the

immunosuppressive tumor environment. There are a number of mechanisms by which tumors

may actively evade or suppress an immune response: deletion of immune effector cell by

expression of death-inducing ligands by tumor cells, induction of tolerance of tumor-reactive

T cells induced by tumor cells, suppression of tumor-reactive T cells by Treg cells or MDSCs,

ignorance of tumor as a result of spatial separation of T and tumor cells, and induction of

tolerance of host T cells by cross-presentation of tumor-derived antigens (75,173).

Despite the vital importance of functional Treg in balancing inflammatory responses

and preventing autoimmune diseases, these cells have been frequently found to comprise the

majority of TILs and to correlate with poor survival in cancer patients (174). Regulating the

powerful immune-modulating activity of Treg is anticipated to become an important tool in

cancer immunology and has been demonstrated to increase T-cell activation and infiltration in

large tumors (175). Along with costimulatory molecules and cytokines, TLR ligands are one

of the major classes of molecules that regulate Treg and alter their function, through direct or

indirect effects. Indirect effects result from the activation of DCs by TLR ligands. TLR-

activated DCs secrete cytokines, mainly IL-6, IFN-γ and IL-4, which make T cells refractory

to the suppressive actions of Treg (176). Warger et al. (2006) demonstrated that distinct

combinations of two TLR ligands resulted in synergistic activation of DCs that converted to

superior CD4+ and CD8+ T-cell responses while abrogating Treg-mediated suppression (162).

However, in the absence of the TLR stimulus, antigen-loaded DCs were shown to induce Treg

cell proliferation with retention of their immunosuppressive activity, demonstrating that the

capacity of DCs to reverse Treg immunosuppressive function is highly dependent on TLR-

mediated activation (177). Treg cells have been shown to selectively express a multitude of

TLRs, namely TLR4, 5, 7 and 8, which activation induces upregulation of several activation

markers and enhances their proliferation and survival, thus reversing their

immunosuppressive function (178). On the other hand, TLR2 engagement on Treg has been

shown to augment proliferation and survival, enhancing their suppressive function (179).

Olivier et al. (2011) tested a large panel of TLR ligands in combination with a model antigen

covalently linked to an inert delivery system and observed that the negative modulation of

effector CD4+ T cells exerted by Tregs could not be circumvented, whichever TLR ligand was

used as adjuvant (180). Given the contradictory results obtained for the role of TLR

engagement on Treg, it has been hypothesized that TLR ligands can regulate T cell-mediated

immune responses by multiple approaches, possibly including: (i) TLR-mediated activation of

DCs resulting in secretion of cytokines and costimulatory factors that stimulate effector T

Chapter 1

36

cells; (ii) direct effects on effector T cells enhancing their functions and clonal expansion

rendering them resistant to Treg suppressive actions; and (iii) expansion of the Treg cell

population with a transient loss of immunosuppressive function in the early response stage,

and reacquisition at the late stage of immune response to regulate the expanded effector T

cells following clearance of the TLR ligands. At this phase, TLR-mediated enhanced Treg

function can then play a critical role in the prevention of immune pathology or in maintaining

low levels of pathogens, effects that are needed for the maintenance of immunologic memory

(179). In some types of cancers, tumoral Treg infiltration have been shown to correlate with a

better control of the tumor, possibly through the production of pro-inflammatory cytokines,

and because intratumoral accumulation of Tregs is often associated with the overall level of

tumor infiltration by immune cells, including CTLs (181).

Another important action of TLR ligands in reversing tumor immunosuppression is

exerted on MDSCs. MDSCs accumulate in tumor-bearing hosts and cancer patients and play a

major role in tumor-related immunosuppression, hampering successful immunotherapy

through inhibition of CD4+ and CD8+ T cell function and control of NK cell cytotoxicity

(173). Zoglmeier et al. (2011) showed for the first time that short-term activation with the

TLR9 ligand CpG blocked the suppressive function of MDSCs in tumor-bearing mice,

promoting MDSC differentiation and restoring the disturbed balance of mature and immature

myeloid cells through the induction of IFN-α (182).

In summary, developing effective immunotherapy for cancer requires two steps:

targeted, antigen-specific immune stimulation through effective DC activation; and

concurrent reversal of tumor-driven immune suppression. TLR ligands have been shown to

play important roles in both steps and promise to become essential tools for effective cancer

immunotherapy.

3.3. Delivery system

Live attenuated virus- or bacterial toxoid-based vaccines generally induce excellent

effector and memory cell formation, whereas the safer and currently preferred peptide

immunization or subunit vaccines elicit poor cellular immune responses. It can thus be

anticipated that mimicking the signals provided during invasion with pathogens should

significantly improve subunit vaccination efficacy (183). On the other hand, the efficacy of

cancer vaccination strategies depends on the targeted delivery of TAAs to APCs and

consequent presentation of TAAs to T cells in an immunostimulatory environment. As

mentioned in the previous section, this can be achieved by using molecules with known


37

adjuvant potential, such as the TLR ligands (184). However, additional strategies are needed

in order to prevent their prompt in vivo degradation, to simultaneously target antigens and

adjuvants to APCs and to promote their sustained and modulated release in those cells.

The uptake of antigens by DCs depends on several antigen-associated properties, such

as size, shape, surface charge, hydrophobicity/hydrophilicity, as well as receptor interactions.

Particulate vaccines, such as whole cell vaccines, virosomes, virus-like particles or antigens

formulated in particulate adjuvants have large surfaces, which provide improved electrostatic

or receptor interactions with DCs when compared with soluble antigens (185). Several studies

have demonstrated that nanoparticulate delivery systems could enhance the uptake of antigens

and adjuvants by APCs and that these systems are associated with better immune responses

than those obtained with the soluble counterparts (Table 1.4.C) (3,168,169,171,172). Also,

nanocarriers can provide protection to the encapsulated molecules, avoiding the prompt

degradation of vaccine components such as proteins, peptides, nucleic acids and

oligonucleotides, which would otherwise suffer immediate degradation when administered

(186,187). Several immunoadjuvant molecules, such as some TLR ligands, can cause a life-

threatening septic shock-like state in higher doses (188). As such, these molecules not only

benefit from protection by nanocarriers but their safety is also improved because lower doses

are needed and their systemic distribution is restricted (189). Moreover, nanocarriers can

provide direct intracellular access, facilitating engagement of the intracellular TLR3, 7, 8 and

9 by their ligands, improving their efficacy as vaccine adjuvants (190). Nanocarriers are able

to target the immune system and co-deliver antigens and adjuvants simultaneously to the

same APC, enabling its coordinated activation (3). As mentioned before, it has been verified

that the association of TLR ligands induce superior immune responses over the antigen used

alone (Table 1.4.B). In addition to the advantage of delivering antigens and adjuvants

simultaneously in the same particulate delivery system, the combination of several adjuvants

can also have a positive effect on the activation of the immune system, has verified for the

combined TLR ligation on DCs (Table 1.4.A). Furthermore, biodegradable polymeric NPs

have the additional advantage of providing sustained release profiles to the entrapped

molecules according to the polymer’s physicochemical properties (191). Finally, NP

functionalization further allows the active targeting of APCs improving the vaccine outcome

(192). All these advantageous properties confer intrinsic adjuvanticity to biodegradable NPs

and make them promising vaccine delivery systems (193). The aliphatic polyesters-based

particulate delivery systems will be under focus in the next sections.

Chapter 1

38

4. Reaching the immune system with nanoparticles as a cancer vaccine

4.1. Aliphatic polyesters-based particulate delivery systems: classification

and characterization of the different aliphatic polyesters

The first studies on aliphatic polyesters for biomedical applications date from the

1960s and leaded to the development of materials for surgical implants and tissue repair, such

as the resorbable sutures from polyglycolide (Dexon®) and poly(L-lactide-co-glycolide)

(PLGA) (Vicryl®). Since then, the aliphatic polyesters have been considered in a variety of

medical applications such as prosthetics, artificial skin, dental implants, vascular grafts, pins,

bone screws, stents, and plates for temporary internal fracture fixation (194). The exploration

of these polymers as vehicles for controlled drug delivery started on the 1970s. After that,

these composites have been explored to deliver a wide range of active molecules, such as

contraceptive steroids (195–197), anticancer agents (198), local anesthetics (199) non-steroid

anti-inflammatory drugs (NSAIDs) (200) as well as macromolecular biological therapeutic

agents with short half-life (201). The LHRH agonist leuprorelin acetate (Lupron®) and

goserelin acetate (Zoladex®), both based on poly(lactic-co-glycolic) acid (PLGA), intended

for endometriosis and prostate cancer therapy, are examples of successful commercially

available drug delivery systems (DDSs) (202–204). Aliphatic polyesters have also found

potential for biomedical application as controlled release antigen delivery systems. Advances

in biotechnology allowed the development of subunit vaccines that, apart from the several

advantages over the traditional vaccines, have as general drawback the need for repeated

immunizations due to poor immunogenicity (205,206). Aliphatic polyester-based delivery

systems emerged as promising tools to increase antigen immunogenicity.

In the past three decades, synthetic biodegradable polymers have been increasingly

used for different biomedical applications as an attempt to avoid most of the problems

associated with natural polymers, such as higher costs, lack of reproducibility and

questionable purity (207). Synthetic polymers can now be easily produced with tailored

mechanical and degradative properties and high uniformity in terms of molecular weight

distribution, monomer orientation, sequence, stereo-regularity, polymer shape, morphology

and chemical functionality. This uniformity is required by regulatory entities and thus allows

their application as integral components in final dosage forms, DDSs and in implantable

devices (202–204,208). Poly(amides), poly(aminoacids), poly(alkyl-α-cyanoacrylates),

poly(esters), poly-(orthoesters), poly(urethanes), and poly(acrylamides) have been used to

prepare polymeric devices for biomedical applications (209). Among the synthetic

biodegradable polymers, the thermoplastic aliphatic polyesters have generated tremendous


39

interest because of their excellent biocompatibility, biodegradability, and mechanical strength,

which is reflected on their long history of biomedical applications such as sutures, bone

screws, tissue engineering scaffolds and DDSs. Simple formulation methods can be used to

modify those polymers in order to design carrier systems able to deliver a variety of drug

classes such as peptides, proteins, and nucleic acids. Most importantly, they are approved by

FDA and EMA for drug delivery in humans (186,210,211).

The synthesis of aliphatic polyesters can follow three major routes. The first route is

polycondensation of a hydroxyacid or a diol and a diacid, a method which drawbacks include

the low degree of polymerization resulting in low molecular weight polymers and the

impossibility of synthesis of block copolymers (212). The second route is ring opening

polymerization (ROP) of lactones and other cyclic diesters which under proper conditions can

result in polyesters with high molecular weights and limited side reactions such as

racemization (213,214). The third route is enzymatic polymerization, which is carried out

under mild conditions avoiding the use of toxic reagents and with the possibility to recycle the

catalyst, being its major drawback the relatively low molecular weight of the obtained

polymers (215,216).

The aliphatic polyesters mainly used for biomedical applications are those derived

from the monomers glycolide/glycolic acid (GA), lactide/lactid acid (LA), β-butyrolactone (β-

BL), ε-caprolactone (ε-CL), 1,5-dioxepan-2-one (DXO) and trimethylene carbonate (TMC).

They can be classified as homopolymers or copolymers depending on their homogenous or

heterogeneous composition on repeating units, respectively (213). The molecular structures of

the main aliphatic polyester homo- and copolymers as well as their synthesis mechanisms

starting from the correspondent monomers are represented in Table 1.5..

Chapter 1

40

Table 1.5. Examples of synthetic aliphatic polyesters and their manufacturing methods.

Examples of polyesters

Polymer molecular structure

Examples of manufacturing methods

Monomer molecular structure

Homopolymers

Polyglycolide or Polyglycolic acid (PGA)

1. Ring-opening polymerization (ROP) of glycolide;

2. polycondensation of glycolic acid (217).

Polylactide or Polylactic acid (PLA)

1. ROP of lactide;

2. polycondensation of lactic acid (218,219).

Polycaprolactone (PCL)

1. ROP of caprolactone;

2. free radical ROP of 2-methylene-1-3-dioxepane;

3. polycondensation of 6-hydroxyhexanoic acid (220,221).

Poly(1,5-dioxepan-2-one) (PDXO)

1. ROP of 1,5-dioxepan-2-one (213).

Poly(trimethylene carbonate) (PTMC)

1. ROP of trimethylene carbonate (213).

Poly(3-hydroxybutyrate) (P3HB)

1. ROP of β-butyrolactone;

2. Polycondensation of 3-hydroxybutyric acid (222).

Copolymers

Poly(lactic-co-glycolide) (PLGA)

1. Ring-opening copolymerization of glycolide and lactide (223).

Poly(propylene fumarate) (PPF)

1. Combination of propylene glycol and fumaryl chloride to form an intermediate, fumaric diester, which is then transesterified (224).

Polyethylene adipate (PEA)

1. Esterification and polycondensation of adipic acid and ethylene glycol (225).

http://en.wikipedia.org/w/index.php?title=Polyethylene_adipate&action=edit&redlink=1


41

Poly(3-hydroxybutyrate-co-3-hydroxyvalerate) (PHBV)

1. ROP of butyrolactone and valerolactone (oligomeric aluminoxane as a catalyst);

2. Copolymerization of 3-hydroxybutyric acid and 3-hydroxypentanoic acid (226).

Poly(lactide-co-glycolide-co-α-cloro-ε-caprolactone) (PLGA-α-Cl-ε-PCL)

1. Ring-opening copolymerization of α-cloro-ε-caprolactone, glycolide and lactide. The chloride can be then substituted to further functionalization (227).

n, number of repeated units; x, number of units of lactic acid; y, number of units of glycolic acid; k, number of units of 3-hydroxybutyric acid; z, number of units of 3-hydroxypentanoic acid; r, number of units of α-cloro-ε-caprolactone

From Silva JM. et al. (2014) Encyclopedia of Biomedical Polymers and Polymeric Biomaterials, Taylor &


Polylactic acid (PLA)-based polymers were largely commercialized as fiber materials

for resorbable sutures. After this, different prosthetic devices have been developed.

Nowadays, PLA resins are approved by the FDA and EMA for food and surgical applications

such as DDSs (228). Because the monomer lactide exists in three diastereomeric forms, PLA

possesses chiral molecules and can be found in four forms: poly(L-lactic acid) (PLLA),

poly(D-lactic acid) (PDLA), poly(D,L-lactic acid) (PDLLA) - a racemic mixture of PLLA and

PDLA - and meso-poly(lactic acid). When polymerized, atactic, heterotactic and isotactic

chains exhibit strikingly different crystallinity, thermal properties and degradability profiles.

Considering its use in biomedical research, only PLLA and PDLLA have shown promise and

thus have been extensively studied (229). Polyglycolic acid (PGA) polyesters are readily

degraded and apart from its use in absorbable sutures, they have found less use as

homopolymers, appearing predominantly as copolymers with lactide and trimethylene

carbonate monomers (230).

During the resorbable polymer “boom” of the 1970s and 1980s, polycaprolactone

(PCL) and its copolymers were used in a number of DDSs due to their numerous advantages

over other biopolymers in use at that time: (i) tailorable degradation kinetics and mechanical

properties; (ii) ease of manufacture and shaping, enabling appropriate pore sizes conducive to

tissue in-growth; (iii) controlled delivery of entrapped drugs; (iv) functionalization to render

the polymer more hydrophilic or adhesive; and (v) superior rheological and viscoelastic

properties, such as low melting (Tm) and glass transition temperatures (Tg) (231).

Polyhydroxyalkanoates are biodegradable and biocompatible polyesters that can be

produced by bacterial and synthetic routes. The most common polymer is poly(3-

hydroxybutyrate) (P3HB), a semi-crystalline isotactic polymer that undergoes surface erosion

Chapter 1

42

due to the hydrophobicity of the backbone and its crystallinity (222). It has been used to

produce particulate DDSs (232,233) and also other composites for non-biomedical

applications (234).

Poly(propylene fumarate) (PPF) is a high-strength polymeric biomaterial that while

technically a polyester, possesses the unique ability to be cross-linked through the unsaturated

bonds in its backbone. As a result, its degradation is dependent on molecular weight, cross-

linker and cross-linking density. PPF is injected as a liquid that becomes solid upon cross-

linking. Therefore it is considered promising for biomedical applications, such as filling bone

defects and long-term delivery of ocular drugs. PPF-based scaffolds allow the design of

structures that may not be attainable from non-crosslinkable degradable polymers (235,236).

To our knowledge, it has never been used to formulate particulate delivery systems.

Physical properties such as Tg, Tm, and crystallinity can be significantly affected by

copolymerization (237). Random, block, and graft copolymerization can yield products with

significantly different properties and be used to obtain a product with a particular combination

of desirable properties. For instance, in the 1970s it had already been recognized that PCL

was particularly amenable to form polymer blends (231). Completely amorphous polymers

like poly(1,5-dioxepan-2-one) (PDXO) are also very valuable for copolymerization to

improve the elasticity of the polymer (238). PLA toughness limits its applications, rendering

it a good candidate for copolymerization (239). Another example is the case of P3HB, which

reduced stability makes it a poor candidate for controlled delivery applications, being most

commonly used as a copolymer with 3-hydroxyvalerate to create PHBV (240). PHBV is less

crystalline than P3HB with a lower Tg and Tm, widely used to tissue engineering, for

instance, to produce polymer composites with high porosity and controlled pore scaffolds

(241). It has also been used to produce particulate DDSs (242,243).

Random copolymers can be easily synthesized by polymerization of different

monomers by the synthesis methods mentioned before. The final copolymer composition

depends on the composition of the monomer feed as well as the reactivity ratio of the

monomers. Normally, copolymers are represented as AB products, where A and B represent

constituent blocks of different nature. The most well-known example of a random polyester

copolymer is PLGA, the copolymer of the LA and GA monomers (186). PLGA can be

produced with different stoichiometric ratios of its monomers and several molecular weights,

two parameters that are of determinant influence on the hydrophobicity and degradation

kinetics of the polymer. The forms of PLGA are usually identified by the monomers’ ratio

used. Accordingly, PLGA 50:50 identifies a copolymer whose composition is 50 % LA and


43

50 % GA. The ratio 50:50 is the most widely used of the PLGA copolymers in

nanotechnology (244). PLGA has been widely used to formulate different biodegradable

devices, such as MPs and NPs, implants and in situ-formed devices (245). Because of their

ability to protect molecules from the aggressive in vivo environment, biodegradable PLGA

particles have been investigated for sustained and targeted delivery of various agents,

including hydrophilic and hydrophobic drugs, proteins and peptides, plasmid DNA and

siRNA (246,247). It has also been extensively tested as vaccine particulate delivery systems

to encapsulate a variety of antigens such as proteins, peptides, lipopeptides, cell lysates,

viruses or plasmid DNA (172,248–252). Some advantages and disadvantages of PLGA as a

particulate vaccine delivery system are presented in Table 1.6., some of which are transversal

to all aliphatic polyester-based vaccine particulate delivery systems.

Table 1.6. Main advantages and disadvantages of PLGA as a particulate vaccine delivery system

component. ADVANTAGES

• Biodegradability and biocompatibility; • approval for parenteral use by regulatory authorities around the world; • commercially available with different physicochemical properties (several molecular weights and lactide:glycolide ratios); • drug release profile can be tailored by selecting PLGA polymers with the appropriate properties. A pulsatile release is also possible,

which provides more effective immune responses as it can avoid the risk of tolerance and substitute the need of several boosting administrations typically required to induce protective immunity (253); • protection of encapsulated biomolecules from in vivo degradation in the blood stream, gastro-intestinal tract and nasal mucosa

(254,255); • delivery of antigens to be presented by both MHC class I and MHC class II pathways; • transportation of more than one molecule concomitantly in the same particulate delivery system (e.g. several antigens or co-

encapsulation of antigen and adjuvant) increasing the probability of coordinated and synergistic action (3); • capacity to induce strong T cell responses containing very low doses of antigens and adjuvants, allowing the use of lower doses of these

molecules minimizing the potential side effects often associated with the use of adjuvants (256); • possibility of blending or co-polymerization with other materials; • can be stably stored and easily scaled up for pharmaceutical manufacture.

DISADVANTAGES

• Environment acidification upon degradation compromising cargo’s stability; • risk of denaturation of the incorporated biomacromolecules by the organic solvents and/or shear stress used during particle formulation; • low encapsulation efficiencies of some macromolecules; • lack of suitable functional groups for efficient covalent bioconjugation of bioactive ligands or the adsorption of negatively charged

therapeutics such as nucleic acids; • required sterilization for clinical use; • potential expensive DDS.


Advances in synthetic polymer chemistry have unleashed seemingly unlimited

strategies for producing block copolymers beyond the established AB copolymers, with

arbitrary numbers and types of repeating units. Combining chemically distinct blocks in ABA

or BAB triblock, multiblock, star-block and graft copolymers offers unparalleled

opportunities for designing new nanostructured materials with enhanced functionality and

Chapter 1

44

properties, often without adding substantially costs of production (257,258). AB-diblock and

multiblock copolymers possess amphiphilic properties (they are also known as amphiphilic

block copolymers, ABCs) due to their two regions of distinct chemical nature that undergo

phase separation as a result of chain association in solvents that selectively dissolve one of the

blocks. This process results in the formation of nanoscopic supramolecular core/shell

structures - polymeric micelles - through interactions between the hydrophilic and

hydrophobic blocks with one another and the surrounding medium. The chemical nature of

the core-forming block may allow drug incorporation via chemical, physical, and/or

electrostatic means (259). These systems offer several advantages for drug delivery as it may

be possible to choose appropriate block copolymers for specific purposes, such as prolonged

circulation time, introduction of targeting moieties, and modification of the drug-release

profile (260). Poly(ethylene glycol) (PEG)-block-poly(ester)s are one class of the most

frequent ABCs used to polymeric micelle formation. For instance, triblock copolymer

micelles of PLA–PEG–PLA and PLGA–PEG–PLGA were used to encapsulate plasmid DNA

encoding for a multiple-epitope antigen gene of the hepatitis C virus (HCV) (261). As

controlled-release gene coatings, these triblock micelles had shown high DNA loading

efficiency, low cytotoxicity, sustained-release profile and satisfying immune responses in

vivo. A new poly(lactide-co-glycolide-co-ε-caprolactone)-graft mannosylated poly(ethylene

oxide) copolymer was synthesized by combination of “clip” and “click” chemistries and

demonstrated potential to formulate micelles with DC- and macrophage-targeting capacity

(227).

Aliphatic polyesters can also form star polymers taking advantage of synthesis by

ROP of cyclic esters in a “core-first” approach (262). Star polymers are branched, multi-

armed polymeric materials in which the branches radiate from a central core. They offer

increased concentration of functional end groups comparing to polymers of equal molecular

weight, with improved solubility and distinct hydrodynamic volumes. They often have lower

melt viscosities, distinct thermal properties and improved physical processing, while other

properties are more influenced by arm molecular weight than the total molecular weight of the

polymer star. These polymers have been prepared from the monomers LA, GA, β-BL, ε-CL,

and TMC as well as from their copolymers (263). Aliphatic biodegradable star polymers have

found particular utility as controlled release DDSs and in nanotechnology applications, such

as molecular imaging. Their hydrophobic interiors and hydrophilic coronas have the capacity

to accommodate hydrophobic drugs within their interior, providing a way to transport the

payload through aqueous media to the desired physiological target and control the rate of drug


45

release (264,265). Star polymers have also demonstrated the capacity to accommodate water-

soluble molecules in their hydrophilic arms (266). It is noteworthy that immunogens (antigens

and adjuvants) are either hydrophilic or hydrophobic molecules, making star polymers

promising tools for vaccine delivery systems. Unfortunately, these structures are still under-

explored as vaccine delivery systems.

Among the different forms of aliphatic polyester-based DDSs, the most common are

micro/nanospheres, micro/nanocapsules, polymeric micelles, nanogels, star copolymers,

films, cylinders, in situ forming implants, scaffolds, and foams (267,268). Some of these

DDSs are relevant for vaccine applications and are schematically represented on Table 1.7..

Table 1.7. Schematic representation of the main classes of particulate vaccine delivery systems that can be

prepared with aliphatic polyesters.

DDS Definition Main formulation methods

Micro/nanospheres

Particle composed by a polymeric matrix in which the cargo is dispersed. Molecules can also be adsorbed at the surface.

Solvent evaporation and solvent extraction processes (single or multiple emulsion); phase separation (coacervation); spray-drying; dialysis (233,245).

Micro/nanocapsules

Vesicular systems in which the drug is confined to an aqueous or oily cavity surrounded by a single polymeric membrane, being able to function as a reservoir.

Nanoprecipitation; emulsion–diffusion, double emulsification; emulsion-coacervation; polymer-coating and layer-by-layer (269).

Micelles

Supramolecular core/shell structures with a hydrophobic core stabilized by a hydrophilic shell. Can function as nanoscopic depots or stabilizers for poorly water-soluble compounds.

Self-assembly of block copolymers (260)

Star polymers

Supramolecular branched, multi-armed polymeric materials in which the hydrophilic branches radiate from a hydrophobic central core. Can accommodate hydrophobic molecules in the core and/or hydrophilic molecules associated with their branches.

Controlled polymerization by ring-opening polymerization (ROP) of cyclic esters in a “core-first” approach (263).

Nanogels

Swollen polymeric networks with tunable chemical and physical structures. Promising tool to overcome major biological barriers due to physicochemical properties manipulation after its injection into body fluids.

Physical self-assembly of interactive polymers, polymerization of monomers in a homogeneous phase or in a micro- or nanoscale heterogeneous environment; crosslinking of preformed polymers; template-assisted nanofabrication (267).



Chapter 1

46

4.2. Biocompatibility and biodegradability of aliphatic polyesters:

degradation and elimination mechanisms

Biocompatibility refers to the ability of a material to perform with an appropriate host

response in a specific application. Interest in the aliphatic polyesters is derived primarily from

this property. These polymers are readily hydrolyzed to form the corresponding hydroxyacids,

many of which are byproducts of various metabolic pathways in the body under normal

physiological conditions and are easily metabolized in the body via the Krebs cycle and

physiologically eliminated (270).

Vert el al. (1992) had defined several terms related to biodegradation that should not

be confounded (Table 1.8.) (271). The biodegradability of a polymer does not guarantee its

biocompatibility since it does not indicate if the degradation products are inert and/or if they

are eliminated from the body. As so, the fact that a polymer is bioresorbable is as important as

its biodegradability. The homopolymers PLA, PGA and PCL and their copolymers are known

to be bioresorbable (213,272). During this section, PLGA degradation will be the primary

focus as an exemplificative case.

Table 1.8. Polymer properties related with in vivo degradation.

Biodegradable Polymer suffer break down due to macromolecular degradation with in vivo dispersion, but no proof for the elimination from the body.

Bioresorbable

Polymer undergoes bulk degradation and elimination through natural pathways reflecting total elimination of the initial material and its degradation byproducts with no residual side effects.

Bioerodable The same as bioresorbable, but the degradation is from the surface.

Bioabsorbable Polymer dissolution in body fluids without any polymer chain cleavage or molecular mass decrease, as happens for water-soluble implants.



Aliphatic polyesters are bulk-eroding polymers, meaning that erosion happens

throughout the polymer bulk and not exclusively from the surface inwards, as happens with

surface-eroding polymers such as polyanhydrides (273). Both degradation mechanisms are

illustrated in Figure 1.8.. For less hydrophobic polymers, water is rapidly transported into the

matrix and the polymer degradation rate is similar everywhere within the matrix, leading to

erosion throughout the polymer matrix (i.e., bulk erosion). In contrast, in hydrophobic


47

polymers, water is excluded from the bulk of the matrix leading to erosion only at the surface.

In reality, many polymers erode by a combination of surface and bulk erosion (274). Erosion

depends on the degradation, dissolution and diffusion processes. For PLGA, the dissolution of

water-soluble oligomers (up to nonamers) is often assumed to be the rate-limiting process of

erosion (275). The in vivo degradation of PLGA (and also other polyesters) happens by a

chemical hydrolysis reaction of ester bonds in its backbone resulting in the production of the

original monomers (LA and GA in the case of PLGA) (276). The reaction can be catalyzed by

acids or bases, acids being more relevant. The source of the catalyst can be external (non-

autocatalytic reaction) or internal (autocatalytic reaction) when it happens by the carboxylic

acid end groups of the polymer chain (275). The degradation rate of PLGA is related to the

monomer ratio used in production: GA is slightly more hydrophilic than LA, leading to higher

hydrolysis rates with its higher content (277). From the several monomer ratio combinations

available in the market (50:50, 65:35, 75:25 and 80:20), PLGA 50:50 is a fairly hydrophilic

polymer and has the fastest biodegradation rate of the PLGA polymers (278). For instance,

PLGA 50:50 of 14 KDa has demonstrated to be almost completely degraded in water within

30 days (279).

Figure 1.8. Mechanisms of bulk and surface erosion of polymers. From Peppas N. and Narasimah B.

(2014) J Control Release; pii: S0168-3659(14)00450-7.

Concerning other aliphatic polyester degradation products, hydrolytic degradation of

PHB results in the formation of D-(−)-3-hydroxybutyric acid, a normal blood constituent in

common with acetoacetate and acetone, constitutes one of the three ketone bodies produced

endogenously by the ketogenesis process (280). The PPF breaks down into nontoxic waste

Chapter 1

48

products of fumaric acid and propylene glycol (235). PCL degradation is a homogenous

process that happens in two stages: (i) the non-enzymatic hydrolytic cleavage of ester groups,

and (ii) intracellular degradation for more crystalline polymers and low molecular weight

(less than 3000 KDa). Acetyl coenzyme A and 6-hydroxyl caproic acid are hydrolysis

intermediates that are eliminated through the Krebs cycle (231).

Biodegradation is closely related with the cargo release process. Upon immersion in

aqueous environments, the polymer starts to absorb water immediately causing pore

formation. When the pore network becomes big enough, the cargo release starts (268).

Several mechanistic mathematical models for prediction of drug release from PLGA bulk

polymer have been proposed (275,281). These models are often based on studies with PLGA

microspheres (MSs) and specifically address interactions between three main influent

phenomena: polymer degradation, erosion and cargo transport. Models could be further

improved by considering the effects of autocatalysis on degradation kinetics and oligomer

transport. Deeper insights on the mechanistic coupling between drug diffusion rate and

polymer erosion are also important to characterize those degradation mechanistic models.

There are only four possible ways for molecules to be released from PLGA-based

DDSs: (i) transport through water-filled pores by diffusion (the most common release process

due to the cargo physicochemical characteristics such as a protein or a peptide that are too

large and hydrophilic to be transported through the polymer phase); (ii) transport through

water-filled pores by convention or osmotic pumping; (iii) transport through the polymer; and

(iv) dissolution or erosion of the polymer (which does not require drug transport) (268,282).

Cargo release from aliphatic polyester particulate delivery system is often described to

happen in three phases (Figure 1.9.): an initial phase with high release rate (burst release

phase); an intermediated slow release phase of the molecules entrapped in the polymeric

matrix (lag phase); and a second increased release rate phase (final release phase). The first

phase of the release happens due to the release of adsorbed molecules to the particle surface

and reflects diffusion/controlled dissolution of drug molecules accessible to the solid/liquid

interface. This phenomenon seems to be accentuated by the high hydrophobicity of the

polymer and hydrophilicity of the entrapped molecule (283). The second phase results from

the entrapped drug release that is closely related to the bulk degradation of the polymer (201).

Some studies point only two degradation phases: a first phase that is dependent on particle

size with no polymer mass loss and a second phase that is independent from particle size

during which mass loss occurs (281).


49

Figure 1.9. Typical cargo release curve from aliphatic polyester-based particulate vaccine delivery

systems. An exemplificative curve of the release behavior of a macromolecule from an aliphatic polyester-

based particulate delivery system is represented. The release from aliphatic polyester particulate delivery

systems normally happens in three phases. It starts with a “burst release phase” (1.) that can function as

the vaccine priming dose. The following “lag phase” (2.) and the final “sustained final phase” (3.) can

provide controlled release of the antigens and adjuvants and mimic vaccine boosting doses. From Silva

JM. et al. (2014) Encyclopedia of Biomedical Polymers and Polymeric Biomaterials, Taylor & Francis

Editorial Group, London, UK, 2014 [In Press].

Selection of the appropriate polymer material to achieve the expected cargo release

time scale is normally a primordial consideration in formulation design. The choice of PLGA

polymer for antigen delivery depends on the goal of the immunization strategy. Generally, the

burst release is often considered to avoid when the particulate delivery systems are used for

general drug delivery. However, for vaccine delivery the burst effect can mimic the priming

doses required for current vaccination programs. The release profile is also considered

advantageous because the dose of antigen necessary to stimulate the secondary response is

much lower than that required for evoking a primary response (284). For instance, MSs

prepared with PLGA polymers with different degradation rates (different LA:GA ratios)

yielded particles with different dimensions with fast or slow antigen release profiles with the

aim of developing a single-injection vaccines (167).

Chapter 1

50

4.3. Inherent adjuvanticity

Synthetic polymers are normally referred to have only a limited capacity to elicit

antibody formation or to induce cellular immune responses. Even that the negligible adjuvant

properties are pointed out as one of the disadvantages of aliphatic polyester for vaccine

delivery systems, these materials can also exhibit significant immunomodulation activity in a

complex process dependent on inter-related physicochemical factors such as hydrodynamic

size, morphology, composition and surface properties (285). This immunomodulation

capacity can be considered as an intrinsic adjuvant effect, and is mainly related to their

particulate and physicochemical characteristics and passive targeting of the immune system

(52). These factors are enumerated in Table 1.9.. Aliphatic polyesters can be derivatized or

particles can be decorated in a way that the adjuvant effects on the immune system become

more prominent. Several strategies will be mentioned later on section 6..

Table 1.9. Inherent adjuvanticity of aliphatic polyester particulate delivery systems for vaccines.

• Ability to protect the immunogens from rapid degradation and clearance;

• efficient internalization by APCs; • extracellular reservoirs of immunogens due to sustained release

occurring for lengthy periods (depot effect); • intracellular reservoirs of immunogens in APCs after particle

uptake so that intracellularly released antigens can be presented by the APCs to specific T cells over extended periods of time;

• capacity to directly migrate to lymph nodes after peripheral administration (for particles < 200 nm);

• codelivery of several immunogens, being either several antigens or antigens and adjuvant molecules;

• capacity to induce presentation of antigens through both MHC class I and MHC class II complexes.


It is well known that non-functionalized polymeric particles can be rapidly removed

from the blood stream by macrophages of the mononuclear phagocytic system (MPS), also

known as the reticuloendothelial system (RES). This process is mediated by the adsorption of

opsonins (mainly complement proteins such as C3, C4, and C5 and immunoglobulins) to

particle surface and recognition of these molecules by the macrophage phagocytic receptors

(286). It seems that hydrophobic surfaces and chemical groups such as -NH3, -OH or -COOH

can influence the activation of complement but it is not clear if aliphatic polyester particles are

able to induce complement activation or other direct effects on the immune system (287).

There are some evidences that several polymer-related parameters, such as chain length,

architecture (e.g., linear, branched, star-shaped, diblock and triblock copolymers, dendrimers),

functional groups, hydrophobicity/hydrophilicity, and solution properties (monomer versus


51

micellar forms) may affect complement activation differently and through different initiation

pathways (288,289). A study on PLGA MPs and NPs demonstrated potent inflammatory

stimulus after the uptake process with NF-κB translocation to cell nucleus and further pro-

inflammatory cytokines production, mainly by MP-stimulated cells (290). On the other hand,

it has been demonstrated that empty PLGA MPs with or without polycationic coatings did not

induced significant maturation and did not affect the capacity of DCs to respond to a

maturation-inducing cocktail afterwards (291). Further studies are needed to clarify the role of

these systems on the activation of the immune system.

5. The influence of physicochemical factors on NP performance

Modulation of immune responses by particulate delivery systems is deeply connected

to their capacity to target the immune system, not only concerning specific tissues and cellular

types but also at a subcellular level. Depending on the internalization mechanism and

intracellular traffic, different immunomodulatory effects may be considered (1,39).

Understanding the interdependent roles that physicochemical characteristics of nanocarriers

play on the cellular uptake and intracellular traffic and fate is extremely important. Many

factors, such as size, charge, geometry, adhesion energy, surface tension of membrane and

bending rigidity ratio between nanocarrier and membrane, can have an impact on their

performance. These parameters affect the so-called “wrapping time,” which describes how a

membrane enclosed and internalize a particle (292,293).

5.1. Influence of size

Size is one of most important factors affecting the uptake of particulate vaccines by

APCs and also on determining their intracellular fate. The cellular uptake can be considered

as a result of the competition between thermodynamic driving force for wrapping and the

receptor diffusion kinetics. The thermodynamic driving force refers to the amount of free

energy required to drive the NPs into the cell while the receptor diffusion kinetics refer to the

kinetics of recruitment of receptors to the binding site. These are fundamental factors that

dictate the amount of NPs that are taken up by cells, as well as the time needed for that (294).

Very small NPs might not produce enough free energy to be wrapped by cell

membrane and bigger NPs might require a too long wrapping time due to the slower receptor

diffusion kinetics (295). As so, it is almost utopical to think about an optimal size for particle

uptake by APCs. There are evidences pointing out that these cells have evolved to effectively

process any antigen with similar dimensions to pathogens, ranging from viruses (20 - 100 nm)

Chapter 1

52

to bacteria and even cells (in the micrometer range) (185). DCs and macrophages have been

shown to optimally phagocyte particles up to 10 and 30 μm in diameter, respectively (296).

Particle size also have an impact on the endocytic mechanism and on the intracellular

fate (accumulation in specific organelles such as lysosomes, endoplasmic reticulum (ER) or

Golgi apparatus, escape to cytosol, exocytosis, etc) and, when dealing with APCs, the type of

immune response generated (297). Each endocytic pathway seems to be defined by a specific

size range of the engulfed soluble or particulate material. In general, virus-sized particles (20

– 200 nm) are usually taken up via classic receptor-mediated endocytosis (clathrin-mediated)

(particles < 200 nm) or endocytosis through caveolae (particles within 50 – 100 nm) and tend

to generate a virus-like immune response with activation of CTLs and Th1 cells (298,299).

Endocytosis of larger sized particles (> 0.5 µm) occurs mainly via macropinocytosis.

Phagocytosis happens only in phagocytic cells, such as APCs, and seems to be more related

with the presence of opsonins at NP surface than with size itself (286). Phagocytosis

preferentially generates a bacteria-like immune response with activation of Th2 cells and

production of antibodies (300).

It has been suggested that NPs smaller than 50 nm tend to aggregate during cellular

uptake. Moreover, the higher surface curvature associated with smaller NPs restricts the

binding and the mutual adsorption between NPs and cells. For NPs larger than 50 nm, the

slower receptor diffusion rate led to much fewer NPs internalized by cells (301). On the other

hand, Gao et al. (2005) demonstrated that, in a size range from tens to hundreds of

nanometers, the fastest wrapping time and receptor-ligand interaction was verified for NPs

with ~55 nm leading to higher intracellular accumulation. For bigger NPs (> 50 nm), the

wrapping time was slower because of the slower receptor diffusion kinetics since more

receptors were taken up during the receptor-ligand binding process and were not available for

binding (295).

Particulate size cannot be ignored when considering the route of administration of a

particulate vaccine. The more traditional routes of vaccine administration are the

subcutaneous (s.c.) and intramuscular (i.m.) injections, the last is often preferred since it has

been recognized that adjuvanted vaccines given via s.c. route induce an unacceptable rate of

injection site reaction (302). Nevertheless, while the two routes are convenient and suitable

for almost any type of material and formulation, neither the muscular tissue nor the subcutis is

particularly rich in APCs. Thus, introducing antigens at sites with a higher density of APCs,

such as the epidermis, lymph nodes, or the afferent lymphatics, with appropriate formulations

and injection devices may induce more efficacious immune responses and protection (303).


53

The epidermis is particularly rich in specialized DCs called Langerhans cells (LCs),

which extend dendritic processes to sample a large area of the skin and eventually detect

antigens from pathogens that invade the epidermis (303). After acquisition of the antigen in

the periphery, LCs migrate to regional lymph nodes where they can present antigen to naïve

and memory T cells. As so, a vaccine injected into the epidermis will certainly reach the

lymph nodes for stimulation of immune responses. However, the intradermal (i.d) route is

underexplored for vaccine administration, likely due to the relative difficulty in efficient

intradermal administration, and due to presence of alum in many vaccines, which is

contraindicated for i.d. application due to the risk of long-lasting local adverse reactions

(303). Moreover, the skin of small rodents and humans differ not only in their thickness, but

also in the compactness and connection to adjacent tissues, which might compromise the

translation of pre-clinical studies approaching the impact of different routes of administration

in the immune response.

The majority of lymph node resident DCs have an immature phenotype and can

respond to activator signals and mature in situ (304,305). When targeting the lymph nodes,

additional size aspects must be taken into account. Initial lymph vessels have diameters

around 10 - 60 µm and the sinusoid in the spleen varies from 150 to 200 nm (306). Only

particles of 20 - 200 nm can efficiently enter the lymphatic system and bigger particles only

enter the lymphatic system if they are associated with DCs, which will take approximately 24

hours to arrive in the lymph nodes (307).

Mucosal surfaces, such as gastrointestinal, nasal and vaginal tracts are very often the

portal of entry of the majority of infectious microorganism. Mucosal vaccines have the ability

to confer a protective local immunity to mucosal barriers, in addition to a systemic immune

response. As so, there has been an increasing demand for the development of novel vaccines

that leads to the induction of immune response in systemic circulation as well as at mucosal

surfaces against infectious diseases (308,309). The mucus consists of a physically crosslinked,

viscoelastic hydrogel, with mesh sizes in the order of ~100 nm, which penetration is largely

restricted for particles greater in diameter than a few hundred nanometres (310). It has been

demonstrated that PLGA MPs are suitable for injection into all the aforementioned sites (s.c.,

i.m., i.d., intra-lymph node (i.ln.) administration) but that the type and extent of immune

response varies with the site of administration (303).

Chapter 1

54

5.2. Influence of chemical constitution and hydrophilicity/hydrophobicity

Studies using particulate delivery systems with distinct chemical natures have

demonstrated that hydrophilicity/hydrophobicity can have an impact on the extent of cellular

uptake and intracellular trafficking and fate (311). Zhao F. et al. (2011) reviewed the major

experimental findings of the effects of physicochemical and surface properties of NPs on the

cellular uptake pathway. Nevertheless, the proposed mechanisms of cellular uptake for NPs

studied in different laboratories are sometimes inconsistent or even totally conflicting (312).

Non-functionalized PLGA NPs seem to interact with DCs through β2integrins. The

involvement of these adhesion molecules might explain the higher adhesion of PLGA to DCs

comparing with other biomaterials and also the capacity of PLGA NPs to induce DC

maturation even in the absence of further stimuli (313). A systematic understanding of the

uptake and trafficking processes of particulate delivery systems within cells hence becomes

most important.

5.3. Influence of charge

Surface charge has a profound effect on the internalization capability of particulate

delivery systems. Positively charged particles seem to allow higher extent of internalization,

apparently as a result of the ionic interactions established between positively charged particles

and the negative charge of cell membrane (314–316). Normally, fast and efficient uptake is

associated with positively charged copolymers due to non-specific adsorptive endocytosis,

whereas slow uptake is associated with negatively charged copolymers. Subsequent

intracellular trafficking indicates that some of positively charged NPs could escape from

lysosomes after being internalized and exhibit perinuclear localization, whereas the negatively

charged and neutral NPs prefer to colocalize within lysosomes (317,318). Taking into account

the authors’ experience, polymeric particle charge mainly depends on the chemical nature of

the polymer, the chemical nature of the stabilizing agent and the pH of the dispersant.

The pKa of LA is 3.1 and that of GA is 3.8. As so, PLGA particles are normally

negatively charged at the physiological pH as carboxylic groups on the polymer chain are

ionized at pH 7.4. Notwithstanding, it has been described that PLGA particles reverse their

surface charge at more acidic pH, as that in the endo-lysosomal compartment (86,319). This

reversal of surface charge can explain the capacity of PLGA particles to rapidly escape from

endosomes and lysosomes due to interaction with the membranes of these organelles (316).

This property is a great advantage for a vaccine delivery system where a cellular immune

response is aimed, as it can contribute to the accumulation of antigens in the cytosol and their


55

cross-presentation through the MHC class I pathway. Surface charge of aliphatic polyester-

based particulate delivery systems can be easily changed by several techniques such as the use

of PEG-containing copolymers or recurrence to cationic polymer coatings such as chitosan or

poly(ethylene imine) (PEI) (320–324).

5.4. Influence of shape

Particle shape is another parameter of great impact in the context of cellular uptake

and intracellular trafficking. Venkataraman S. et al. (2011) provides a comprehensive

summary on the current understandings of the influence of nanostructures with different

shapes on important biological processes in drug delivery (325). Emerging studies have

clearly shown that non-spherical particles possess drug loading capacities and biological

behaviors that frequently deviate from their historically well-studied spherical counterparts

(326). Spherical-shaped NPs have demonstrated higher cellular uptake comparing to their

sheet-shaped or nanorod-shaped counterparts (294,327). These studies show that the selection

of the NP shape can influence the accumulation and concentration rates of the NPs in a cell.

The optimization of such parameters will lead to improvement in the design of smart

nanoparticulate carriers for various biomedical applications including vaccination.

6. Targeting NPs to the immune system

Generally, two main approaches can be used to target particulate vaccines to the

immune system: passive targeting and active targeting. Passive targeting relies on relatively

simple characteristics such as size, shape, surface charge and hydrophobicity/hydrophilicity of

the particulate vaccine delivery system that influence the rate and extent of internalization by

APCs (185). On the other hand, active targeting is based on surface functionalization of

particles with ligands directed against surface receptors of cells that can function as a gateway

to the immune system (328).

6.1. Passive targeting

Passive targeting to the immune system is an inherent property of particulate vaccine

delivery systems since their particulate nature induces per se the internalization by APCs

(185). Factors that influence the rate and extend of internalization by APCs, such as size,

geometry, surface charge, adhesion energy, surface tension of membrane and bending rigidity

ratio between particle and membrane, hydrophobicity and hydrophilicity, are relatively easy

to manipulate on aliphatic polyester-based particulate delivery systems (245). For instance,

Chapter 1

56

Reddy et al. (2006) presented an interesting study where polypropylene sulphide NPs were

targeted to lymphatic DCs by virtue of their small size, without using any targeting ligand

(329). These parameters have been discussed in more detail in section 5..

A classic example of the passive target potential of nanocarries is the accumulation of

NPs in the tumor microenvironment over time due to the enhanced permeability and retention

(EPR) effect (330). This phenomenon can be explained by the poorly developed leaky

vasculature containing inter-endotelial gaps and the failure to drain extravasated materials due

to an impaired lymphatic system, inherent characteristic of the majority of tumors. The EPR

effect is mostly exploited for anticancer nanomedicines as it is expected to increase the

therapeutic efficacy of chemotherapeutics due to tumor accumulation (331). In an

immunotherapeutic approach, the EPR effect can be seen as a potential way of targeting

immune cells in the tumor microenvironment which are known to play important roles in the

tumor and metastasis development (332).

6.2. Active targeting

Functionalization of particulate-delivery systems can take advantage of different classes

of ligands such as peptides, antibodies, proteins, polysaccharides, glycolipids, glycoproteins,

and lectins (333). Targeting the immune system with functionalizing particulate vaccine

delivery systems can be based on the introduction of ligands for specific cell surface receptors

of defined cell types of the immune system and enhance cellular specific internalization (334).

Also, the recognition of some specific ligands by their receptors on APCs can also contribute

to the enhancement of the immunogenicity of the particulate vaccine, providing an intrinsic

“danger signal” that induces the activation of innate and adaptive immune mechanisms

(321,335). A schematic representation of a functionalized particle designed as a vaccine

delivery system is presented on Figure 1.10..


57

Figure 1.10. Schematic representation of a functionalized particle intended to function as a vaccine

delivery system. NPs can be functionalized with antibodies directed to receptors expressed on cells of the

immune systems (e.g. anti-DEC205 to target DCs). Carbohydrates are frequently used for active targeting

of NPs. Simple carbohydrate residues, such as mannose or fucose, are used to target C-type lectins

expressed on DCs. More complex carbohydrates can be also used, such as hyaluronic acid which targets

CD44 receptors on several tumor cell types. NPs can be equipped with an immunogenic coating in order

to increase their recognition by the immune system (e.g. coating with immunogenic polymers such as

chitosan or pluronic block copolymers). The cargo to be delivered by NPs can be either adsorbed at NP

surface or/and entrapped in the polymeric matrix.

An important issue for vaccine design is the consideration of the ligands carried by a

number of pathogens that can interact with receptors on cells of the immune system. As

mentioned in section 3., APCs possess a broad spectrum of cell surface receptors (the PRRs)

that recognize conservative elements exclusively expressed on pathogens (the PAMPs) and

are involved in the initiation, promotion and execution of immune responses (33,144,336).

Recognition of PAMPs by PRRs induces activation of APCs by triggering intracellular

signaling pathways that lead to the induction of inflammatory cytokines, chemokines, IFNs

and upregulation of costimulatory molecules (184). Several PRRs have been targeted by

PLGA NPs functionalized with ligands or antibodies specific for these receptors (Table

1.10.).

Chapter 1

58

Table 1.10. Pattern Recognition Receptors (PRRs) targeted by functionalized PLGA NPs.

PRRs Ligand Antigen Targeted cells

Study design Reference

Toll-like receptors (TLRs)

TLR4 TLR4 ligand: MPLA Ovalbumin (OVA) DCs Preclinical

(mice) (337)

TLR4 TLR4 ligand: 7-acyl lipid A

Tyrosinase-related protein 2 (TRP2) DCs Preclinical

(mice) (167)

TLR4 TLR4 ligand: LPS OVA DCs In vitro (168)

TLR3 + TLR9 TLR3 ligand:

Poly(I:C)

TLR9 ligand: CpG OVA DCs Preclinical

(mice) (165)

TLR4 + TLR7 TLR4 ligand:

MPLA

TLR7 ligand: R837 OVA DCs Preclinical

(mice) (163)

TLR4 or TLR9 TLR4 ligand:

MPLA

TLR9 ligand: CpG

Tetanus toxoid (TT) or MUC1 lipopeptide DCs In vitro (249)

C-Type lectins

Mannose receptor (MR) mannan OVA DCs Preclinical

(mice) (338)

Mannose receptor (MR) mannose OVA Macrophages

In vitro

Preclinical (mice)

(339)

DC-SIGN humanized

targeting antibody hD1

TT DCs In vitro (340)

α-l-fucose

LTA (Lotus tetragonolobus from Winged or Asparagus pea)

hepatitis B surface antigen (HBsAg) M cells Preclinical

(mice) (341)

DEC-205 Anti-DEC-205 mAb OVA

DCs

T cells

In vitro

Preclinical (mice)

(342)

Siglecs

Siglec-7 Anti-siglec-7 polyclonal antibody -

Fibroblast transfected

with Siglec 7 In vitro (343)

Claudins

Claudin 4 C-terminal 30 amino acids of CPE (CPE30)

influenza hemagglutinin (HA) M cells Preclinical

(mice) (344)

Integrins

β1α5Integrin RGD OVA M cells In vitro

Preclinical (mice)

(254)

β1α5Integrin RGD RGDp

OVA M cells In vitro Preclinical

(339)


59

LDV LDVp

(mice)

Other targets

STAT3 STAT3 inhibitor:

JSI-124 (cucurbitacin I)

- DCs In vitro (345)

STAT3 + TLR4

STAT3 inhibitor: JSI-124

(cucurbitacin I) TLR4 ligand: 7-acyl lipid A

- DCs In vitro

Preclinical (mice)

(346)



Active targeting is often performed by the functionalization of particulate vaccine

delivery systems with antibodies (Abs). The advantage of this approach is the high specificity

and affinity of Abs for their counterpart ligands. However, their size impedes tissue

penetration and the Fc-part of the Ab may induce nonspecific uptake, Fc-R triggering or

evoke immunogenic reactions against it. These problems may be overcome by using the

smaller single-chain Fv antibody (scFv), humanized Abs or ligands for the receptors, either of

natural or synthetic origins and even modified to have increased affinity (347,348).

As mentioned before, the family of TLRs is the largest and most extensively studied

class of PRRs. They are mainly expressed on APCs but also on several T cell subsets, such as

conventional αβT cells, Treg cells, and γδT cells as well as NKT cells, and serve central roles

in the induction of innate and adaptive immune responses (147). Mammalian TLRs are

classified into several groups based on the type of PAMPs they recognize and cellular

localization (see Fig. 1.4.). As many studies have demonstrated direct costimulatory effects of

TLR agonists in both CD4+ and CD8+ T cells and also B cells in enhancing their proliferation,

activation and effector functions, the use of TLR agonists as vaccine adjuvants is an attractive

target of research (349,350). Moreover, synthetic molecules mimicking original PAMPs are

also recognized by TLRs, which increases their potential for clinical investigation (154).

Nevertheless, as TLRs do not have a direct effect on the uptake of antigens it might be

advantageous to associate the DC activation potential of TLR ligands with other factors that

can have a direct action on the uptake of antigens by APCs.

Other PRRs expressed by APCs that are often targeted by particulate vaccine delivery

systems are the C-type lectin receptors (CLRs). CLRs are a family of transmembrane

receptors characterized by the presence of carbohydrate-binding domains. CLRs are involved

in the recognition and internalization of many glycosylated self and pathogenic antigens.

Chapter 1

60

CLRs are highly specific receptors that facilitate antigen internalization and processing.

Depending on the CLR targeted, either CD4+ or CD8+ T cell responses can be specifically

induced (347,351). For instance, the mannose receptor (MR) recognizes sugars terminated in

D-mannose, L-fucose or N-acetyl glucosamine present on a range of bacteria, viruses, and

yeast (352). Antigens targeted to the MR seem to be directed to distinct early endosomes that

remain stable over extended periods within APCs, ending by being presented exclusively by

the cross-presentation pathway to CD8+ T cells through MHC class I (353). For instance,

PLGA NPs decorated with mannan, a natural polymannose isolated from the cell wall of

Saccharomyces cerevisae, has demonstrated a strong binding affinity and increased CD4+ and

CD8+ T cell responses compared to non-functionalized NPs (338). Another C-type lectin

receptor that has been extensively employed for functionalization of vaccine NPs to APCs is

the DEC-205 (354). Ovalbumin-containing PLGA NPs decorated with different densities of

anti-DEC-205 mAb induced stronger DC and T cell activation with the increasing of the

density of ligands on the surface (342).

The Siglec (sialic acid-binding immunoglobulin-like lectins), another family of PRRs,

is differentially expressed on leukocytes and other immune cells, including APCs (355,356).

Siglecs bind specific sialic acid-containing carbohydrates (sialoglycans) and are believed to

function as endocytic receptors in innate immune recognition of sialylated pathogens,

including both bacteria (e.g. N. meningitidis) and viruses (e.g. HIV) (357). Synthetic glycan

ligands can be used to target these receptors (358).

DC-specific intracellular adhesion molecule-3 grabbing non-integrin (DC-SIGN) is

one of the most DC-restricted C-type lectin receptors in humans that can also mediate antigen

presentation. DC-SIGN specifically binds high-mannose glycans and Lewis-type antigens

which are present on pathogens such as HIV and Mycobacterium and its targeting has

demonstrated to improved antigen presentation of NPs and induced stronger antigen-

dependent T cell responses (340,359).

M cells are specialized cells present in mucosal-associated lymphoid tissue (MALT)

that have a crucial role on mucosal antigen sampling (360). Targeting of these M cells is a

way of getting direct access to APCs (361). Integrins are a family of receptors that can be

targeted on M cells. This family is composed of twenty-four αβ heterodimeric members that

not only mediate the attachment of cells to the extracellular matrix but also take part in

specialized cell-cell interactions (362). β1-integrins at the surface of M cells mediate the

uptake of bacteria, alone or in complex with α5-integrins. Garinot et al. (2007) demonstrated

in vitro higher internalization of PEGylated PLGA NPs grafted with the β1 intregrin peptide


61

ligand RGD (Arg-Gly-Asp) and in vivo studies demonstrated that those NPs concentrated in

M cells and induced an antigen-specific IgG response on mice (254). As RGD peptide is

susceptible to degradation, several RGD analogs as well as mannose were grafted on the PEG

chain of PCL–PEG copolymer and incorporated in PLGA-based NPs and demonstrated to

increase the transport of NPs across an in vitro model of human M cells, enhanced NP

internalization by macrophages in vitro, and induced higher production of IgG antibodies than

the i.m. injection of free ovalbumin or intraduodenal administration of either non-targeted or

RGD-NPs (339). Claudins are a family of integral membrane proteins that are found on tight

junctions that are highly implicated on paracellular transport (363). Claudin 4 is one of such

receptors and is highly expressed on M cells in the colon and nasopharynx surface epithelium

that has also been successfully targeted with functionalized PLGA NPs (344).

7. Aliphatic polyester-based NPs applied to cancer vaccines, prophylactic

vaccines and other immunotherapeutic strategies

Aliphatic polyesters-based particulate delivery systems have been tested as carriers for

antigens and adjuvants for prophylactic and therapeutic vaccination strategies, as well as for

the delivery of immnunomodulatory agents. Some examples are presented on Table 1.11..

Vaccines for infectious diseases currently under development aim to mimic the

immune response stimulated by the natural infectious agent in order to induce a protective and

specific immunity against the disease-causing pathogen. However, even that killed or live

attenuated microorganisms and bacterial toxoids are highly effective in the induction of

effector and memory immune responses, related safety issues have driven contemporary

vaccine to be preferentially based on defined and purified recombinant subunit proteins (47).

The comprehension of the mechanisms of microbial evasion and of the host immune system

complex mucosal network has led to the development of several strategies focused on the

induction of protective local immune responses through the administration of mucosal

vaccines based on specific adjuvants or delivery systems (254,339,364). The major advantage

of those mucosal vaccines is their ability to simultaneously induce systemic and local

protective immune responses, through the production of antigen-specific antibodies and the

induction of cellular immune responses (365–367).

As represented on Figure 1.11.A, for the majority of the extracellular pathogens,

protective immunity depends on the presence of antibodies that are able to: (i) bind toxins and

physically block their interaction with host cells; (ii) have a bactericidal effect mediated by

the activation of the classical pathway of complement activation; or (iii) opsonise bacteria that

Chapter 1

62

are then ingested by macrophages (368). In the case of intracellular pathogens (Fig. 1.11.B),

the generalizations are not so easy to apply. It is consensual that a cellular immune response,

where CTLs derived from CD8+ T cells play the most preeminent effector role not only in the

protection against tumors (as represented in Figure 1.4.) but are also essential in the protection

against intracellular pathogens (369). Even though, it would be simplistic to consider that a

cellular immune response should be the only concern of a vaccine against an intracellular

pathogen since it seems that a synergy of different responses might be needed to provide the

adequate protection (370). The role of antibodies in the protection against intracellular

pathogens is not negligible. Antibodies have been shown to provide protection against

intracellular pathogens by exerting a significant immunoregulatory effect on T-cell immunity

and, in some cases, through the interaction with the pathogen before it enters the target cells,

during cell-to-cell spread of the pathogen or even inside the cell upon membrane crossing

(371,372).

The great difficulty in developing such a vaccine is the identification of a single

component (or a limited pool of components) that provides high levels of protection when

used as an immunogen. Instead of a single gene product, such as a toxin with a major role in

the pathogenesis, intracellular pathogens are often equipped with a battery of virulence factors

with high complexity and limited visibility to the immune system, which are generally not

good targets for antibody neutralization (373–375). For many pathogens it is necessary to use

a mixture of subunits to elicit a protective response that is comparable to that elicited by a live

attenuated vaccine (368). The selection of the best candidate antigens requires the application

of distinct methods such as, for example, the identification of antigens deeply involved in

pathogenesis, bacterial survival or conserved sites of vulnerability between strains (376).

Specific features of pathogens such as size, shape and surface molecule organization

seem to be key factors for their recognition and internalization by DCs (292,293). Particulate

vaccines are able to provide an improved interaction with DCs due to their high surface area,

which can provide electrostatic or receptor-interactions (185). From all the classes of

particulate vaccine delivery systems, NPs, especially those made of biodegradable and

biocompatible polymers, have attracted special attention (292,293).


63

Figure 1.11 Desired immune responses against extracellular and intracellular pathogens. A. Once

recognized and internalized by DCs, extracellular pathogens are digested in endo-lysosomal organelles

and resultant peptides are loaded on MHC class II molecules. MHC-antigen complexes are presented on

Chapter 1

64

DC surface to CD4+ T cells. The recognition of the antigens happens through the TCR on T cells. The

costimulatory environment resultant from pathogen infection and DC maturation causes T cell activation,

differentiation and proliferation. Upon extracellular pathogen infection, the cytokine priming by DCs

favors a Th2 profile, which results in the activation of B cells and secretion of antibodies against the

pathogen. These antibodies can act through direct pathogen neutralization, complement activation and/or

signaling the pathogen to phagocytic cells through opsonization. The recruitment of cells of the innate

immune system, such as NK cells, granulocytes and macrophages, plays also an important role in the

immune response against extracellular pathogens. Memory Th1 and Th2 cells are also induced and

rapidly reacquire their lineage-specific effector functions upon antigen reencounter. B. Intracellular

pathogens seem to need a much more complex immune response with the involvement of cellular and

humoral branches of the immune system. Antigens from intracellular pathogens are presented through

MHC class I complexes to CD8+ T cells inducing the differentiation of CTLs, which are the main effector

cells in pathogen-infected cell lysis. CD8+ T cells can also develop a memory phenotype that will allow a

prompt response in the case of a second infection. The presentation of pathogen antigens through MHC

class II to CD4+ T cells is crucial for the enhancement of CTL functions through the auxiliary action of Th

cells. Th1 cells enhance CTL functions through the secretion of cytokines (such as IL-2, IL-12 and IFN-γ)

and Th2 cells stimulate the secretion of antibodies by B cells. Players from the innate immune system,

such as NK cells, granulocytes and macrophages, are also recruited in the destruction of intracellular

pathogens.

Aliphatic polyesters-based particulate delivery systems have been tested as carriers for

antigens and adjuvants for prophylactic vaccination strategies (Table 1.11.A). In recent

studies, our group demonstrated that polymeric MSs and NSs were able to influence

Streptococcus equi (S. equi) enzymatic extract presentation by the immune system, inducing a

mucosal and balanced Th1/Th2 immune response crucial for protection against S. equi

infection (255,364,377). Those studies focused mainly on mucosal immunization, which is

thought to be more appropriate for a respiratory infection, such as equine strangles, while

emphasizing the mucosal adjuvant properties of PCL NSs containing S. equi protein extract.

Although some state that aliphatic polyesters homopolymers are quite limited in terms

of conjugation possibilities, the use of these polymers in the formulation of particulate

delivery systems broaden the possibilities of conjugation strategies of different classes of

molecules. For instance, Florindo et al. (2009) tested PLA NSs as vaccine delivery systems

for the delivery of the S. equi M-like protein (SeM) concomitantly with other molecules with

adjuvant properties, such as spermine, oleic acid, alginate and glycol-chitosan (171). Guo and

Gemeinhart (2008) also demonstrated that chitosan can easily be adsorbed to PLGA NPs,

yielding NPs with highly positive zeta potential, which are useful to increase the loading of

negatively charged biomolecules, such as proteins, peptides and nucleic acids (378). Roth-


65

Walter et al. (2005) functionalized PLGA MSs with Aleuria aurantia lectin taking advantage

of the available surface carboxylic groups of the polymer for covalent coupling with the

protein (379).

Aliphatic polyester NPs are under investigation for several immunotherapeutic

applications, including the reversion of allergies, asthma and autoimmune diseases. This set

of diseases is normally characterized by IgE-mediated reactions initiated by the degranulation

of mast cells and basophils when their surface-bound IgE molecules are cross-linked through

the binding of the allergen. The reversion of these conditions depends on the shifting of the

immune response against the allergen from a predominantly Th2-type response (IgE and IL-4)

towards a Th1-like immune response (IgG and IFN-γ) (380). Despite the proven clinical

efficacy of standard allergen-specific immunotherapy, this laborious and time-consuming

procedure has reduced patient compliance. Alternative approaches aiming at enhanced

efficacy, shorter treatment duration and lower number of interventions, while simultaneously

providing a high-safety profile, are under intense investigation (381). Examples of aliphatic

polyester particulate delivery systems under investigation to immunotherapy are presented in

Table 1.11.C. These nanomaterials are particularly attractive for allergy immunotherapy due

to their capacity to provide controlled release of allergens overtime and coencaptulate them

with Th1-inducing immunoadjuvants (379,380).

Table 1.11. Examples of aliphatic polyester particulate delivery systems applied to prophylactic

vaccination, cancer therapeutic vaccines and immunotherapy. A. Aliphatic polyester particulate delivery systems for prophylactic vaccines Carrier Aim Study design Outcome Ref.

PLA NSsa

Application: horse protection from the infectious disease strangles. Aim: evaluate the humoral and cellular immune responses induced by i.m. vaccination with Streptococcus equi enzymatic extract or purified Streptococcus equi M-like protein (SeM) entrapped in PLA NSs and the effect of including molecules with adjuvant properties such as spermine (SP), oleic acid (OA), alginate (ALG) and glycol-chitosan (GCS).

Design: Preclinical (mice), immune response evaluation after i.m.b immunizations. Groups:

1. PLA-PVASeM NSs 2. PLA-GCSSeM NSs 3. PLA-ALGSeM NSs 4. PLA-SPSeM NSs 5. PLA-OASeM NSs 6. PLA-PVASeM+CpG NSs 7. SeM+CpG sol.c 8. SeM sol.

• The humoral immune response induced by NSs was markedly higher than that elicited by soluble antigens, isolated or co-admixed with CpG;

• the IgG and IgG subtypes and cytokine titres indicated that NSs with GCS developed a more balanced Th1/Th2 response for both purified SeM and S. equi enzymatic extract proteins, although those induced by the pure antigen-entrapped particles were higher than the S. equi tested vaccines composed by total antigens entrapped in polymeric NSs.

(171)

PLGA NPsd

Application: protection against lethal avian H5N1 influenza virus. Aim: understand the critical parameters of innate immunity that program antibody responses

Design: Preclinical (mice), immune response evaluation after s.c.e immunizations. Groups:

1. NP(HA) + NP(MPL+R837) 2. NP(HA) + NP(R837)

• Synergistic enhancement in the antigen-specific antibody responses after primary and secondary immunization of mice with NP(MPL+R837) plus NP(HA).

(163)

Chapter 1

66

by triggering specific combinations of TLRs delivered by PLGA NPs on DCs.

3. NP(HA) + NP(MPL) 4. NP(HA) 5. Alum(HA) 6. Untreated mice

PLGA NSs

Application: protection against Leishmaniasis. Aim: evaluate the potential of PLGA NSs to enhance the immunogenicity of autoclaved Leishmania major antigen (ALM) and Quillaja saponins (QS) adjuvant.

Design: Preclinical (mice), immune response evaluation after s.c. immunizations. Groups:

1. PLGA(ALM) NSs 2. PLGA(ALM) NSs + QS 3. PLGA(ALM+QS) NSs 4. ALM + QS sol. 5. ALM sol. 6. PBS

• Encapsulation of ALM in NSs induced a smaller lesion at the injection site;

• PLGA(ALM) NSs + QS induced significantly higher IFN-γ titers (ex vivo) than any other group;

• no significant differences in IL-4 levels (ex vivo) between NSs groups or soluble ALM+QS;

• IgG1 and IgG2a titers and Ig2a/IgG1 ratio were significantly higher for PLGA(ALM) NSs + QS and soluble ALM + QS sol..

(382)

PLA MPsf and NPs

Application: prophylactic vaccine for Salmonella typhi infections. Aim: improve immunogenicity of Vi polysaccharide antigen from Salmonella typhi by entrapping and delivering it using biodegradable polymer particles. Coentrapment of a carrier protein, Tetanus toxoid (TT), and Vi polysaccharide antigen in the same PLA particle was also tested. Higher surface density of Vi polysaccharide in NPs and MPs was also evaluated.

Design: Preclinical (mice), immune response evaluation, after i.m. immunizations. Groups: 1. MP(Vi) 2. NP(Vi) 3. MP(Vi+TT) 4. NP(Vi+TT) 5. MP(Vi)-higher density 6. NP(Yi)-higher density

• Immunization with particles entrapping Vi antigen elicited significantly higher anti-Vi IgM response than that observed from immunization with soluble Vi antigen;

• Vi-entrapped in NPs elicited a stronger IgG response and significantly higher memory antibody responses than Vi MPs;

• coentrapment of Vi-polysaccharide antigen and TT in both NPs and MPs resulted in lower anti-Vi and anti-TT antibody titers;

• upon challenge with S. typhi, groups primed with particulate formulations elicited stronger anti-Vi recall responses;

• surface density of Vi antigen on polymer particle surface was a major determinant in eliciting higher anti-Vi polysaccharide antibody response;

• the results indicate that polymer particle based vaccine delivery system improves the immunogenicity of T-independent antigens considerably from a single immunization dose.

(383)

B. Aliphatic polyester particulate delivery systems for cancer therapeutic vaccines Carrier Aim Study design Outcome Ref.

PLGA NPs

Application: therapeutic melanoma vaccine in a murine melanoma model. Aim: evaluate the efficacy of PLGA-based vaccines in breaking immunotolerance to the cancer-associated self-antigen tyrosinase-related protein 2 (TRP2) in association with the TLR7 ligand 7-acyl lipid A.

Design: Preclinical (mice), immune response evaluation, tumor therapeutic effect evaluation after s.c. immunizations. Groups:

1. Empty NPs 2. NP(TLR2180-188) 3. NP(TLR2180-188+7-acyl

lipid)

• Co-delivery of cancer antigen along with 7-acyl lipid A in PLGA NPs have proven to be effective strategy in inducing immunostimulatory milieu at the tumor microenvironment;

• NP(TLR2180-188+7-acyl lipid) induced potent and specific antitumor T cell responses with no concomitant autoimmunity;

• NP(TLR2180-188+7-acyl lipid) activated IFN-γ secretion by antigen-specific CD8+ T cells

• NP(TLR2180-188+7-acyl lipid)

(167)


67

induced of therapeutic antitumor effect;

• the results validated the potential of PLGA-based cancer vaccines to break self-tolerance against cancer antigen.

PLGA NPs

Application: develop a novel delivery approach for tumor antigenic peptides in order to elicit enhanced immune responses using PLGA NPs encapsulating tumor antigenic peptides. Aim: explore a novel strategy for effective peptide delivery that enhances the cytoplasmic delivery of peptides into DCs, eliciting a more robust tumor antigen-specific CTL response both in vitro and in vivo. The following peptides were tested: ovalbumin (OVA) peptide 256–264, and mouse six-transmembrane epithelial antigen of the prostate (mSTEAP): 326–335.

Design: Preclinical (mice), immune response evaluation, tumor therapeutic effect evaluation after s.c. immunizations. Groups:

1. empty NPs 2. OVA emulsified in IFA 3. mSTEAP emulsified in IFA 4. NP(OVA) 5. NP(mSTEAP)

• CTL activity in the mice immunized with NPs encapsulating peptides was significantly higher than in those immunized with peptides emulsified in IFA;

• peptide dose encapsulated in NPs was 63 times less than that emulsified in IFA, but it induced a more robust CTL response;

• the lystic capacity of the CTLs induced by NPs encapsulating mSTEAP peptide was 1.82–2.22-fold higher than of the CTLs induced by mSTEAP peptide emulsified in IFA.

(384)

C. Aliphatic polyester particulate delivery systems of immunotherapeutic agents

PLGA MSsg

Application: counteract the Th2-dominated type I allergy. Aim: construct a novel allergen delivery system with the ability for mucosal targeting and evaluate their capacity to induce allergen-specific immune. PLGA MSs were loaded with birch pollen allergens (BP), and functionalized with the α- l-fucose specific Aleuria aurantia lectin (AAL).

Design: preclinical (mice), immune response evaluation, after oral immunizations.

Groups:

1. Empty MSs 2. MS(BP) 3. ALL-MS(BP) 4. BP 5. mSTEAP emulsified in IFA

• AAL-MS(BP) induced a significant production of allergen-specific IgG2a comparing to MS(BS) but not IgG1;

• BS alone induced IgG2a and IgG1, a typical antibody subclass during Th2-type responses in mice.

(379)

PLGA MPs

Application: subcutaneous allergen-specific immunotherapy (SIT) to counteract the Th2-dominated type I allergy Aim: evaluate the capacity of a PLGA MS-based vaccine to be used in SIT and trigger IgG2a antibodies. PLGA MSs were loaded with the major allergen of bee venom, phospholipase A2 (PLA2). The effect of coencapsulation or admixed CpG with or without the cationic stabilizer protamine was also evaluated.

Design: preclinical (mice), immune response evaluation in bee venom pre-sensitized mice followed by oral immunizations with the vaccine.

Groups:

1. MS(PLA2) 2. PLA2 sol. + Alum 3. MS(PLA2+CpG)

• CpG lowered the dose-threshold for induction of allergen-specific immune responses; • only CpG-containing

preparations induced IgG2a antibodies, suggesting that a potent allergy vaccine based on PLGA MPs should also contain CpG or an equivalent Th1-triggering adjuvant; • coencapsulated protamine

exerted its effect through stabilization and improved encapsulation of CpG.

(380)

PLGA/1,2-dioleoyl-3-

(trimethylammonium) propane

(DOTAP)/ligand asialofetuin (AF)

NPs

Application: immunotherapy for hepatocellular carcinoma Aim: development of a non-viral vector for IL-12 gene transfer in hepatocellular carcinoma by employing lipopolymeric Asialoglycoprotein receptor-targeted cationic (PLGA/DOTAP/AF) NPs for plasmid IL-12 (pIL-12) encapsulation or adsorption.

Design: preclinical (mice), antitumor activity and cytokine levels evaluation after intratumoral administration of pIl-12-encapsulated or adsorbed NPs.

Groups:

1. No treatment 2. PBS 3. Naked pIL-12 4. Empty NPs

• Suppression of tumor growth strictly dependent on the presence of the ligand AF; • injection of naked pIL-12

had no effect on tumor growth; • empty NPs by themselves

have no significatively effect on tumor suppression or progression; • AF-NP(pIL-12) and Plain

NP(pIL-12) inhibited significatively the growth of

(385)

Chapter 1

68

5. NP(pIL-12) (encapsulated) 6. NP-pIL-12 (adorbed) 7. AF-NP(pIL-12)

(encapsulated) 8. AF-NP-pIL-12 (adorbed)

tumors with their complete disappearance; • AF-NP-pIl-12 resulted in a

modest antitumor activity, with a slight growth inhibition and very low levels of IL-12 detected.

a nanospheres; b intramuscular; c solution; d nanoparticles; e subcutaneous; f microparticles; g microspheres.



8. Translational aspects and regulatory requirements

Polymeric NPs have demonstrated promising results as particulate vaccine delivery

systems and several advantages over the currently available strategies. The field of particulate

vaccine delivery systems is rapidly evolving and those based on aliphatic polyester polymers

are closer to make a major contribution to improve vaccinology in the 21st century. The

expectation is that the particulate vaccine delivery systems along with the recent developed

techniques in detecting the most appropriate bacterial targets will be better at providing potent

antigen-specific humoral and cellular immune responses and will allow next generation

vaccines to be devised against a range of infectious diseases. With the development of many

new vaccines, children immunization programs have to deliver a large number of

inoculations, a burden for them and for their parents (386) Combining antigens is one of the

solutions despite their technical, clinical, and regulatory difficulties. Nanoparticulate delivery

systems can have an important role in combining several antigens in one vaccine. An aging

population requires prevention to several infectious diseases, such as influenza or

pneumococcal, which require regular booster doses. Polymeric NPs with a prolonged antigen

and adjuvant release might also solve the problem of the need of regular booster injections for

elderly. Nevertheless, several difficulties still need to be overcome. These difficulties are both

related to the vaccine development process - need for validated methods to clinically evaluate

new vaccine strategies; selection of the most relevant antigens and epitopes; determination of

the optimal target population, doses and schedules - as well as with the particulate delivery

systems - determination of whole body and cellular pharmacokinetics; stability; drug release

rates and translation to clinic.

Current translational requirements for nanoparticulate-based systems in

immunomodulation against microbial pathogens have to deal with aspects related to: (i)

conventional approaches for translational research of antimicrobial medicinal products (387–

389); (ii) aspects related to immunomodulation looking at risk-benefit specific assessment and

the toxicological relevance of activating a number of immunomodulatory pathways (390);


69

(iii) the importance of immunomodulatory effects of a number of particulate systems, either

activating specific cascades, or potential deleterious effects through non-intended

accumulation of synthetic polymers (391) or potential for generating a stronger immune

response with non-intended systemic impact (392).

Improved understanding of the role of the immune system in controlling tumor growth

and recent developments in the field of nanoparticulate cancer vaccines have created a degree

of knowledge that promises to lead to favorable results with this approach in the near future.

Nevertheless, several questions remain unanswered and difficulties need to be overcome.

Methods to clinically evaluate cancer vaccine responses need to be validated. More

information about the most relevant tumor antigens and epitopes, the optimal patient

population and optimal doses and schedules need to be collected.

Regulatory issues regarding this area deal with two sets of issues: the materials

involved and the cancer vaccine approach in itself. From the materials side, certainly a

number of polymeric and macromolecular carriers have made the way to clinical practice and

are being used for parenteral administration, which might facilitate the access to regulatory

appraisal. But in any specific case a full assessment will have to be considered and the

nonclinical requirements to clinical translation will vary according also to disease

pathophysiology and its impact on overall clinical benefit-risk assessment, together with

materials’ properties and administration routes (2,393–395). A number of activities

particularly dealing with vaccines have a growing place in EMA’s agenda. Even though,

current priorities go further than specific anti-infectious vaccines and even consider DNA

vaccines, meanwhile they lack a strong committement on the Cancer Therapeutic Vaccines

area (396). Current regulatory compliance for clinical development of vaccines applicable

also to cancer vaccines in Europe has long time dealt both with “Note for guidance on the

clinical evaluation of vaccines” (397) and also “Guideline on adjuvants in vaccines for human

use” (398) as well as other relevant documents for vaccines in general. Meanwhile, FDA as

issued in October 2011 a relevant guidance document prepared by the Office of Cellular,

Tissue and Gene Therapies in FDA’s Center for Biologics Evaluation and Research. The

guidance on “Clinical Considerations for Therapeutic Cancer Vaccines” aims at providing

guidance to “sponsors who wish to submit an Investigational New Drug application (IND) for

a therapeutic cancer vaccine with recommendations on critical clinical considerations for

investigational studies of these products” (399). This will have a major impact in present and

future plans to move Cancer Therapeutic Vaccines.

Chapter 1

70

Tumor vaccines might have the capacity to combat already established malignant

disease, but it must be kept in mind that the success of immunological strategies will correlate

with the stage of the disease. The ideal scenario for the application of a therapeutic cancer

vaccine might be minimal residual disease with low numbers of aberrant or cancer stem cells,

where the actively induced immune mechanisms would have a fair chance to prevent tumor

relapse through reduction of circulating tumor cells and micrometastases. In addition,

prophylactic TAA-based vaccines may be conceivable in cases of hereditary predisposition.

Notwithstanding these remaining issues, the development of nanoparticulate cancer

vaccines has received great impetus and efforts are being applied to the development of novel

vaccine adjuvants and nanoparticulate delivery systems, moving from the understanding of

the inherent cellular mechanisms to the evaluation of therapeutic potential in clinical practice.

Chapter 2

73

Chapter 2 - Development of Functionalized Nanoparticles for Vaccine

Delivery to Dendritic Cells: a Mechanistic Approach

Joana M. Silva1,2, Gaëlle Vandermeulen2, Vanessa G. Oliveira3, Sandra N. Pinto4, Catarina

Rodrigues1, Ana Salgado1, Carlos A. Afonso1, Ana S. Viana5, Christine Jérôme6, Liana C.

Silva1, Luís Graça3, Véronique Préat2 & Helena F. Florindo1

1Instituto de Investigação do Medicamento (iMed.ULisboa), Faculdade de Farmácia, Universidade de Lisboa,

1649-003 Lisbon, Portugal. 2Louvain Drug Research Institute, Advanced Drug Delivery & Biomaterials, Université Catholique de Louvain,

1200 Brussels, Belgium. 3Instituto de Medicina Molecular, Faculdade de Medicina da Universidade de Lisboa, 1649-025 Lisbon,

Portugal. 4Centro de Química-Física Molecular & Institute of Nanoscience and Nanotechnology, Instituto Superior

Técnico, Universidade de Lisboa, 1049-001 Lisbon, Portugal. 5Centro de Química e Bioquímica, Faculdade de Ciências da Universidade de Lisboa, 1749-016 Lisbon,

Portugal. 6Center for Education and Research on Macromolecules, Université de Liège, 4000 Liège, Belgium.

Accepted for publication in Nanomedicines, Special Issue Nanotechnology for Vaccine

Development (November 2014)

Nanoparticle delivery to dendritic cells

75

Abstract

Aim: Produce biodegradable nanoparticles to target antigen-presenting cells and evaluate

their potential to be used as a vaccine delivery system. Materials & methods: Untargeted

PEGylated PLGA-based nanoparticles and mannose-grafted nanoparticles were formulated

and physicochemically characterized. Immortalized and primary antigen-presenting cells were

used to study nanoparticle internalization patterns. The endocytic pathways and intracellular

trafficking followed by nanoparticles were also investigated. Results & discussion:

Nanoparticles displayed mannose residues available for binding at the nanoparticle surface.

Different nanoparticle internalization patterns by immortalized and primary antigen

presenting cells were verified. Macropinocytosis, clathrin-mediated endocytosis, caveolin-

and lipid raft-dependent endocytosis are involved in nanoparticles internalization.

Nanoparticles demonstrate both endo-lysosomal and cytosolic localizations and a tendency to

accumulate nearby the endoplasmic reticulum. Conclusion & future perspective: The

developed nanoparticles might drive antigens to be presented through MHC class I and II

molecules to both CD8+ and CD4+ T cells, favoring a complete and coordinated immune

response.

Keywords

Nanoparticles, PLGA, immunotherapy, vaccine delivery systems, mannose receptor

targeting, dendritic cells.


77

1. Introduction

Increasing evidence of the active role of the immune system in non-infectious diseases

such as cancer, autoimmune diseases and allergies, justifies the need for the development of

new strategies for vaccine delivery and immunotherapy (400). Biodegradable nanoparticles

(NPs) are promising delivery systems have been shown to enhance the uptake of antigens and

adjuvants by antigen-presenting cells (APCs), improving immune responses (171,172). These

carriers provide a suitable platform to target the immune system and co-deliver antigens and

adjuvants simultaneously to the same APC, enabling its coordinated activation (3). In

addition, NPs have a large surface area that promote electrostatic and/or receptor-interacting

properties in a greater extent compared to soluble antigens (185). NPs can also protect from

immediate degradation a variety of molecules commonly used as key subunit vaccine

components, such as proteins, peptides, nucleic acids and oligonucleotides (186,187).

Furthermore, biodegradable polymeric NPs, such as those based on aliphatic polyesters, are

able to modulate the release profiles of the entrapped agents through the manipulation of

polymers’ physicochemical properties (191).

NP functionalization further allows the active targeting of APCs improving the

vaccine outcome. The mannose receptor (MR/CD206), a C-type lectin receptor, is involved in

the internalization of pathogens through the recognition of carbohydrate-binding domains. It

recognizes sugars terminating in D-mannose, L-fucose or N-acetyl glucosamine present on

pathogens (351). As so, NP functionalization with mannose can be used to improve APC

targeting and provide direct intracellular access to immunotherapeutic molecules.

The cellular internalization mechanisms and intracellular trafficking pathways

followed by NPs determine the way in which antigens are processed and the nature of

downstream events (1). Cell-surface and intracellular interactions seem to be influenced by

NP physicochemical characteristics. For instance, each endocytic pathway is potentially

adapted to a range of particle sizes and normally relates to a specific type of immune response

(300). Also, extracellular antigens, like those delivered by NPs, are normally directed to

lysosomes where they are processed and loaded onto MHC class II molecules for subsequent

presentation to CD4+ T cells. However, an alternative antigen presentation pathway (cross-

presentation) has also been described, whereby NPs are able to escape from endo-lysosomal

compartments to the cytosol and provide access to MHC class I molecules, insuring the

activation of CD8+ T cells (193). How exactly the NP-related factors contribute to the

Chapter 2

78

determination of these cellular mechanisms is insufficiently understood and must be analyzed

in order to better predict the in vivo performance of these nanosystems.

Herein, we report the development of aliphatic polyester-based NPs functionalized to

target APCs and be used as a vaccine delivery system. NPs were physicochemically

characterized and NP-cell interaction profiles were analyzed. Moreover, we studied the

intracellular trafficking profile that could predict presentation of antigens through both MHC

class I and II, supporting the potential induction of a complete and coordinated immune

response.

2. Materials and Methods

2.1. Materials

Poly(D,L-lactic-co-glycolide) (PLGA) Resomer® RG 502 (lactide:glycolide 50:50)

(average Mw = 7,000 – 17,000 g/mol), sodium cholate hydrate, sucrose, dichloromethane

(DCM), dimethilsulfoxide (DMSO), 3-(4,5-dimethylthiazol-2-yl)-2,3-(4,5-dimethylthiazol-2-

yl)-2,5-diphenyltetrazolium bromide (MTT), paraformaldehyde, concanavalin A (Con A)

(lectin from Canavalia ensiformis (Jack bean), Type IV) grafted to fluorescein isothiocyanate

(FITC) (Con A-FITC), lipopolysaccharide (LPS) from Escherichia coli, bovine serum

albumin (BSA), rottlerin and cytochalasin D were purchased from Sigma-Aldrich (St. Louis,

MO, USA). Chlorpromazine hydrochloride, genistein, nystatin and dynasore were purchased

from Enzo Life Sciences (Farmingdale, NY, USA).

Poly(D,L-lactic-co-glycolide-b-ethylene glycol) (PEG-b-PLGA) (average Mw(PEG) =

4,600 g/mol and Mw(PLGA) = 16,500 g/mol) and poly(ε-caprolactone-b-ethylene glycol)

(PEG-b-PCL) (average Mw(PEG) = 6,000 g/mol and Mw(PCL) = 12,000 g/mol) were

synthesized by ring opening polymerization (402,403). Fluorescein derivative- (F-PLGA) and

rhodamine 6G derivative-grafted poly(D,L-lactic-co-glycolide) (R-PLGA) polymers were

synthesized as described by Freichels et al. (2011) (404). Rhodamine 6G derivative (9-(2-

((carboxymethoxy)carbonyl)phenyl)-3,6-bis(ethylamino)-2,7-dimethylxanthylium bromide)

was synthesized as described elsewhere (405). Mannose-grafted poly(ε-caprolactone-b-

ethylene glycol) (man-PEG-b-PCL) (average Mw(PCL) = 17,000 g/mol and Mw(PEG) =

2,000 g/mol) was synthesized by the Huisgen 1,3-dipolar cycloaddition, where each PCL

chain was grafted with three PEG chains, with 30 % of the PEG chains containing one

mannose residue (406).

Ovalbumin (OVA) Alexa Fluor® 647, wheat germ agglutinin (WGA) Alexa Fluor®

594, goat anti-rabbit IgG Alexa Fluor 488® antibody, Image-iTTM FX Signal Enhancer and


79

AlamarBlue® reagent were purchased from Life Technologies (Carlsbad, CA, USA). The

fluorescence-conjugated rat anti-mouse monoclonal antibodies for flow cytometry analysis

PE-CD11c, FITC-CD206, FITC-Rat IgG2a к isotype control, APC-CD80 and APC-Armenian

Hamster IgG isotype control were purchased from Biolegend (San Diego, CA, USA). Anti-

EEA1, anti-Rab7a, anti-LAMP1 and anti-calnexin immunofluorescence rabbit anti-mouse

antibodies were acquired from Novus Biologicals (Littleton, CO, USA).

2.2. Preparation of NPs

NPs were prepared by the double emulsion-solvent evaporation method, as previously

reported with modifications (254). Two different kinds of NPs were formulated: non-

functionalized NPs (hereafter NPs), constituted by a blend of PLGA, PEG-b-PLGA and PEG-

b-PCL in a 70:15:15 ratio; and functionalized (mannose-grafted) NPs (hereafter man-NPs)

using a blend of PLGA, PEG-b-PLGA and man-PEG-b-PCL (70:15:15). Polymers were

dissolved in DCM (NPs) or DCM:DMSO 70:30 (man-NPs). Fluorescent NPs were formulated

by replacing one tenth of the PLGA mass by F-PLGA (NP-F) or R-PLGA (NP-R). Fifty

microliters of phosphate buffer containing Ca2+ and Mg2+ (DPBS) were added to the polymer

solution and mixtures were emulsified using an ultrasonic processor for 15 seconds at 70 W.

A second emulsion was performed with 1 % (w/v) sodium cholate aqueous solution under the

same conditions. The double emulsion was then poured drip into a 0.3 % (w/v) sodium

cholate aqueous solution, and stirred at 37 °C for 1 h. The NP suspension was washed twice

with ultrapure water by centrifugation at 22000 × g for 45 min, 4 °C (Beckman Coulter

Avanti® J-E Centrifuge JA-20) and finally resuspended in DPBS.

2.3. Physicochemical characterization of NPs

NP size was determined by Dynamic Light Scattering (DLS) using a Malvern Nano

ZS (Malvern Instruments, UK). Cumulative analysis was used to determine the Z-average

size. The zeta potential of NPs was measured using the same device by Laser Doppler

Velocimetry (LDV) in combination with Phase Analysis Light Scattering (PALS). NPs were

diluted in DPBS or phosphate-citrate buffer 200 mM pH 6.0 or 5.0. Electrophoretic mobility

was determined at 25 °C using the Helmholtz-von Smoluchowski model. For stability studies,

NPs were resuspended in DPBS, phosphate-citrate buffer 200 mM pH 6.0 or 5.0 or in cell

culture medium (CCM), i.e., RPMI 1640 + GlutamaxTM supplemented with 10 % (v/v) FBS,

104 Unit/ml/10,000 μg/ml penicillin - streptomycin (PEST), 50 µM β-mercaptoethanol, 10

Chapter 2

80

mM HEPES and 1 mM sodium pyruvate, kept at 4, 25 or 37 °C protected from light, and size

and zeta potential were analyzed as described above at the defined time points.

To determine NP morphology using atomic force microscopy (AFM), NPs were

diluted in purified water at a concentration of 5 mg/ml. Samples were prepared by placing a

drop of the colloidal suspension onto freshly cleaved mica for 15 min, and drying with pure

N2. Samples were than analyzed by AFM in tapping mode in air at room temperature, using a

Nanoscope IIIa Multimode AFM (Digital Instruments, Veeco), and etched silicon tips (ca.

300 kHz), at a scan rate of ca. 1.6 Hz.

To determine surfactant washing efficiency, the supernatants from NP centrifugations

were collected for sodium cholate quantification by high-performance liquid chromatography

method (HPLC) using a Beckman System Gold: UV-vis detector (Beckman 166), Beckman

126 solvent module and Midas autosampler. Samples (20 µl) were injected onto a Shodex

PROTEIN KW-803 series column (8.0 mm ID x 300 mm, 5 µm particle size, 300 Å pore size)

and eluted with 50 mM sodium phosphate buffer (pH 7.0) plus 0.3 M NaCl at 1 ml/min for 20

min at room temperature. Elution was monitored at 220 nm by spectrophotometric analysis.

The amount of sodium cholate in each sample was calculated using a linear standard curve

generated in the range of 0.5 – 5.0 mg/ml, r2 = 0.9979. The surfactant washing efficiency was

calculated as the percentage of sodium cholate quantified in the supernatants comparing to the

total amount used for NP formulation.

2.4. Detection of mannose on functionalized NPs by Lectin Recognition

Assay

Con A was used to detect mannose residues at man-NP surface. man-NPs (1 mg/ml)

were incubated for 1 h with Con A (0.7 mg/ml) in DPBS supplemented with 3 % (w/v) BSA.

Non-targeted NPs were used as a control. NPs were then washed twice with supplemented

DPBS by centrifugation at 22000 × g for 45 min, 4 °C (Beckman Coulter Avanti® J-E

Centrifuge JA-20). Finally, NPs were resuspended in DPBS and RFU were measured using

the Tecan Infinite® Pro 200 Multimode plate reader at 494 nm excitation and 518 nm

emission wavelengths. NPs were also loaded in 8-well Ibidi® µ-Slide microscopy chambers

(Martinsried, Germany) in order to confirm the presence of aggregates induced by Con A

binding. Images were obtained by confocal microscopy using a Leica TCS SP5 (Leica

Mycrosystems CMS GmbH, Mannheim, Germany) inverted microscope (DMI6000) with a

63× water (1.2 numerical aperture) apochromatic objective. Images were processed using the

WCIF ImageJ Software (University Health Network, Toronto, Canada).


81

2.5. Cell line culture conditions

Murine immature dendritic cells (DCs) (JAW SII cell line, ATCC#CRL-11904) were

propagated in αMEM with 10 % (v/v) FBS, 5 ng/ml murine GM-CSF and 4 mM L-glutamine.

Murine macrophage-like cells (J744 cell line), kindly given by Professor Marie-Paule

Mingeot-Leclercq, Université Catholique de Louvain, Belgium, were propagated in RPMI

medium with 10 % (v/v) FBS and 104 U/ml/10 mg/ml PEST.

2.6. Generation of murine bone-marrow derived DCs

Immature bone marrow-derived DCs (BMDCs) were generated as described by Inaba

et al. (1992) (407), with some modifications. Fresh bone marrows flushed from femurs and

tibias from C57BL/6 female mice (Jackson Laboratories) were depleted of erythrocytes by

ACK lysis buffer and cultured for 7 days in RPMI 1640 + GlutamaxTM with 10 % (v/v) FBS,

104 Unit/ml/10,000 μg/ml PEST, 50 µM β-mercaptoethanol, 10 mM HEPES, 1 mM sodium

pyruvate and 20 ng/ml murine GM-CSF. On days 3 and 6, plates were gently swirled, and

medium replaced. On day 7, loosely and non-adherent cells were harvested and cryopreserved

at - 80 °C. DC purity was tested by flow cytometry analysis of PE-CD11c monoclonal

antibody-surface stained cells. Cell cultures had approximately 75 % of CD11c+ DCs.

2.7. In vitro cell viability in the presence of NPs

Cell viability of JAW SII DCs, murine macrophage-like J744.1 cells and BMDCs in

the presence of NPs was evaluated by using the MTT or AlamarBlue® assays (364,408).

Briefly, 4 × 104 cells were seeded in 96-well plates, incubated overnight and treated with

different concentrations of NPs for 48 h. Cells were then washed and the MTT reagent was

added and incubated for 3 h. Formazan crystals were dissolved in DMSO. Absorbance was

quantified at 560 nm using the MultiSkan Ex plate reader (Thermo Fisher Scientific,

Waltham, MA). Alternatively, AlamarBlue® reagent was added at 10 % (v/v) and incubated

for 3 h. Fluorescence measurements were made at 530 nm/590 nm using a FLUOstar Omega

microplate reader (BMG Labtech, Ortenberg, Germany). Triton 0.5 % (v/v) and cell culture

medium were used as positive and negative controls, respectively.

2.8. Nanoparticle uptake by flow cytometry analysis

JAW SII DCs or murine macrophage-like J744.1 cells (5 × 105 /ml/well) were seeded

in 12-well plates and incubated overnight. Cells were then incubated with NP-F (100 and 250

μg/ml) for 3, 8, 24 and 42 h. BMDCs (1.3 × 105 /200 µl/well) were seeded in 96-well flat

Chapter 2

82

bottom plate and incubated overnight. NP-F (100 and 250 mg/ml) were added and incubated

for the indicated times. Cells were then washed with DPBS and resuspended in flow

cytometry buffer. BMDCs were also stained with anti-mouse fluorescently labeled

monoclonal antibodies (PE-CD11c, FITC-CD206, APC-CD80) for 20 min, harvested by

centrifugation and resuspended in the same buffer. The individual fluorescence of 10,000

cells was collected for each sample using a FACScan (BD Biosciences) or a LSR Fortessa

cytometer (BD Biosciences) and analyzed with the CellQuest software (BD Biosciences) or

FlowJo software version 7.6.5 for Microsoft (TreeStar, San Carlos, CA).

2.9. Confocal microscopy imaging analysis

For qualitative uptake studies, BMDCs (2 × 105 /200 µl/well) were seeded in 8-well

Ibidi® µ-Slide microscopy chambers and NP-F were added at the indicated concentrations for

18 h. Cells were then washed with DPBS buffer at 4 °C and stained with WGA-Alexa Fluor®

594 for plasma membrane and Golgi apparatus. Images were obtained by confocal

microscopy as mentioned and processed using the WCIF ImageJ Software. Three-

dimensional (3D) projection images were obtained from 0.4 µm Z-stacks and processed using

the Leica Application Suite-Advanced Fluorescence (LAS-AF) software.

To study intracellular trafficking, BMDCs (2 × 105 /200 µl/well) were seeded in 8-well

Ibidi® μ-Slide microscopy chambers and incubated with NP-R at 500 µg/ml for 3 or 18 h.

Cells were then washed with DPBS buffer at 4 °C, fixed with 4 % (w/v) paraformaldehyde

and permeabilized with 0.2 % (v/v) triton X-100 for 10 min. Nonspecific fluorescence was

prevented by blocking samples with Image-iTTM FX Signal Enhancer for 30 min. Anti-EEA1,

anti-Rab7a, anti-LAMP1 and anti-calnexin rabbit anti-mouse antibodies were added at 1:100

for 2 h. Cells were washed with DPBS and the secondary goat anti-rabbit IgG Alexa Fluor

488® antibody was added at 1:400 for 2 h. Final nucleus contrast was achieved with Hoescht®

332 at 1 µg/ml for 10 min. Images were obtained by confocal microscopy and processed as

mentioned.

For colocalization analysis, images were processed using the WCIF ImageJ Software,

colocalization plug-in. Raw images from each channel were used. Background was

automatically subtracted and thresholds for red and green channels were calculated. A

colocalization finder was run and Pearson’s correlation coefficient (Rr) as well as Mander’s

coefficients (M1 and M2) were calculated. The percentages of colocalization for each channel

were given by the number of voxels for each channel which have both green and red channel

intensities above the threshold.


83

2.10. Study of endocytic pathways involved in NP internalization

BMDCs were seeded in 8-well Ibidi® μ-Slide microscopy chambers for confocal

microscopy (2 × 105 /200 µl/well) or in 96-well flat bottom plate (1.5 × 105 /150 µl/well) for

flow cytometry and challenged for 30 min with one of the following molecules: cytochalasin

D (10 µM), rottlerin (10 µM), chlorpromazine (10 µg/ml), dynasore (80 µM), genistein (100

and 200 µM), nystatin (50 and 100 µM) and sucrose (0.45 M). NPs were then added (500

µg/ml) for 18 h. To check energy-dependency of NP internalization, NPs were added to

BMDCs at 500 µg/ml for 3, 18 or 24 h at 4 or 37 °C. For the experiments performed at 4 °C,

BMDCs were kept at that temperature for 30 min before the addition of NPs. Analyses were

performed by confocal microscopy or flow cytometry as described. OVA Alexa Fluor® 647

(10 µg/ml), used as clathrin-mediated endocytosis (CME) control, was incubated for 30 min

after BMDC treatment with the inhibitors.

2.11. Statistics

All results are expressed as mean ± standard deviation (SD). T-test, one-way ANOVA

and Tukey's post test or two-way ANOVA and Bonferroni’s post test were performed to

demonstrate statistical differences (P < 0.05), using the software GraphPad Prism version

5.00 (GraphPad Software.Inc, CA, USA).

3. Results


Biodegradable polymeric NPs were produced by the double emulsion-solvent

evaporation method using a blend of three aliphatic polyester copolymers: (i) PLGA; (ii)

PLGA pegylated counterpart (PEG-b-PLGA) and (iii) pegylated poly-ε-caprolactone (PEG-b-

PCL) (254).

NPs were physicochemically characterized by the determination of size and

polydispersity Index (PdI) (Table 2.1.). NPs were in a size range between 130 ± 13 nm and

143 ± 22 nm, with a narrow particle size distribution (PdI ranging from 0.09 ± 0.04 to 0.16 ±

0.05). Sodium cholate was quantified by HPLC in the supernatants obtained from the

washings of NPs and demonstrated to be efficiently removed. The surfactant washing

efficiency of NPs was 100.1 ± 6.1 %. The average recovered amount of sodium cholate in

each of the three supernatants was 98.2 ± 7.0 % in the first, 1.6 ± 0.7 % in the second and 0.2

± 0.1 % in the third (data not shown).

Chapter 2

84

In order to potentiate NP interaction with APCs, a targeted delivery system to

MR/CD206 on APCs was also developed. man-NPs were produced by replacing the polymer

PEG-b-PCL by its mannose-grafted equivalent man-PEG-b-PCL. The presence of mannose

did not affect NP size distribution (Table 2.1.).

Table 2.1. Nanoparticle size and polydispersity index (PdI) (mean ± SD; N ≥ 5, n = 3).

Nanoparticles Sizea (nm) PdIb

NP 135 ± 20 0.11 ± 0.07

NP-F 143 ± 22 0.09 ± 0.04

NP-R 130 ± 13 0.16 ± 0.05

man-NP 135 ± 19 0.18 ± 0.06

man-NP-F 132 ± 05 0.18 ± 0.09 a Z-average hydrodynamic diameter. b PdI, polydispersity index.

The zeta potential was measured in three pH values mimicking intracellular

compartments: pH 7.4 (extracellular and cytosolic environments), pH 6.0 (early endosomes)

and pH 5.0 (lysosomes). At pH 7.4, NPs presented a zeta potential around -3 mV confirming

the presence of PEG chains shielding the negative charges of PLGA at NP surface (Fig. 2.1.).

At pH 6.0 and 5.0, zeta potential of NPs and man-NPs became closer to neutrality or even

slightly positive.

Figure 2.1. Zeta potential of NPs and man-NPs at three pH values mimicking intracellular compartments:

DPBS at pH 7.4 (mimicking cytosol) and in 200 mM phosphate/citrate buffer at pH 6.0 (mimicking early

endosomes) or pH 5.0 (mimicking lysosomes). Mean ± SD; N = 3, n = 3. Statistics: one-way ANOVA and

Tukey’s post test. Relative to zeta potential at pH 7.4: ** p < 0.01. NS, statistically non-significant. Two-

way ANOVA and Bonferroni’s post test were used to compare NPs and man-NPs.


85

AFM was used to further characterize the size, shape and surface morphology of NPs

and man-NPs. Both types of NPs presented smooth surface and spherical topography, as can

be seen in 3D images (Fig. 2.2.A and 2.2.C). Section analyses of the diameters demonstrate a

homogenous size distribution but smaller diameters (~15 nm less) compared to the

hydrodynamic diameters obtained by DLS. This can be explained by the fact that the PEG

chains were not in a hydrated state, hence not being extended as they were during the DLS

measurements.

Figure 2.2. Analysis of NP morphology and size by atomic force microscopy. 3D images of NPs (A) and

man-NPs (C), as well as section analysis of NPs (B) and man-NPs (D) where mean diameters are

presented. Mean diameters ± SD were calculated from fifty individual NPs from section analysis of five

different areas imaged for each type of NP.

3.2. Detection of mannose residues at man-NP surface by lectin-recognition

assay

To investigate if mannose residues were exposed at man-NP surface, a lectin (Con A)

recognition assay using DLS, confocal microscopy and fluorescence intensity measurements

was developed. Con A would induce man-NP aggregation if mannose residues were

accessible for binding at NP surface (Fig. 2.3.A) (409). DLS analysis demonstrated that Z-

average hydrodynamic diameter of man-NPs increased from 107 ± 0.4 nm to 572 ± 36 nm,

and PdI increased from 0.126 ± 0.01 to 0.613 ± 0.12 after their incubation with Con A (Fig.

Chapter 2

86

2.3.B). This augmentation in size and PdI was not observed for non-functionalized NPs.

Moreover, confocal microscopy images after treatment with Con A clearly showed bigger

aggregates for man-NPs when compared to NPs (Fig. 2.3.C) and their fluorescence intensity

was significantly higher (p < 0.05) (Fig.2.3.D). These observations demonstrate that mannose

residues were exposed at man-NP surface and were accessible for binding.

Figure 2.3. Detection of mannose residues at man-NP surface using a lectin recognition assay. A.

Schematic representation of man-NP aggregation in the presence of Con A due to the binding of mannose

residues to one of the four binding sites in Con A tetramers. B. NP size distribution represented as

frequency curves of Intensity (%) in function of diameter determined by DLS for man-NPs (upper graph)

and NPs (lower graph), before and after the incubation with Con A. C. Confocal microscopy images of the

NP-Con A-FITC aggregates (scale bars = 20 µm). D. Fluorescence given in arbitrary units (a.u.) of NP-

Con A-FITC aggregates. Mean ± SD; N = 3, n = 3. Statistical analysis: one-way ANOVA and Tukey’s post

test.

3.3. Effect of pH, temperature and medium composition on NP stability

In order to predict the stability and degradation profiles of NPs at different conditions,

NPs were resuspended in DPBS (pH 7.4), 200 mM phosphate/citrate buffer (pH 6.0 or pH

5.0) or CCM, incubated at three temperatures (4, 25 and 37 °C) and their size and zeta

potential were followed for 45 days. NPs did not show any tendency to aggregate, even in the

presence of serum, a constituent of CCM (Fig. 2.4.). The zeta potential decreased with time,


87

which is consistent with the degradation of the aliphatic polyesters and exposure of an

increasing number of carboxylic groups. The decrease of the zeta potential was more

accentuated at 25 and 37 °C and at pH 7.4 and it was similar in DPBS or CCM.

Figure 2.4. The effect of temperature (4 °C, 25 °C and 37 °C) in DPBS (A), the effect of pH (DPBS at pH

7.4 or phosphate/citrate buffer 200 mM at pH 6.0 or 5.0) at 37 °C (B) and the effect of fluid constitution

(DPBS or cell culture medium, CCM) at 37 °C on NP size are represented as the overlay of frequency

curves of Intensity (%) as a function of the diameter over time determined by DLS (histograms). The

Chapter 2

88

variation of mean hydrodynamic diameter and zeta potential of NPs over time is represented in the

graphics on the right. The analysis of a representative batch of NPs out of four is presented. (N = 4, n = 3).

Statistics: two-way ANOVA and Bonferroni’s post test. * p < 0.05, *** p < 0.001.

3.4. Effect of NPs on viability of APCs

In order to verify if formulated NPs could affect viability of APCs, MTT or

AlamarBlue® assays were performed. JAW SII and J744.1 cell lines were incubated with

increasing concentrations of NPs and man-NPs. Figure 2.5.A shows that both cell lines

maintained high levels of cell viability (> 70 %). BMDCs viability was kept higher than 70 %

even after 48 h of incubation with 1000 µg/ml of NPs (Fig. 2.5.B).

Figure 2.5. Determination of cell viability by the MTT assay of JAW SII DCs and J744.1 macrophage-like

cells incubated for 42 h with man-NPs and NPs, respectively (A). Determination of cell viability by the

AlamarBlue® assay of BMDCs incubated for 24, 42 and 48 h with NPs (B). Cell culture medium and 0.5 %

(v/v) triton X-100 were used as negative and positive control, respectively. Mean ± SD; N = 3, n = 3.

Statistics: one-way ANOVA and Tukey’s post test. Relative to cell culture medium: * p < 0.05, ** p < 0.01

and *** p < 0.001. Two-way ANOVA and Bonferroni’s post test were used to compare JAW SII and

J744.1 cell lines (A) and incubation times (B). ### p < 0.001.


89

3.5. Uptake of NPs by APCs

To verify if the produced NPs could be internalized by APCs, flow cytometry analyses

were performed. NPs were internalized by JAW SII and J744.1 cell lines as early as after 3 h

of incubation. Internalization levels increased with the concentration and incubation time

(Fig. 2.6.A and 2.6.B). After 24 and 42 h, NP internalization levels were significantly superior

to those obtained after only 3 h (p < 0.001). The uptake levels were statistically different for

both NP concentrations tested (unpaired t-test analysis).

BMDCs were used to confirm the uptake patterns of NPs in primary cells.

Surprisingly, a totally different pattern of internalization was observed. Similar levels of

positive cells (around 60 %) were obtained after 3, 18 or 24h of incubation (Fig. 2.6.C).

Differences observed between NP concentration and times of incubation were not statistically

significant. It was possible to exclude the possibility of NP-F adsorption onto plasma

membranes since NP-F have a clear intracellular localization shown by 3D confocal

microscopy images (Fig. 2.7.). Moreover, regardless the concentration used, high levels of

NP-F can be seen inside BMDCs, corroborating the results from flow cytometry analysis (Fig.

2.4.C).

Figure 2.6. Internalization of NPs by JAW SII murine immature DCs (A), J744.1 murine macrophage-like

cells (B) and BMDCs (C), expressed by percentage of positive cells in the population sorted by a flow

cytometer. Mean ± SD; N = 3, n = 3. One-way ANOVA and Tukey’s post test were used to compare

uptake at any time point to 3 h of incubation in the respective NP concentration: NS, statistically non-

significant; * p < 0.05, ** p < 0.01 and *** p < 0.001. Two-way ANOVA and Bonferroni’s post test were

used to compare uptake at 100 µg/ml vs. 250 µg/ml: # p < 0.05, ## p < 0.01 and ### p < 0.001.

Chapter 2

90

Figure 2.7. Confocal microscopy images obtained after 18 h of incubation of BMDCs with three different

concentrations of NPs (250, 500 and 1000 µg/ml). Plasma membrane was stained with WGA-Alexa Fluor®

594. Representative images of three independent experiments are shown. Scale bars = 15 µm.

3.6. Endocytic pathways involved in NP internalization

There was a clear inhibition of NP internalization at 4 °C suggesting energy-

dependency of the process (Figure 2.8.A). To study the involvement of CME in the

internalization of NPs by BMDCs, chlorpromazine, dynasore and a hypertonic sucrose

solution were used. Chlorpromazine and hypertonic sucrose solution are known to prevent the

recycling of clathrin and consequently disable the formation of clathrin-coated pits (410,411).

Dynasore is an inhibitor of dynamin and consequently prevents clathrin-coated pits and

caveoli from pinching off from cell membrane (412). BMDCs were incubated with NPs for

18 h after treatment with one of those molecules for 30 min. Cells were then analyzed by flow

cytometry and confocal microscopy. OVA-Alexa Fluor® 647 was used as a control since it is


91

known to be internalized by CME (413). Confocal microscopy images demonstrate an

apparent total inhibition of NP internalization by dynasore, a very significant inhibition by

chlorpromazine and a partial inhibition by sucrose (Fig. 2.8.B). When analyzed by flow

cytometry, the internalization of NPs was reduced by 40 to 60 % (Fig. 2.8.C). Therefore,

CME seems to be partially involved in the internalization of NPs by BMDCs. Further

evidence of the partial involvement of CME in NP internalization was obtained by analyzing

the colocalization of NPs and OVA-Alexa Fluor® 647 after their coincubation on BMDCs.

Colocalization analysis was based on the approach of Costes et al. (2004) using the WCIF

ImageJ software and a colocalization plug-in (414). After 30 min of simultaneous incubation

of NPs and OVA, their colocalization was near 20 % (Fig. 2.8.D). M1, M2 and Rr were in

accordance. After 18 h of incubation of NPs followed by 30 min of incubation with OVA-

Alexa Fluor® 647, the colocalization of NPs with OVA increased to ~40 %, while

colocalization of OVA with NPs increased to ~60 %. MNPs increased from 0.27 ± 0.08 to 0.52

± 0.17 while MOVA increased from 0.39 ±0.12 to 0.73 ± 0.17, suggesting an increase of

dependence of both channels with time. Rr increased from 0.32 ± 0.11 to 0.55 ± 0.04,

suggesting a prominent correlation of both channels with time.

Since macropinocytosis is a constitutive process in DCs it is likely to be involved in

NP internalization (415). Cytochalasin D, a known actin disrupter, and rottlerin which

interfers with cytoskeletal rearrangements through the inhibition of the delta protein kinase C

(PKCδ), were used. Confocal microscopy images (Fig. 2.8.E) as well as flow cytometry

analyses (Fig. 2.8.F) demonstrate that both molecules extensively inhibited the internalization

of NPs by BMDCs (p < 0.001). The vehicle used for these molecules (DMSO) had no effect

on NP internalization at the concentration used. As expected, macropinocytosis was involved

in the internalization of the nanocarriers by BMDCs.

Genistein, a specific inhibitor of tyrosine kinases, and nystatin, which complexes with

cholesterol, inhibit the caveolae- and lipid raft-dependent endocytosis (410,416). Figure 2.8.G

demonstrates that both molecules reduced the internalization of NPs by BMDCs in 60 %.

Genistein and nystatin concentrations were doubled to 200 and 100 µM, respectively, and the

reduction of NP internalization was similar, demonstrating that the maximum inhibition was

reached and caveolin- and lipid raft-dependent endocytosis is only partially involved in the

internalization of NPs by BMDCs.

Chapter 2

92

Figure 2.8. Effect of endocytic inhibitors on the internalization of NPs by BMDCs. A. Energy-dependency

of NP internalization by BMDCs. Clathrin-mediated endocytosis (CME) involvement was analyzed by

confocal microscopy (B) and flow cytometry (C) after treatment with dynasore, chlorpromazine and


93

hypertonic sucrose solution. For colocalization analysis of NPs and OVA in BMDCs (D), NP-R (green)

were added to BMDCs at 500 µg/ml and incubated for 30 min or 18 h. OVA-Alexa Fluor® 647 (red) were

simultaneously added at 10 µg/ml and incubated for 30 min. Hoescht® 342 was used for nucleus contrast

(blue). Colocalized pixels from red and green channels, obtained through WCIF ImageJ software, appear

in white (right). This software was also used to quantify the percentage of colocalization of the NPs with

OVA (%ColNP) and OVA with NPs (%ColOVA), the Mander’s coefficients for both entities (MNPs and

MOVA) and the Pearson’s correlation coefficient (Rr). Mean ± SD from at least 25 cells from six

independent images is represented. Macropinocytosis involvement analyzed by confocal microscopy (E)

and flow cytometry (F) after treatment with rottlerin and cytochalasin D. G. Caveolin and lipid raft

involvement analyzed by flow cytometry after treatment with genistein and nystatin. DMSO was tested as

the vehicle control. Scale bars = 25 µm. Results from flow cytometry analysis are expressed as normalized

median fluorescence intensity relative to untreated samples (mean ± SD; N = 3, n = 3). Statistics: one-way

ANOVA and Tukey’s post test. *** p < 0.001. Two-way ANOVA and Bonferroni’s post test were used to

compare uptake at 4 °C and 37 °C at different time points (A).

3.7. Intracellular trafficking followed by NPs in BMDCs

To evaluate the potential of NPs to deliver antigens to MHC class I and II complexes,

the intracellular trafficking of NPs was followed in BMDCs. NP-R were added to BMDCs

and immunofluorescence antibodies were used to visualize organelles: anti-calnexin for

endoplasmic reticulum (ER), anti-EEA1 for early endosomes (EE), anti-rab7a for EE and late

endosomes (LE) and anti-LAMP1 for LE and lysosomes (Ly). Figure 2.9.A shows

representative images of three independent experiments of the incubation of BMDCs with

NP-R (red) for 30 min, 1, 2, 3 and 18 h, and staining of each organelle (green). Red-green

merged images present the colocalized pixels (in white). Figure 2.9.B represents the

percentage of colocalization of NPs with each organelle. After 30 min, NPs presented a

colocalization of 35.4 ± 15.4 %, 46.3 ± 14.6 %, 55.9 ± 13.2 % and 61.9 ± 13.2 % with EEA1,

Rab7a, LAMP1 and calnexin, respectively. After 3 h, NPs colocalization with organelles

increased to 51.6 ± 10.0 %, 62.7 ± 9.8 %, 66.3 ± 13.3 % and 77.1 ± 8.8 % for EEA1, Rab7a,

LAMP1 and calnexin, respectively. The percentage of colocalization of NPs with EEA1,

Rab7a and LAMP1 after 18 h decreased to 46.1 ± 13.8 %, 56.9 ± 10.2 % and 47.2 ± 22.1 %,

respectively. Only the colocalization with calnexin increased (79.1 ± 8.2 %). This suggests

that NPs rapidly reach the endo-lysosomal pathway since after only 30 min considerable

amounts of NPs colocalized with those organelles (between 35.4 ± 15.4 % for EEA1 and 61.9

± 13.2 % for calnexin). The levels of colocalization increased for all the organelles during the

first 3 h, decreasing then at 18 h, with the exception of calnexin, which remained very high (~

80 %) and kept almost constant from 3 to 18 h of NP incubation. The percentage of

Chapter 2

94

colocalization of the organelles with NPs varied from 32.6 ± 13.0 % to 77.1 ± 8.8 %

suggesting no saturation of the organelles with NPs (Fig. 2.10.A). M1 was in accordance to

what was obtained for the percentage of colocalization of the red with the green channels

(Fig. 2.9.C). Once again, the highest colocalization was obtained between NPs and calnexin.

M2 varied in accordance with the M1, suggesting the dependence of the staining of NPs and

organelles (Fig. 2.10.B). Rr values were higher than 0.5 at all time points, implying high

correlation levels between NP and organelle stains (Fig. 2.9.D).

Figure 2.9. Intracellular trafficking and colocalization analysis of NPs in BMDCs. A. Confocal microscopy

images obtained after 30 min, 1, 2, 3 and 18 h of BMDCs incubation with NP-R (red). Cells were

incubated with rabbit anti-mouse anti-EEA1 for early endosomes (EE), anti-Rab7a for EE and late

endosomes (EE + LE), anti-LAMP1 for LE and lysosomes (LE + Lys) and anti-calnexin for the

endoplasmic reticulum (ER) and then labeled with goat anti-rabbit IgG Alexa Fluor® 488 (green).


95

Hoescht® 342 was used for nuclei contrast (blue). Scale bars = 15 µm. Colocalized pixels from red and

green channels, obtained through WCIF ImageJ software, appear in white below the respective image.

This software was also used to quantify the percentage of colocalization of NPs with each organelle-

labeling protein (B), the Mander’s coefficient values for the red channel (M1) (C) and the Pearson’s

correlation coefficient (Rr) (D). Mean ± SD from at least 25 cells from six independent images is

represented.

Figure 2.10. Percentage of colocalization of organelles (green pixels) with NPs (red pixels) (A). Mander’s

coefficient of green channel (M2) (B). Mean ± SD from at least 25 cells from six independent images is

represented.

3.8. In vitro targeting of APCs with mannose-grafted NPs

To verify if man-NPs could be actively targeted to APCs, flow cytometry analyses

were performed to compare the internalization levels of NPs and man-NPs. For JAW SII DC

line, a significantly higher uptake was obtained for man-NPs (15.6 ± 0.9 % and 43.8 ± 1.6 %

for 100 and 250 µg/ml of man-NPs comparing to 7.5 ± 0.4 % and 17 ± 7.6 % for 100 and 250

µg/ml of non-functionalized NPs) (Fig. 2.11.A). Increasing the amount of man-PEG-b-PCL in

the formulation to 30 % w/w (man(30%)-NPs) resulted in higher internalization levels (42.7 ±

0.1 % and 66.7 ± 1.1 %, for 100 and 250 µg/ml, respectively) (p < 0.001). Similar

observations were made on the macrophage-like cell line after 3 h of incubation with 250

µg/ml of non-targeted NPs, man(15%)-NP and man(30%)-NPs (10.1 ± 1.0 %, 14.0 ± 1.2 %

Chapter 2

96

and 30.0 ± 2.6 %, respectively) (Fig. 2.11.B). These results confirm the successful active

targeting of mannose-grafted NPs to APC lines.

Mannose did not significatively increase the internalization of NPs by BMDC (Fig.

2.11.C). Non-functionalized NPs, man(15%)-NPs and man(30%)-NPs presented all high

levels of internalization. We hypothesize that this could be related to a downregulation of the

MR/CD206 by those cells under culture conditions. We verified that untreated BMDCs have a

low expression of MR/CD206, and the expected downregulation of this molecule after

treatment with LPS was not observed (Fig. 2.12.). Untreated BMDCs have also a residual

expression of CD80, a maturation marker which expression is upregulated in LPS-treated

cells. This indicates that even untreated BMDCs are in a slightly activated state where

MR/CD206 is completely downregulated. It is also likely that the considerable high

internalization levels obtained by BMDCs for non-targeted NPs might hide any additional

effect that mannose targeting by man-NPs could have.

Figure 2.11. Comparison of the cellular uptake of mannose-grafted NPs containing 15 % (w/w)

(man(15%)-NPs) or 30 % (w/w) (man(30%)-NPs) of mannose-grafted PEG-b-PCL polymer with non-

functionalized NPs (NPs). NPs at 100 or 250 µg/ml were added to JAW SII DCs (A) or BMDCs (C) and

incubated for 24 h. NPs at 250 µg/ml were added to J744.1 macrophage-like cells and incubated for 3 h

(B). NP internalization levels are expressed by percentage of positive cells in the population sorted by a

flow cytometer (mean ± SD, N = 3, n = 3). Statistics: two-way ANOVA and Bonferroni’s post test. Relative

to non-functionalized NPs: NS, statistically non-significant; * p < 0.05, *** p < 0.001. One-way ANOVA

and Tukey’s post test were used in B.


97

Figure 2.12. Surface expression of the mannose receptor (MR/CD206) and the costimulatory molecule

CD80 by BMDCs before and after treatment with LPS. Black lines: untreated BMDCs. Colored lines:

BMDCs treated with 100 ng/ml LPS from E.coli for 24 h. Tinted curves: isotype antibody control.

Numbers correspond to median fluorescence intensity levels. One representative experiment out of three

is represented.

4. Discussion

The aim of this study was to develop a nanoparticulate delivery system to target

APCs, deliver antigens to be presented by MHC class I (in the endoplasmic reticulum) and II

molecules (in the lysosomes) and potentiate the encounter of immunoadjuvants with their

intracellular receptors. We also intended to increase the knowledge on NP-cell interaction, NP

functionalization impact, endocytic pathways and intracellular trafficking.

A reproducible formulation method has been developed using biodegradable and

biocompatible aliphatic polyester copolymers to produce ~130 nm NPs with narrow particle

size distribution, smooth surface and spherical morphology. PLGA, the main constituent of

NPs, is approved for parenteral use in humans (186,193). PEG-b-PLGA and PEG-b-PCL,

were used in order to provide a PEG source in NP formulation, to chemically functionalize

the polymers with ligands and increase NP stability due to PEG repulsive properties (254).

PEG-b-PCL was also used due to its easiness of functionalization (231). The ratio of the

polymers in the formulation has been previously optimized in terms of shielding of negative

charges at physiologic pH without hindering ligand accessibility (254). In order to potentiate

NP interaction with APCs, functionalization of NPs with mannose was developed to target the

MR/CD206 on APCs, which is involved in the recognition and internalization of pathogens

(351).

The uptake efficiency of particulate delivery systems by APCs depends on several

particle properties, such as size, shape, surface charge, hydrophobicity/hydrophilicity and

Chapter 2

98

receptor interactions (417). The developed NPs should be able to travel through the lymphatic

system after peripheral injection and arrive directly to the lymph nodes, where high number of

DCs can be found. Only NPs up to 200 nm can be delivered into the lymphatic circulation

(185,418). Bigger particles will need transportation by DCs. NP charge can also influence

their internalization and intracellular trafficking (314). Zeta potential measurements showing

a tendency to revert NP surface charge from negative values to neutral or even positive

surface charge, possibly due to protonation of the exposed acidic groups on PLGA chains, can

explain the capacity of PLGA NPs to escape from endo-lysosomes due to their association

with the membranes of those organelles (86,319). This property constitutes an advantage for a

vaccine delivery system where a cellular immune response is required, as is the case of anti-

viral or cancer vaccines. Escape from endo-lysosomes to cytosol is known to be one of the

mechanisms of cross-presentation of exogenous antigens to CD8+ T cells, potentiating the

activation of cytotoxic T lymphocytes (CTLs) (1). The maintenance of NP size over time

along with the decrease of zeta potential is in accordance with a bulk eroding profile,

characteristic of the aliphatic polyesters (419).

To verify if the produced NPs were internalized by APCs, JAW SII and J744.1 cell

lines were incubated with fluorescent NPs containing fluorescein derivative or rhodamine

derivative-grafted PLGA. The use of fluorophore-grafted polymers in our formulation

constitute a great advantage over the use of soluble probes entrapped in NPs, since it

eliminates the risk of misinterpretation due to probe leakage. Internalization levels increased

with NP concentration and incubation time. The hydrophilic surface of PEGylated NPs could

confer a “stealth-like” effect and delay the NP recognition and uptake by APCs (420). The

internalization levels obtained for both cell lines were not statistically different, reinforcing

the previous observation that DCs and macrophages have equivalent internalization capacities

(35). BMDCs were used to confirm the uptake patterns of NPs in physiologic-closer

conditions. Surprisingly, a totally different pattern of NP internalization was observed.

BMDCs internalized NPs more promptly in a time- and concentration-independent manner.

To the best of our knowledge this is the first time that profiles of NP internalization by APC

of different natures are compared. These results suggest that immortalized cell lines of APCs

might have lost their avidness for particulate entities. APC lines have been pointed out as an

effective alternative to the use of primary cells in order to avoid several experimental issues

related to their use, such as culture heterogeneity, contamination with other cell types,

variability due to donor characteristics and need of animals (421). However, our study shows

that careful attention must be paid to the interpretation of the results obtained with cell lines


99

since they might not always be correlated with what happens in vivo, contrary to the

observations made before by others, where BMDC and immortalized DC lines were

compared in other contexts (421,422).

The endocytic pathways followed by NPs are determinant of its intracellular

trafficking and final fate and can determine the type of induced immune response. The

formulated NPs presented mean diameters that fall into the range usually taken up via CME

(< 150 nm) and tend to generate a virus-like immune response with activation of CTLs and T

helper (Th) 1 cells (300). Our study demonstrates that CME is partially involved in NP

internalization by BMDCs. Since macropinocytosis is a constitutive process in DCs, this

mechanism could be involved in the internalization of NPs, even though it normally happens

to particles bigger than 0.5 µm (300,415). Macropinocytosis drives antigens to be presented

preferentially by MHC class II molecules and induces mainly a humoral immune response,

but it can also drive antigens for presentation by MHC class I (415). As expected,

macropinocytosis was highly involved in the internalization of the nanocarrier by BMDCs.

The total inhibition of NP internalization by dynasore, which inhibits both CME and caveolin-

dependent endocytosis, suggested that this last mechanism could also participate in the

internalization of NPs, albeit the size range normally internalized by this pathway (50 – 80

nm) is smaller than our NP mean size. Surprisingly, caveolin- and lipid raft inhibitors

genistein and nystatin reduced NP internalization to 40 %.

As several endocytic mechanisms seem to be involved in the internalization of our

NPs by BMDCs, we hypothesized that these NPs could also have distinct intracellular

pathways. Our results suggest that NPs rapidly reach the endo-lysosomal pathway since after

only 30 min of incubation considerable amounts of NPs colocalized with the organelles.

Then, NPs might travel through endo-lysosomal vesicles but might also escape to the cytosol,

as reported previously (86,319). This property of PLGA-based NPs can be explained by the

reversion of surface charge at lysosomal pH (Fig. 2.1.). The colocalization with ER protein

marker calnexin was very high (~ 80 %) and kept almost at a constant level from throughout

the study. Extracellular antigens are usually digested in endo-lysosomes, and processed

peptides are loaded onto MHC class II molecules. By contrast, intracellular antigens are

degraded by the proteasome, released into the cytosol and subsequently translocated into the

ER by the transporter associated with antigen processing (TAP) to be loaded into the peptide-

binding site of MHC class I molecules. This assembly typically happens in the ER (1). Our

observations suggest that NPs have the potential to function as an efficient vaccine delivery

Chapter 2

100

system that might provide access to MHC class I and II pathways of antigen presentation,

promoting a complete and coordinated immune response.

Based on the results obtained, a hypothetical schematic representation of the

intracellular trafficking of the developed NPs is presented in Figure 2.13.. Firstly,

considerable colocalization levels (50 to 70 %) with endo-lysosomal vesicles suggest the high

potential of this carrier to induce the presentation of antigens through MHC class II molecules

to CD4+ T cells. Secondly, high levels of colocalization with the ER protein marker calnexin

suggest a considerable potential for cross-presentation of antigens through the MHC class I

molecules to CD8+ T cells. Thirdly, colocalization with endosomes suggests that NPs are able

to deliver immunoadjuvants to the compartment where some have their receptors, such as the

ligands of the Toll-like receptors 3 and 9. Additionally, the decrease in the colocalization of

NPs with EE, LE and Lys from 3 to 18 h suggests that NPs might escape from these vesicles

to the cytosol. This phenomenon might translate in the accumulation of NPs in the cytosol and

prolonged release of the entrapped antigens over time, demonstrating potential to be used as a

single-dose vaccine.

The most common method of generating ligand-targeted NPs involves coupling

targeting moieties directly to preformed NPs as a second step of the NP preparation (423).

However, this approach results in variations in coupling yields and side reactions that can

cause chemical and conformational changes to the ligand, resulting in highly heterogeneous

NP populations with inconsistent outcomes (424). The use of the mannose-grafted polymer

man-PEG-b-PCL in our formulation obviates this problem. Even if it is established that long

PEG polymers, including PEG with 2000 Da, fold into a mushroom like globular structure

that can hide a large fraction of the conjugated ligand (425), we have verified that mannose

residues are available for binding at man-NP surface. Surprisingly, the effect of active

targeting of man-NP to APCs was verified in immortalized APC lines but not in BMDCs. We

hypothesized that this could be related to the downregulation of the MR/CD206 by those cells

under culture conditions. It is also likely that the considerable high internalization levels

obtained by BMDCs for non-targeted NPs hide any additional effect that mannose targeting

by man-NPs may have. In fact, the benefit of the functionalization of NPs for active targeting

must be verified in vivo.


101

Figure 2.13. Schematic representation of the hypothetical intracellular trafficking of the developed NPs in

DCs. NPs are internalized by DCs and contained within early endosomes (EE), where NPs start to degrade

and release some of their cargo. Immunoadjuvants with receptors located in the endosomal membrane

might get access to them. As endosomes start to mature, their pH drops and NPs become neutral or

positively charged, being able to interact with endo-lysosomal membranes and escape to cytosol. Here,

NPs accumulate nearby the endoplasmic reticulum (ER), where the loading of antigens on MHC class I

molecules happens. MHC class I-peptide complexes are transported to the cell surface in exocytic vesicles

to be presented to CD8+ T cells. Some NPs continue to degrade in the lysosomes, releasing their cargo.

Here, peptides can be loaded on MHC class II molecules. MHC class II-peptide complexes are then

transferred to cell surface to be presented to CD4+ T cells.

5. Conclusions & future perspective

We aimed at developing biodegradable NPs to target APCs and evaluate their

potential to be used as a vaccine delivery system by exploring their profile of cellular

interaction. We were able to produce spherical NPs with ~130 nm functionalized with

mannose residues, which were available for binding at NP surface. NP internalization profiles

were different for immortalized APCs and primary BMDCs, the last revealing a more prompt

NP internalization, independent of mannose functionalization. These results highlight the

importance of choosing physiologic-closer models to better predict NP behavior in vivo.

Multiple endocytic pathways were involved in NP internalization, namely macropinocytosis,

Chapter 2

102

CME and caveolin- and lipid raft- dependent endocytosis. This fact demonstrates the

versatility of the present system since different endocytic pathways might lead to distinct

intracellular trafficking pathways and fates. NPs demonstrated both an endo-lysosomal and

cytosolic localizations and a tendency to accumulate nearby the ER. This system may provide

intracellular access to immunoadjuvants and drive antigens to be presented by both MHC

class I and II molecules to CD8+ and CD4+ T cells leading to a complete and coordinated

immune response. Our study highlights the need to fully understand the mechanisms by which

the vaccine delivery nanosystems interact with the immune system.

Vaccine delivery nanosystems can (i) be loaded with both antigen(s) and adjuvant(s),

(ii) be taken up by APCs, (iii) be presented to MHC class I and II, and (iv) be administered by

different routes (193). Hence, we foresee a great applicability of this vaccine delivery

nanosystem on a wide range of vaccine formulations, from prophylactic vaccines to viral

infectious diseases and therapeutic cancer vaccines.

The selection of the polymer for a potential clinical application will require either the

use of well accepted polymers already approved by EMA/FDA for parenteral use (e.g. PLGA)

or the development of smarter polymers which will need to be tested before their approval as

vaccine excipient. Scaling up process will also be required and cost/benefit should be

assessed. If extensive studies have been performed in preclinical models, in particular in

rodent models, further studies with vaccine delivery nanosystems must be performed both in

primate and humans before their marketing authorization is granted and their clinical use

increases.

6. Executive Summary

• Aliphatic polyester-based NPs were developed and functionalized to target APCs.

NPs were physicochemically characterized and NP-cell interaction profiles were analyzed.

• Spherical NPs were produced with ~130 nm and slightly negative zeta potential that

reverse to neutral/positive values in acidic pH.

• NPs did not affect cell viability of the APC lines JAW SII and J744.1 and primary

BMDCS.

• NP internalization profiles were different for immortalized APCs and primary

BMDCs, the last revealing a more prompt NP internalization, independent from mannose

functionalization of NPs.


103

• Mannose residues are exposed and available for binding at mannose-grafted NP

surface.

• NPs are extensively internalized by macropinocytosis but clathrin-mediated,

caveolin- and lipid raft- dependent endocytosis are also partially involved.

• NPs demonstrated endo-lysosomal and cytosolic localizations and a tendency to

accumulate nearby the endoplasmic reticulum.

• The developed NPs are promising vaccine delivery systems that can provide direct

access to endo-lysosomal vesicles and cytosol, potentially driving antigens to be presented by

both MHC class I and II molecules to CD8+ and CD4+ T cells.

Acknowledgments

The authors which to thank M. Leclercq from Unit of Cellular and Molecular

Pharmacology, Catholic University of Louvain, Brussels, Belgium, for supplying J744.1

murine macrophage-like cell line. We also thank Professor M. Prieto from Instituto Superior

Tecnico (Lisbon, Portugal) for accessibility to confocal microscope facilities.

Financial & competing interests disclosure

This work was supported by Fundação para a Ciência e a Tecnologia, Ministério da

Educação e Ciência, Portugal (PhD Grant SFRH/BD/64295/2009 to JMS, PTDC/SAU-

FAR/119389/2010, Compromisso para a Ciência 2008 to LCS, and Pest-

OE/SAU/UI4013/2011) and by Fonds de la Recherche Scientifique Médicale, Belgium. GV is

a postdoctoral researcher of the Fonds de la Recherche Scientifique-FNRS. The authors have

no other relevant affiliations or financial involvement with any organization or entity with a

financial interest or financial conflict with the subject matter or materials discussed in the

manuscript.

Ethical conduct of research

Animal experimental procedures were reviewed and approved by the Direcção-Geral

de Alimentação e Veterinária, Portugal.

Chapter 3

107

Chapter 3 - Combination of peptides and adjuvants in mannose-

functionalized nanoparticles for melanoma immunotherapy

Joana M. Silvaa,b, Eva Zupancica, Gaëlle Vandermeulenb, Vanessa G. Oliveirac, Ana Salgadoa,

Mafalda Videiraa, Manuela Gaspara, Luís Graçac, Véronique Préatb & Helena F. Florindoa

aInstituto de Investigação do Medicamento (iMed.ULisboa), Faculdade de Farmácia, Universidade de

Lisboa, 1649-003 Lisbon, Portugal. bLouvain Drug Research Institute, Advanced Drug Delivery & Biomaterials, Université Catholique de

Louvain, 1200 Brussels, Belgium. cInstituto de Medicina Molecular, Faculdade de Medicina da Universidade de Lisboa, 1649-025 Lisbon,

Portugal. dCenter for Education and Research on Macromolecules, Université de Liège, 4000 Liège, Belgium.

Submitted for publication

Nanoparticles for melanoma immunotherapy

109

Abstract

We hypothesized that the coentrapment of multiple melanoma-associated antigens

along with Toll-like receptor ligands in mannose-functionalized aliphatic polyester-based

nanoparticles could be an effective antitumor strategy. High entrapment efficiencies of

antigens and immunoadjuvants in 150 nm nanoparticles were obtained. In OT II mice, the

coentrapment of ovalbumin and the Toll-like receptor ligands Poly(I:C) and CpG was crucial

to induce high levels of IFN-γ and IL-2, as well as high IgG2c/IgG1 ratios. Mannose-

functionalization of nanoparticles potentiated the Th1 immune response. The nanoparticulate

vaccines decreased the growth rate of murine B16F10 melanoma tumors in both therapeutic

and prophylatic settings. The combination of MHC class I- and class II-restricted melanoma

antigens in different mannose-functionalyzed nanoparticles containing Toll like receptor

ligands induced the highest tumor growth delay. Overall, we demonstrate that the

combination of active targeting of nanoparticles with their multifunctional properties in terms

of antigen and adjuvant delivery has high cancer immunotherapeutic potential.

Graphical abstract

Keywords

Cancer vaccine, nanoparticles, PLGA, mannose receptor targeting, TLR, antigen

presenting cells, melanoma


111

1. Introduction

There are increasing evidences that the immune system is able to mount responses

against tumors that can be enhanced using a number of strategies (4). Cancer immunotherapy

must envision the activation of cell-mediated immunity, particularly CD8+ cytotoxic T cells.

Activated CD8+ T cells are able to directly kill malignant cells and also acquire a long-lasting

memory phenotype, important in the prevention of cancer relapses (183). CD4+ T helper (Th)

1 cells are also essential to obtain an effective antitumor response by enhancing clonal

expansion of cytotoxic T lymphocytes (CTLs) at the tumor site and promoting the generation

and maintenance of a memory phenotype (426). To activate both CD8+ and CD4+ T cells

against tumor, tumor-associated antigens (TAAs) must be presented through major

histocompatibility complex (MHC) class I and II molecules in an immunostimulatory context

(36).

Several vaccination strategies have been tested as whole tumor cells, cell lysates,

proteins or specific peptide fragments, leading to the generation of tumor-specific T cell

responses (427). Nevertheless, the therapeutic benefit of these strategies remains unclear and

further well designed studies are needed to clarify the potential of each approach. Improved

cancer vaccination strategies depend on the targeted delivery of TAAs to antigen presenting

cells (APCs) - dendritic cells (DCs) by excellence but also macrophages and B cells - which

present antigens to T cells (38). Notwithstanding, their capacity to properly stimulate T cells

depends on the presentation of antigens in an immunostimulatory environment, which can be

achieved by using molecules with known adjuvant potential, such as the Toll-like receptor

(TLR) ligands. The stimulation of TLRs in APCs activates intracellular signaling pathways

that culminate in the induction of inflammatory cytokines, chemokines, interferons and

upregulation of costimulatory molecules that provide the proper environment for T cell

stimulation (184). Some studies have demonstrated that the combined administration of TLR

ligands and antigens enhances specific immune responses (170,428). However, additional

strategies are needed in order to (i) prevent their prompt in vivo degradation, (ii)

simultaneously target antigens and adjuvants to an APC and (iii) promote their sustained and

modulated release in those cells. This can be accomplished by the use of biodegradable

nanoparticles (NPs), which have been shown to improve immune responses by enhancing the

uptake of antigens and adjuvants by APCs (171,172). NPs are able to target the immune

system and co-deliver antigens and adjuvants simultaneously to the same APC, enabling its

coordinated activation (3). The large surface area of NPs potentiates electrostatic and/or

receptor-interactions in a greater extent compared to soluble antigens (185). By providing

Chapter 3

112

direct intracellular access, the engagement of intracellular receptors is facilitated, which

improves the efficacy of vaccine adjuvants (190). Also, NPs avoid immediate degradation of

the key vaccine components i.e. proteins, peptides, nucleic acids and oligonucleotides

(186,187). Furthermore, biodegradable polymeric NPs can provide different release profiles

to the entrapped molecules according to polymer’s physicochemical properties (191). Finally,

NP functionalization further allows the active targeting of APCs potentiating the delivery of

their cargo at the intracellular level and thus improving the vaccine outcome (192). All these

advantageous properties confer intrinsic adjuvanticity to aliphatic polyester-based NPs and

make them promising vaccine delivery systems (193).

We hypothesized that the coentrapment of several melanoma-associated antigens

(MAAs) along with TLR ligands in mannose-functionalized aliphatic polyester-based NPs

could be an effective antitumor strategy. The developed nanoparticulate vaccines were able to

induce antitumor immune responses in a murine melanoma model, when used in therapeutic

and prophylactic approaches. We investigated multiple factors that have an impact on the

therapeutic effect of a cancer vaccine, as the importance of using an actively targeted delivery

system, the synergy between TLR ligands and the relevance of combining multiple TAAs,

including MHC class I- and class II-restricted peptides.

2. Materials and methods

2.1. Materials

Poly(D,L-lactic-co-glycolide) (PLGA) Resomer® RG 502 (lactide:glycolide 50:50)

(average Mw = 7,000 – 17,000 g/mol), sodium cholate hydrate, dichloromethane (DCM),

Tris, fluorescamine, lipopolysaccharide (LPS) from Escherichia coli and bovine serum

albumin (BSA) were purchased from Sigma-Aldrich (St. Louis, MO,USA). Poly(D,L-lactic-

co-glycolide-b-ethylene glycol) (PEG-b-PLGA) (average Mw(PEG) = 4,600 g/mol and

Mw(PLGA) = 16,500 g/mol) and poly(ε-caprolactone-b-ethylene glycol) (PEG-b-PCL)

(average Mw(PEG) = 6,000 g/mol and Mw(PCL) = 12,000 g/mol) were synthesized by ring

opening polymerization followed by a “clip” and “click” reaction of α-methoxy-ω-alkyne

poly(ethylene glycol) (PEG) to N-hydroxy-succinimidyl activated esters (402,403). Mannose-

grafted poly(ε-caprolactone-b-ethylene glycol) (man-PEG-b-PCL) (average Mw(PCL) =

17,000 g/mol and Mw(PEG) = 2,000 g/mol) was synthesized by the Huisgen 1,3-dipolar

cycloaddition, where each PCL long chain was grafted with three PEG chains, with 30 % of

PEG chains containing one mannose residue (406).


113

Dimethilsulfoxide (DMSO) and hydrochloric acid were purchased from Merck

(Darmstadt, Germany). The MicroBCATM Protein assay kit and the Oligreen® ssDNA

quantitation kit were supplied by Thermo Fisher Scientific Inc. (Rockford, IL USA) and Life

Technologies (Carlsbad, CA, USA), respectively.

Melan-A:26-35(L27) (hereafter Melan-A:26 or M), ELAGIGILTV, gp100:209-

217(2M) (hereafter gp100:209 or G209), IMDQVPFSV and gp100:44-59 (hereafter gp100:44

or G44), WNRQLYPEWTEAQRLD, were synthesized by JPT Peptide Technologies GmbH

(Berlin, Germany). CpG ODN 1826 VaccigradeTM (hereafter CpG or C),

TCCATGACGTTCCTGACGTT, and Poly(I:C) (HMW) VaccigradeTM (hereafter Poly(I:C)

or P) were purchased from InvivoGen (San Diego, CA, USA).

Dulbecco’s Phosphate Buffered Saline (DPBS) (1×), RPMI + Glutamax® medium, heat

inactivated fetal bovine serum (FBS), trypsin EDTA 0.05 %, penicilin/streptomycin (PEST)

10,000 Unit/ml/10,000 µg/ml, sodium pyruvate 100 mM, HEPES 1 M, 2-mercaptoethanol 50

mM, ACK lysing buffer and AlamarBlue® reagent were purchase from Life Technologies

(Carlsbad, CA, USA).

Rat anti-mouse PE-conjugated anti-CD4 for flow cytometry was purchased from

Miltenyi Biotec (Koln Germany). Rat anti-mouse APC-conjugated anti-CD8α and PerCP-

Cy5.5-conjugated anti-CD3 monoclonal antibodies for flow cytometry were purchased from

Biolegend (San Diego, CA, USA). Horseradish peroxidase (HRP) conjugate goat anti-mouse

IgG (1:2000), IgG1 (1:6000) and IgG2c (1:10000) for ELISA were purchased from AbD

Serotech (Raleigh, NC, USA). TMB One Component HRP substrate was acquired from Tebu-

bio (Le Perray-en-Yvelines, France). DuoSet® ELISA Development kits for IFN-γ, IL-2, IL-4,

IL-5, IL-6, IL-10 and Granzyme B (Grz B) were purchased from R&D Systems Europe

(Abingdon, UK). Anti-mouse ELISA sets for IL-2, IL-4, IL-6 and IL-10 were also acquired

from Southern biotech (Birmingham, AL, USA).

2.2. Mice

Female transgenic OT-II mice were bred in-house at Instituto Gulbenkian de Ciência

(Oeiras, Portugal), under conventional, non-specific pathogen-free conditions.

Male C57Bl6 mice 8-10 weeks old were purchased from Charles River (Wilmington,

MA, USA.).

Procedures were reviewed and ethically approved by the local ethics committee and

Portuguese competent authority for animal protection, Direcção Geral de Alimentação e

Veterinária, Lisbon, Portugal.

http://www.thermofisher.com/

Chapter 3

114

2.3. Preparation of NPs

NPs were aseptically prepared at room temperature by the double emulsion solvent

evaporation method, as previously reported with modifications (254). Two different types of

NPs were formulated: non-functionalized NPs (hereafter NPs), constituted by a blend of

PLGA, PEG-b-PLGA and PEG-b-PCL in a 70:15:15 ratio; and functionalized (mannose-

grafted) NPs (hereafter man-NPs) using PLGA, PEG-b-PLGA and man-PEG-b-PCL

(70:15:15). Polymers were dissolved in DCM or DCM:DMSO 70:30 to prepare NPs or man-

NPs, respectively. Aqueous solutions of antigens (Melan-A:26, gp100:209 or gp100:44) at 5

mg/ml and adjuvants CpG (5 mg/ml) and Poly(I:C) (2.5 mg/ml), were added to the polymer

solutions (50 mg/ml) and mixtures were emulsified using an ultrasonic processor for 15 s at

70 W. Ovalbumin (OVA) (10 mg/ml) was also used as a model antigen. A second emulsion

was performed with 1 % (w/v) sodium cholate aqueous solution under the same conditions.

The double emulsion was then poured drip into a 0.3 % (w/v) sodium cholate aqueous

solution, and stirred at 37 °C for 1 h. The NP suspension was then washed twice with

ultrapure water by centrifugation at 22000 × g for 45 min, 4 °C (Beckman Coulter Avanti® J-

E Centrifuge JA-20) and finally resuspended in DPBS.


NP size was determined by Dynamic Light Scattering (DLS) in DPBS using a Malvern

Nano ZS (Malvern Instruments, UK). Cumulant analysis was used to determine the Z-average

size. The zeta potential of NPs was measured using the same device by Laser Doppler

Velocimetry (LDV) in combination with Phase Analysis Light Scattering (PALS). NPs were

diluted in DPBS and electrophoretic mobility was determined at 25 °C using the Helmholtz-

von Smoluchowski model.

2.5. Determination of antigen and adjuvant loadings

The supernatants of NPs were collected by centrifugations to quantify indirectly the

entrapped agents. The entrapment efficiency [EE% (w/w), Eq. (1)] and the loading capacity

[LC µg/mg, Eq. (2)] of Melan-A:26, gp100:44 and OVA were determined by the

MicroBCATM assay according to the manufacturer’s instructions (364). For the quantification

of gp100:209, the fluorescent dye fluorescamine was used (429). Relative Fluorescence Units

(RFU) were measured using a FluorocountTM fluorometer (Packard, NY, USA), at 360 nm

excitation and 460 nm emission wavelengths. Both adjuvants CpG and Poly(I:C) were


115

quantified by the Oligreen® ssDNA quantitation kit (430). RFU were measured using the

fluorometer at 485 nm excitation and 530 nm emission wavelengths.

The loading of OVA was also quantified by high-performance liquid chromatography

method (HPLC), using a Beckman System Gold: UV-vis detector (Beckman 166), Beckman

126 solvent module and Midas autosampler. Samples (20 µl) were injected onto a Shodex

PROTEIN KW-803 series column (8.0 mm ID x 300 mm, 5 µm particle size, 300 Å pore size)

and eluted with 50 mM sodium phosphate buffer (pH 7.0) + 0.3 M NaCl at 1 ml/min for 20

min at room temperature. OVA elution was monitored at 220 nm by spectrophotometric

analysis. The amount of OVA in each sample was calculated using a standard curve generated

with known concentrations of the protein (0.5 – 10.0 μg/ml, r2 = 0.99).

(1)

(2)

2.6. Integrity of the NP-entrapped OVA

OVA standard solution (250 µg/ml) and NP suspensions (20 mg/ml) were mixed with

SDS-containing loading buffer and digested at 95 °C for 20 min. Samples were then loaded

onto a SDS PAGE system composed by a stacking gel at 4 % (w/v) (2.5 cm depth) and a

resolving gel at 12 % (w/v) (5.5 cm depth), both prepared with an acrylamide:bisacrylamide

solution 29:1 at 30 % (w/v) (Bio-Rad, UK). Electrophoresis was performed in a PowerpackTM

Basic Power Supply (Bio-Rad, UK) in a SDS-containing discontinuous buffer system,

initially at 30 V for approximately 30 min and then at 190 V for approximately 1 h. The

resolving gel was then stained with a Coomassie blue solution.

2.7. Cell line culture conditions

Murine melanoma B16F10 cell line (ATCC#CRL-6475) were propagated in RPMI-

1640 + GlutamaxTM supplemented with 10 % (v/v) FBS, 10,000 Unit/ml/10,000 μg/ml PEST,

50 µM β-mercaptoethanol, 10 mM HEPES and 1 mM sodium pyruvate (hereafter complete

medium).

Chapter 3

116

2.8 Characterization of the immune response induced by the nanoparticulate

vaccines in OT II mice

Female OT II mice were subcutaneously immunized on day 1 and boosted on day 15

and 29, with 100 µl of one of the following formulations (n = 5): 100 µg OVA entrapped in

NP (NP[OVA]) or 100 µg OVA admixed with 20 µg CpG and 40 µg Poly(I:C) in PBS

(OVA+P+C sol.) or entrapped in NPs (NP[OVA+P+C]) or man-NPs (man-NP[OVA+P+C]).

Blood samples were collected on weeks 1, 3, 5, 7, 9 and 12 after the first immunization. Sera

were separated from clotted blood by centrifugation (18,000 × g, 20 min at 4 °C, Allegra 64R,

Beckman, USA) and stored at - 20 °C till quantification of immunoglobulins by ELISA.

Twelve weeks after the first immunization mice were sacrificed and spleens were aseptically

isolated.

2.9. Therapeutic efficacy of the nanoparticulate vaccines

Male C57Bl6 6-8 weeks old mice were randomized into one of the following treatment

groups (n = 6): (1) PBS, (2) Melan-A:26 (M) + Poly(I:C) (P) in solution, (3) M + gp100:209

(G209) + P + CpG (C) in solution, (4) NP[M+P], (5) NP[M+P+C], (6) man-NP[M+P+C], (7)

man-NP[M+G209+P+C] and (8) man-NP[M+P+C] + man-NP[G209+P+C]. Mice were

subcutaneously challenged in the right flank with 1 × 105 B16F10 cells suspended in PBS

with 2 % (v/v) FBS (day 0). One week after the tumor challenge, mice were immunized 3

times with subcutaneous injections of 100 µl of the vaccine in the left groin with 1-week

interval (days 7, 14 and 21). When two different types of NPs were administered [group (8)]

50 µl of each NP suspension were administered in adjacent spots. Each mice received 100 µg

of antigen (50 µg of each when two antigens were used), 40 µg of Poly(I:C) and 20 µg of

CpG, entrapped in 4 mg of NPs or man-NPs. Mice were monitored every two days for pain or

distress, tumor volume and body weight. Tumor growth was evaluated by measuring two

perpendicular tumor dimensions using a caliper. Tumor volumes (V, mm3) were calculated

using the following formula: V = ½ × (L × W2), where L (length) is the longest dimension

and W (width) is the perpendicular dimension to the length. Mice were sacrificed on day 26.

Spleens and tumor tissues were excised and weighted.

2.10. Protection efficacy of the nanoparticulate vaccines against tumor

challenge

Male C57Bl6 6-8 weeks old mice were randomized into the same immunization groups

referred in section 2.9.. An additional group (9) was assayed where mice received Melan-


117

A:26, Poly(I:C) and CpG entrapped in man-NPs mixed with man-NPs entrapping gp100:44,

Poly(I:C) and CpG (man-[M+P+C] + man-NP[G44+P+C]). Mice received 3 subcutaneous

injections of 100 µl of vaccine with 2-week intervals (days -42, -28 and -14) in the left groin.

When two different types of NPs were administered (groups (8) and (9)), 50 µl of each were

administered in adjacent spots. Each mice received 100 µg of antigen (50 µg of each when

two antigens were used), 40 µg of Poly(I:C) and 20 µg of CpG, entrapped in 4 mg of NPs or

man-NPs. On day 0, mice were subcutaneously challenged in the right flank with 1 × 105

B16F10 cells suspended in PBS with 2 % (v/v) FBS. Mice were monitored every two days for

pain or distress, tumor volume and body weight. Mice were sacrificed on day 19. Spleens and

tumor tissues were excised and weighed. Tumor growth was evaluated as mentioned before.

2.11. Cytokine and Granzyme B quantification

Spleens were aseptically removed from sacrificed mice and placed in sterile PBS. A

crude suspension of splenocytes was prepared by filtration through 70 µm strainers in

complete medium. The cell suspension was spun at 200 × g for 10 min, the cell pellet

resuspended and erythrocytes were lyzed using ACK lysing buffer. The centrifugation was

repeated and the cell pellet was resuspended in fresh complete medium. Cells were then

seeded in sterile 96-well tissue culture plates at the amount of 1 × 106 cells in 200 µl of media

per well with or without 20 µg/ml of antigen. Plates were incubated at 37 °C in a humidified

incubator at 5 % CO2. After 72 h of re-stimulation, splenocyte culture supernatants were

collected and cytokine production was assessed using DuoSet® ELISA Development kits

(R&D) for IFN-γ, IL-2, IL-4, IL-5, IL-6 and IL-10 or anti-mouse ELISA sets (Southern

biotech) for IL-2, IL-4, IL-6 and IL-10, according to the manufacturer’s instructions. The

concentrations, expressed in pg/ml, were determined by reference to cytokine standard curves.

To assess Granzyme B (Grz B) production, splenocytes (effector cells, E) from mice

in the protection study were seeded in sterile 96-well tissue culture plates at the amount of 1 ×

106 cells in 100 µl of complete media. Murine melanoma B16F10 cells (target cells, T) were

added in the following day in a 100:1 ratio in 100 µl of complete media. Breast cancer MDA-

MB-231 cells (ATCC-HTB-26) were used as unspecific target cell control in the same E:T

ratio. After 4 h of incubation, supernatants were collected and analyzed for Grz B production

using a murine Granzyme B DuoSet® ELISA Development kits (R&D). Relative ratios of the

Grz B production by each group were determined by comparing the production in the

presence or absence of target cells.

Chapter 3

118

2.12. Splenocyte proliferation assay

Splenocytes harvested from mice in the protection study were seeded in sterile 96-well

tissue culture plates at the amount of 5 × 105 in 200 µl of complete media per well in the

presence of 20 µg/ml of antigen (Melan-A:26, gp100:209 or gp100:44), 1 μg/ml of LPS,

Triton X-100 0.025 % (v/v), or left untreated for 48 h. AlamarBlue® reagent was added at 10

% (v/v) of the total volume and incubated for 3 h. Fluorescence measurements were made at

530 nm/590 nm using a FLUOstar Omega microplate reader (BMG Labtech, Ortenberg,

Germany). Stimulation Index (SI) was calculated using the formula SI = (RFUstimulated –

RFUmedium) - (RFUunstimulated – RFUmedium), where RFUstimulated is the mean RFU of treated

splenocytes, RFUunstimulated is the mean RFU of untreated splenocytes and RFUmedium is the

mean RFU of the wells containing only medium.

2.13. Analysis of spleen T lymphocyte subsets

Splenocytes from mice in the protection assay were seeded in sterile 96-well tissue

culture plates at the amount of 1 × 106 cells in 200 µl of complete media per well and

stimulated with 20 µg/ml of antigen (Melan-A:26, gp100:209 or gp100:44) for 72 h.

Splenocytes were then stained with anti-mouse fluorescently labeled monoclonal antibodies

for flow cytometry (PerCPCy5.5-CD3, PE-CD4 and APC-CD8α) for 20 min after Fc blocking

with rat anti-mouse CD16/CD32 antibody for 15 min. Splenocytes were harvested by

centrifugation and analysed by flow cytometry. The individual fluorescence of 50,000 cells

was collected for each sample using a LSR Fortessa cytometer (BD Biosciences) and

analyzed with FlowJo software version 7.6.5 for Microsoft (TreeStar, San Carlos, CA).

2.14. Statistics

All results are expressed as mean ± standard deviation (SD). T-test, one-way ANOVA

and Tukey's post test or two-way ANOVA and Bonferroni’s post test were performed to

demonstrate statistical differences (p < 0.05), using the software GraphPad Prism version 5.00

(GraphPad Software.Inc, CA, USA).


119

3. Results

3.1. NP physicochemical characterization

3.1.1. NP size and zeta potential

The double emulsion-solvent evaporation method was used to produce biodegradable

polymeric NPs from a blend of three aliphatic polyester copolymers: (i) PLGA; (ii) pegylated

PLGA (PEG-b-PLGA) and (iii) pegylated poly-ε-caprolactone (PEG-b-PCL) or mannose

grafted polymer (man-PEG-b-PCL) (254). PLGA, the main constituent of these NPs (70 %

w/w), is a biodegradable polymer approved for parenteral use in humans and is the most

studied aliphatic polyester for biomedical applications (186,193). PEG-b-PLGA and PEG-b-

PCL were introduced in the formulation to functionalize the polymers with ligands and

increase NP stability due to PEG repulsive properties (254). The ratio of the three different

polymers in the formulation has been previously optimized in our laboratory in terms of

shielding of PLGA negative charges at physiologic pH without hindering ligand accessibility

(254).

To physicochemically characterize the produced NPs, size (Z-average hydrodynamic

diameters), polydispersity index (PdI) and zeta potential were determined (Table 3.1.). The

formulation method was very reproducible. NPs displayed a size range between 145 ± 28 nm

and 190 ± 27 nm, and a narrow particle size distribution (PdI ranging from 0.11 ± 0.02 to 0.28

± 0.02), indicating a homogenous NP population. At pH 7.4, NPs presented a zeta potential

ranging from -0.8 ± 0.8 to -6.2 ± 0.8 mV (Table 3.1.).

Table 3.1. Nanoparticle size, polydispersity index (PdI) and zeta potential (mean ± SD; N ≥ 5, n = 3).

Formulations Sizea (nm) PdIb Zeta Potential (mV)

NP[OVA] 161 ± 26 0.17 ± 0.05 -4.1 ± 1.0 NP[OVA+P] 162 ± 09 0.14 ± 0.06 -6.0 ± 14.7 NP[OVA+C] 148 ± 23 0.15 ± 0.06 -4.1 ± 1.8 NP[OVA+P+C] 145 ± 28 0.13 ± 0.03 -3.5 ± 1.9 man-NP[OVA+P+C] 185 ± 17 0.22 ± 0.02 -5.5 ± 2.8 NP[M] 159 ± 11 0.11 ± 0.02 -0.8 ± 0.8 NP[G209] 159 ± 21 0.13 ± 0.03 -1.4 ± 0.4 NP[M+P] 158 ± 17 0.13 ± 0.02 -4.4 ± 0.1 NP[M+C] 167 ± 06 0.11 ± 0.02 -1.4 ± 0.2 NP[M+P+C] 162 ± 17 0.12 ± 0.02 -4.1 ± 0.8 man-NP[M+P+C] 169 ± 02 0.18 ± 0.07 -4.4 ± 1.5 man-NP[G209+P+C] 157 ± 19 0.28 ± 0.02 -3.7 ± 0.5 man-NP[G44+P+C] 147 ± 25 0.25 ± 0.06 -6.2 ± 0.8 man-NP[M+G209+P+C] 190 ± 27 0.28 ± 0.02 -3.7 ± 1.2

a Z-average hydrodynamic diameter. b Polydispersity index.

Chapter 3

120

3.1.2. Loading of antigens and adjuvants

NPs were able to coentrap different molecules such as OVA, the MAAs Melan-A,

gp100:209 and gp100:44, the oligonucleotide CpG and the dsRNA analog Poly(I:C) (Table

3.2.). The amount of antigens and adjuvants used in the formulation of NPs was adjusted

according to the doses needed for the in vivo proof of concept studies.

To formulate NPs and man-NPs containing OVA, 50 µg of the protein per mg of

polymer were used. A high EE % of OVA in NPs and man-NPs was obtained (between 71.0 ±

24.1 and 79.2 ± 14.0 % (w/w)). It was possible to load between 25.7 ± 10.2 to 39.6 ± 7.0 µg

of OVA per mg of NPs and man-NPs. These results were also confirmed by HPLC (data not

shown). The presence of CpG and/or Poly(I:C) had no significant impact on the loading

capacity of these formulations.

To formulate non-functionalized NPs containing MAAs, 25 μg of either Melan-A:26

or gp100:209 per mg of polymer were used. The EE % obtained ranged from 63.0 ± 20.6 to

71.2 ± 10.2 % (w/w) and the LC 15.8 ± 5.2 and 19.7 ± 3.3 µg of peptide per mg of NPs. To

formulate man-NP[M+P+C], 50 µg of Melan-A:26 per mg of polymer were used. To

formulate either man-NP[G209+P+C] or man-NP[G44+P+C], 25 µg of peptide per mg of

polymer were used. Finally, 25 μg of each peptide per mg of polymer were used to formulate

man-NP[M+G209+P+C]. When, 25 µg of peptide per mg of polymer were used, the EE %

ranged from 80.1 ± 5.2 to 83.6 ± 10.6 % (w/w) with a LC of 20 μg of peptide per mg of man-

NPs. When 50 μg of peptide per mg of polymer were used, the loading increased to values

between 30.0 ± 0.9 and 36.2 ± 1.1 µg of peptide per mg of man-NPs, with a slight decreased

in the EE % (60.0 ± 1.8 to 72.4 ± 2.2 % (w/w)).

The amounts of the immunoadjuvants used in the formulation of all NPs were 20 µg of

Poly(I:C) and 10 μg of CpG per mg of polymer. It was possible to load approximately 11 μg

of Poly(I:C) and 7 μg of CpG, when used individually. When both immunoadjuvants were

coentrapped, the total LC ranged from 15.8 ± 2.1 to 22.5 ± 0.8 µg/mg, and the EE % varied

between 52.7 ± 7.0 and 75.0 ± 2.6 % (w/w).


121

Table 3.2. Entrapment Efficiency (EE %) and Loading Capacity (LC µg/mg) of antigens and

immunoadjuvants in NPs (mean ± SD; N ≥ 5, n = 3).

Formulations EE % Antigen LCa Antigen EE % Adjuvant LC Adjuvant

NP[OVA] 71.0 ± 24.1 25.7 ± 10.2 - - NP[OVA+P] 79.2 ± 14.0 39.6 ± 7.0 52.0 ± 10.5 10.4 ± 2.1

NP[OVA+C] 74.0 ± 12.5 28.7 ± 11.7 78.0 ± 7.0 7.8 ± 0.7

NP[OVA+P+C] 74.0 ± 21.4 30.2 ± 11.1 52.7 ± 7.0b 15.8 ± 2.1b

man-NP[OVA+P+C] 76.1 ± 25.8 33.7 ± 15.0 53.7 ± 4.7b 16.1 ± 1.4b

NP[M] 71.2 ± 10.2 17.8 ± 2.6 - - NP[G209] 66.0 ± 9.1 16.5 ± 2.3 - - NP[M+P] 67.9 ± 26.0 16.1 ± 7.8 57.9 ± 3.9 11.6 ± 0.8 NP[M+C] 63.0 ± 20.6 15.8 ± 5.2 66.1 ± 22.8 6.6 ± 2.3 NP[M+P+C] 65.6 ± 10.9 19.7 ± 3.3 75.0 ± 2.6b 22.5 ± 0.8b

man-NP[M+P+C] 60.0 ± 1.8 30.0 ± 0.9 54.3 ± 8.3b 16.3 ± 2.5b

man-NP[G209+P+C] 83.6 ± 10.6 20.9 ± 2.7 49.0 ± 4.3b 14.7 ± 1.3b

man-NP[G44+P+C] 80.1 ± 5.2 20.0 ± 1.3 49.0 ± 10.7b 13.9 ± 3.2b

man-NP[M+G209+P+C] 72.4 ± 2.2c 36.2 ± 1.1c 47.0 ± 6.0b 14.1 ± 1.8b

a Loading Capacity corresponds to µg of entrapped molecule per mg of polymer. b Total values for CpG and Poly(I:C). c Total values for Melan-A:26 and gp100:209.

3.1.3. Ovalbumin integrity after NP formulation

In order to verify if OVA is degraded during NP formulation, a SDS PAGE analysis

was performed. OVA-entrapping NPs, in the presence or absence of the adjuvants CpG and

Poly(I:C), were applied to the gel. Plain NPs as well as an OVA standard solution and

commercial molecular weight standards were used as controls. OVA maintained its molecular

weight (45 KDa) after the formulation procedure since the bands obtained for all samples of

NPs containing OVA were very similar to those obtained for OVA standard and no other

bands with different molecular weights were detected (Fig. 3.1.). OVA integrity is maintained

independently from the presence of the adjuvants CpG and Poly(I:C) entrapped in the same

NPs.

Chapter 3

122

Figure 3.1. SDS-PAGE (12 % gel) of NPs entrapping OVA and the adjuvants Poly(I:C) and CpG. Lanes:

(1) Standard molecular weight markers; (2) Standard OVA solution (4 µg); (3) NP blank; (4) NP[OVA];

(5) NP[OVA+CpG]; (6) NP[OVA+Poly(I:C)] and (7) NP[OVA+Poly(I:C)+CpG]. A representative image

of three independent experiments is presented.

3.2. Immune response characterization induced in OT II mice by the

nanoparticulate vaccines

3.2.1. Antibody production

In order to determine the effect of loaded NPs with the entrapment of adjuvants (CpG

and Poly(I:C)) in NPs, as well as NP functionalization with mannose, on the humoral immune

response elicited, OT II mice were immunized with OVA+P+C in solution, NP[OVA],

NP[OVA+P+C] or man-NP[OVA+P+C]. The production of anti-OVA total IgG, IgG1 and

IgG2c in sera collected on weeks 1, 3, 5, 7, 9 and 12 after the first immunization was

evaluated by ELISA and is presented in Figure 3.2.. During the assay, no adverse reaction to

the formulations administered was detected.

One week after the first immunization, total IgG and subtype levels were very

homogenous among all the groups. Total IgG and subtype titers peaked on week 5 (one week

after the third immunization). The differences between groups started to be evident on week 3

from when NP[OVA] induced the highest IgG1 titers (p < 0.01), and NP[OVA+P+C] and

man-NP[OVA+P+C] induced similarly high total IgG and IgG2c titers. When OVA and the

adjuvants CpG and Poly(I:C) were administered in solution, the total IgG and IgG2c titers

were lower than the titers induced by the groups inoculated with NPs. Total IgG and IgG2c

titers for this group peaked on week 5 and then decreased considerably over time till week 12.

On the other hand, IgG1 titers were constant after peaking on week 5.


123

Figure 3.2. Anti-OVA specific immunoglobulin sera titers from OT II mice immunized with OVA- and

adjuvant-loaded NPs. OT II mice were immunized with OVA and the adjuvants CpG and Poly(I:C) in

solution, NP[OVA], NP[OVA+P+C] or man-NP[OVA+P+C] on weeks 0, 2 and 4. The production of anti-

OVA total IgG (A), IgG1 (B) and IgG2c (C) in sera collected on weeks 1,3,5,7,9 and 12 after the first

immunization were evaluated by ELISA. Sera from naїve OT II mice were used as control. The titres

reported are the reciprocal of serum dilution that gave an optical density 5 % higher than the control at

the same dilution. D. Th1/Th2 indexes in OT II mice immunized with OVA and adjuvant-loaded NPs,

calculated as a ratio of the obtained mean IgG2c and IgG1 titers for each group at each time point. The

grid line at Th1/Th2 = 1 separates the Th1-biased indexes (> 1) from the Th2-biased ones (< 1). The bars

correspond to mean ± SD; n = 3. Statistics: two-way ANOVA and Bonferroni’s post test. Relative to levels

determined on naїve mice: * p < 0.05, ** p < 0.01 and *** p < 0.001.

To assess the Th1/Th2 polarity of the immune response induced by the different

immunization strategies tested, a Th1/Th2 (IgG2c/IgG1) index was calculated. A Th1/Th2

index < 1 stands for a Th2 polarization while a Th1/Th2 index > 1 stands for a Th1

polarization. Groups immunized with NP[OVA+P+C] and man-NP[OVA+P+C] induced very

high Th1/Th2 indexes, mainly on weeks 3 and 5. The indexes were constant (above 10) from

week 7 to week 12 for both groups (Fig. 3.2.D). The Th1/Th2 index for the NP[OVA] group

Chapter 3

124

was constant (around 5) till week 5 and then decreased to levels below 1 on week 9. The

groups that received OVA and the adjuvants in solution also induced a temporary Th1-biased

immune response (from week 3 to week 7) that reversed to a Th2 profile on week 9.

3.2.2. Cytokine secretion

Cytokine levels were determined to complement the information obtained from the

IgG subtype production in order to understand the overall profile of the immune response

induced by the different vaccine formulations. Mice were sacrificed on week 12 after

immunizations, their spleens were aseptically removed and splenocytes were put in culture

and restimulated with 20 µg/ml of OVA. After 72 h of restimulation, cytokines were

quantified in culture supernatants by ELISA. Cytokine levels are represented in Figure 3.3..

NP[OVA+P+C] and man-NP[OVA+P+C] induced the highest levels of the Th1 cytokine IL-2

(p < 0.01). Surprisingly, only man-NP[OVA+P+C] induced significant superior levels of IFN-

γ (p < 0.001) while NP[OVA+P+C] induced levels of IFN-γ comparable to the other groups.

NP[OVA] and OVA+P+C sol. induced similar low levels of both cytokines. Concerning the

secretion of the Th2 cytokines IL-4, IL-6 and IL-10, all groups induced similar low levels of

IL-4 and no detectable levels of IL-10 (data not shown). OVA and the adjuvants in solution

induced a significantly higher level of IL-6 (p < 0.05) comparing to the NP-based groups.


125

Figure 3.3. Cytokine levels in supernatants of cultured splenocytes from immunized OT II mice. Twelve

weeks after the first immunization mice were sacrificed, spleens were collected and splenocytes were put

in culture and restimulated with 20 μg/ml of OVA for 72 h. Cytokine titers (A. IL-2, B. IFN-γ, C. IL-4, D.

IL-6) were determined by ELISA and compared to the respective standard. Mean ± SD; n = 3. Statistics:

one-way ANOVA and Tukey’s post test. Relative to levels determined on naїve mice: * p < 0.05, ** p <

0.01 and *** p < 0.001.

3.3. Antitumor therapeutic efficacy of the nanoparticulate vaccines

3.3.1. Tumor growth

In order to test the antitumor therapeutic efficacy of the nanoparticulate vaccines, mice

were randomized into one of the following treatment groups: (1) PBS, (2) M+P sol, (3)

M+G209+P+C sol, (4) NP[M+P], (5) NP[M+P+C], (6) man-NP[M+P+C], (7) man-

NP[M+G209+P+C] and (8) man-NP[M+P+C] + man-NP[G209+P+C]. Mice were immunized 3

times weekly after the tumor challenge, according to the schedule presented on Figure 3.4.A.

Tumor growth is expressed by the mean tumor volume over time (Fig. 3.4.B). The groups

treated with man-NP[M+P+C] and man-NP[M+P+C] + man-NP[G209+P+C] presented the

slowest tumor growth (p < 0.001), followed by the group immunized with NP[M+P+C] (p <

Chapter 3

126

0.001) and then NP[M+P] (p < 0.01). The groups immunized with antigens and adjuvants

solutions and the saline control had similar tumor growth. Surprisingly, the group immunized

with man-NP[M+G209+P+C] had a tumor growth rate similar to these groups too.

The mean mass of tumors per 100 g of final body weight and the mean mass of

spleens per 100 g of initial body weight are represented on Figures 3.4.C and 3.4.D,

respectively. These data are in accordance with the obtained mean tumor growth curves, with

the group immunized with man-NP[M+P+C] + man-NP[G209+P+C] presenting the highest

spleen mass per 100 g of initial body weight and the lowest mean tumor mass per 100 g of

final body weight.

Figure 3.4. Antitumor therapeutic efficacy of the nanoparticulate vaccines. A. Schedule of the therapeutic

assay. B. Mean tumor growth curves given by mean tumor volume over time, determined by V = ½ × (L ×

W2), where L (length) is the longest dimension and W (width) is the perpendicular dimension to the

length. C. Mean final tumor weight per 100 g of final body weight. D. Mean final spleen weight per 100 g

of initial body weight. Mean ± SD, N = 6, n = 3. Statistics: two-way ANOVA and Bonferroni’s post test (B)

or one-way ANOVA and Tukey’s post test (C & D); * p < 0.05, ** p < 0.01 and *** p < 0.001.


127


In order to understand the overall profile of immune response induced by the different

vaccines, the Th1 cytokines IFN-γ and IL-2 and the Th2 cytokines IL-4, IL-5, IL-6 and IL-10

were determined by ELISA after 72 h of splenocyte culture in the presence of Melan-A:26

(Fig. 3.5.A) or gp100:209 (Fig. 3.5.B). The groups immunized with man-NP[M+P+C] + man-

NP[G209+P+C], man-NP[M+P+C] and NP[M+P+C] had the highest levels of the Th1

cytokines IFN-γ and IL-2 (p < 0.001) after splenocyte restimulation with Melan-A:26.

Stimulation with gp100:209 induced high secretion of IFN-γ and IL-2 by the groups that

received this antigen delivered in NPs (man-NP[M+P+C] + man-NP[G209+P+C] and man-

NP[M+G209+P+C]) but not by the group that received it in solution. On the other hand, the

highest levels of the Th2 cytokines IL-4, IL-5 and IL-6 were secreted by splenocytes from the

groups immunized with the antigens and adjuvants in solution and the saline control, either

after restimulation with Melan-A:26 or gp100:209. All groups produced undetectable levels

of IL-10 (data not shown).

Figure 3.5. Cytokine levels in the supernatants of cultured splenocytes from mice in the therapeutic study.

Splenocytes were restimulated with 20 μg/ml of Melan-A:26 (A) or gp100:209 (B) for 72 h, and cytokines

were measured in culture supernatants by ELISA. Mean ± SD, n = 3. Statistics: one-way ANOVA and

Tukey’s post test. Relative to the saline control group: * p < 0.05, ** p < 0.01 and *** p < 0.001.

Chapter 3

128

3.4. Protection efficacy of the nanoparticulate vaccine against tumor

challenge

3.4.1. Tumor growth

The antitumor protection capacity of the nanoparticulate vaccines was also evaluated

in a prophylactic setting. Mice were randomized into the same groups tested in the therapeutic

assay. An additional group was included in order to test the combination of MHC class I

(Melan-A:26) and class II (gp100:44) antigens, where mice received man-NP[M+P+C] +

man-NP[G44+P+C]. Mice were immunized 3 times every two weeks before the tumor

challenge (Fig. 3.6.A). Tumor growth curves demonstrate that the additional group tested in

this assay (man-NP[M+P+C] + man-NP[G44+P+C]) induced the slowest tumor growth rate (p

< 0.001) (Fig. 3.6.B). This group presented the lowest mean tumor mass per 100 g of final

body weight (Fig. 3.6.D) and the highest mean spleen mass per 100 g if initial body weight

(Fig. 3.6.E). The remaining groups produced similar results to those obtained in the

therapeutic setting in terms of mean tumor growth curves and mean tumor and spleen

weights. Photographs of the excised tumors representative of each group can be seen in

Figure 3.6.C.


129

Figure 3.6. Efficacy of the nanoparticulate vaccines in the protection against tumor challenge. A. Schedule

of the prophylactic assay. B. Mean tumor growth curves given by tumor volume. C. Representative

images of excised tumors from each treatment group by the end of the assay. D. Mean final tumor weight

per 100 g of final body weight. E. Mean final spleen weight per 100 g of initial body weight. Mean ± SD, N

= 6, n = 3. Statistics: one-way ANOVA and Tukey’s post test. Relative to the saline control group: * p <

0.05, ** p < 0.01 and *** p < 0.001.


The Th1 cytokines IFN-γ and IL-2 and the Th2 cytokines IL-4, IL-5, IL-6 and IL-10

were determined by ELISA after 72 h of splenocyte culture in the presence of Melan-A:26

(Fig. 3.7.A) or gp100:209 (Fig. 3.7.B). Splenocytes from the group immunized with man-

NP[M+P+C] + man-NP[G44+P+C] produced the highest levels of the Th1 cytokines IFN-γ

and IL-2 (p < 0.001) after splenocyte restimulation with Melan-A:26. Stimulation with

gp100:209 or gp100:44 induced high secretion of IFN-γ and IL-2 by the groups that received

this antigen delivered in NPs but not by the group that received it in solution. The highest

level of the Th2 cytokine IL-4 was produced by the group immunized with M+G209+P+C sol.

(p < 0.001), although immunization with man-NP[M+P+C] + man-NP[G44+P+C] also showed

some IL-4 production. IL-5 production was mainly detected in the groups immunized with

Chapter 3

130

antigens and adjuvants in solution and in the saline control group, although the NP[M+P]

group demonstrated also some IL-5 production. The highest levels of IL-6 were secreted by

splenocytes from the group immunized with M+G209+P+C sol. (p < 0.001) but also with man-

NP[M+G209+P+C], either after restimulation with Melan-A:26 or gp100:209. All groups

produced undetectable levels of IL-10 (data not shown).

Figure 3.7. Cytokine levels in the supernatants of cultured splenocytes from mice in the prophylactic

study. Splenocytes were restimulated with 20 μg/ml of Melan-A:26 (A) or gp100:209 or gp100:44 for

group (9) (B) for 72 h, and cytokines were measured in culture supernatants by ELISA. Mean ± SD, n = 3.

Statistics: one-way ANOVA and Tukey’s post test. Relative to the saline control group: * p < 0.05, ** p <

0.01 and *** p < 0.001.

3.4.3. Granzyme B production

As can be observed in Figure 3.8., the highest ratio of Grz B production was induced

in the group immunized with man-NP[M+P+C] + man-NP[G44+P+C] (p < 0.001).

Immunization with man-NP[M+P+C] + man-NP[G209+P+C] and man-NP[M+G209+P+C] also

induced high levels of Grz B (p < 0.001). NP[M+P] and man-NP[M+P+C] also induced some

Grz B production (p < 0.01). Groups immunized with antigens and adjuvants in solution

demonstrated a very low production of Grz B, similar to the saline control group. Incubation

of the effector cells with the unspecific target cells did not induce significant increases in Grz

B ratios.


131

Figure 3.8. Relative granzyme B (Grz B) production by splenocytes collected from mice in the protection

study. Splenocytes (effector cells, E) were cultured with B16F10 cells (target cells, T) or breast cancer

MDA-MB-231 cells as unspecific target control (unsp T). After 4 h of incubation, Grz B levels were

measured in culture supernatants by ELISA. Relative ratios of the Grz B production were determined by

comparing the production in the presence or absence of target cells. Mean ± SD, n = 3. Statistics: one-way

ANOVA and Tukey’s post test. Relative to levels of the saline control group: * p < 0.05, ** p < 0.01 and

*** p < 0.001.

3.4.4. Splenocyte proliferation assay

Splenocyte proliferation capacity from immunized mice in the protection study is

shown in Figure 3.9.. Stimulation of splenocytes with Melan-A:26 induced proliferation in all

groups (p < 0.001) except in the saline control. The highest SI was verified in the groups

immunized with man-NP[M+P+C] + man-NP[G44+P+C] and man-NP[M+P+C] + man-

NP[G209+P+C]. Stimulation with gp100:209 caused high proliferation (p < 0.001) of the

splenocytes from the man-NP[M+P+C] + man-NP[G209+P+C] group. Similarly, stimulation

with gp100:44 caused high proliferation (p < 0.001) of the splenocytes of the group

immunized with man-NP[M+P+C] + man-NP[G44+P+C]. In both cases, the SI of the

remaining groups was not significantly augmented and any stimulation was seen in the saline

control group. The mitogen LPS induced high proliferation (p < 0.001) of the same groups as

well as the group immunized with NP[M+P+C]. Some proliferation was observed for the rest

of the groups, including the saline control, but not statistically significant.

Chapter 3

132

Figure 3.9. Splenocyte proliferation assay from mice in the protection study. Splenocytes were

restimulated with 20 µg/ml of each antigen (Melan-A:26, gp100:209 or gp100:44), 1 μg/ml of the mitogen

LPS from E. coli, Triton X-100 0.025 % (v/v) as a negative control, or left untreated for 48 h. Splenocyte

proliferation was measured using the AlamarBlue® reagent. Stimulation Index (SI) was calculated as the

ratio of the proliferation in each sample to the proliferation of the untreated splenocytes for each

immunization group. Mean ± SD, n = 3. Statistics: two-way ANOVA and Bonferroni’s post test; * p < 0.05,

** p < 0.01 and *** p < 0.001.

3.4.5. Spleen T lymphocytes subset analysis

Splenocytes from mice in the protection study were harvested and restimulated with

the peptides Melan-A:26, gp100:209 and gp100:44. After 72 h, the percentages of CD3+CD4+

and CD3+CD8+ T cells were quantified by flow cytometry. Figure 3.10. shows representative

histograms of the percentages of CD3+ versus CD4+ and CD3+ versus CD8+ T cells for each

group in the protection assay, after restimulation with the antigens. Mean percentages of each

T cell subset are also presented in the graphics on the right. It is possible to observe that the

groups immunized with man-NP[M+P+C] + man-NP[G44+P+C] and man-NP[M+P+C] +

man-NP[G209+P+C] had a superior (p < 0.001) percentage of CD3+CD4+ and CD3+CD8+ T

cells. The groups immunized with NP[M+P+C] and man-NP[M+P+C] also showed slightly

higher levels (p < 0.05) of CD3+CD4+ T cells but not CD3+CD8+ T cells. After restimulation

with gp100:209 (Fig. 3.10.C) or gp100:44 (Fig. 3.10.D), the groups immunized with man-

NP[M+P+C] + man-NP[G209+P+C] and man-NP[M+G209+P+C] demonstrated superior

percentage of CD3+CD4+ T cells (p < 0.001), comparing to the saline control group cells.

Surprisingly, any group demonstrated to induce higher percentages of CD3+CD8+ T cells.

Similarly, the group immunized with man-NP[M+P+C] + man-NP[G44+P+C] showed

superior levels of CD3+CD4+ T cells (p <0.001) but not of CD3+CD8+ T cells (Fig. 3.10.E &

3.10.F).


133

Figure 3.10. Representative

flow cytometry histograms

of the percentages of CD3+

versus CD4+ and CD3+

versus CD8+ T cells for

each group in the

protection study, after

restimulation with Melan-

A:26 (A), gp100:209 (C) or

gp100:44 (D). Mean

percentages of each T cell

subset after restimulation

Melan-A:26 (B), gp100:44

(E) or gp100:209 (F) are

presented. Mean ± SD, n =

3. Statistics: one-way

ANOVA and Tukey’s post

test. Relative to the saline

control group: * p < 0.05,

** p < 0.01 and *** p <

0.001.

Chapter 3

134

3.5. Vaccine tolerability

The mean ratios of body weight to the initial body weight of mice were used to

evaluate vaccine tolerability (Fig. 3.11.). It is possible to observe that mice body weight

increased over time in all groups, mainly after tumor challenge. No abrupt weight loss was

verified. Mice were also monitored every two days, and no signal of pain or distress was

registered.

Figure 3.11. Tolerability to the vaccines. The tolerability to vaccine formulations was evaluated by

monitoring body weight of the animals throughout the therapeutic (A) and the protection (B) studies,

given by the mean ratio of body weight to the initial body weight of all animals. Mean ± SD, N = 6, n = 3.

4. Discussion

The aim of this study was to develop a nanoparticulate delivery system able to target

TAAs and immunoadjuvants to APCs and consequently induce the activation of CD8+ to

expand into CTLs and CD4+ T cells, since CD8+ lymphocytes can fail to maintain

functionality in the absence of CD4+ T helper cells (193).

A reproducible formulation method has been developed using aliphatic polyester

copolymers to produce biodegradable polymeric NPs composed of a blend of three aliphatic

polyester copolymers. NPs in a 140 to 190 nm size range and narrow particle size

distributions were produced. These diameters fall into the range of particles that are usually

taken up via clathrin-mediated endocytosis (< 200 nm) and tend to generate a virus-like

immune response with activation of CTLs and Th1 cells (300). Moreover, only NPs up to 200

nm can be transported through the lymphatic system after peripheral injection and arrive

directly to the lymph nodes, where a high number of DCs can be found (185,418). The

slightly negative zeta potential of NPs at pH 7.4 confirms the presence of PEG chains


135

shielding the highly negative charges of PLGA at NP surface. It also indicates that sodium

cholate, which is an anionic tensioactive, might be efficiently removed from NP surface.

NPs demonstrated great versatility in terms of their capacity to coentrap different

molecules including a 45 KDa protein (OVA), very small peptides (~ 1 KDa) (Melan-A:26,

gp100:209 and gp100:44) and even the oligonucleotide CpG and the dsRNA analog

Poly(I:C). EE % around 70 % and LC ranging from 20 to 40 µg of antigen and from 7 to 11

µg of immunoadjuvant per mg of polymer indicate that these NPs are adequate for mice

immunization, since few milligrams of NPs were necessary to deliver the amount of peptide

and adjuvant normally used in pre-clinical studies (431). Biological responses do not to

correlate with doses and very small amounts of antigens and adjuvants seem to be necessary

to obtain effective immune responses (72). The MHC class I-restricted MAAs - Melan-A:26

and gp100:209 - have been used as they represent two highly immunogenic epitopes that are

frequently recognized by tumor-infiltrating T lymphocytes (TILs) (16). A MHC class II-

restricted melanoma antigen (gp100:44) has also been used to test the impact of co-

presentation of MHC class I and class II peptides in the antitumor immune response. Two

TLR ligands, Poly(I:C) and CpG, were specifically chosen because they have been described

as potent Th1-inducing immunoadjuvants (148). Their receptors, TLR3 and TLR9

respectively, are both localized in the endosomal membrane where NPs can easily get access

(184). Moreover, the dissimilar distribution pattern among human leukocytes and the

induction of parallel signaling pathways by these TLR ligands might allow a synergistic

action in the promotion of cytokine release and broader activation of APCs (432). To the best

of our knowledge, neither gp100:209 or gp100:44 have been encapsulated in any particulate

delivery system. On the other hand, Melan-A:26 has already been incorporated in virosomes

and liposomes, but considerably lower EE % values have been reported (429,433).

In order to potentiate NP interaction with APCs, a mannose-functionalized delivery

system was developed to target the mannose receptor (MR/CD206) on APCs, which is

involved in the recognition and internalization of pathogens (351). Several studies suggest

that mannose-grafted nanocarriers can have an increased uptake by APCs, resulting in

enhanced humoral and cellular antitumor responses (339,434).

The immune response profile induced by OVA-containing NPs was characterized in

OT II mice which are transgenic mice in which all CD4+ T cells express transgenic αβ-TCRs

that are specific for the OVA323–339 determinant in the context of H-2-I-Ab (435). This mice

model provides CD4+ T cell homogeneity that allows the characterization of immune

response profiles (Th1/Th2) without unspecific immune response bias (436). In this study, it

Chapter 3

136

was possible to verify by the immunoglobulins and cytokines produced that the administration

of OVA and the immunoadjuvants in solution induced a Th2-biased immune response. OVA-

containing NPs in the absence of the adjuvants induced a weak Th1-biased immune response

that reverted to Th2 three weeks after the last immunization. As so, it seems that antigens

delivered by NPs are not sufficient to induce a long lasting Th1 profile in the absence of

immunoadjuvants. When OVA and the immunoadjuvants were coentrapped in NPs or man-

NPs, a strong and long lasting Th1-biased immune response was induced. This demonstrates

that both the use of NPs and the coentrapment of Th1-immunoadjuvants along with the

antigen are essential to induce a Th1-biased immune response. Poly(I:C) and CpG are known

by their Th1-inducing properties (148). However, it is likely that these molecules are not able

to exert their effect when administered in solution, probably due to degradation and/or low

uptake by APCs.

In order to characterize the antitumor therapeutic efficacy of the developed NPs, the

MAAs were entrapped in NPs and used in combination with the immunoadjuvants Poly(I:C)

and CpG and administered to B16F10-bearing mice. Tumor growth rates and tumor and

spleen weights suggest that the combination of man-NPs coentrapping different MHC class I-

restricted MAAs along with two TLR ligands (man-NP(M+P+C] + man-NP[G209+P+C])

induced the most effective antitumor immune response. Using only one MAA along with two

TLR ligands-containing man-NPs (man-NP[M+P+C]) was equally very effective in tumor

growth reduction. However, when two MAAs were combined in the same man-NP, a

detrimental effect was obtained, since mean tumor volume over time was similar between the

group treated with man-NP[M+G209+P+C] and the groups that received antigens and

adjuvants in solution. The presence of both antigens in the same NP, and consequently, in the

same APC, could induce competition to the MHC class I complexes (437). However, when

the antigens are carried by different NPs, the chances that they are processed by different

APCs increase, and a stronger antitumor immune response was induced. Treatment with

NP[M+P+C] was inferior to man-NP[M+P+C], which demonstrate that mannose-

functionalization increased NP antitumor efficacy. NP[M+P+C] was slightly superior to

NP[M+P], suggesting a synergistic effect between both TLR ligands when they are

administered concomitantly, as previously reported (166,438). The groups immunized with

antigens and adjuvants in solution and the saline control had similar higher tumor growth

rates, which demonstrates the inefficacy of these molecules when administered in solution.

The nanoparticulate vaccines were also evaluated in a prophylactic setting. Here, an

additional group was tested, where man-NPs containing a MHC class I or a MHC class II-


137

restricted MAA with both TLR ligands were combined (man-NP[M+P+C] + man-

NP[G44+P+C]). In recent years it has became evident that CD4+ T cells also play a critical

role in the development of effective antitumor immunity. Indeed, CD8+ lymphocytes can fail

to maintain functionality in large part because of the absence of CD4+ T cell help (426,439).

CD4+ T helper cells can enhance antitumor CTL responses by enhancing clonal expansion at

the tumor site, promoting the generation and maintenance of the memory CTL phenotype,

preventing activation-induced cell death (AICD) and functioning as APCs for CD8+ T cells

(26). We hypothesized that the combination of MHC class I and class II-restricted peptides

could induce both CD8+ and CD4+ activation and lead to a superior antitumor immune

response. In fact, the group immunized with the combination of man-NPs containing MHC

class I- and MHC class II-restricted peptides demonstrated the most significant tumor growth

rate reduction and the best results in terms of tumor and spleen weights, Th1-cytokine

production, Grz B secretion, splenocyte proliferation and percentage of CD4+ and CD8+ T

cells. The remaining groups tested in the protection assay demonstrated similar results to what

was obtained in the therapeutic setting.

5. Conclusions

We report the successful development of a cancer immunotherapeutic strategy by

using biodegradable polymeric NPs to target TAAs and TLR ligands to APCs and induce an

antitumor immune response. We were able to produce 140 – 190 nm NPs, either plain or

functionalized with mannose residues, that could successfully coentrap various antigens and

immunoadjuvants. Several factors that could affect the performance of the vaccine were

evaluated, such as (i) the importance of using a nanoparticulate delivery system; (ii) the

impact of mannose-functionalization of NPs for active targeting of APCs; (iii) the potential

synergy between two TLR ligands; (iv) the impact of the combination of two peptide antigens

either in separated or in the same NP; and (v) the effect of using a combination of NPs

containing MHC class I- and class II-restricted peptides.

All together, the in vivo results obtained lead us to the following conclusions:

• The coentrapment of antigens and immunoadjuvants in NPs is essential to induce a

long lasting Th1 immune response;

• Mannose functionalization of NPs improves NP performance in terms of the

desired Th1/antitumor immune response;

• The immunoadjuvants CpG and Poly(I:C) exert a synergistic effect when

coentrapped in NPs;

Chapter 3

138

• Immunization with two MHC class I-restricted MAAs in separated man-NPs was

slightly superior comparing to when only one antigen was used;

• The use of two MHC class I-restricted MAAs (Melan-A:26 and gp100:209)

coentrapped in the same man-NPs has a detrimental effect on the antitumor immune response,

possibly due to a competition of both peptides to the MHC class I molecules;

• The combination of man-NPs containing either a MHC class I- or class II-restricted

MAAs along with both immunoadjuvants elicited the most potent antitumor immune

response, suggesting the importance of the activation of both CD4+ and CD8+ T cells in the

efficacy of the antitumor immune response.

Akgwledgements

This work was supported by Fundação para a Ciência e a Tecnologia, Ministério da

Educação e Ciência, Portugal (PhD Grant SFRH/BD/64295/2009 to JMS, PTDC/SAU-

FAR/119389/2010 and Pest-OE/SAU/UI4013/2011) and by Fonds de la Recherche

Scientifique Médicale, Belgium. GV is a postdoctoral researcher of the Fonds de la Recherche

Scientifique-FNRS. The authors have no other relevant affiliations or financial involvement

with any organization or entity with a financial interest or financial conflict with the subject

matter or materials discussed in the manuscript.


139

Appendix

1. Induction of DC maturation by NPs

In order to properly stimulate T cells to start an effective immune response, DC

maturation must be induced upon the internalization of the antigens to be presented. Given

that, it is important to evaluate the capacity of the antigen- and immunoadjuvant-loaded NPs

to induce the maturation of DCs. To access the effect of different NP formulations containing

the model antigen OVA and the TLR ligands Poly(I:C) and CpG on the maturation induction

of DCs, the surface expression of the costimulatory molecules CD40 and CD86 was

quantified in the CD11c+ population of BMDCs after 24 h of incubation with the different NP

formulations.

1.1. Method

BMDCs were seeded in 96-flat bottom well plates (2 × 105/200 µl) and let to become

adherent overnight. Cells were treated in triplicate with one of the following treatments: OVA

2.5 µg/ml, LPS 100 ng/ml, Poly(I:C) 5 µg/ml, NP[blank], NP[OVA], NP[OVA+P],

NP[OVA+P+C] and man-NP[OVA+P+C] or left untreated. NPs were added at a

concentration of 500 µg/ml. NPs carried 12.5 µg/mg of OVA and 2.5 µg/mg of Poly(I:C) or

CpG. After 24 h of incubation, BMDCs were washed with FACS buffer and stained with anti-

mouse fluorescently labeled monoclonal antibodies for flow cytometry (PE-CD11c, FITC-

CD86 and APC-CD40) for 20 min after Fc blocking with rat anti-mouse CD16/CD32

antibody for 15 min. BMDCs were harvested by centrifugation and analysed by flow

cytometry. The individual fluorescence of 10,000 cells was collected for each sample using a

LSR Fortessa cytometer (BD Biosciences) and analyzed with FlowJo software version 7.6.5

for Microsoft (TreeStar, San Carlos, CA).

1.2. Results

To access the effect of different NP formulations containing the model antigen OVA

and the TLR ligands Poly(I:C) and CpG on the maturation induction of DCs, the surface

expression of the costimulatory molecules CD40 and CD86 was quantified in the CD11c+

population of BMDCs after 24 h of incubation with different NP formulations. Untreated and

LPS-treated BMDCs were used as controls. OVA and Poly(I:C) were also tested in solution.

The surface expression of CD40 and CD86 by CD11c+ BMDCs upon different treatments is

Chapter 3

140

represented in the histograms presented in Figure 3.12.A along with the histograms of

untreated cells and isotype control. Figure 3.12.B presents the expression of the costimulatory

molecules by median fluorescence intensities in the graphics. Untreated BMDCs presented

basal levels of CD40 and CD86 expression. These costimulatory molecules were highly

upregulated by treatment with LPS (p < 0.001), with CD40 demonstrating a much higher

upregulation than CD86. OVA and Poly(I:C) added to BMDCs in solution had slightly

different effects on the expression of CD40 and CD80. OVA significantly increased the

expression of CD40 (p < 0.01) but not CD86, while Poly(I:C) had the opposite effect. The

great majority of NP formulations induced a significant increase (p < 0.001) in CD40 and

CD86 expression. Comparing to OVA solutions, OVA entrapped in NPs induced significant

upregulation of CD40 (p < 0.05) but mainly of CD86 (p < 0.001). Surprisingly, the addition of

the TLR ligands Poly(I:C) or CpG to the NP formulations did not significantly increased the

expression of both molecules. Plain NPs also demonstrate to significantly increased the

expression of both costimulatory molecules (p < 0.001) comparing to untreated cells and were

not significantly different from the antigen and adjuvant-loaded NPs. man-NP[OVA+P+C]

induced very different effects on the expression of CD40 and CD86. While this formulation

induced lower upregulation of CD40 comparing to the other NP formulations tested, it

induced a much higher CD86 expression (p < 0.001) comparing to any other NP formulation

or even LPS.


141

Figure 3.12. Expression of the costimulatory molecules CD40 and CD86 by BMDCs upon incubation with

NPs. BMDCs were incubated for 24 h with OVA 2.5 µg/ml, LPS 100 ng/ml, Poly(I:C) 5 µg/ml, NP[blank],

NP[OVA], NP[OVA+P], NP[OVA+P+C] and man-NP[OVA+P+C)] or left untreated. After staining with

anti-mouse fluorescently labeled monoclonal antibodies for flow cytometry (PE-CD11c, FITC-CD86 and

APC-CD40) 10,000 cells were analyzed in a flow cytometer. A. Upregulation of CD40 and CD86 presented

in histograms. Each histogram presents the isotype control (blue line), untreated cells (red line) and

treated cells (orange or green line for CD40 or CD86, respectively). B. Median fluorescence intensity

translating the expression of CD40 or CD86 for each condition tested. Mean ± SD, N = 3, n = 3. Statistics:

one-way ANOVA and Tukey’s post test. * p < 0.05, ** p < 0.01, *** p < 0.001, NS, statistically non-

significant.

2. Discussion & conclusions

For T cells to be effectively activated by DCs, the presentation of the antigen by DCs

to T cells needs to happen in an immunostimulatory environment. This means that, along with

the recognition of the MHC-antigen complex presented by DCs, T cells need to receive other

stimuli from DCs. This stimuli results from the maturation of DCs which induces the

upregulation of cell surface molecules, also known as costimulatory molecules, such as

Chapter 3

142

CD40, the receptor for CD40L expressed by naïve T cells, and also CD80 and CD86 (B7-1

and B7-2 in humans, respectively), which are the ligands for the immunoglobulin superfamily

member CD28, also expressed by naïve T cells. Also, T cells need cytokines and chemokines,

such as IL-12 and type I IFNs, which are produced by DCs and directly affect T cells in a

paracrine fashion (41,42).

The analysis of the expression of CD40 and CD86 by BMDCs treated with different

NP formulations revealed that NPs are able to induce the upregulation of those costimulatory

factors. The slightly different effects that were observed in the expression of CD40 and CD86

might be explained by the fact that the induction of the expression of these costimulatory

molecules happens in different moments of the DC maturation process. CD86 is known to be

an affector costimulatory molecule, since its upregulation on DCs is induced in an early stage

upon stimulation. CD40 expression happens later on as it is known to be an effector

costimulatory molecule (440). This can explain the fact that NP formulations, mainly man-

NP[OVA+P+C], had a stronger effect on the induction of CD86 than of CD40. We

hypothesized that a longer time of incubation would be necessary to see a higher effect of

these NPs on CD40 expression. Even though, these results suggest that mannose

functionalization can significantly increase the induction of the maturation process of DCs,

which may happen due to an increase of the uptake of the mannose-functionalized NPs, but

more likely due to the direct effect of mannose on triggering the C-type lectin receptor

MR/CD206 and consequently induce the activation of DCs.

NPs loaded with OVA demonstrated to be more effective in the induction of the

expression of CD40 (p < 0.05) and CD86 (p < 0.001) than OVA solution, which demonstrates

the importance of using NPs as vaccine delivery systems. Surprisingly, the coentrapment of

the TLR ligands Poly(I:C) and CpG did not significantly increase the effect observed for

NP[OVA]. We hypothesized that the 24 h of incubation used in this experiment were not

enough to observe the effect of antigen and adjuvant-loaded NP maximal effect. We alert to

the fact that the full potentiating effect of the immune response by of loaded NPs is probably

more notorious in vivo due to the more efficient targeting and internalization of the antigens

and adjuvants by DCs.

Another surprising result observed in this experiment is the fact that plain NPs (i.e.

NPs deprived of any payload) induced also the upregulation of both costimulatory molecules

in a level not significantly different from the antigen/adjuvant-loaded NPs. There are several

possible explanations for this observation. One hypothesis is the fact that the formulated NPs

have intrinsic immunogenicity. There is a great debate around the possibility of aliphatic


143

polyester-based particles being able to induce complement activation or other direct effects on

the immune system (287). A study on PLGA MPs and NPs demonstrated potent inflammatory

stimulus after the uptake process with NF-κB translocation to cell nucleus and further pro-

inflammatory cytokine production (290). On the other hand, other study has demonstrated that

empty PLGA MPs did not induced significant maturation and did not affect the capacity of

DCs to respond to a maturation-inducing cocktail afterwards (291). We do not exclude the

possibility of some contamination with pirogens or endotoxins of some of the bulk material

used to formulate the NPs since it was not possible to get pirogen/endotoxin-free grade for

some of the reagents used. There is also the possibility that plain NPs increased the

immunogenicity of serum proteins present in the cell culture medium due to adsorption of

those proteins to the NPs during the incubation period and consequent increase of their

internalization. We also hypothesized that BMDCs are more susceptible in vitro to the effects

of external factors since we also verified that untreated cells also have a basal expression of

the costimulatory factors and they downregulate the expression the MR/CD206.

In conclusion, it was possible to observe that NPs are able to induce the upregulation

of the costimulatory factors CD40 and CD86, mainly when NPs were functionalized with

mannose. However, some of the results obtained, such as the low effect of TLR ligand-loaded

NPs and the high stimulation caused by empty NPs, were not expected. We conclude that the

full potentiating effect of the immune response by loaded NPs would be more notorious in

vivo due to the more efficient targeting and internalization of the antigens and adjuvants by

DCs. The real potential of the NP formulations might not be possible to observe in vitro due

to several limitations imposed by the nature of these experiments, such as the limited time of

incubation which might impose limited antigen and immunoadjuvant release from NPs; the

unrealistic environment provided to DCs, which might cause some basal level of maturation;

and the absence of the in vivo complex environment, which might further enhance the

importance of using antigen- and immunoadjuvant-loaded NPs over those molecules in

solution.

Chapter 4

Integrative discussion

147

Chapter 4 - Integrative discussion

Despite the fact that more than a century has passed from the first observations of the

active role of the immune system in combating cancer, very few immunotherapeutic strategies

have been approved to clinical use. Some of the clinical trials of the first cancer vaccines have

provided evidence of clinical benefit thus encouraging the development of other vaccines. The

identification and characterization of the antigens to be targeted, the definition of the desired

immune response to be elicited by a vaccine, and the choice of the appropriate vaccine

delivery system, are among the main difficulties drawing vaccine development back. An

optimistic perspective would see that there is an enormous amount of information and

techniques available for guiding vaccine development in the context of cancer

immunotherapy. Several TAAs have been identified and can be produced in large scale by

recombinant techniques, either as fusion proteins in bacterial or other systems, or as soluble

molecules in eukaryotic systems. Synthetic peptides mimicking immunodominant tumor

antigens to be presented by either class I or class II MHC molecules can also be produced.

Cytokines have been described and there are much more knowledge of how the immune

system functions, in particular how cellular immune responses are generated and how

peptides can be presented. DCs have also been discovered and have shown to play a central

role in generating immune responses in patients with cancer, establishing a bridge between

the innate and the adaptive branches of the immune system. Several methods have also been

applied for the generation of optimal immune responses, such as DNA vaccines, gene therapy,

hybrid cell vaccination, tumor cell vaccination and cell-free vaccines. In addition, there are

several methods of assessing cellular immunity: measuring CTLs, T-cell proliferation,

intracellular and extracellular cytokine production by cells in culture using ELISA or

multiplex and flow cytometry, polyfunctional T-cell assays, ELISPOT and MHC class I/II

tetramers.

Vaccination has had a significant impact in global heath as they permitted the control

of many infectious diseases and the eradication of smallpox (44,45). Although similar in

concept to the more conventional vaccines directed against infectious diseases, cancer

vaccines differ in several critical areas. Cancer vaccines are envisioned to be administered

after the onset or detection of disease thus they would be considered therapeutic rather than

prophylactic vaccines. As many tumor antigens are intracellular proteins rather than cell

surface molecules, cancer vaccines should be designed to elicit cell-mediated immunity rather

Chapter 4

148

then humoral responses. Lastly, the target of most cancer vaccines might be self-molecules

instead of foreign antigens, which raises the concern of whether vaccination will be

sufficiently robust enough to initiate an immune response rather than immunological self-

tolerance (7).

Several vaccine strategies have been evaluated in clinical trials for cancer therapy,

including administration of peptides and proteins mixed with adjuvants, injection of

recombinant viruses or other recombinant microorganisms, delivery of killed tumor cells, or

infusion of protein- or peptide-activated DCs to patients (8).

Since the first clinical trial of a melanoma antigen gene-1 (MAGE-1)-derived peptide-

based vaccine was reported in 1995 (441), several peptide and protein-based vaccines have

reached the clinical trials. The earlier generations of peptide vaccines were composed by one

to several HLA class I-restricted epitope peptides of a single HLA type. Currently, various

types of next-generation peptide vaccines are under development: (i) multivalent long peptide

vaccines; (ii) multi-peptide vaccines consisting of CTL- and helper-epitopes; (iii) peptide

cocktail vaccines; (iv) hybrid peptide vaccines; (v) personalized peptide vaccines; and (vi)

peptide-pulsed DC vaccines (442). Viral vectors, either from non-lytic or oncolytic nature,

expressing TAAs and immunostimulatory molecules, such as cytokines, GM-CSF or

costimulatory molecules, are also being tested in clinical trials. However, the therapeutic

benefit of delivering transgenes using viruses needs to become clearer and easier to define

(443). Tumor cell vaccines have an advantage in that the antigen does not need to be defined

or identified prior to vaccination. However, the mechanisms of action and the relevant target

of the vaccine may be difficult to elucidate. In addition, there may be significant regulatory

and manufacturing issues that will need to be considered before commercialization. Of

particular interest is Melacine, an allogeneic melanoma cell line lysate vaccine combined with

a potent adjuvant. Despite data from phase II clinical trials not indicating a benefit in either

early stage or advanced stage melanoma, these studies conducted to the critical finding that

HLA expression can influence the efficacy of a cancer vaccine (444,445).

Ex vivo loaded DC-based vaccines have been intensively studied over the past decade.

At the time of writing this thesis, 300 clinical trials with DC-based immunotherapies were

registered, not only for cancer therapy but also for other immune-related diseases, such as

HIV infection and type 1 diabetes (446). FDA and EMA have recently approved Sipuleucel-T

as the first DC-based vaccine (Provenge®, Dendreon Corp.) for the therapy of asymptomatic

metastatic castrate-resistant prostate cancer (9). The requirement of leukapheresis and cell

culture processing are pointed out as drawbacks of this strategy, due to its high cost and


149

limited number of vaccinations that can be used. The combination of nanotechnological and

biochemical advances has been pointing out NP-based vaccines as being one possible strategy

to overcome these drawbacks. This strategy focus on loading and activating DCs in vivo, by

targeting antigens and immunoadjuvant molecules to these cells without the need for

isolatation (447).

Since the lecture of Richard Feynman (1959), which is considered the beginning of the

“nanotechnology era”, the outcome of nanomedicines has been modest. The concepts of

antibody-conjugates, liposomes, NPs, and polymer-conjugates stem from the 1970s. These

strategies were seen as competing technologies to the only one that would eventually stand up

as the “magic bullet” for all drug-targeting applications. However, the advantages and

disadvantages of each one have emerged. Antibodies have great potential for selective

targeting but high risk of immunogenicity. Liposomes are able to transport high quantities of

drug, but drug release from the liposomes might be difficult to control and they are prone to

be captured by the RES. Similarly, NPs are also difficult to avoid capture by RES after

intravenous injection. The combination of several technologies in one delivery system is more

likely to lead to its desired performance. Since 1990, several nanomedicines have been

approved for clinical use by regulatory authorities, mostly for cancer therapy, such as

liposomes (e.g. DaunoXome®), polymer-coated liposomes (Doxil®/Caelyx®), polymeric drugs

(Copaxone®), antibodies (Herceptin®, Avastin™) and antibody conjugates (Mylotarg®),

polymer-protein conjugates (Oncaspar®, Neulasta®), and, lately, NPs containing paclitaxel

(Abraxane™) (2). The application of nanomedicines for cancer vaccines and immunotherapy,

or even for vaccine delivery in general, is giving the first steps, and the present research work

was developed aiming to contribute to the acceleration of the process.

The main goal of the research work presented in this thesis was to develop a

melanoma therapeutic vaccine by using biodegradable polymeric NPs to deliver MAAs and

immunoadjuvant molecules and induce an antitumor immune response. As described in

chapter 2, the aim of the study started to be the development of a nanoparticulate delivery

system to target APCs, deliver antigens to be presented by MHC class I (in the endoplasmic

reticulum) and II molecules (in the lysosomes) and potentiate the encounter of

immunoadjuvants with their intracellular receptors. Increase the knowledge on NP-cell

interaction, NP functionalization impact, endocytic pathways and intracellular trafficking was

also under focus. Spherical NPs with ~130 nm were produced in a reproducible way. It was

possible to produce also NPs functionalized with mannose residues, which were available for

binding at NP surface. The study provided insight on the different NP internalization profiles

Chapter 4

150

by immortalized APCs and primary BMDCs as well as on the multiple endocytic pathways

that were involved in NP internalization. NPs demonstrated both an endo-lysosomal and

cytosolic localizations and a tendency to accumulate nearby the ER. This system may provide

intracellular access to immunoadjuvants and drive antigens to be presented by both MHC

class I and II molecules to CD8+ and CD4+ T cells, and consequently it has potential to induce

a complete and coordinated immune response. This preliminary research provided sufficient

information to go a step further and test the developed NPs as a cancer vaccine delivery

system in a preclinical context.

In chapter 3, we report the results of the preclinical evaluation of the developed cancer

immunotherapy strategy by using biodegradable polymeric NPs to target TAAs and TLR

ligands to APCs and induce an antitumor immune response. We were able to produce 140 –

190 nm NPs, either plain or functionalized with mannose residues, that could successfully

coentrap various antigens and immunoadjuvants. Several factors that could affect the

performance of the vaccine and have an impact on the antitumor immune response were

evaluated, such as (i) the importance of using a NPs for vaccine delivery; (ii) the impact of

mannose-functionalization of NPs for active targeting of APCs; (iii) the potential synergy

between two TLR ligands; (iv) the impact of the combination of two peptide antigens either in

separated or in the same NP; and (v) the effect of using a combination of NPs containing

MHC class I- and class II-restricted peptides.

As mentioned in the section “Aim and outline of the thesis”, throughout the

development of this work, several questions were raised. The answers to these questions were

addressed throughout this manuscript and summarily presented here:

1. Is it possible to produce biodegradable polymeric NPs with the desired

physicochemical characteristics in a reproducible way? Is was possible to produce

biodegradable polymeric NPs in a reproducible way with the desired physicochemical

characteristics for cancer vaccine delivery, such as a mean diameter around 150 nm, zeta

potential close to neutrality at pH 7.4 and spherical morphology. A mean diameter aroud 150

nm was desired primarly because it is known that NPs with diameters up to 150 nm seem to

be mainly taken up via CME and tend to generate a virus-like immune response with

activation of CTLs and T helper (Th) 1 cells (300). Moreover, NPs up to 200 nm are able to

travel through the lymphatic system after peripheral injection and arrive directly to the lymph

nodes, where a high number of DCs can be found. NPs with zeta potential close to neutrality

at physiologic pH were desired because highly negative NPs might be repulsed from the

negatively charged plasma membranes, highly positively charged NPs are generally very


151

toxic due to high penetration in plasma membranes and neutral NPs are more prone to

aggregate. The slightly negatively zeta potential verified for the produced NPs is likely to

contribute to the high internalization levels obtained, the low tocxicity verified and the

absence of aggregation of NPs over time.

2. Can biodegradable polymeric NPs entrap MAAs and immunoadjuvant

molecules? The produced NPs were able to entrap several MAAs (Melan-A:26-35(27L),

gp100:209-217(2M) and gp100:44-59) and immunoadjuvant molecules (Poly(I:C) and CpG)

in appropriate quantities for in vivo use (20 a 40 µg of antigen and 7 a 11 µg of adjuvant per

mg of polymer). The obtained loadings ensured the immunization of mice with the standard

doses mostly referred in literature (100 µg, 40 µg of Poly(I:C) and 20 µg of CpG) delivered in

4 mg of NPs, which demonstrated to be easily administered subcutaneously and well

tolerated.

3. Can biodegradable polymeric NPs target and be internalized by APCs? The

produced NPs demonstrated to be internalized by APCs of different natures. To the best of

our knowledge this was the first time that the profile of NP internalization by immortalized

and primary APCs was compared. The observation that immortalized APCs (DCs and

macrophages) and primary DCs have distinct patterns of NP internalization might contribute

to the awareness of the scientific community for the impact of the chosen models to the

outcome of the experiment. Mannose functionalization of NPs revealed to increase the in vivo

efficacy of the nanoparticulate vaccines. However, in vitro it increased internalization by

immortalized cell lines but not by primary DCs. Once again, this observation reinforces the

difficulty of translation of the observations made in vitro to the preclinical and clinical reality.

4. Which endocytic mechanisms are involved in the internalization of the NPs?

Several endocytic mechanisms demonstrated to be involved in the internalization of the NPs

by DCs, namely macropinocytosis, clathrin-mediated endocytosis, caveolin- and lipid raft-

dependent endocytosis. Successful navigation of the endocytic pathways is usually a

prerequisite to the achievement of the intracellular targets of nanomedicines, with

simultaneous reduced access to sites of toxicity (448). When targeting APCs for the activation

of the immune system, considerations about size, endocytic pathways and final immune

response must come together. Each endocytic pathway seems to be defined by a specific size

range of the engulfed soluble or particulate material and apparently drives the activation of a

specific branch of the immune system (298,299). The fact that multiple endocytic pathways

seem to be involved in the internalization of the produced NPs might be related with the fact,

even that NPs present low PdI and are a monodispersed population in terms of diameter, there

Chapter 4

152

are still some variability of the NP size. It is possible that the narrow size distribution of NP

population is heterogeneous enough to activate distinct endocytic pathways. On the other end,

it might also be utopical to think that only one endocytic pathway is activated by one single

particulate entity. It is well know that macropinocytosis is a constitutive process in DCs (415).

As so, it has a great probability of being involved in NP internalization by these cells. It is

also likely, that specific physicochemical features of NPs, such as size, shape and charge, also

contribute to the activation of other(s) endocytic pathways. Despite the high number of

nanoparticulate systems under research, there is still a lack of knowledge on the kinetics of

these systems at the cellular level. There is a need to use endocytosis-relevant clinical

biomarkers to better select those patients most likely to benefit from nanomedicine therapy

since it is becoming evident that endocytic pathways are disregulated in many diseases and

this has the potential to significantly impact nanomedicine performance in terms of safety and

efficacy (448).

5. Once internalized by APCs, which are the intracellular traffic and final fate of the

NPs? The knowledge of the endocytic pathways involved in NP internalization provides

information that can help to predict if NPs can achieve the desired final intracellular target.

However, only the observation of their intracellular traffic can confirm that. The produced

NPs demonstrated both an endo-lysosomal and cytosolic localizations and a tendency to

accumulate nearby the ER overtime. This pattern of intracellular traffic allowed the prediction

that this nanosystem could provide intracellular access to the immunoadjuvants CpG and

Poly(I:C), which receptors are located at the endosomal membrane, and also drive antigens to

be presented by both MHC class I (in the ER) and II (in lysosomes) molecules to CD8+ and

CD4+ T cells leading to a complete and coordinated immune response. The knowledge of the

intracellular traffic and final fate of particulate delivery systems constitutes an important and

underrated tool to evaluate the potential of these systems and support rational decisions

concerning the choice of the best systems to each application.

6. Which is the profile of the immune response induced by NPs entrapping antigens

and immunoadjuvants? The transgenic mice model OT II allowed the characterization of the

profile of the immune responses induced by NPs and the impact of coentrapping the

immunoadjuvants CpG and Poly(I:C) with the antigen as well as the effect of mannose

functionalization on the final outcome. The fact that this mice model provides CD4+ T cell

homogeneity avoids unspecific immune response bias in the characterization of immune

response profiles in terms Th1/Th2 balance (436). This study supported three valuable

conclusions that confirm the observations made by others. Firstly, NPs improved the vaccine


153

outcome of the antigen and adjuvants administered in solution, as verified before (3,169,449).

Secondly, the immunoadjuvants CpG and Poly(I:C) coentrapped with the antigen in NPs

reverted a Th2-biased immune response to a long lasting Th1 profile. It has been verified

before that NPs coentrapping TLR ligands along with the antigens induced better immune

responses than the NPs containing only the antigen (165–167,169,170,449). Thirdly, mannose

functionalization of NPs further improved the vaccine outcome, as also verified before

(339,434). This study might seem redundant since the information collected only confirms

others’ observations. However, when developing a new nanoparticulate delivery system for

biomedical applications, assumptions should be avoided since there are several factors that

can affect the performance of these systems, from physicochemical properties to the models

and conditions used to test them.

7. Can NPs induce an antitumor immune response? Different NP-based

immunizations were tested in a melanoma murine model, either in a therapeutic (after tumor

challenge) or prophylactic settings (before tumor challenge). All the NP-based vaccines

reduced the tumor growth rate when compared to the antigens and adjuvants administered in

solution. NP formulations also induced higher levels of granzyme B production by

splenocytes, higher splenocyte proliferation, higher CD3+CD4+ and CD3+CD8+ splenocyte

frequencies and higher production of IFN-γ and IL-2 by restimulated splenocytes. Given that,

it is possible to conclude that NP-based vaccines are able to induce an antitumor immune

response. It is important to keep in mind that cancer vaccine research aims to develop

therapeutic strategies for cancer rather than prophylactic vaccines. However, the high tumor

growth rate of mice tumor models might not allow the development of the antitumor immune

response to its greater extension since this process might take longer than the tumor

development. Moreover, the melanoma model used (B16F10) is highly aggressive and

metastatic. This cell line is obtained from ten repeated passages of lung colonies obtained

from C57Bl6 mice after their intravenous injection with the murine epithelial melanoma

B16F0 cell line (ATCC) (450). These limitant aspects of the animal models available for the

preclinical development justify the application of the NP formulations in a prophylactic

setting, in an attempt to increase the time for the immune response development before the

invasiveness of the tumor reaches a level that compromises the immune system of the animals

under test.

8. Which is the impact of the coentrapment of different MAAs and immunoadjuvant

molecules in the antitumor response induced by the NPs? To the best of our knowledge this is

the first time that several antigens are coentrapped in the same nanoparticulate delivery

Chapter 4

154

system and tested as a cancer vaccine. This research provides valuable information on the

impact of combining several antigens in the same NP or in separated NPs. It was possible to

observe that the coentrapment of Melan-A:26-35(27L) and gp100:209-217(2M) in the same

NP (man-NP[M+G209+P+C]) had a detrimental effect in the antitumor immune response. On

the other hand, when the peptides were administered in separated NPs (man-NP(M+P+C] +

man-NP[G209+P+C]), there was an improvement of the antitumor response relatively to the

use of only one peptide. The presence of both antigens in the same NP, and consequently, in

the same APC, could induce competition to the MHC class I complexes (437). However,

when the antigens are carried by different NPs, the chances that they are processed by

different APCs increase, and a stronger antitumor immune response was induced. This

information might contribute to the successful design of effective particulate vaccines in the

future. The present research also took insight on the impact of combining MHC class I- and

class II-restricted peptides in the immunization regimens. Even that the induction of CTLs is

the primary goal in antitumor immunization, it is well established that CD8+ lymphocytes can

fail to maintain functionality in the absence of CD4+ T helper cells (193). As so, it would

make sense to combine both types of antigens in an attempt to activate both CD8+ and CD4+

T cells. However, there are very few studies combining MHC class I- and class II-restricted

peptides for antitumor immunization, probably due to the late identification of MHC class II-

restricted tumor peptides (451). Surprisingly, Phan G. (2003) and coworkers verified that the

addition of the class II peptide appeared to decrease immunologic response of circulating

PBMC to the class I-restricted peptide (452). The authors hypothesized that this unexpected

result could have involved increased CD4+CD25+ Treg activity, a possible increased

apoptosis of activated CD8+ T cells, the trafficking of sensitized CD8+ reactive cells out of the

peripheral blood or even bias in the sequential, nonrandomized nature of patient enrollment. It

has also been demonstrated that the peptide Melan-A:26-35(27L) could elicit peptide-specific

CTLs in the absence of a Th peptide due to its increased immunogenicity resultant from the

single aminoacid modification (453). However, it remained to be proven if the presence of a

Th peptide would not further improve the immune response obtained. The present research

demonstrates that mice immunized with a combination of NPs containing either the MHC

class I-restricted peptide Melan-A:26-35(27L) either the MHC class II-restricted peptide

gp100:44-59 (man-NP[M+P+C] + man-NP[G44+P+C]) had a very significant reduction of the

tumor growth rate and improved the overall immune response comparing to mice that

received either only one MHC class I-restricted peptide (man-NP[M+P+C]) either two MHC

class I-restricted peptides entrapped in separated NPs (man-NP(M+P+C] + man-


155

NP[G209+P+C]). These results reinforce the fact that activation of CD4+ T might be an

advantageous strategy for the induction of potent antitumor immune responses.

Chapter 5

General conclusions & future perspectives

159

Chapter 5 - General conclusions & future perspectives

The research work described in this thesis highlights the potential of NPs, in particular

those constituted by biodegradable aliphatic polyesters, for use as cancer vaccines to target

tumor antigens and adjuvants to DCs for priming antigen-specific T cell responses. Improved

understanding of the role of the immune system in controlling tumor growth and recent

developments in the field of nanoparticulate cancer vaccines have created a degree of

knowledge that promises to lead to favorable results with this approach in a near future.

However, there are still more limitations in the knowledge of the pathways of cancer immune

evasion rather than in the ability to develop new vaccines and immunotherapies capable of

addressing them. Notably, it is clear that preclinical model systems can be poorly predictive

of clinical challenges, with promising preclinical results often not translating into patient

survival benefits. This may be due, at least in part, to the genetic diversity of the outbred

human population, presenting highly heterogeneous malignancies, but may also reflect

qualitative differences between slow-growing clinical disease and the rapidly growing

transplantable tumors that are often used in murine models.

Tumor vaccines might have the capacity to combat already established malignant

disease, but it must be kept in mind that the success of immunological strategies will correlate

with the stage of the disease. The ideal scenario for the application of a therapeutic cancer

vaccine might be minimal residual disease with low numbers of aberrant or cancer stem cells,

where the actively induced immune mechanisms would have a fair chance to prevent tumor

relapse through reduction of circulating tumor cells and micrometastases. The determination

of the stage of disease has been prioritized over immune stage of the host. The evaluation of

individual host immunity should be considered in the selection of the most appropriate

treatment protocols.

To shift favorably the balance between anticancer effector cells and tumor-induced

immune suppression, cancer vaccines might be more effective in combination with other

therapeutic strategies (454). In theory, the combined use of different approaches to cancer

therapy may reduce the probability of resistance to emerge. Also, it might improve drug

tolerability when different approaches are used sequentially (455). The concomitant

administration of cytotoxic agents and cancer vaccines has been previously avoided due to

potential immune suppression by chemotherapeutics. However, evidences started to point out

that common chemotherapy agents positively influence adaptive and innate antitumor

Chapter 5

160

immune responses and also provide the tumor burden reduction needed for the cancer vaccine

to overcome tumor suppression (456,457). More recently, the use of metronomic

chemotherapy (low-dose chemotherapeutics at short intervals) has demonstrated to promote

tumor eradication not only exerting an antiangiogenic activity but also by stimulating

anticancer immunity and selectively eliminating immunosuppressive cells, while toxicity is

maintained to a mild and short-lived level (458). Cancer vaccines could also beneficiate from

their combination with the new targeted therapies (vemurafenib, dabrafenib and trametinib) or

the immune checkpoint inhibitor of CTLA-4 ipilimumab. There are evidences that targeted

therapies decrease production of the immunosuppressive factor IL-10 and enhance expression

of tumor-specific antigens creating a favorable environment for the action of immunotherapy

(459).

When analysing the main barriers for cancer vaccine efficacy presented on Table 1.2.,

the developed strategy might be able to revert some of them. The developed NP-based

vaccine might contribute to overcome the fact that MHC class I molecules are down-regulated

in most tumor cells and consequently they do not constitute good antigen sources for

presentation to DCs. Tumor cells can even be able to present directly their antigens to T cells

but will rather induce tolarization of T cells due to the lack of effective costimulation (75). T

cell ignorance to tumor antigens due to its “self” nature might be also reverted by the

developed strategy as it potentiate the proper activation of DCs and consequently an

immunostimulatory environment for DC-T cell contact, which might overcome the

“ignorance” threshold of T cells. Helpless CTLs are not long lasting and die early in the

absence of CD4+ helper T cells (26). The fact that NPs have great versatility in terms of the

molecules that can be loaded into their matrix allows the combination of MHC class I- and

class II-restricted peptides in the same immunization regimen, which was translated in a very

high tumor growth rate reduction.

Notwithstanding all these promising advantages of the developed antitumor vaccine,

there are still bigger challenges related to T-cell or tumor cell biology that need to be

considered. For instance, if tumor cells “edit” their immunologic print, they can avoid

immunosurveillance and recognition by activated T cells. As so, it might be necessary to use

personalized vaccination to select the antigens with higher CTL precursor frequency and

adequate the vaccine composition to the patient. Also, the sustained release over time that

polymeric NPs can provide to the entrapped molecules is pointed out as one of their

advantages for vaccine delivery. However, it is also known that the chronic presence of tumor

antigens can induce T cell exhaustion by activation of the programmed death-1 (PD-1)

General conclusions & future perspectives

161

molecule on T cells that ultimately leads to T cell death (79). As so, further studies should be

conducted in order to analyze the in vivo kinetics and biodynamics of the antigens and

adjuvants entrapped in biodegradable NPs. The tumor microenvironment in solid tumors is an

immunoregulatory network composed by malignant cells surrounded by a tumor-conditioned

stroma that contains extracellular matrix and a variety of nonmalignant populations, including

myeloid cells, lymphocytes, fibroblasts, and endothelial cells (71). It is likely that successful

antitumor immunotherapeutic strategies encompass the targeting of the immune cells within

the tumor microenvironment to revert their state of anergy and tumor tolerance and effectively

destroy tumor cells. These strategies might include the combination of NP functionalization

with tumor-specific targeting ligands or antibodies along with the delivery of

immunostimulatory molecules.

In spite of the great advances in vaccinology over the last century, a number of

problems still remain. There are a considerable number of infectious diseases for which an

effective vaccine has not been developed such as HIV, malaria and tuberculosis. Also, the

currently approved vaccines have weaknesses in several aspects: (i) inadequacy for specific

populations such as newborns, elderly and immunocompromised individuals; (ii) long-term

maintenance of both effector and central memory; (iii) adjuvants capable of selectively

stimulating distinct cell types and induce the immune response with the desired profile; and

(iv) alternative immunization routes with feasibility for massive vaccination of populations,

namely in subdeveloped countries, such as mucosal immunization. Recent developments in

the field of particulate delivery systems has alerted to their great potential as

immunomodulation tools not only for cancer therapy but also for vaccination against

infectious diseases and other diseases where the immune system plays a prominent role, such

allergy and autoimmune diseases. The long history of use of aliphatic polyesters for

biomedical applications has proven their safety and flexibility for modification and

functionalization. Particulate vaccine delivery systems based on these polymers have

demonstrated promising results and several advantages over the currently available strategies.

Nevertheless, several questions remain unanswered and difficulties need to be overcome.

These difficulties are both related to the vaccine development process - need for validated

methods to clinically evaluate new vaccine strategies, selection of most relevant antigens and

epitopes, determination of the optimal target population, doses and schedules - as well as with

the particulate delivery systems – determination of whole body and cellular pharmacokinetics,

stability, drug release rates and translation to clinic.

Chapter 5

162

The present research work reports the successful development of biodegradable

polymeric NPs with great potential to be used as a vaccine delivery system. It was possible to

prove this concept in a cancer immunotherapy strategy by using the developed biodegradable

polymeric NPs to target TAAs and TLR ligands to APCs and induce an antitumor immune

response. The present work contributes with valuable information on several factors that can

affect the performance of a vaccine, such as (i) the fact that coentrapment of antigens and

immunoadjuvants in NPs demonstrated to be essential to induce a long lasting Th1 immune

response; (ii) the fact that mannose functionalization of NPs improved NP performance in

terms of the desired Th1/antitumor immune response; (iii) the fact that the immunoadjuvants

CpG and Poly(I:C) demonstrated to exert a synergistic effect when coentrapped in NPs; (iv)

the fact that immunization with two MHC class I-restricted MAAs in separated man-NPs was

slightly superior comparing to when only one antigen was used; (v) the fact that the use of

two MHC class I-restricted MAAs coentrapped in the same man-NPs demonstrated to have a

detrimental effect on the antitumor immune response; and (vi) the fact that the combination of

man-NPs containing either a MHC class I- or class II-restricted MAAs along with both

immunoadjuvants demonstrated the most potent antitumor immune response, suggesting the

importance of the activation of both CD4+ and CD8+ T cells in the efficacy of the antitumor

immune response. This information will certainly contribute to the improvement of the

development of novel immunization approaches, not only for cancer therapy but also for other

diseases where the immune system plays a central role. The field of particulate vaccine

delivery systems is rapidly evolving moment by moment and those based on aliphatic

polyester polymers are closer to make a major contribution to improved vaccinology, cancer

therapy and immunotherapy in the 21st century.

References

163

References

1. Hubbell JA, Thomas SN, Swartz MA. Materials engineering for immunomodulation. Nature. 2009;462(7272):449–60.

2. Duncan R, Gaspar R. Nanomedicine (s) under the Microscope. Mol Pharm. 2011;8(6):2101–41.

3. Schlosser E, Mueller M, Fischer S, Basta S, Busch DH, Gander B, et al. TLR ligands and antigen need to be coencapsulated into the same biodegradable microsphere for the generation of potent cytotoxic T lymphocyte responses. Vaccine. 2008;26(13):1626–37.

4. Begley J, Ribas A. Targeted therapies to improve tumor immunotherapy. Clin Cancer Res. 2008;14(14):4385–91.

5. Dimberu PM, Leonhardt RM. Cancer immunotherapy takes a multi-faceted approach to kick the immune system into gear. Yale J Biol Med. 2011;84(4):371–80.

6. Speiser DE, Romero P. Molecularly defined vaccines for cancer immunotherapy, and protective T cell immunity. Semin Immunol. 2010;22(3):144–54.

7. Henderson RA, Mossman S, Nairn N, Cheever MA. Cancer vaccines and immunotherapies: emerging perspectives. Vaccine. 2005;23(17-18):2359–62.

8. Schlom J. Therapeutic Cancer Vaccines: Current Status and Moving Forward. JNCI J Natl Cancer Inst. 2012;104(8):599–613.

9. Kantoff PW, Higano CS, Shore ND, Berger ER, Small EJ, Penson DF, et al. Sipuleucel-T immunotherapy for castration-resistant prostate cancer. N Engl J Med. 2010;363(5):411–22.

10. Markovic SN, Erickson LA, Rao RD, McWilliams RR, Kottschade LA, Creagan ET, et al. Malignant melanoma in the 21st century, part 1: epidemiology, risk factors, screening, prevention, and diagnosis. Mayo Clin Proc. 2007;82(3):364–80.

11. NCCN. NCCN Guidelines for Patients - Melanoma, Version 1.2014. National Comprehensive Cancer Network; 2014.

12. Melanoma Skin Cancer [Internet]. American Cancer Society. 2014. Obtido de: http://www.cancer.org/cancer/skincancer-melanoma/detailedguide/melanoma-skin-cancer-key-statistics

13. Markovic SN, Erickson LA, Rao RD, Weenig RH, Pockaj BA, Bardia A, et al. Malignant melanoma in the 21st century, part 2: staging, prognosis, and treatment. Mayo Clin Proc. 2007;82(4):490–13.

14. Yang AS, Chapman PB. The history and future of chemotherapy for melanoma. Hematol Oncol Clin North Am. 2009;23(3):583–97.

15. Olszanski AJ. Current and future roles of targeted therapy and immunotherapy in advanced melanoma. J Manag Care Pharm JMCP. 2014;20(4):346–56.

16. Benlalam H, Labarrière N, Linard B, Derré L, Diez E, Pandolfino MC, et al. Comprehensive analysis of the frequency of recognition of melanoma associated antigen (MAA) by CD8

164

melanoma infiltrating lymphocytes (TIL): implications for immunotherapy. Eur J Immunol. 2001;31(7):2007–15.

17. Barnetson R, Halliday G. Regression in skin tumours: a common phenomenon. Australas J Dermatol. 1997;38(Suppl 1):S63–65.

18. Rao UN, Lee SJ, Luo W, Mihm MC, Kirkwood JM. Presence of tumor-infiltrating lymphocytes and a dominant nodule within primary melanoma are prognostic factors for relapse-free survival of patients with thick (t4) primary melanoma: pathologic analysis of the e1690 and e1694 intergroup trials. Am J Clin Pathol. 2010;133(4):646–53.

19. Yaziji H, Gown AM. Immunohistochemical markers of melanocytic tumors. Int J Surg Pathol. 2003;11(1):11–5.

20. Nicholas C, Lesinski GB. Immunomodulatory cytokines as therapeutic agents for melanoma. Immunotherapy. 2011;3(5):673–90.

21. Vujanovic L, Butterfield LH. Melanoma cancer vaccines and anti-tumor T cell responses. J Cell Biochem. 2007;102(2):301–10.

22. Rosenberg SA, Yang JC, Restifo NP. Cancer immunotherapy: moving beyond current vaccines. Nat Med. 2004;10(9):909–15.

23. Weiss SA, Chandra S, Pavlick AC. Update on vaccines for high-risk melanoma. Curr Treat Options Oncol. 2014;15(2):269–80.

24. Huang Y, Shah S, Qiao L. Tumor resistance to CD8+ T cell-based therapeutic vaccination. Arch Immunol Ther Exp Warsz. 2007;55(4):205–17.

25. Ahlers JD, Belyakov IM. Memories that last forever: strategies for optimizing vaccine T-cell memory. Blood. 2010;115(9):1678–9.

26. Kennedy R, Celis E. Multiple roles for CD4+ T cells in anti tumor immune responses. Immunol Rev. 2008;222(1):129–44.

27. Walsh KP, Mills KHG. Dendritic cells and other innate determinants of T helper cell polarisation. Trends Immunol. Novembro de 2013;34(11):521–30.

28. Nishimura T, Iwakabe K, Sekimoto M, Ohmi Y, Yahata T, Nakui M, et al. Distinct role of antigen-specific T helper type 1 (Th1) and Th2 cells in tumor eradication in vivo. J Exp Med. 1999;190(5):617–27.

29. Becker Y. Molecular immunological approaches to biotherapy of human cancers-a review, hypothesis and implications. Anticancer Res. 2006;26(2A):1113–34.

30. Gilboa E. The promise of cancer vaccines. Nat Rev Cancer. 2004;4(5):401–11.

31. Rossi M, Young JW. Human dendritic cells: potent antigen-presenting cells at the crossroads of innate and adaptive immunity. J Immunol. 2005;175(3):1373–81.

32. Merad M, Manz MG. Dendritic cell homeostasis. Blood. 2009;113(15):3418–27.

33. Takeuchi O, Akira S. Pattern recognition receptors and inflammation. Cell. 2010;140(6):805–20.

References

165

34. Gajewski TF, Fuertes MB, Woo S-R. Innate immune sensing of cancer: clues from an identified role for type I IFNs. Cancer Immunol Immunother. 2012;61(8):1343–7.

35. Delamarre L, Pack M, Chang H, Mellman I, Trombetta ES. Differential lysosomal proteolysis in antigen-presenting cells determines antigen fate. Science. 2005;307(5715):1630–4.

36. Kadowaki N. Dendritic cells: a conductor of T cell differentiation. Allergol Int. 2007;56(3):193–9.

37. Martín-Fontecha A, Sebastiani S, Höpken UE, Uguccioni M, Lipp M, Lanzavecchia A, et al. Regulation of Dendritic Cell Migration to the Draining Lymph Node. J Exp Med. 2003;198(4):615–21.

38. Palucka AK, Ueno H, Fay J, Banchereau J. Dendritic cells: a critical player in cancer therapy? J Immunother. 2008;31(9):793–805.

39. Hillaireau H, Couvreur P. Nanocarriers’ entry into the cell: relevance to drug delivery. Cell Mol Life Sci. 2009;66(17):2873–96.

40. Raghavan M, Del Cid N, Rizvi SM, Peters LR. MHC class I assembly: out and about. Trends Immunol. 2008;29(9):436–43.

41. Hwang I, Ki DL. Receptor-mediated T cell absorption of antigen presenting cell-derived molecules. Front Biosci. 2011;16:411–21.

42. Takeuchi S, Furue M. Dendritic cells: ontogeny. Allergol Int. 2007;56(3):215–23.

43. Muranski P, Restifo NP. Adoptive immunotherapy of cancer using CD4+ T cells. Curr Opin Immunol. 2009;21(2):200–8.

44. Verardi PH, Titong A, Hagen CJ. A vaccinia virus renaissance: new vaccine and immunotherapeutic uses after smallpox eradication. Hum Vaccin Immunother. 2012;8(7):961–70.

45. Ravanfar P, Satyaprakash A, Creed R, Mendoza N. Existing antiviral vaccines. Dermatol Ther. 2009;22(2):110–28.

46. Riedel S. Edward Jenner and the history of smallpox and vaccination. Proc Bayl Univ Med Cent. 2005;18(1):21–5.

47. Plotkin SA. History of Vaccine Development. Plotkin SA, editor. New York, NY: Springer New York; 2011. 364 p.

48. Waldmann TA. Immunotherapy: past, present and future. Nat Med. 2003;9(3):269–77.

49. Lundin JI, Checkoway H. Endotoxin and cancer. Env Health Perspecs. 2009;117(9):1344–50.

50. Vacchelli E, Martins I, Eggermont A, Fridman WH, Galon J, Sautès-Fridman C, et al. Trial watch: Peptide vaccines in cancer therapy. Oncoimmunology. 2012;1(9):1557–76.

51. Malyala P, O’Hagan DT, Singh M. Enhancing the therapeutic efficacy of CpG oligonucleotides using biodegradable microparticles. Adv Drug Deliv Rev. 2009;61(3):218–25.

52. Krishnamachari Y, Geary SM, Lemke CD, Salem AK. Nanoparticle Delivery Systems in Cancer Vaccines. Pharma Res. 2011;28(2):215–36.

166

53. Matera L. The choice of the antigen in the dendritic cell-based vaccine therapy for prostate cancer. Cancer Treat Rev. 2010;36(2):131–41.

54. Van der Bruggen P, Traversari C, Chomez P, Lurquin C, De Plaen E, Van den Eynde BJ, et al. A gene encoding an antigen recognized by cytolytic T lymphocytes on a human melanoma. J Immunol. 2007;178(5):2617–21.

55. Novellino L, Castelli C, Parmiani G. A listing of human tumor antigens recognized by T cells: March 2004 update. Cancer Immunol Immunother. 2005;54(3):187–207.

56. Zhao L, Liu Z, Fan D. Overview of mimotopes and related strategies in tumor vaccine development. Expert Rev Vaccines. 2008;7(10):1547–55.

57. Parmiani G, Castelli C, Dalerba P, Mortarini R, Rivoltini L, Marincola FM, et al. Cancer immunotherapy with peptide-based vaccines: what have we achieved? Where are we going? J Natl Cancer Inst. 2002;94(11):805–18.

58. Higgins JP, Bernstein MB, Hodge JW. Enhancing immune responses to tumor-associated antigens. Cancer Biol Ther. 2009;8(15):1440–9.

59. Pejawar-Gaddy S, Rajawat Y, Hilioti Z, Xue J, Gaddy DF, Finn OJ, et al. Generation of a tumor vaccine candidate based on conjugation of a MUC1 peptide to polyionic papillomavirus virus-like particles. Cancer Immunol Immunother. 2010;59(11):1685–96.

60. Dalerba P, Cho RW, Clarke MF. Cancer stem cells: models and concepts. Annu Rev Med. 2007;58:267–84.

61. Andersen MH, Svane IM, Becker JC, Straten PT. The universal character of the tumor-associated antigen survivin. Clin Cancer Res. 2007;13(20):5991–4.

62. Liao Z-L, Tang X-D, Lü M-H, Wu Y-Y, Cao Y-L, Fang D-C, et al. Antitumor effect of new multiple antigen peptide based on HLA-A0201-restricted CTL epitopes of human telomerase reverse transcriptase (hTERT). Cancer Sci. 2012;103(11):1920–8.

63. Parmiani G, Russo V, Marrari A, Cutolo G, Casati C, Pilla L, et al. Universal and stemness-related tumor antigens: potential use in cancer immunotherapy. Clin Cancer Res. 2007;13(19):5675–9.

64. Anichini A, Molla A, Mortarini R, Tragni G, Bersani I, Di Nicola M, et al. An expanded peripheral T cell population to a cytotoxic T lymphocyte (CTL)-defined, melanocyte-specific antigen in metastatic melanoma patients impacts on generation of peptide-specific CTLs but does not overcome tumor escape from immune surveillance in metastatic lesions. J Exp Med. 1999;190(5):651–67.

65. Maeda Y, Hida N, Niiya F, Katagiri K, Harada M, Yamana H, et al. Detection of peptide-specific CTL-precursors in peripheral blood lymphocytes of cancer patients. Br J Cancer. 2002;87(7):796–804.

66. Noguchi M, Sasada T, Itoh K. Personalized peptide vaccination: a new approach for advanced cancer as therapeutic cancer vaccine. Cancer Immunol Immunother. 2012;62(5):919–29.

67. Sensi M, Anichini A. Unique tumor antigens: evidence for immune control of genome integrity and immunogenic targets for T cell-mediated patient-specific immunotherapy. Clin Cancer Res. 2006;12(17):5023–32.

References

167

68. Itoh K, Yamada A. Personalized peptide vaccines: a new therapeutic modality for cancer. Cancer Sci. 2006;97(10):970–6.

69. Poland GA, Kennedy RB, Ovsyannikova IG. Vaccinomics and Personalized Vaccinology: Is Science Leading Us Toward a New Path of Directed Vaccine Development and Discovery? Rall GF, editor. PLoS Pathog. 2011;7(12):e1002344.

70. Crespo J, Sun H, Welling TH, Tian Z, Zou W. T cell anergy, exhaustion, senescence, and stemness in the tumor microenvironment. Curr Opin Immunol. 2013;25(2):214–21.

71. Gajewski TF, Meng Y, Blank C, Brown I, Kacha A, Kline J, et al. Immune resistance orchestrated by the tumor microenvironment. Immunol Rev. 2006;213:131–45.

72. Lesterhuis WJ, Haanen JB, Punt CJ. Cancer immunotherapy–revisited. Nat Rev Drug Discov. 2011;10(8):591–600.

73. Aleksic M, Liddy N, Molloy PE, Pumphrey N, Vuidepot A, Chang K-M, et al. Different affinity windows for virus and cancer-specific T-cell receptors: implications for therapeutic strategies. Eur J Immunol. 2012;42(12):3174–9.

74. Hebeisen M, Baitsch L, Presotto D, Baumgaertner P, Romero P, Michielin O, et al. SHP-1 phosphatase activity counteracts increased T cell receptor affinity. J Clin Invest. 2013;123(3):1044–56.

75. Mapara MY, Sykes M. Tolerance and cancer: mechanisms of tumor evasion and strategies for breaking tolerance. J Clin Oncol. 2004;22(6):1136–51.

76. Ray S, Chhabra A, Mehrotra S, Chakraborty NG, Ribas A, Economou J, et al. Obstacles to and opportunities for more effective peptide-based therapeutic immunization in human melanoma. Clin Dermatol. 2009;27(6):603–13.

77. Prado-Garcia H, Romero-Garcia S, Aguilar-Cazares D, Meneses-Flores M, Lopez-Gonzalez JS. Tumor-induced CD8+ T-cell dysfunction in lung cancer patients. Clin Dev Immunol. 2012;2012:741741.

78. Mehrotra S, Chhabra A, Chattopadhyay S, Dorsky DI, Chakraborty NG, Mukherji B. Rescuing melanoma epitope-specific cytolytic T lymphocytes from activation-induced cell death, by SP600125, an inhibitor of JNK: implications in cancer immunotherapy. J Immunol. 2004;173(10):6017–24.

79. Mumprecht S, Schürch C, Schwaller J, Solenthaler M, Ochsenbein AF. Programmed death 1 signaling on chronic myeloid leukemia-specific T cells results in T-cell exhaustion and disease progression. Blood. 2009;114(8):1528–36.

80. Zielinski C, Knapp S, Mascaux C, Hirsch F. Rationale for targeting the immune system through checkpoint molecule blockade in the treatment of non-small-cell lung cancer. Ann Oncol. 2013;24(5):1170–9.

81. Lindau D, Gielen P, Kroesen M, Wesseling P, Adema GJ. The immunosuppressive tumour network: myeloid-derived suppressor cells, regulatory T cells and natural killer T cells. Immunology. 2013;138(2):105–15.

82. Morita R, Hirohashi Y, Sato N. Depletion of Tregs in vivo: a promising approach to enhance antitumor immunity without autoimmunity. Immunotherapy. 2012;4(11):1103–5.

168

83. Whiteside TL. Disarming suppressor cells to improve immunotherapy. Cancer Immunol Immunother. 2012;61(2):283–8.

84. Zarour HM, Kirkwood JM, Kierstead LS, Herr W, Brusic V, Slingluff CL Jr, et al. Melan-A/MART-1(51-73) represents an immunogenic HLA-DR4-restricted epitope recognized by melanoma-reactive CD4(+) T cells. Proc Natl Acad Sci U A. 2000;97(1):400–5.

85. Kerkar SP, Sanchez-Perez L, Yang S, Borman ZA, Muranski P, Ji Y, et al. Genetic engineering of murine CD8+ and CD4+ T cells for preclinical adoptive immunotherapy studies. J Immunother. 2011;34(4):343–52.

86. Shen H, Ackerman AL, Cody V, Giodini A, Hinson ER, Cresswell P, et al. Enhanced and prolonged cross presentation following endosomal escape of exogenous antigens encapsulated in biodegradable nanoparticles. Immunology. 2006;117(1):78–88.

87. Bukur J, Jasinski S, Seliger B. The role of classical and non-classical HLA class I antigens in human tumors. Semin Cancer Biol. 2012;22(4):350–8.

88. Bubeník J. MHC class I down-regulation: tumour escape from immune surveillance? (review). Int J Oncol. 2004;25(2):487–91.

89. Rabinovich GA, Gabrilovich D, Sotomayor EM. Immunosuppressive strategies that are mediated by tumor cells. Ann Rev Immunol. 2007;25:267–96.

90. Liu J, Liao S, Diop-Frimpong B, Chen W, Goel S, Naxerova K, et al. TGF-β blockade improves the distribution and efficacy of therapeutics in breast carcinoma by normalizing the tumor stroma. Proc Natl Acad Sci U A. 2012;109(41):16618–23.

91. Nawrocki S, Mackiewicz A. Genetically modified tumour vaccines--where we are today. Cancer Treat Rev. 1999;25(1):29–46.

92. Taddei ML, Giannoni E, Comito G, Chiarugi P. Microenvironment and tumor cell plasticity: An easy way out. Cancer Lett. 2013;341(1):80–96.

93. Rivoltini L, Carrabba M, Huber V, Castelli C, Novellino L, Dalerba P, et al. Immunity to cancer: attack and escape in T lymphocyte–tumor cell interaction. Immunol Rev. 2002;188(1):97–113.

94. Kawakami Y, Eliyahu S, Jennings C, Sakaguchi K, Kang X, Southwood S, et al. Recognition of multiple epitopes in the human melanoma antigen gp100 by tumor-infiltrating T lymphocytes associated with in vivo tumor regression. J Immunol. 1995;154(8):3961.

95. Labarriere N, Pandolfino MC, Raingeard D, Le Guiner S, Diez E, Le Drean E, et al. Frequency and relative fraction of tumor antigen specific T cells among lymphocytes from melanoma invaded lymph nodes. Int J Cancer. 1998;78(2):209–15.

96. Benlalam H, Linard B, Guilloux Y, Moreau-Aubry A, Derré L, Diez E, et al. Identification of five new HLA-B* 3501-restricted epitopes derived from common melanoma-associated antigens, spontaneously recognized by tumor-infiltrating lymphocytes. J Immunol. 2003;171(11):6283–9.

97. Rivoltini L, Squarcina P, Loftus DJ, Castelli C, Tarsini P, Mazzocchi A, et al. A superagonist variant of peptide MART1/Melan A27–35 elicits anti-melanoma CD8+ T cells with enhanced functional characteristics: implication for more effective immunotherapy. Cancer Res. 1999;59(2):301–6.

References

169

98. Valmori D, Fonteneau JF, Lizana CM, Gervois N, Liénard D, Rimoldi D, et al. Enhanced generation of specific tumor-reactive CTL in vitro by selected Melan-A/MART-1 immunodominant peptide analogues. J Immunol. 1998;160(4):1750–8.

99. Blanchet JS, Valmori D, Dufau I, Ayyoub M, Nguyen C, Guillaume P, et al. A new generation of Melan-A/MART-1 peptides that fulfill both increased immunogenicity and high resistance to biodegradation: implication for molecular anti-melanoma immunotherapy. J Immunol. 2001;167(10):5852–61.

100. Rosenberg SA, Yang JC, Schwartzentruber DJ, Hwu P, Marincola FM, Topalian SL, et al. Immunologic and therapeutic evaluation of a synthetic peptide vaccine for the treatment of patients with metastatic melanoma. Nat Med. 1998;4(3):321–7.

101. Borbulevych OY, Baxter TK, Yu Z, Restifo NP, Baker BM. Increased immunogenicity of an anchor-modified tumor-associated antigen is due to the enhanced stability of the peptide/MHC complex: implications for vaccine design. J Immunol. 2005;174(8):4812–20.

102. Smith KA, Meisenburg BL, Tam VL, Pagarigan RR, Wong R, Joea DK, et al. Lymph Node–Targeted Immunotherapy Mediates Potent Immunity Resulting in Regression of Isolated or Metastatic Human Papillomavirus–Transformed Tumors. Clin Cancer Res. 2009;15(19):6167–76.

103. Walker EB, Haley D, Miller W, Floyd K, Wisner KP, Sanjuan N, et al. gp100(209–2M) Peptide Immunization of Human Lymphocyte Antigen-A2+ Stage I-III Melanoma Patients Induces Significant Increase in Antigen-Specific Effector and Long-Term Memory CD8+ T Cells. Clin Cancer Res. 2004;10(2):668–80.

104. Nawrath M, Pavlovic J, Moelling K. Synergistic effect of a combined DNA and peptide vaccine against gp100 in a malignant melanoma mouse model. J Mol Med. 2001;79(2):133–42.

105. Ginsberg BA, Gallardo HF, Rasalan TS, Adamow M, Mu Z, Tandon S, et al. Immunologic response to xenogeneic gp100 DNA in melanoma patients: comparison of particle-mediated epidermal delivery with intramuscular injection. Clin Cancer Res. 2010;16(15):4057–65.

106. Tagawa ST, Lee P, Snively J, Boswell W, Ounpraseuth S, Lee S, et al. Phase I study of intranodal delivery of a plasmid DNA vaccine for patients with Stage IV melanoma. Cancer. 2003;98(1):144–54.

107. Bioley G, Jandus C, Tuyaerts S, Rimoldi D, Kwok WW, Speiser DE, et al. Melan-A/MART-1-Specific CD4 T Cells in Melanoma Patients: Identification of New Epitopes and Ex Vivo Visualization of Specific T Cells by MHC Class II Tetramers. J Immunol. 2006;177(10):6769–79.

108. Reynolds SR, Celis E, Sette A, Oratz R, Shapiro RL, Johnston D, et al. HLA-independent heterogeneity of CD8+ T cell responses to MAGE-3, Melan-A/MART-1, gp100, tyrosinase, MC1R, and TRP-2 in vaccine-treated melanoma patients. J Immunol. 1998;161(12):6970–6.

109. Cobb BA, Kasper DL. Coming of age: carbohydrates and immunity. Eur J Immunol. 2005;35(2):352–6.

110. De Libero G, Mori L. How the immune system detects lipid antigens. Prog Lipid Res. 2010;49(2):120–7.

111. Facciotti F, Cavallari M, Angénieux C, Garcia-Alles LF, Signorino-Gelo F, Angman L, et al. Fine tuning by human CD1e of lipid-specific immune responses. Proc Natl Acad Sci USA. 2011;108(34):14228–33.

170

112. De Libero G, Collmann A, Mori L. The cellular and biochemical rules of lipid antigen presentation. Eur J Immunol. 2009;39(10):2648–56.

113. Godfrey DI, Pellicci DG, Patel O, Kjer-Nielsen L, McCluskey J, Rossjohn J. Antigen recognition by CD1d-restricted NKT T cell receptors. Semin Immunol. 2010;22(2):61–7.

114. Schiefner A, Wilson IA. Presentation of lipid antigens by CD1 glycoproteins. Curr Pharm Des. 2009;15(28):3311–7.

115. Fujii S-I, Shimizu K, Smith C, Bonifaz L, Steinman RM. Activation of natural killer T cells by alpha-galactosylceramide rapidly induces the full maturation of dendritic cells in vivo and thereby acts as an adjuvant for combined CD4 and CD8 T cell immunity to a coadministered protein. J Exp Med. 2003;198(2):267–79.

116. Hakomori S. Tumor malignancy defined by aberrant glycosylation and sphingo(glyco)lipid metabolism. Cancer Res. 1996;56(23):5309–18.

117. Heimburg-Molinaro J, Lum M, Vijay G, Jain M, Almogren A, Rittenhouse-Olson K. Cancer vaccines and carbohydrate epitopes. Vaccine. 2011;29(48):8802–26.

118. Pashov A, Monzavi-Karbassi B, Kieber-Emmons T. Glycan mediated immune responses to tumor cells. Hum Vaccin. 2011;7 Suppl:156–65.

119. Monzavi-Karbassi B, Pashov A, Jousheghany F, Artaud C, Kieber-Emmons T. Evaluating strategies to enhance the anti-tumor immune response to a carbohydrate mimetic peptide vaccine. Int J Mol Med. 2006;17(6):1045–52.

120. Cheever MA, Allison JP, Ferris AS, Finn OJ, Hastings BM, Hecht TT, et al. The prioritization of cancer antigens: a national cancer institute pilot project for the acceleration of translational research. Clin Cancer Res. 2009;15(17):5323–37.

121. Vlad AM, Kettel JC, Alajez NM, Carlos CA, Finn OJ. MUC1 immunobiology: from discovery to clinical applications. Adv Immunol. 2004;82:249–93.

122. Gaidzik N, Westerlind U, Kunz H. The development of synthetic antitumour vaccines from mucin glycopeptide antigens. Chem Soc Rev. 2013;42(10):4421–42.

123. Kaiser A, Gaidzik N, Westerlind U, Kowalczyk D, Hobel A, Schmitt E, et al. A synthetic vaccine consisting of a tumor-associated sialyl-T(N)-MUC1 tandem-repeat glycopeptide and tetanus toxoid: induction of a strong and highly selective immune response. Angew Chem Int Ed Engl. 2009;48(41):7551–5.

124. Cai H, Huang Z-H, Shi L, Sun Z-Y, Zhao Y-F, Kunz H, et al. Variation of the Glycosylation Pattern in MUC1 Glycopeptide BSA Vaccines and Its Influence on the Immune Response. Angew Chem Int Ed Engl. 2012;51(7):1719–23.

125. Mazorra Z, Mesa C, Fernández A, Fernández LE. Immunization with a GM3 ganglioside nanoparticulated vaccine confers an effector CD8(+) T cells-mediated protection against melanoma B16 challenge. Cancer Immunol Immunother. 2008;57(12):1771–80.

126. O’Hagan DT, De Gregorio E. The path to a successful vaccine adjuvant--’the long and winding road’. Drug Discov Today. 2009;14(11-12):541–51.

127. Kool M, Fierens K, Lambrecht BN. Alum adjuvant: some of the tricks of the oldest adjuvant. J Med Microbiol. 2012;61(Pt 7):927–34.

References

171

128. Mbow ML, De Gregorio E, Valiante NM, Rappuoli R. New adjuvants for human vaccines. Curr Opin Immunol. 2010;22(3):411–6.

129. Wilschut J. Influenza vaccines: the virosome concept. Immunol Lett. 2009;122(2):118–21.

130. Morel S, Didierlaurent A, Bourguignon P, Delhaye S, Baras B, Jacob V, et al. Adjuvant System AS03 containing α-tocopherol modulates innate immune response and leads to improved adaptive immunity. Vaccine. 2011;29(13):2461–73.

131. Didierlaurent AM, Morel S, Lockman L, Giannini SL, Bisteau M, Carlsen H, et al. AS04, an aluminum salt- and TLR4 agonist-based adjuvant system, induces a transient localized innate immune response leading to enhanced adaptive immunity. J Immunol. 2009;183(10):6186–97.

132. Vandepapelière P, Horsmans Y, Moris P, Van Mechelen M, Janssens M, Koutsoukos M, et al. Vaccine adjuvant systems containing monophosphoryl lipid A and QS21 induce strong and persistent humoral and T cell responses against hepatitis B surface antigen in healthy adult volunteers. Vaccine. 2008;26(10):1375–86.

133. Aucouturier J, Dupuis L, Ganne V. Adjuvants designed for veterinary and human vaccines. Vaccine. 2001;19(17-19):2666–72.

134. Thompson BS, Chilton PM, Ward JR, Evans JT, Mitchell TC. The low-toxicity versions of LPS, MPL adjuvant and RC529, are efficient adjuvants for CD4+ T cells. J Leukoc Biol. 2005;78(6):1273–80.

135. Schellack C, Prinz K, Egyed A, Fritz JH, Wittmann B, Ginzler M, et al. IC31, a novel adjuvant signaling via TLR9, induces potent cellular and humoral immune responses. Vaccine. 2006;24(26):5461–72.

136. Halperin SA, McNeil S, Langley JM, Smith B, MacKinnon-Cameron D, McCall-Sani R, et al. Safety and immunogenicity of different two-dose regimens of an investigational hepatitis B vaccine (hepatitis B surface antigen co-administered with an immunostimulatory phosphorothioate oligodeoxyribonucleotide) in healthy young adults. Vaccine. 2012;30(36):54458.

137. Krieg AM. Development of TLR9 agonists for cancer therapy. J Clin Invest. 2007;117(5):1184–94.

138. Yuzhalin AE, Kutikhin AG. Interleukin-12: clinical usage and molecular markers of cancer susceptibility. Growth Factors. 2012;30(3):176–91.

139. Pichichero ME. Improving vaccine delivery using novel adjuvant systems. Hum Vaccin. 2008;4(4):262–70.

140. Chuang C-M, Monie A, Hung C-F, Wu T-C. Treatment with imiquimod enhances antitumor immunity induced by therapeutic HPV DNA vaccination. J Biomed Sci. 2010;17:32.

141. Wu JJ, Huang DB, Tyring SK. Resiquimod: a new immune response modifier with potential as a vaccine adjuvant for Th1 immune responses. Antivir Res. 2004;64(2):79–83.

142. Nicodemus CF, Berek JS. TLR3 agonists as immunotherapeutic agents. Immunotherapy. 2010;2(2):137–40.

143. Mizel SB, Bates JT. Flagellin as an adjuvant: cellular mechanisms and potential. J Immunol. 2010;185(10):5677–82.

172

144. Kumar H, Kawai T, Akira S. Pathogen recognition in the innate immune response. Biochem J. 2009;420(1):1–16.

145. Beutler B. Microbe sensing, positive feedback loops, and the pathogenesis of inflammatory diseases. Immunolo Rev. 2009;227(1):248–63.

146. Wesch D, Peters C, Oberg H-H, Pietschmann K, Kabelitz D. Modulation of γδ T cell responses by TLR ligands. Cell Mol Life Sci. 2011;68(14):2357–70.

147. Takeda K, Kaisho T, Akira S. Toll-like receptors. Ann Rev Immunol. 2003;21(1):335–76.

148. Gautier G, Humbert M, Deauvieau F, Scuiller M, Hiscott J, Bates EEM, et al. A type I interferon autocrine-paracrine loop is involved in Toll-like receptor-induced interleukin-12p70 secretion by dendritic cells. J Exp Med. 2005;201(9):1435–46.

149. Sariol CA, Martínez MI, Rivera F, Rodríguez IV, Pantoja P, Abel K, et al. Decreased dengue replication and an increased anti-viral humoral response with the use of combined Toll-like receptor 3 and 7/8 agonists in macaques. PloS One. 2011;6(4):e19323.

150. Duthie MS, Windish HP, Fox CB, Reed SG. Use of defined TLR ligands as adjuvants within human vaccines. Immunol Rev. 2011;239(1):178–96.

151. Liu G, Zhang L, Zhao Y. Modulation of immune responses through direct activation of Toll like receptors to T cells. Clin Exp Immunol. 2010;160(2):168–75.

152. Avalos AM, Latz E, Mousseau B, Christensen SR, Shlomchik MJ, Lund F, et al. Differential cytokine production and bystander activation of autoreactive B cells in response to CpG-A and CpG-B oligonucleotides. J Immunol. 2009;183(10):6262–8.

153. Vollmer J, Weeratna R, Payette P, Jurk M, Schetter C, Laucht M, et al. Characterization of three CpG oligodeoxynucleotide classes with distinct immunostimulatory activities. Eur J Immunol. 2004;34(1):251–62.

154. Agrawal S, Kandimalla E. Synthetic agonists of Toll-like receptors 7, 8 and 9. Bioch Soc Trans. 2007;35(6):1461–7.

155. Barata T, Teo I, Lalwani S, Simanek E, Zloh M, Shaunak S. Computational design principles for bioactive dendrimer based constructs as antagonists of the TLR4-MD-2-LPS complex. Biomaterials. 2011;32(33):8702–11.

156. Barata TS, Teo I, Brocchini S, Zloh M, Shaunak S. Partially glycosylated dendrimers block MD-2 and prevent TLR4-MD-2-LPS complex mediated cytokine responses. PLoS Comput Biol. 2011;7(6):e1002095.

157. Goldinger SM, Dummer R, Baumgaertner P, Mihic-Probst D, Schwarz K, Hammann-Haenni A, et al. Nano-particle vaccination combined with TLR-7 and -9 ligands triggers memory and effector CD8+ T-cell responses in melanoma patients. Eur J Immunol. 2012;42(11):3049–61.

158. Link BK, Ballas ZK, Weisdorf D, Wooldridge JE, Bossler AD, Shannon M, et al. Oligodeoxynucleotide CpG 7909 delivered as intravenous infusion demonstrates immunologic modulation in patients with previously treated non-Hodgkin lymphoma. J Immunother. 2006;29(5):558–68.

159. Carpentier A, Laigle-Donadey F, Zohar S, Capelle L, Behin A, Tibi A, et al. Phase 1 trial of a CpG oligodeoxynucleotide for patients with recurrent glioblastoma. Neuro Oncol. 2006;8(1):60–6.

References

173

160. Manegold C, Gravenor D, Woytowitz D, Mezger J, Hirsh V, Albert G, et al. Randomized phase II trial of a toll-like receptor 9 agonist oligodeoxynucleotide, PF-3512676, in combination with first-line taxane plus platinum chemotherapy for advanced-stage non-small-cell lung cancer. J Clin Oncol. 2008;26(24):3979–86.

161. Engel AL, Holt GE, Lu H. The pharmacokinetics of Toll-like receptor agonists and the impact on the immune system. Exp Rev Clin Pharmacol. 2011;4(2):275–89.

162. Warger T, Osterloh P, Rechtsteiner G, Fassbender M, Heib V, Schmid B, et al. Synergistic activation of dendritic cells by combined Toll-like receptor ligation induces superior CTL responses in vivo. Blood. 2006;108(2):544–50.

163. Kasturi SP, Skountzou I, Albrecht RA, Koutsonanos D, Hua T, Nakaya HI, et al. Programming the magnitude and persistence of antibody responses with innate immunity. Nature. 2011;470(7335):543–7.

164. Tross D, Petrenko L, Klaschik S, Zhu Q, Klinman DM. Global changes in gene expression and synergistic interactions induced by TLR9 and TLR3. Mol Immunol. 2009;46(13):2557–64.

165. Lee YR, Lee YH, Im SA, Yang IH, Ahn GW, Kim K, et al. Biodegradable nanoparticles containing TLR3 or TLR9 agonists together with antigen enhance MHC-restricted presentation of the antigen. Arch Pharm Res. 2010;33(11):1859–66.

166. Stone GW, Barzee S, Snarsky V, Santucci C, Tran B, Langer R, et al. Nanoparticle-delivered multimeric soluble CD40L DNA combined with Toll-Like Receptor agonists as a treatment for melanoma. PLoS One. 2009;4(10):e7334.

167. Hamdy S, Molavi O, Ma Z, Haddadi A, Alshamsan A, Gobti Z, et al. Co-delivery of cancer-associated antigen and Toll-like receptor 4 ligand in PLGA nanoparticles induces potent CD8+ T cell-mediated anti-tumor immunity. Vaccine. 2008;26(39):5046–57.

168. Demento SL, Eisenbarth SC, Foellmer HG, Platt C, Caplan MJ, Mark Saltzman W, et al. Inflammasome-activating nanoparticles as modular systems for optimizing vaccine efficacy. Vaccine. 2009;27(23):3013–21.

169. Diwan M, Tafaghodi M, Samuel J. Enhancement of immune responses by co-delivery of a CpG oligodeoxynucleotide and tetanus toxoid in biodegradable nanospheres. J Control Release. 2002;85(1-3):247–62.

170. Slütter B, Jiskoot W. Dual role of CpG as immune modulator and physical crosslinker in ovalbumin loaded N-trimethyl chitosan (TMC) nanoparticles for nasal vaccination. J Control Release. 2010;148(1):117–21.

171. Florindo HF, Pandit S, Gonçalves L, Videira M, Alpar O, Almeida AJ. Antibody and cytokine-associated immune responses to S. equi antigens entrapped in PLA nanospheres. Biomaterials. 2009;30(28):5161–9.

172. Clawson C, Huang CT, Futalan D, Martin Seible D, Saenz R, Larsson M, et al. Delivery of a peptide via poly (d, l-lactic-co-glycolic) acid nanoparticles enhances its dendritic cell-stimulatory capacity. Nanomed. 2010;6(5):651–61.

173. Kusmartsev S, Gabrilovich DI. Role of immature myeloid cells in mechanisms of immune evasion in cancer. Cancer Immunol Immunother. 2006;55(3):237–45.

174

174. Gao Q, Qiu S-J, Fan J, Zhou J, Wang X-Y, Xiao Y-S, et al. Intratumoral balance of regulatory and cytotoxic T cells is associated with prognosis of hepatocellular carcinoma after resection. J Clin Oncol. 2007;25(18):2586–93.

175. Zhang Y, Luo F, Cai Y, Liu N, Wang L, Xu D, et al. TLR1/TLR2 agonist induces tumor regression by reciprocal modulation of effector and regulatory T cells. J Immunol. 2011;186(4):1963–9.

176. Oberg H-H, Juricke M, Kabelitz D, Wesch D. Regulation of T cell activation by TLR ligands. Eur J Cell Biol. 2011;90(6-7):582–92.

177. Yang Y, Huang CT, Huang X, Pardoll DM. Persistent Toll-like receptor signals are required for reversal of regulatory T cell–mediated CD8 tolerance. Nat Immunol. 2004;5(5):508–15.

178. Caramalho I, Lopes-Carvalho T, Ostler D, Zelenay S, Haury M, Demengeot J. Regulatory T cells selectively express toll-like receptors and are activated by lipopolysaccharide. J Exp Med. 2003;197(4):403–11.

179. Chen Q, Davidson TS, Huter EN, Shevach EM. Engagement of TLR2 does not reverse the suppressor function of mouse regulatory T cells, but promotes their survival. J Immunol. 2009;183(7):4458–66.

180. Olivier A, Sainz-Perez A, Dong H, Sparwasser T, Majlessi L, Leclerc C. The adjuvant effect of TLR agonists on CD4(+) effector T cells is under the indirect control of regulatory T cells. Eur J Immunol. 2011;41(8):2303–13.

181. Tanchot C, Terme M, Pere H, Tran T, Benhamouda N, Strioga M, et al. Tumor-Infiltrating Regulatory T Cells: Phenotype, Role, Mechanism of Expansion In Situ and Clinical Significance. Cancer Microenviron. 2012;6(2):147–57.

182. Zoglmeier C, Bauer H, Nörenberg D, Wedekind G, Bittner P, Sandholzer N, et al. CpG blocks immunosuppression by myeloid-derived suppressor cells in tumor-bearing mice. Clin Cancer Res. 2011;17(7):1765–75.

183. Arens R, Schoenberger SP. Plasticity in programming of effector and memory CD8+ T cell formation. Immunolo Rev. 2010;235(1):190–205.

184. Kawai T, Akira S. TLR signaling. 2007;19(1):24–32.

185. Bachmann MF, Jennings GT. Vaccine delivery: a matter of size, geometry, kinetics and molecular patterns. Nat Rev Immunol. 2010;10(11):787–96.

186. Danhier F, Ansorena E, Silva, JM. J, Coco R, Le Breton A, Préat V. PLGA-based nanoparticles: An overview of biomedical applications. J Control Release. 2012;161(2):505–22.

187. Panyam J, Labhasetwar V. Biodegradable nanoparticles for drug and gene delivery to cells and tissue. Adv Drug Deliv Rev. 2003;55(3):329–47.

188. Damm J, Wiegand F, Harden LM, Gerstberger R, Rummel C, Roth J. Fever, sickness behavior, and expression of inflammatory genes in the hypothalamus after systemic and localized subcutaneous stimulation of rats with the Toll-like receptor 7 agonist imiquimod. Neuroscience. 2012;201:166–83.

References

175

189. Tacken PJ, Zeelenberg IS, Cruz LJ, van Hout-Kuijer MA, van de Glind G, Fokkink RG, et al. Targeted delivery of TLR ligands to human and mouse dendritic cells strongly enhances adjuvanticity. Blood. 2011;118(26):6836–44.

190. Nguyen DN, Mahon KP, Chikh G, Kim P, Chung H, Vicari AP, et al. Lipid-derived nanoparticles for immunostimulatory RNA adjuvant delivery. Proc Natl Acad Sci USA. 2012;109(14):E797–803.

191. Jain RA, Rhodes CT, Railkar AM, Malick AW, Shah NH. Controlled release of drugs from injectable in situ formed biodegradable PLGA microspheres: effect of various formulation variables. Eur J Pharm Biopharm. 2000;50(2):257–62.

192. Fernandez-Megia E, Novoa-Carballal R, Quiñoá E, Riguera R. Conjugation of bioactive ligands to PEG-grafted chitosan at the distal end of PEG. Biomacromolecules. 2007;8(3):833–42.

193. Silva JM, Videira M, Gaspar R, Préat V, Florindo HF. Immune system targeting by biodegradable nanoparticles for cancer vaccines. J Control Release. 2013;168(2):179–99.

194. Pulapura S, Kohn J. Trends in the development of bioresorbable polymers for medical applications. J Biomater Appl. 1992;6(3):216–50.

195. Beck LR, Cowsar DR, Lewis DH, Cosgrove RJ Jr, Riddle CT, Lowry SL, et al. A new long-acting injectable microcapsule system for the administration of progesterone. Fertil Steril. 1979;31(5):545–51.

196. Benita S, Benoit JP, Puisieux F, Thies C. Characterization of drug-loaded poly(d,l-lactide) microspheres. J Pharm Sci. 1984;73(12):1721–4.

197. Pitt CG, Marks TA, Schindler A. Biodegradable drug delivery systems based on aliphatic polyesters: application to contraceptives and narcotic antagonists. NIDA Res Monogr. 1981;28:232–53.

198. Juni K, Ogata J, Nakano M, Ichihara T, Mori K, Akagi M. Preparation and evaluation in vitro and in vivo of polylactic acid microspheres containing doxorubicin. Chem Pharm Bull. 1985;33(1):313–8.

199. Wakiyama N, Juni K, Nakano M. Preparation and evaluation in vitro of polylactic acid microspheres containing local anesthetics. Chem Pharm Bull. 1981;29(11):3363–8.

200. Guiziou B, Armstrong DJ, Elliott PN, Ford JL, Rostron C. Investigation of in-vitro release characteristics of NSAID-loaded polylactic acid microspheres. J Microencapsul. 1996;13(6):701–8.

201. Corrigan OI, Li X. Quantifying drug release from PLGA nanoparticulates. Eur J Pharm Sci. 2009;37(3-4):477–85.

202. Okada H, Doken Y, Ogawa Y, Toguchi H. Preparation of three-month depot injectable microspheres of leuprorelin acetate using biodegradable polymers. Pharma Res. 1994;11(8):1143–7.

203. Isurugi K, Niijima T, Akaza H, Aso Y, Koiso K, Fuse M, et al. Treatment of prostatic cancer with TAP-144-SR, a depot preparation of LH-RH agonist (leuprolide). J Chemother. 1989;1(4 Suppl):1237–41.

176

204. Nicholson RI, Walker KJ, Maynard PV. Anti-tumour potential of a new luteinizing hormone releasing hormone analogue, ICI 118630. Eur J Cancer. 1980;Suppl 1:295–9.

205. O’Hagan DT, Rahman D, McGee JP, Jeffery H, Davies MC, Williams P, et al. Biodegradable microparticles as controlled release antigen delivery systems. Immunology. 1991;73(2):239–42.

206. Lo RY. The development of subunit and synthetic vaccines using recombinant DNA technology. Biotechnol Adv. 1987;5(2):235–56.

207. Hudson D, Margaritis A. Biopolymer nanoparticle production for controlled release of biopharmaceuticals. Crit Rev Biotechnol. 2013;34(2):161–79.

208. Ali M, Brocchini S. Synthetic approaches to uniform polymers. Adv Drug Deliv Rev. 2006;58(15):1671–87.

209. Ulery BD, Nair LS, Laurencin CT. Biomedical applications of biodegradable polymers. J Polym Sci Polym Phys. 2011;49(12):832–64.

210. Seyednejad H, Ghassemi AH, van Nostrum CF, Vermonden T, Hennink WE. Functional aliphatic polyesters for biomedical and pharmaceutical applications. J Control Release. 2011;152(1):168–76.

211. Athanasiou KA, Niederauer GG, Agrawal C. Sterilization, toxicity, biocompatibility and clinical applications of polylactic acid/polyglycolic acid copolymers. Biomaterials. 1996;17(2):93–102.

212. Hyon SH, Jamshidi K, Ikada Y. Synthesis of polylactides with different molecular weights. Biomaterials. 1997;18(22):1503–8.

213. Albertsson A-C, Varma IK. Recent developments in ring opening polymerization of lactones for biomedical applications. Biomacromolecules. 2003;4(6):1466–86.

214. Thomas CM. Stereocontrolled ring-opening polymerization of cyclic esters: synthesis of new polyester microstructures. Chem Soc Rev. 2010;39(1):165–73.

215. Kobayashi S, Uyama H, Kimura S. Enzymatic polymerization. Chem Rev. 2001;101(12):3793–818.

216. Dordick JS. Enzymatic and chemoenzymatic approaches to polymer synthesis. Trends Biotechnol. 1992;10(8):287–90.

217. Dechy-Cabaret O, Martin-Vaca B, Bourissou D. Controlled ring-opening polymerization of lactide and glycolide. Chem Rev. 2004;104(12):6147–76.

218. Platel R, Hodgson L, Williams C. Biocompatible Initiators for Lactide Polymerization. Polym Rev. 2008;48(1):11–63.

219. Kricheldorf HR. Syntheses and application of polylactides. Chemosphere. 2001;43(1):49–54.

220. Labet M, Thielemans W. Synthesis of polycaprolactone: a review. Chem Soc Rev. 2009;38(12):3484–504.

221. Huatan H, Collett JH, Attwood D, Booth C. Preparation and characterization of poly(epsilon-caprolactone) polymer blends for the delivery of proteins. Biomaterials. 1995;16(17):1297–303.

References

177

222. Abe H, Doi Y. Structural effects on enzymatic degradabilities for poly[(R)-3-hydroxybutyric acid] and its copolymers. Int J Biol Macromol. 1999;25(1-3):185–92.

223. Qian H, Wohl AR, Crow JT, Macosko CW, Hoye TR. A Strategy for Control of «Random» Copolymerization of Lactide and Glycolide: Application to Synthesis of PEG-b-PLGA Block Polymers Having Narrow Dispersity. Macromolecules. 2011;44(18):7132–40.

224. Peter SJ, Yaszemski MJ, Suggs LJ, Payne RG, Langer R, Hayes WC, et al. Characterization of partially saturated poly(propylene fumarate) for orthopaedic application. J Biomater SCi Polym Ed. 1997;8(11):893–904.

225. Liu J, Chen P, Li J, Jiang S-H, Jiang Z-Q, Gu Q. Synthesis of poly(ethylene adipate-co-l-lactic acid) copolymers via ring opening polymerization. Polym Bull. 2011;66(2):187–97.

226. Lee CW, Urakawa R, Kimura Y. Copolymerization of γ-valerolactone and β-butyrolactone. Eur Polym J. 1998;34(1):117–22.

227. Freichels H, Pourcelle V, Auzély-Velty R, Marchand-Brynaert J, Jérôme C. Synthesis of poly(lactide-co-glycolide-co-ε-caprolactone)-graft-mannosylated poly(ethylene oxide) copolymers by combination of «clip» and «click» chemistries. Biomacromolecules. 2012;13(3):760–8.

228. Lasprilla AJR, Martinez GAR, Lunelli BH, Jardini AL, Filho RM. Poly-lactic acid synthesis for application in biomedical devices - a review. Biotechnol Adv. 2012;30(1):321–8.

229. Shao J, Sun J, Bian X, Cui Y, Li G, Chen X. Investigation of poly(lactide) stereocomplexes: 3-armed poly(L-lactide) blended with linear and 3-armed enantiomers. J Phys Chem B. 2012;116(33):9983–91.

230. Gunatillake P, Mayadunne R, Adhikari R. Recent developments in biodegradable synthetic polymers. Biotechnol Annu Rev. 2006;12:301–47.

231. Woodruff MA, Hutmacher DW. The return of a forgotten polymer—Polycaprolactone in the 21st century. Prog Polym Sci. 2010;35(10):1217–56.

232. Francis L, Meng D, Knowles J, Keshavarz T, Boccaccini AR, Roy I. Controlled Delivery of Gentamicin Using Poly(3-hydroxybutyrate) Microspheres. Int J Mol Sci. 2011;12(7):4294–314.

233. Errico C, Bartoli C, Chiellini F, Chiellini E. Poly(hydroxyalkanoates)-based polymeric nanoparticles for drug delivery. J Biomed Biotechnol. 2009;2009:571702.

234. Wróbel-Kwiatkowska M, Skórkowska-Telichowska K, Dymińska L, Maczka M, Hanuza J, Szopa J. Biochemical, mechanical, and spectroscopic analyses of genetically engineered flax fibers producing bioplastic (poly-beta-hydroxybutyrate). Biotechnol Prog. 2009;25(5):1489–98.

235. Dreifke MB, Ebraheim NA, Jayasuriya AC. Investigation of potential injectable polymeric biomaterials for bone regeneration. J Biomed Mater Res A. 2013;101(8):2436–47.

236. Mistry AS, Mikos AG, Jansen JA. Degradation and biocompatibility of a poly(propylene fumarate)-based/alumoxane nanocomposite for bone tissue engineering. J Biomed Mater Res A. 2007;83(4):940–53.

237. Malberg S, Hoglund A, Albertsson A-C. Macromolecular design of aliphatic polyesters with maintained mechanical properties and a rapid, customized degradation profile. Biomacromolecules. 2011;12(6):2382–8.

178

238. Ryner M, Albertsson A-C. Resorbable and highly elastic block copolymers from 1,5-dioxepan-2-one and L-lactide with controlled tensile properties and hydrophilicity. Biomacromolecules. 2002;3(3):601–8.

239. Pang X, Zhuang X, Tang Z, Chen X. Polylactic acid (PLA): Research, development and industrialization. Biotechnol. 2010;5(11):1125–36.

240. Köse GT, Kenar H, Hasirci N, Hasirci V. Macroporous poly(3-hydroxybutyrate-co-3-hydroxyvalerate) matrices for bone tissue engineering. Biomaterials. 2003;24(11):1949–58.

241. Jack KS, Velayudhan S, Luckman P, Trau M, Grøndahl L, Cooper-White J. The fabrication and characterization of biodegradable HA/PHBV nanoparticle-polymer composite scaffolds. Acta Biomater. 2009;5(7):2657–67.

242. Khang G, Kim SW, Cho JC, Rhee JM, Yoon SC, Lee HB. Preparation and characterization of poly(3-hydroxybutyrate-co-3-hydroxyvalerate) microspheres for the sustained release of 5-fluorouracil. Biomed Mater Eng. 2001;11(2):89–103.

243. Mendes JBE, Riekes MK, de Oliveira VM, Michel MD, Stulzer HK, Khalil NM, et al. PHBV/PCL microparticles for controlled release of resveratrol: physicochemical characterization, antioxidant potential, and effect on hemolysis of human erythrocytes. ScientificWorldJournal. 2012;2012:542937.

244. Lü JM, Wang X, Marin-Muller C, Wang H, Lin PH, Yao Q, et al. Current advances in research and clinical applications of PLGA-based nanotechnology. Exp Rev Mol Diagn. 2009;9(4):325–41.

245. Jain RA. The manufacturing techniques of various drug loaded biodegradable poly (lactide-co-glycolide)(PLGA) devices. Biomaterials. 2000;21(23):2475–90.

246. Soderquist RG, Sloane EM, Loram LC, Harrison JA, Dengler EC, Johnson SM, et al. Release of plasmid DNA-encoding IL-10 from PLGA microparticles facilitates long-term reversal of neuropathic pain following a single intrathecal administration. Pharm Res. 2010;27(5):841–54.

247. Cun D, Jensen DK, Maltesen MJ, Bunker M, Whiteside P, Scurr D, et al. High loading efficiency and sustained release of siRNA encapsulated in PLGA nanoparticles: Quality by design optimization and characterization. Eur J Pharm Biopharm. 2010;77(1):26–35.

248. Solbrig C, Saucier-Sawyer J, Cody V, Saltzman W, Hanlon D. Polymer nanoparticles for immunotherapy from encapsulated tumor-associated antigens and whole tumor cells. Mol Pharm. 2007;4(1):47–57.

249. Diwan M, Elamanchili P, Lane H, Gainer A, Samuel J. Biodegradable nanoparticle mediated antigen delivery to human cord blood derived dendritic cells for induction of primary T cell responses. J Drug Target. 2003;11(8-10):495–507.

250. Prasad S, Cody V, Saucier-Sawyer JK, Saltzman WM, Sasaki CT, Edelson RL, et al. Polymer nanoparticles containing tumor lysates as antigen delivery vehicles for dendritic cell–based antitumor immunotherapy. Nanomed. 2011;7(1):1–10.

251. Thomas CM, Rawat A, Hope-Weeks LJ, Ahsan F. Aerosolized PLA and PLGA Nanoparticles Enhance Humoral, Mucosal and Cytokine Responses to Hepatitis B Vaccine. Mol Pharm. 2010;27:905–19.

252. Tian J, Yu J. Cell biology of antigen processing in vitro and in vivo. Fish Shellfish Immunol. 2010;30(1):109–17.

References

179

253. Jiang W, Gupta RK, Deshpande MC, Schwendeman SP. Biodegradable poly (lactic-co-glycolic acid) microparticles for injectable delivery of vaccine antigens. Adv Drug Deliv Rev. 2005;57(3):391–410.

254. Garinot M, Fiévez V, Pourcelle V, Stoffelbach F, Des Rieux A, Plapied L, et al. PEGylated PLGA-based nanoparticles targeting M cells for oral vaccination. J Control Release. 2007;120(3):195–204.

255. Florindo HF, Pandit S, Gonçalves LMD, Alpar HO, Almeida AJ. New approach on the development of a mucosal vaccine against strangles: Systemic and mucosal immune responses in a mouse model. Vaccine. 2009;27(8):1230–41.

256. Diwan M, Elamanchili P, Cao M, Samuel J. Dose sparing of CpG oligodeoxynucleotide vaccine adjuvants by nanoparticle delivery. Curr Drug Deliv. 2004;1(4):405–12.

257. Bates FS, Hillmyer MA, Lodge TP, Bates CM, Delaney KT, Fredrickson GH. Multiblock Polymers: Panacea or Pandora’s Box? Science. 2012;336(6080):434–40.

258. Kissel T, Li Y, Unger F. ABA-triblock copolymers from biodegradable polyester A-blocks and hydrophilic poly(ethylene oxide) B-blocks as a candidate for in situ forming hydrogel delivery systems for proteins. Adv Drug Deliv Rev. 2002;54(1):99–134.

259. Xiong X-B, Falamarzian A, Garg SM, Lavasanifar A. Engineering of amphiphilic block copolymers for polymeric micellar drug and gene delivery. J Control Release. 2011;155(2):248–61.

260. Adams ML, Lavasanifar A, Kwon GS. Amphiphilic block copolymers for drug delivery. J Pharm Sci. 2003;92(7):1343–55.

261. Yang Y, Kuang Y, Liu Y, Li W, Jiang Z, Xiao L, et al. Immunogenicity of multiple-epitope antigen gene of HCV carried by novel biodegradable polymers. Comp Immunol Microbiol Infect Dis. 2011;34(1):65–72.

262. Blencowe A, Tan JF, Goh TK, Qiao GG. Core cross-linked star polymers via controlled radical polymerisation. Polymer. 2009;50(1):5–32.

263. Cameron DJA, Shaver MP. Aliphatic polyester polymer stars: synthesis, properties and applications in biomedicine and nanotechnology. Chem Soc Rev. 2011;40(3):1761–76.

264. Jansen J, Tibbe MP, Mihov G, Feijen J, Grijpma DW. Photo-crosslinked networks prepared from fumaric acid monoethyl ester-functionalized poly(D,L-lactic acid) oligomers and N-vinyl-2-pyrrolidone for the controlled and sustained release of proteins. Acta Biomater. 2012;8(10):3652–9.

265. Zotzmann J, Alteheld A, Behl M, Lendlein A. Amorphous phase-segregated copoly(ether)esterurethane thermoset networks with oligo(propylene glycol) and oligo[(rac-lactide)-co-glycolide] segments: synthesis and characterization. J Mater Sci Mater Med. 2009;20(9):1815–24.

266. Nagahama K, Saito T, Ouchi T, Ohya Y. Biodegradable Nano-aggregates of Star-Shaped 8-arm PEG-PLLA Block Co-polymers for Encapsulation of Water-Soluble Macromolecules. J Biomater SCi Polym Ed. 2010;[Epub ahead of print].

267. Ferreira SA, Gama FM, Vilanova M. Polymeric nanogels as vaccine delivery systems. Nanomed. 2013;9(2):159–73.

180

268. Fredenberg S, Wahlgren M, Reslow M, Axelsson A. The mechanisms of drug release in poly(lactic-co-glycolic acid)-based drug delivery systems--a review. Int J Pharm. 2011;415(1-2):34–52.

269. Mora-Huertas CE, Fessi H, Elaissari A. Polymer-based nanocapsules for drug delivery. Int J Pharm. 2010;385(1-2):113–42.

270. Chye Joachim Loo S, Ooi CP, Hong Elyna Wee S, Chiang Freddy Boey Y. Effect of isothermal annealing on the hydrolytic degradation rate of poly (lactide-co-glycolide)(PLGA). Biomaterials. 2005;26(16):2827–33.

271. Vert M, Li SM, Spenlehauer G, Guerin P. Bioresorbability and biocompatibility of aliphatic polyesters. J Mater Sci Mater Med. 1992;3(6):432–46.

272. Weir NA, Buchanan FJ, Orr JF, Dickson GR. Degradation of poly-L-lactide. Part 1: in vitro and in vivo physiological temperature degradation. Proc Inst Mech Eng H. 2004;218(5):307–19.

273. Göpferich A, Tessmar J. Polyanhydride degradation and erosion. Adv Drug Deliv Rev. 2002;54(7):911–31.

274. Peppas NA, Narasimhan B. Mathematical models in drug delivery: How modeling has shaped the way we design new drug delivery systems. J Control Release Off J Control Release Soc. 2014;pii: S0168-3659(14)00450-7.

275. Ford Versypt AN, Pack DW, Braatz RD. Mathematical modeling of drug delivery from autocatalytically degradable PLGA microspheres - A review. J Control Release. 2013;165(1):29–37.

276. Li S. Hydrolytic degradation characteristics of aliphatic polyesters derived from lactic and glycolic acids. J Biomed Mater Res. 1999;48(3):342–53.

277. Houchin ML, Topp EM. Chemical degradation of peptides and proteins in PLGA: a review of reactions and mechanisms. J Pharm Sci. 2008;97(7):2395–404.

278. Mundargi RC, Babu VR, Rangaswamy V, Patel P, Aminabhavi TM. Nano/micro technologies for delivering macromolecular therapeutics using poly (D, L-lactide-co-glycolide) and its derivatives. J Control Release. 2008;125(3):193–209.

279. Waeckerle-Men Y, Groettrup M. PLGA microspheres for improved antigen delivery to dendritic cells as cellular vaccines. Adv Drug Deliv Rev. 2005;57(3):475–82.

280. Laeger T, Metges CC, Kuhla B. Role of beta-hydroxybutyric acid in the central regulation of energy balance. Appetite. 2010;54(3):450–5.

281. Dunne M, Corrigan I, Ramtoola Z. Influence of particle size and dissolution conditions on the degradation properties of polylactide-co-glycolide particles. Biomaterials. 2000;21(16):1659–68.

282. Batycky RP, Hanes J, Langer R, Edwards DA. A theoretical model of erosion and macromolecular drug release from biodegrading microspheres. J Pharm Sci. 1997;86(12):1464–77.

283. Benoit MA, Baras B, Gillard J. Preparation and characterization of protein-loaded poly (epsilon-caprolactone) microparticles for oral vaccine delivery. Int J Pharm. 1999;184(1):73–84.

References

181

284. Gao H, Wang Y-N, Fan Y-G, Ma J-B. Conjugates of poly(DL-lactide-co-glycolide) on amino cyclodextrins and their nanoparticles as protein delivery system. J Biomed Mater Res A. 2007;80(1):111–22.

285. Storni T, Kundig T, Senti G, Johansen P. Immunity in response to particulate antigen-delivery systems. Adv Drug Delive Rev. 2005;57(3):333–55.

286. Owens DE, Peppas NA. Opsonization, biodistribution, and pharmacokinetics of polymeric nanoparticles. Int J Pharm. 2006;307(1):93–102.

287. Nilsson B, Ekdahl KN, Mollnes TE, Lambris JD. The role of complement in biomaterial-induced inflammation. Mol Immunol. 2007;44(1-3):82–94.

288. Moghimi SM, Andersen AJ, Ahmadvand D, Wibroe PP, Andresen TL, Hunter AC. Material properties in complement activation. Adv Drug Deliv Rev. 2011;63(12):1000–7.

289. Mosqueira VC, Legrand P, Gulik A, Bourdon O, Gref R, Labarre D, et al. Relationship between complement activation, cellular uptake and surface physicochemical aspects of novel PEG-modified nanocapsules. Biomaterials. 2001;22(22):2967–79.

290. Nicolete R, Santos DF dos, Faccioli LH. The uptake of PLGA micro or nanoparticles by macrophages provokes distinct in vitro inflammatory response. Int Immunopharmacol. 2011;11(10):1557–63.

291. Fischer S, Uetz-von Allmen E, Waeckerle-Men Y, Groettrup M, Merkle HP, Gander B. The preservation of phenotype and functionality of dendritic cells upon phagocytosis of polyelectrolyte-coated PLGA microparticles. Biomaterials. 2007;28(6):994–1004.

292. Yi X, Shi X, Gao H. Cellular Uptake of Elastic Nanoparticles. Phys Rev Lett. 2011;107(9):98101.

293. Tzlil S, Deserno M, Gelbart WM, Ben-Shaul A. A statistical-thermodynamic model of viral budding. Biophys J. 2004;86(4):2037–48.

294. Chithrani BD, Chan WCW. Elucidating the mechanism of cellular uptake and removal of protein-coated gold nanoparticles of different sizes and shapes. Nano Lett. 2007;7(6):1542–50.

295. Gao H, Shi W, Freund LB. Mechanics of receptor-mediated endocytosis. Proc Natl Acad Sci USA. 2005;102(27):9469–74.

296. Sapin A, Garcion E, Clavreul A, Lagarce F, Benoit JP, Menei P. Development of new polymer-based particulate systems for anti-glioma vaccination. Int J Pharm. 2006;309(1-2):1–5.

297. Mottram PL, Leong D, Crimeen-Irwin B, Gloster S, Xiang SD, Meanger J, et al. Type 1 and 2 immunity following vaccination is influenced by nanoparticle size: formulation of a model vaccine for respiratory syncytial virus. Mol Pharm. 2007;4(1):73–84.

298. Ehrlich M, Boll W, van Oijen A, Hariharan R, Chandran K, Nibert ML, et al. Endocytosis by random initiation and stabilization of clathrin-coated pits. Cell. 2004;118(5):591–605.

299. Wang Z, Tiruppathi C, Minshall RD, Malik AB. Size and dynamics of caveolae studied using nanoparticles in living endothelial cells. ACS Nano. 2009;3(12):4110–6.

300. Xiang SD, Scholzen A, Minigo G, David C, Apostolopoulos V, Mottram PL, et al. Pathogen recognition and development of particulate vaccines: Does size matter? Methods. 2006;40(1):1–9.

182

301. Gan Q, Dai D, Yuan Y, Qian J, Sha S, Shi J, et al. Effect of size on the cellular endocytosis and controlled release of mesoporous silica nanoparticles for intracellular delivery. Biomed Microdevices. 2011;14(2):259–70.

302. Cook IF. Evidence based route of administration of vaccines. Hum Vaccin. 2008;4(1):67–73.

303. Johansen P, Mohanan D, Martínez-Gómez JM, Kündig TM, Gander B. Lympho-geographical concepts in vaccine delivery. J Control Release. 2010;148(1):56–62.

304. Villadangos JA, Heath WR. Life cycle, migration and antigen presenting functions of spleen and lymph node dendritic cells: limitations of the Langerhans cells paradigm. Semin Immunol. 2005;17(4):262–72.

305. Wilson NS, El-Sukkari D, Belz GT, Smith CM, Steptoe RJ, Heath WR, et al. Most lymphoid organ dendritic cell types are phenotypically and functionally immature. Blood. 2003;102(6):2187–94.

306. Cho K, Wang X, Nie S, Chen ZG, Shin DM. Therapeutic nanoparticles for drug delivery in cancer. Clin Cancer Res. 2008;14(5):1310–6.

307. Manolova V, Flace A, Bauer M, Schwarz K, Saudan P, Bachmann MF. Nanoparticles target distinct dendritic cell populations according to their size. Eur J Immunol. 2008;38(5):1404–13.

308. Garg K, Mangal S, Khambete H, Sharma K, Tyagi K. Mucosal delivery of vaccines: role of mucoadhesive/biodegradable polymers. Recent Pat Drug Deliv Formul. 2010;4(2):114–28.

309. Foster N, Hirst BH. Exploiting receptor biology for oral vaccination with biodegradable particulates. Adv Drug Deliv Rev. 2005;57(3):431–50.

310. Cone RA. Barrier properties of mucus. Adv Drug Deliv Rev. 2009;61(2):75–85.

311. Chiu YL, Ho YC, Chen YM, Peng SF, Ke CJ, Chen KJ, et al. The characteristics, cellular uptake and intracellular trafficking of nanoparticles made of hydrophobically-modified chitosan. J Control Release. 2010;146(1):152–9.

312. Zhao F, Zhao Y, Liu Y, Chang X, Chen C, Zhao Y. Cellular uptake, intracellular trafficking, and cytotoxicity of nanomaterials. Small. 2011;7(10):1322–37.

313. Rogers TH, Babensee JE. The role of integrins in the recognition and response of dendritic cells to biomaterials. Biomaterials. 2010;32:1270–9.

314. Foged C, Brodin B, Frokjaer S, Sundblad A. Particle size and surface charge affect particle uptake by human dendritic cells in an in vitro model. Int J Pharm. 2005;298(2):315–22.

315. Vasir JK, Labhasetwar V. Quantification of the force of nanoparticle-cell membrane interactions and its influence on intracellular trafficking of nanoparticles. Biomaterials. 2008;29(31):4244–52.

316. Thurn KT, Brown EM, Wu A, Vogt S, Lai B, Maser J, et al. Nanoparticles for applications in cellular imaging. Nanoscale Res Lett. 2007;2(9):430–41.

317. Liu J, Bauer H, Callahan J, Kopecková P, Pan H, Kopecek J. Endocytic uptake of a large array of HPMA copolymers: Elucidation into the dependence on the physicochemical characteristics. J Control Release. 2010;143(1):71–9.

References

183

318. Yue ZG, Wei W, Lv PP, Yue H, Wang LY, Su ZG, et al. Surface Charge Affects Cellular Uptake and Intracellular Trafficking of Chitosan-based Nanoparticles. Biomacromolecules. 2011;12(7):2440–6.

319. Panyam M J, Zhou WENZ, Prabha S, Sahoo SK, Labhase V. Rapid endo-lysosomal escape of poly (DL-lactide-co-glycolide) nanoparticles: implications for drug and gene delivery. FASEB J. 2002;16(10):1217–26.

320. Danhier F, Lecouturier N, Vroman B, Jér me C, Marchand-Brynaert J, Feron O, et al. Paclitaxel-loaded PEGylated PLGA-based nanoparticles: in vitro and in vivo evaluation. J Control Release. 2009;133(1):11–7.

321. Van den Berg JH, Oosterhuis K, Hennink WE, Storm G, van der Aa LJ, Engbersen JF, et al. Shielding the cationic charge of nanoparticle-formulated dermal DNA vaccines is essential for antigen expression and immunogenicity. J Control Release. 2010;141(2):234–40.

322. Florindo HF, Pandit S, Gonçalves LMD, Alpar HO, Almeida AJ. Surface modified polymeric nanoparticles for immunisation against equine strangles. Int J Pharm. 2010;390(1):25–31.

323. Tahara K, Sakai T, Yamamoto H, Takeuchi H, Hirashima N, Kawashima Y. Improved cellular uptake of chitosan-modified PLGA nanospheres by A549 cells. Int J Pharm. 2009;382(1-2):198–204.

324. Sirsi SR, Schray RC, Wheatley MA, Lutz GJ. Formulation of polylactide-co-glycolic acid nanospheres for encapsulation and sustained release of poly(ethylene imine)-poly(ethylene glycol) copolymers complexed to oligonucleotides. J Nanobiotechnology. 2009;7(1):1.

325. Venkataraman S, Hedrick JL, Ong ZY, Chuan Y, Ee PL, Hammond PT, et al. The effects of polymeric nanostructure shape on drug delivery. Adv Drug Deliv Rev. 2011;63(14-15):1228–46.

326. Arnida, Janát-Amsbury MM, Ray A, Peterson CM, Ghandehari H. Geometry and surface characteristics of gold nanoparticles influence their biodistribution and uptake by macrophages. Eur J Pharm Biopharm. 2011;77(3):417–23.

327. Heng BC, Zhao X, Tan EC, Khamis N, Assodani A, Xiong S, et al. Evaluation of the cytotoxic and inflammatory potential of differentially shaped zinc oxide nanoparticles. Arch Toxicol. 2011;85(12):1517–28.

328. Alexis F, Pridgen E, Molnar LK, Farokhzad OC. Factors affecting the clearance and biodistribution of polymeric nanoparticles. Mol Pharm. 2008;5(4):505–15.

329. Reddy ST, Rehor A, Schmoekel HG, Hubbell JA, Swartz MA. In vivo targeting of dendritic cells in lymph nodes with poly(propylene sulfide) nanoparticles. J Control Release Off J Control Release Soc. 1 de Maio de 2006;112(1):26–34.

330. Matsumura Y, Maeda H. A new concept for macromolecular therapeutics in cancer chemotherapy: mechanism of tumoritropic accumulation of proteins and the antitumor agent smancs. Cancer Res. 1986;46(12 Pt 1):6387–92.

331. Upreti M, Jyoti A, Sethi P. Tumor microenvironment and nanotherapeutics. Transl Cancer Res. 2013;2(4):309–19.

332. Goubran HA, Kotb RR, Stakiw J, Emara ME, Burnouf T. Regulation of tumor growth and metastasis: the role of tumor microenvironment. Cancer Growth Metastasis. 2014;7:9–18.

184

333. Kelly C, Jefferies C, Cryan SA. Targeted Liposomal Drug Delivery to Monocytes and Macrophages. J Drug Deliv. 2011;2011:727241.

334. Burgdorf S, Kurts C. Endocytosis mechanisms and the cell biology of antigen presentation. Curr Opin Immunol. 2008;20(1):89–95.

335. Fernandez-Megia E, Novoa-Carballal R, Quiñoá E, Riguera R. Conjugation of bioactive ligands to PEG-grafted chitosan at the distal end of PEG. Biomacromolecules. 2007;8(3):833–42.

336. Kadowaki N, Ho S, Antonenko S, de Waal Malefyt R, Kastelein RA, Bazan F, et al. Subsets of human dendritic cell precursors express different toll-like receptors and respond to different microbial antigens. J Exp Med. 2001;194(6):863–70.

337. Hamdy S, Elamanchili P, Alshamsan A, Molavi O, Satou T, Samuel J. Enhanced antigen specific primary CD4+ and CD8+ responses by codelivery of ovalbumin and toll like receptor ligand monophosphoryl lipid A in poly (D, L lactic co glycolic acid) nanoparticles. J Biomed Mater Res A. 2007;81(3):652–62.

338. Hamdy S, Haddadi A, Shayeganpour A, Samuel J, Lavasanifar A. Activation of Antigen-Specific T Cell-Responses by Mannan-Decorated PLGA Nanoparticles. Pharm Res. 2011;28(9):2288–301.

339. Fievez V, Plapied L, Des Rieux A, Pourcelle V, Freichels H, Wascotte V, et al. Targeting nanoparticles to M cells with non-peptidic ligands for oral vaccination. Eur J Pharm Biopharm. 2009;73(1):16–24.

340. Cruz LJ, Tacken PJ, Fokkink R, Joosten B, Stuart MC, Albericio F, et al. Targeted PLGA nano-but not microparticles specifically deliver antigen to human dendritic cells via DC-SIGN in vitro. J Control Release. 2010;144(2):118–26.

341. Mishra N, Tiwari S, Vaidya B, Agrawal GP, Vyas SP. Lectin anchored PLGA nanoparticles for oral mucosal immunization against hepatitis B. J Drug Target. 2010;19(1):67–78.

342. Bandyopadhyay A, Fine RL, Demento S, Bockenstedt LK, Fahmy TM. The impact of nanoparticle ligand density on dendritic-cell targeted vaccines. Biomaterials. 2011;32(11):3094–105.

343. Scott CJ, Marouf WM, Quinn DJ, Buick RJ, Orr SJ, Donnelly RF, et al. Immunocolloidal targeting of the endocytotic siglec-7 receptor using peripheral attachment of siglec-7 antibodies to poly (lactide-co-glycolide) nanoparticles. Pharma Res. 2008;25(1):135–46.

344. Rajapaksa TE, Stover-Hamer M, Fernandez X, Eckelhoefer HA, Lo DD. Claudin 4-targeted protein incorporated into PLGA nanoparticles can mediate M cell targeted delivery. J Control Release. 2010;142(2):196–205.

345. Molavi O, Mahmud A, Hamdy S, Hung RW, Lai R, Samuel J, et al. Development of a Poly (d, l-lactic-co-glycolic acid) Nanoparticle Formulation of STAT3 Inhibitor JSI-124: Implication for Cancer Immunotherapy. Mol Pharm. 2010;7(2):364–74.

346. Molavi O, Ma Z, Hamdy S, Lavasanifar A, Samuel J. Immunomodulatory and anticancer effects of intra-tumoral co-delivery of synthetic lipid A adjuvant and STAT3 inhibitor, JSI-124. Immunopharmacol Immunotoxicol. 2009;31(2):214–21.

347. Unger WWJ, van Kooyk Y. «Dressed for success» C-type lectin receptors for the delivery of glyco-vaccines to dendritic cells. Curr Opin Immunol. 2010;23(1):131–7.

References

185

348. Flacher V, Tripp CH, Stoitzner P, Haid B, Ebner S, Del Frari B, et al. Epidermal Langerhans cells rapidly capture and present antigens from C-type lectin-targeting antibodies deposited in the dermis. J Invest Dermatol. 2009;130(3):755–62.

349. Liu G, Zhang L, Zhao Y. Modulation of immune responses through direct activation of Toll like receptors to T cells. Clin Exp Immunol. 2010;160(2):168–75.

350. Bekeredjian Ding I, Jego G. Toll like receptors–sentries in the B cell response. Immunology. 2009;128(3):311–23.

351. Van Kooyk Y. C-type lectins on dendritic cells: key modulators for the induction of immune responses. Biochem Soc Trans. 2008;36(Pt 6):1478–81.

352. Gazi U, Martinez-Pomares L. Influence of the mannose receptor in host immune responses. Immunobiology. 2009;214(7):554–61.

353. Burgdorf S, Kautz A, Böhnert V, Knolle PA, Kurts C. Distinct pathways of antigen uptake and intracellular routing in CD4 and CD8 T cell activation. Science. 2007;316(5824):612–6.

354. Tel J, Benitez Ribas D, Hoosemans S, Cambi A, Adema GJ, Figdor CG, et al. DEC 205 mediates antigen uptake and presentation by both resting and activated human plasmacytoid dendritic cells. Eur J Immunol. 2011;41(4):1014–23.

355. O’Reilly MK, Paulson JC. Siglecs as targets for therapy in immune-cell-mediated disease. Trends Pharmacol Sci. 2009;30(5):240–8.

356. Jandus C, Simon HU, von Gunten S. Targeting Siglecs--A novel pharmacological strategy for immuno-and glycotherapy. Biochem Pharmacol. 2011;82(4):323–32.

357. Von Gunten S, Bochner BS. Basic and clinical immunology of Siglecs. Ann N Acad Sci. 2008;1143:61–82.

358. Collins BE, Paulson JC. Cell surface biology mediated by low affinity multivalent protein-glycan interactions. Curr Opin Chem Biol. 2004;8(6):617–25.

359. Joshi MD, Unger WWJ, Litjens M, van Bloois L, Kalay H, van Kooyk Y, et al. DC-SIGN mediated antigen-targeting using glycan-modified liposomes: Formulation considerations. Int J Pharm. 2011;416(2):426–32.

360. Neutra MR, Kozlowski PA. Mucosal vaccines: the promise and the challenge. Nat Rev Immunol. 2006;6(2):148–58.

361. Des Rieux A, Fievez V, Garinot M, Schneider YJ, Préat V. Nanoparticles as potential oral delivery systems of proteins and vaccines: a mechanistic approach. J Control Release. 2006;116(1):1–27.

362. Barczyk M, Carracedo S, Gullberg D. Integrins. Cell Tissue Res. 2010;339(1):269–80.

363. Peter Y, Goodenough D. Claudins. Curr Biol. 2004;14(8):R293–4.

364. Florindo H, Pandit S, Lacerda L, Gonçalves L, Alpar H, Almeida A. The enhancement of the immune response against S. equi antigens through the intranasal administration of poly--caprolactone-based nanoparticles. Biomaterials. 2009;30(5):879–91.

365. Watts PJ, Smith A. Re-formulating drugs and vaccines for intranasal delivery: maximum benefits for minimum risks? Drug Discov Today. 2011;16(1-2):4–7.

186

366. Krauland AH, Guggi D, Bernkop-Schnürch A. Thiolated chitosan microparticles: a vehicle for nasal peptide drug delivery. Int J Pharm. 2006;307(2):270–7.

367. Alpar HO, Eyles JE, Williamson ED, Somavarapu S. Intranasal vaccination against plague, tetanus and diphtheria. Adv Drug Deliv Rev. 2001;51(1-3):173–201.

368. Titball RW. Vaccines against intracellular bacterial pathogens. Drug Discov Today. 2008;13(13-14):596–600.

369. Schenkel JM, Fraser KA, Vezys V, Masopust D. Sensing and alarm function of resident memory CD8(+) T cells. Nat Immunol. 2013;14(5):509–13.

370. Igietseme JU, Eko FO, He Q, Black CM. Antibody regulation of Tcell immunity: implications for vaccine strategies against intracellular pathogens. Exp Rev Vaccines. 2004;3(1):23–34.

371. Casadevall A, Pirofski L. Antibody-mediated regulation of cellular immunity and the inflammatory response. Trends Immunol. 2003;24(9):474–8.

372. McEwan WA, Mallery DL, Rhodes DA, Trowsdale J, James LC. Intracellular antibody-mediated immunity and the role of TRIM21. BioEssays. 2011;33(11):803–9.

373. Manish M, Rahi A, Kaur M, Bhatnagar R, Singh S. A Single-Dose PLGA Encapsulated Protective Antigen Domain 4 Nanoformulation Protects Mice against Bacillus anthracis Spore Challenge. PloS One. 2013;8(4):e61885.

374. Camejo A, Carvalho F, Reis O, Leitão E, Sousa S, Cabanes D. The arsenal of virulence factors deployed by Listeria monocytogenes to promote its cell infection cycle. Virulence. 2011;2(5):379–94.

375. Barat S, Willer Y, Rizos K, Claudi B, Mazé A, Schemmer AK, et al. Immunity to intracellular Salmonella depends on surface-associated antigens. PLoS Pathog. 2012;8(10):e1002966.

376. Zepp F. Principles of vaccine design—Lessons from nature. Vaccine. 2010;28:C14–C24.

377. Florindo H, Pandit S, Goncalves L, Alpar H, Almeida A. S. equi antigens adsorbed onto surface modified poly-epsilon-caprolactone microspheres induce humoral and cellular specific immune responses. Vaccine. 2008;26(33):4168–77.

378. Guo C, Gemeinhart RA. Understanding the adsorption mechanism of chitosan onto poly(lactide-co-glycolide) particles. Eur J Pharm Biopharm. 2008;70(2):597–604.

379. Roth-Walter F, Schöll I, Untersmayr E, Ellinger A, Boltz-Nitulescu G, Scheiner O, et al. Mucosal targeting of allergen-loaded microspheres by Aleuria aurantia lectin. Vaccine. 2005;23(21):2703–10.

380. Gómez JMM, Fischer S, Csaba N, Kündig TM, Merkle HP, Gander B, et al. A Protective Allergy Vaccine Based on CpG- and Protamine-Containing PLGA Microparticles. Pharm Res. 2007;24(10):1927–35.

381. Weiss R, Scheiblhofer S, Machado Y, Thalhamer J. New approaches to transcutaneous immunotherapy: targeting dendritic cells with novel allergen conjugates. Curr Opin Allergy Clin Immunol. 2013;13(6):669–76.

382. Tafaghodi M, Eskandari M, Kharazizadeh M, Khamesipour A, Jaafari MR. Immunization against leishmaniasis by PLGA nanospheres loaded with an experimental autoclaved Leishmania major (ALM) and Quillaja saponins. Trop Biomed. 2010;27(3):639–50.

References

187

383. Anish C, Goswami DG, Kanchan V, Mathew S, Panda AK. The immunogenic characteristics associated with multivalent display of Vi polysaccharide antigen using biodegradable polymer particles. Biomaterials. 2012;33(28):6843–57.

384. Ma W, Chen, Kaushal, McElroy, Zhang, Ozkan, et al. PLGA nanoparticle-mediated delivery of tumor antigenic peptides elicits effective immune responses. Int J Nanomedicine. 2012;7:1475–87.

385. Díez S, Navarro G, de ILarduya CT. In vivo targeted gene delivery by cationic nanoparticles for treatment of hepatocellular carcinoma. J Gene Med. 2009;11(1):38–45.

386. Loucq C. Vaccines today, vaccines tomorrow: a perspective. Clin Expl Vaccine Res. 2013;2(1):4.

387. Lewis K. Platforms for antibiotic discovery. Nat Rev Drug Discov. 2013;12(5):371–87.

388. FDA. FDA Guidance documents for anti-microbial clinical development [Internet]. 2013. Obtido de: http://www.fda.gov/Drugs/GuidanceComplianceRegulatoryInformation/Guidances/ucm064980.htm.

389. European Medicines Agency, Committee for Medicinal Products for Human Use (CHMP),. Guideline on the evaluation of medicinal products indicated for treatment of bacterial infections. [Internet]. Obtido de: http://www.ema.europa.eu/docs/en_GB/document_library/Scientific_guideline/2009/09/WC500003417.pdf.

390. Sathish JG, Sethu S, Bielsky M-C, de Haan L, French NS, Govindappa K, et al. Challenges and approaches for the development of safer immunomodulatory biologics. Nat Rev Drug Discov. 2013;12(4):306–24.

391. McNeil SE. Nanoparticle therapeutics: a personal perspective. Wiley Interdiscip Rev Nanomed Nanobiotechnol. 2009;1(3):264–71.

392. Zolnik BS, González-Fernández A, Sadrieh N, Dobrovolskaia MA. Nanoparticles and the immune system. Endocrinology. 2010;151(2):458–65.

393. Gaspar R. Regulatory issues surrounding nanomedicines: setting the scene for the next generation of nanopharmaceuticals. Nanomedicine Lond. 2007;2(2):143–7.

394. Gaspar R, Duncan R. Polymeric carriers: Preclinical safety and the regulatory implications for design and development of polymer therapeutics. Adv Drug Deliv Rev. 2009;61(13):1220–31.

395. Bowman D, Maynard A, Gaspar R. Chapter 14: Therapeutic products: regulating drugs and medical devices. International Handbook on Regulating Nanotechnologies. Northampton, MA: Edward Elgar Pub; 2010. p. 291– 320.

396. European Medicines Agency C. Vaccines Working Party – «Workplan for 2013» [Internet]. 2013. Obtido de: http://www.ema.europa.eu/docs/en_GB/document_library/Work_programme/2010/02/WC500073590.pdf

397. European Medicines Agency C. Note For Guidance on the Clinical Evaluation of Vaccines [Internet]. (EMEA/CHMP/VWP/164653/2005; 2005. Obtido de: http://www.ema.europa.eu/docs/en_GB/document_library/Scientific_guideline/2009/09/WC500003875.pdf

188

398. European Medicines Agency C. Guideline on Adjuvants in Vaccines for Human Use [Internet]. EMEA/CHMP/VEG/134716/2004; 2005. Obtido de: http://www.ema.europa.eu/docs/en_GB/document_library/Scientific_guideline/2009/09/WC500003809.pdf

399. Food and Drugs Administration O of C, Tissue and Gene Therapies. Clinical Considerations for Therapeutic Cancer Vaccines [Internet]. FDA’s Center for Biologics Evaluation and Research; 2013. Obtido de: (http://www.fda.gov/downloads/biologicsbloodvaccines/guidancecomplianceregulatoryinformation/guidances/vaccines/ucm278673.pdf )

400. França RFO, da Silva CC, De Paula SO. Recent advances in molecular medicine techniques for the diagnosis, prevention, and control of infectious diseases. Eur J Clin Microbiol Infect Dis Off Publ Eur Soc Clin Microbiol. 2013;32(6):723–8.

401. Macho Fernandez E, Chang J, Fontaine J, Bialecki E, Rodriguez F, Werkmeister E, et al. Activation of invariant Natural Killer T lymphocytes in response to the α-galactosylceramide analogue KRN7000 encapsulated in PLGA-based nanoparticles and microparticles. Int J Pharm. 2012;423(1):45–54.

402. Freichels H, Pourcelle V, Le Duff CS, Marchand Brynaert J, Jérôme C. «Clip» and «Click» Chemistries Combination: Toward Easy PEGylation of Degradable Aliphatic Polyesters. Macromol Rapid Commun. 2011;32(7):616–21.

403. Vangeyte P, Leyh B, Heinrich M, Grandjean J, Bourgaux C, Jérôme R. Self-assembly of poly(ethylene oxide)-b-poly(epsilon-caprolactone) copolymers in aqueous solution. Langmuir. 2004;20(20):8442–51.

404. Freichels H, Danhier F, Préat V, Lecomte P, Jérôme C. Fluorescent labeling of degradable poly (lactide-co-glycolide) for cellular nanoparticles tracking in living cells. Int J Artif Organs. 2011;34(2):152–60.

405. Afonso CA, Santhakumar V, Lough A, Batey RA. An Expedient Synthesis of Cationic Rhodamine Fluorescent Probes Suitable for Conjugation to Amino Acids and Peptides. Synthesis. 2003;(17):2647–54.

406. Rieger J, Freichels H, Imberty A, Putaux JL, Delair T, Je ro me C, et al. Polyester nanoparticles presenting mannose residues: toward the development of new vaccine delivery systems combining biodegradability and targeting properties. Biomacromolecules. 2009;10(3):651–7.

407. Inaba K, Inaba M, Romani N, Aya H, Deguchi M, Ikehara S, et al. Generation of large numbers of dendritic cells from mouse bone marrow cultures supplemented with granulocyte/macrophage colony-stimulating factor. J Exp Med. 1992;176(6):1693–702.

408. Ashany D, Savir A, Bhardwaj N, Elkon KB. Dendritic cells are resistant to apoptosis through the Fas (CD95/APO-1) pathway. J Immunol. 1999;163(10):5303–11.

409. Wang X, Ramström O, Yan M. Dynamic light scattering as an efficient tool to study glyconanoparticle-lectin interactions. Analyst. 2011;136(20):4174–8.

410. Haspot F, Lavault A, Sinzger C, Laib Sampaio K, Stierhof Y-D, Pilet P, et al. Human cytomegalovirus entry into dendritic cells occurs via a macropinocytosis-like pathway in a pH-independent and cholesterol-dependent manner. PloS One. 2012;7(4):e34795.

411. Bhattacharyya S, Warfield KL, Ruthel G, Bavari S, Aman MJ, Hope TJ. Ebola virus uses clathrin-mediated endocytosis as an entry pathway. Virology. 2010;401(1):18–28.

References

189

412. Hirosue S, Kourtis IC, van der Vlies AJ, Hubbell JA, Swartz MA. Antigen delivery to dendritic cells by poly(propylene sulfide) nanoparticles with disulfide conjugated peptides: Cross-presentation and T cell activation. Vaccine. 2010;28(50):7897–906.

413. Autenrieth SE, Autenrieth IB. Variable antigen uptake due to different expression of the macrophage mannose receptor by dendritic cells in various inbred mouse strains. Immunology. 2009;127(4):523–9.

414. Costes SV, Daelemans D, Cho EH, Dobbin Z, Pavlakis G, Lockett S. Automatic and quantitative measurement of protein-protein colocalization in live cells. Biophys J. 2004;86(6):3993–4003.

415. Norbury CC. Drinking a lot is good for dendritic cells. Immunology. 2006;117(4):443–51.

416. Dos Santos T, Varela J, Lynch I, Salvati A, Dawson KA. Effects of Transport Inhibitors on the Cellular Uptake of Carboxylated Polystyrene Nanoparticles in Different Cell Lines. Schnur JM, editor. PLoS ONE. 2011;6(9):e24438.

417. Ahsan F, Rivas IP, Khan MA, Torres Suarez AI. Targeting to macrophages: role of physicochemical properties of particulate carriers--liposomes and microspheres--on the phagocytosis by macrophages. J Control Release. 2002;79(1-3):29–40.

418. Platt CD, Ma JK, Chalouni C, Ebersold M, Bou-Reslan H, Carano RAD, et al. Mature dendritic cells use endocytic receptors to capture and present antigens. Proc Natl Acad Sci U A. 2010;107(9):4287–92.

419. Mollica F, Biondi M, Muzzi S, Ungaro F, Quaglia F, Rotonda MI, et al. Mathematical modelling of the evolution of protein distribution within single PLGA microspheres: prediction of local concentration profiles and release kinetics. J Mater Sci Mater Med. 2007;19(4):1587–93.

420. Shan X, Yuan Y, Liu C, Tao X, Sheng Y, Xu F. Influence of PEG chain on the complement activation suppression and longevity in vivo prolongation of the PCL biomedical nanoparticles. Biomed Microdevices. 2009;11(6):1187–94.

421. Jiang X, Shen C, Rey-Ladino J, Yu H, Brunham RC. Characterization of Murine Dendritic Cell Line JAWS II and Primary Bone Marrow-Derived Dendritic Cells in Chlamydia muridarum Antigen Presentation and Induction of Protective Immunity. Infec Immun. 2008;76(6):2392–401.

422. Mendoza L, Bubeník J, Símová J, Jandlová T, Vonka V, Mikysková R. Prophylactic, therapeutic and anti-metastatic effects of BMDC and DC lines in mice carrying HPV 16-associated tumours. Int J Oncol. 2003;23(1):243–7.

423. Horak D, Babic M, Jendelová P, Herynek V, Trchová M, Pientka Z, et al. D-mannose-modified iron oxide nanoparticles for stem cell labeling. Bioconjug Chem. 2007;18(3):635–44.

424. Stefanick JF, Ashley JD, Kiziltepe T, Bilgicer B. A systematic analysis of peptide linker length and liposomal polyethylene glycol coating on cellular uptake of peptide-targeted liposomes. ACS Nano. 2013;7(4):2935–47.

425. Tirosh O, Barenholz Y, Katzhendler J, Priev A. Hydration of polyethylene glycol-grafted liposomes. Biophys J. 1998;74(3):1371–9.

426. Shedlock DJ, Shen H. Requirement for CD4 T cell help in generating functional CD8 T cell memory. Science. 2003;300(5617):337–9.

190

427. Vujanovic L, Butterfield LH. Melanoma cancer vaccines and anti tumor T cell responses. J Cell Biochem. 2007;102(2):301–10.

428. Hamdy S, Elamanchili P, Alshamsan A, Molavi O, Satou T, Samuel J. Enhanced antigen specific primary CD4+ and CD8+ responses by codelivery of ovalbumin and toll like receptor ligand monophosphoryl lipid A in poly (D, L lactic co glycolic acid) nanoparticles. J Biomed Mater Res A. 2007;81(3):652–62.

429. Adamina M, Bolli M, Albo F, Cavazza A, Zajac P, Padovan E, et al. Encapsulation into sterically stabilised liposomes enhances the immunogenicity of melanoma-associated Melan-A/MART-1 epitopes. Br J Cancer. 2004;90(1):263–9.

430. Hafner AM, Corthesy B, Textor M, Merkle HP. Tuning the immune response of dendritic cells to surface-assembled poly (I: C) on microspheres through synergistic interactions between phagocytic and TLR3 signaling. Biomaterials. 2011;32(10):2651–61.

431. Kalariya M, Ganta S, Amiji M. Multi-Compartmental Vaccine Delivery System for Enhanced Immune Response to gp100 Peptide Antigen in Melanoma Immunotherapy. Pharm Res. 2012;29(12):3393–403.

432. Schreibelt G, Tel J, Sliepen KH, Benitez-Ribas D, Figdor CG, Adema GJ, et al. Toll-like receptor expression and function in human dendritic cell subsets: implications for dendritic cell-based anti-cancer immunotherapy. Cancer Immunol Immunother. 2010;59(10):1573–82.

433. Schumacher R, Amacker M, Neuhaus D, Rosenthal R, Groeper C, Heberer M, et al. Efficient induction of tumoricidal cytotoxic T lymphocytes by HLA-A0201 restricted, melanoma associated, L (27) Melan-A/MART-1 (26-35) peptide encapsulated into virosomes in vitro. Vaccine. 2005;23(48-9):5572.

434. He LZ, Crocker A, Lee J, Mendoza-Ramirez J, Wang XT, Vitale LA, et al. Antigenic targeting of the human mannose receptor induces tumor immunity. J Immunol. 2007;178(10):6259–67.

435. Barnden MJ, Allison J, Heath WR, Carbone FR. Defective TCR expression in transgenic mice constructed using cDNA-based alpha- and beta-chain genes under the control of heterologous regulatory elements. Immunol Cell Biol. 1998;76(1):34–40.

436. Leung S, Smith D, Myc A, Morry J, Baker JR. OT-II TCR transgenic mice fail to produce anti-ovalbumin antibodies upon vaccination. Cell Immunol. 2013;282(2):79–84.

437. Yewdell JW, Bennink JR. Immunodominance in major histocompatibility complex class I-restricted T lymphocyte responses. Annu Rev Immunol. 1999;17:51–88.

438. Lee Y-R, Lee Y-H, Im S-A, Yang I-H, Ahn GW, Kim K, et al. Biodegradable nanoparticles containing TLR3 or TLR9 agonists together with antigen enhance MHC-restricted presentation of the antigen. Arch Pharm Res. 2010;33(11):1859–66.

439. Bourgeois C, Veiga Fernandes H, Joret AM, Rocha B, Tanchot C. CD8 lethargy in the absence of CD4 help. Eur J Immunol. 2002;32(8):2199–207.

440. Crow MK. Modification of accessory molecule signaling. Springer Semin Immunopathol. 2006;27(4):409–24.

441. Hu X, Chakraborty NG, Sporn JR, Kurtzman SH, Ergin MT, Mukherji B. Enhancement of cytolytic T lymphocyte precursor frequency in melanoma patients following immunization with the MAGE-1 peptide loaded antigen presenting cell-based vaccine. Cancer Res. 1996;56(11):2479–83.

References

191

442. Yamada A, Sasada T, Noguchi M, Itoh K. Next-generation peptide vaccines for advanced cancer. Cancer Sci. 2013;104(1):15–21.

443. Cawood R, Hills T, Wong SL, Alamoudi AA, Beadle S, Fisher KD, et al. Recombinant viral vaccines for cancer. Trends Mol Med. 2012;18(9):564–74.

444. Sondak VK, Liu P-Y, Tuthill RJ, Kempf RA, Unger JM, Sosman JA, et al. Adjuvant immunotherapy of resected, intermediate-thickness, node-negative melanoma with an allogeneic tumor vaccine: overall results of a randomized trial of the Southwest Oncology Group. J Clin Oncol Off J Am Soc Clin Oncol. 2002;20(8):2058–66.

445. Sosman JA, Unger JM, Liu P-Y, Flaherty LE, Park MS, Kempf RA, et al. Adjuvant immunotherapy of resected, intermediate-thickness, node-negative melanoma with an allogeneic tumor vaccine: impact of HLA class I antigen expression on outcome. J Clin Oncol Off J Am Soc Clin Oncol. 2002;20(8):2067–75.

446. NIH. www.clinicaltrials.gov. National Institutes of Health; 2014.

447. Paulis LE, Mandal S, Kreutz M, Figdor CG. Dendritic cell-based nanovaccines for cancer immunotherapy. Curr Opin Immunol. 2013;25(3):389–95.

448. Duncan R, Richardson SCW. Endocytosis and Intracellular Trafficking as Gateways for Nanomedicine Delivery: Opportunities and Challenges. Mol Pharm. 2012;9(9):2380–402.

449. Demento SL, Eisenbarth SC, Foellmer HG, Platt C, Caplan MJ, Mark Saltzman W, et al. Inflammasome-activating nanoparticles as modular systems for optimizing vaccine efficacy. Vaccine. 2009;27(23):3013–21.

450. Nakamura K, Yoshikawa N, Yamaguchi Y, Kagota S, Shinozuka K, Kunitomo M. Characterization of mouse melanoma cell lines by their mortal malignancy using an experimental metastatic model. Life Sci. 2002;70(7):791–8.

451. Greten TF, Jaffee EM. Cancer vaccines. J Clin Oncol Off J Am Soc Clin Oncol. 1999;17(3):1047–60.

452. Phan GQ, Touloukian CE, Yang JC, Restifo NP, Sherry RM, Hwu P, et al. Immunization of patients with metastatic melanoma using both class I- and class II-restricted peptides from melanoma-associated antigens. J Immunother Hagerstown Md 1997. 2003;26(4):349–56.

453. Men Y, Miconnet I, Valmori D, Rimoldi D, Cerottini JC, Romero P. Assessment of immunogenicity of human Melan-A peptide analogues in HLA-A*0201/Kb transgenic mice. J Immunol Baltim Md 1950. 1999;162(6):3566–73.

454. Elliott RL. Combination cancer immunotherapy «Expanding Paul Ehrlich’s Magic Bullet Concept». Surg Oncol. 2012;21(1):53–5.

455. Azijli K, Stelloo E, Peters GJ, van Den Eertwegh AJM. New developments in the treatment of metastatic melanoma: immune checkpoint inhibitors and targeted therapies. Anticancer Res. 2014;34(4):1493–505.

456. Kohlmeyer J, Cron M, Landsberg J, Bald T, Renn M, Mikus S, et al. Complete Regression of Advanced Primary and Metastatic Mouse Melanomas following Combination Chemoimmunotherapy. Cancer Res. 2009;69(15):6265–74.

457. John J, Ismail M, Riley C, Askham J, Morgan R, Melcher A, et al. Differential effects of Paclitaxel on dendritic cell function. BMC Immunol. 2010;11:14.

192

458. Sheng Sow H, Mattarollo SR. Combining low-dose or metronomic chemotherapy with anticancer vaccines: A therapeutic opportunity for lymphomas. OncoImmunology. 2013;2(12):e27058.

459. Ashworth MT, Daud AI. Combinatorial approach to treatment of melanoma. Hematol Oncol Clin North Am. 2014;28(3):601–12.

Curriculum vitae

193

Curriculum vitae

Academic degrees

Master in Pharmaceutical Sciences, Faculty of Pharmacy University of Lisbon,

Portugal, April 2009 (Final Classification: 16/20).

Current scientific/professional position

• PhD student (supervisors: Prof. Helena Florindo, Prof. Mafalda Videira, Prof.

Véronique Préat), Faculty of Pharmacy University of Lisbon, January 2010/2014. Expected

conclusion date: 3rd October 2014.

Domain of specializations: Pharmacy - Pharmaceutical Technology. Specialization on

cancer therapeutic vaccines: development of a dendritic cell-targeted peptide vaccine through

the coencapsulation of tumor antigens and adjuvants using biodegradable polymeric

nanoparticles with different functionalizations. Intracellular traffic and endocytic mechanisms

of nanocarriers and their interaction with biological membranes. Immunological mechanisms

induced by different nanoparticulate vaccines and in vivo therapeutic potential.

Host Labs:

InTraCell_ADD: Intracellular Trafficking Modulation for Advance Drug Delivery

Group

Instituto de Investigação do Medicamento (iMed-ULisboa)

Faculdade de Farmácia da Universidade de Lisboa

Av. Prof. Gama-Pinto 1649-003 Lisbon

Portugal

&

Advanced Drug Delivery and Biomaterials

Louvain Drug Research Institute (LDRI)

Université Catholique de Louvain

Avenue Mounier, Van Helmont Tower

73, bte B1.73.12, 1200 Woluwe-Saint-Lambert

Brussels, Belgium.

• Postdoctoral fellow at the McKetta Department of Biomedical Engineering,

Cockrell School of Engineering, The University of Texas at Austin, USA, under the

supervision of prof. Nicholas A. Peppas (20th October 2014 – (…)).

194

Scientific papers in peer-review international journals

1. Silva JM, Vandermeulen G, Pinto SN, Rodrigues C, Salgado A, Afonso CA, Viana

A, Jérôme C, Silva LC, Préat V and Florindo HF. Development of Functionalized

Nanoparticles for Vaccine Delivery to Dendritic Cells: a Mechanistic Approach,

Nanomedicines – Nanotechnology for Vaccine Development Special Issue, 2014 (accepted).

(IF 5.26)

2. Zupancic E, Silva JM, Videira M, Moreira JN, Florindo HF, Design of a novel

nanoparticulate platform to deliver tumor associated antigens, Procedia in Vaccinology, 2014,

DOI: 10.1016/j.provac.2014.07.011.

3. Silva JM, Videira M, Gaspar R, Préat V, Florindo HF, Immune System Targeting by

Nanoparticles for Cancer Vaccines. J Control Release, 2013, 168(2):179-99. DOI:

10.1016/j.jconrel.2013.03.010. (IF 7.63)

4. Danhier F, Ansorena E, Silva JM, Coco R, Le Breton A, Préat V, PLGA-based

nanoparticles: an overview of biomedical applications, J Control Release, 2012, 161(2):505-

22. DOI: 10.1016/j.jconrel.2012.01.043. Invited Review. (IF 7.63)

Scientific papers in preparation:

1. Silva JM, Zupancic E, Vandermeulen G, Oliveira VG, Salgado A, Videira M,

Gaspar M, Graca L, Préat V and Florindo HF, Combination of peptides and adjuvants in

mannose-functionalized NPs for melanoma immunotherapy, J Control Release, 2014

(submitted). (IF 7.63)

2. Peres C, Matos A, Conniot J, Zupancic E, Sainz V, Silva JM and Florindo HF,

Poly(lactic acid) nanomedicines: a potential vaccine delivery system, Wiley Interdisciplin

Rev Nanomed Nanobiotechnol – (in final preparation). (IF 5.68)

3.

Book chapters

1. Silva JM, Zupancic E, Peres C, Silva LC, Gaspar R, Préat V and Florindo HF,

Immunomodulation against microbial pathogens through dendritic cells, In: Microbial

pathogens and strategies for combating them: science, technology and education (A. Méndez-

Vilas, Ed., Formatex Research Center, Badajoz, Spain, 2013, pp. 1686-1705. ISBN (13)

Volume 3: 978-84-942134-1-0. - Invited Book Chapter.

2. Silva JM, Préat V, Florindo HF, Role of the Aliphatic Polyesters as Particulate

Vaccine Delivery Systems, In: Encyclopedia of Biomedical Polymers and Polymeric

Curriculum vitae

195

Biomaterials, Taylor & Francis Editorial Group, London, UK, 2014 [In Press] - Invited Book

Chapter.

Grants and prizes

1. II Simpósio Nacional de Nanociência e Nanotecnologia Biomédica, Universidade

Lusófona, 11th October 2013, Lisbon, Portugal (Best panel communication prize).

2. First International Symposium on Profiling – ISPROF, 2nd - 4rd September 2013,

Costa de Caparica, Portugal (Best oral communication prize).

3. 5th iMed.UL Post-Graduate Students Meeting, 18th July 2013, Faculty of Pharmacy

University of Lisbon, Portugal (Best panel communication prize).

4. 38th Federation of European Biochemical Societies (FEBS) Congress “Mechanisms

in Biology”, 6th - 11th July 2013, St. Petersburg, Russia (Congress Bursary awarded).

5. 3rd iMed.UL Post-Graduate Students Meeting, 12th December 2011, Faculty of

Pharmacy University of Lisbon, Portugal (Best oral communication prize).

6. 3rd European Science Foundation Summer School - Nanomedicine 2011, 24th June

2011, Lutherstadt Wittenberg, Germany (Travel grant awarded from the conference).

Teaching and supervision of scientific work

1. Teaching theoric and practical classes of Nanomedicines of the of the 5th year of the

Master in Pharmaceutical Sciences of the Faculty of Pharmacy of the University of Lisbon,

Department of Pharmaceutical Technology and Galenic Pharmacy (November 2013).

2. Teaching of laboratorial classes of Pharmaceutical Technology II of the 4rd year of

the Master in Pharmaceutical Sciences of the Faculty of Pharmacy of the University of

Lisbon, Department of Pharmaceutical Technology and Galenic Pharmacy (September 2013 -

February 2014).

3. Supervision of the undergraduate research project of Tiago Cairrão and Isabel

Marcos from the 5th year of the Master in Pharmaceutical Sciences of the Faculty of

Pharmacy of the University of Lisbon, Department of Pharmaceutical Technology and

Galenic Pharmacy (September 2012 - February 2013).

4. Supervision of the undergraduate extracurricular research internship of Ana Pragana

at Louvain Drug Research Institute, Pharmaceutics & Drug Delivery Group, Université

Catholique de Louvain, Brussels, Belgium (March-June 2011).

5. Supervision of the undergraduate research project of Ana Pragana and Diogo Ferreira

from the 4rd year of the Master in Pharmaceutical Sciences of the Faculty of Pharmacy of the

196

University of Lisbon, Department of Pharmaceutical Technology and Galenic Pharmacy

(July-August 2010).

Communications

Oral Communications:

A. Invited Oral Communications

1. Silva JM, Vandermeulen G, Videira M, Florindo H, Préat V, Design of a therapeutic

melanoma vaccine candidate using polymeric nanoparticles, VI Congresso Científico

AEFFUP - Química Terapêutica e Novas Tecnologias, 2nd November 2011, Oporto, Portugal.

B. Selected Oral Communications

1. Silva JM, Vandermeulen G, Oliveira V, Pinto S, Zupancic E, Graça L, Préat V,

Florindo H, Multifunctional Cancer Vaccine Using Ligand-Modified Nanoparticles, 7th

Vaccine & ISV Congress, 27th - 29th October 2013, Barcelona, Spain.

2. Silva JM, Vandermeulen G, Oliveira V, Pinto S, Videira M, Silva L, Graça L, Préat

V, Florindo H, Development of dendritic cell-targeted peptide vaccine against melanoma by

multifunctional nanoparticles, 1st International Symposium on Profiling – ISPROF, 2nd - 4rd

September 2013, Costa de Caparica, Portugal.


melanoma vaccine candidate using polymeric nanoparticles, III Congress of the Portuguese

Society of Pharmaceutical Sciences and IX Spanish-Portuguese Conference on Controlled

Drug Delivery, 14th October 2011, Oporto, Portugal.


melanoma vaccine candidate: coencapsulation of melanoma antigenic peptides and Toll-like

ligands as adjuvants into polymeric nanoparticles, 3rd European Science Foundation Summer

School - Nanomedicine 2011, 24th June 2011, Lutherstadt Wittenberg, Germany.


melanoma vaccine candidate: coencapsulation of a melanoma peptide antigen and CpG

oligonucleotide as an adjuvant into polymeric nanoparticles, 15th Forum of Pharmaceutical

Sciences, Belgium Society of Pharmaceutical Sciences 13th May 2011, Spa, Belgium.

Curriculum vitae

197

C. Other Oral Communications


melanoma vaccine candidate using polymeric nanoparticles, 3rd iMed.UL Post-Graduate

Students Meeting, 12th December 2011, Faculty of Pharmacy University of Lisbon, Portugal.


melanoma vaccine candidate using polymeric nanoparticles, Nanomedicines and Drug

Delivery Systems Group - iMed.UL, 28th July 2011, Faculty of Pharmacy University of

Lisbon, Portugal.

Panel Communications:

1. Silva JM, Vandermeulen G, Oliveira V, Pinto S, Zupancic E, Videira M, Gaspar M,

Graça L, Préat V, Florindo H1, Ligand-modified nanoparticles as a multifunctional cancer

vaccine, 6th iMed.UL Post-Graduate Students Meeting, 2th July 2014, Faculty of Pharmacy

University of Lisbon, Portugal.

2. Silva JM, Zupancic E, Peres C, Sainz V, Videira M, Graca L, Moreira JN, Preat V &

Florindo HF, Development of multifunctional aliphatic polyester-based biodegradable

nanoparticles for vaccine delivery and immunotherapy, Showcasing Portuguese Pharma

Science Advances in Discovery, Development and Manufacturing, Hovione & MIT Portugal

Symposium, 30th June 2014, Lisbon, Portugal.

3. Silva JM, Vandermeulen G, Oliveira V, Pinto S, Zupancic E, Graca L, Préat V and

Florindo HF, Dendritic Cell-Targeted Multifunctional Cancer Vaccine Using Ligand-

Modified Nanoparticles, 9th World Meeting on Pharmaceutics, Biopharmaceutics and

Pharmaceutical Technology (PBP 2014), 31st March – 3rd April 2014, Lisbon, Portugal.

4. Zupancic E, Silva JM, Videira M, Moreira JN, Florindo HF, A new nanoparticulate

platform for tumor associated antigen delivery, 9th World Meeting on Pharmaceutics,

Biopharmaceutics and Pharmaceutical Technology (PBP 2014), 31st March – 3rd April 2014,

Lisbon, Portugal.

5. Zupancic E, Silva JM, Videira M, Moreira JN, Florindo HF, Novel

immunotherapeutic approach against breast cancer, Informa’s annual Vaccines: Formulation

Development, Manufacturing and Novel Production Technologies, December 2013, Brussels,

Belgium.

6. Zupancic E, Silva JM, Videira M, Moreira JN, Florindo HF, Design of a new

nanoparticulate platform to deliver tumor associated antigens, 7th Vaccine & ISV Congress,

27th - 29th October 2013, Barcelona, Spain.

198

7. Silva JM, Vandermeulen G, Oliveira V, Pinto S, Zupancic E, Graca L, Préat V and

Florindo HF, Ligand-Modified Nanoparticles as a Multifunctional Approach for a Cancer

Vaccine, II Simpósio Nacional de Nanociência e Nanotecnologia Biomédica, Universidade

Lusófona, 11th October 2013, Lisbon, Portugal.

8. Zupancic E, Silva JM, Videira M, Moreira JN, Florindo HF, Novel nanoparticulate

platform for delivery of tumour associated antigens, II Simpósio Nacional de Nanociência e

Nanotecnologia Biomédica, Universidade Lusófona, 11th October 2013, Lisbon, Portugal.


nanoparticulate platform to deliver tumor associated antigens, 13th International Conference

Progress in Vaccination Against Cancer (PIVAC13), October 2013, Amsterdam, Netherlands.

10. Silva JM, Vandermeulen G, Oliveira G, Pinto S, Videira M, Graca L, Préat V and

Florindo HF, Development of Dendritic Cell-Targeted Peptide Vaccine Against Melanoma by

Ligand-Modified Nanoparticles, 40th Annual Meeting & Exposition of the Controlled Release

Society, 21st - 24rd July 2013, Honolulu, Hawaii, USA.

11. Silva JM, Vandermeulen G, Oliveira V, Pinto S, Zupancic E, Videira M, Graca L,

Préat V, Florindo H, Dendritic Cell-Targeted Multifunctional Cancer Vaccine Using Ligand-

Modified Nanoparticles, 5th iMed.UL Post-Graduate Students Meeting, 18th July 2013,

Faculty of Pharmacy University of Lisbon, Portugal.


immunotherapeutic approach against breast cancer, 5th iMed.UL Post-Graduate Students

Meeting, 18th July 2013, Faculty of Pharmacy University of Lisbon, Portugal.

13. Silva JM, Vandermeulen G, Oliveira V, Pinto S, Graca L, Préat V and Florindo HF,

Dendritic Cell-Targeted Multifunctional Vaccine Against Melanoma Using Ligand-Modified

Nanoparticles, 38th Federation of European Biochemical Societies (FEBS) Congress

“Mechanisms in Biology”, 6th - 11th July 2013, St. Petersburg, Russia.

14. Silva JM, Pinto S, Vandermeulen G, Videira M, Florindo H, Préat V, Dendritic cell-

targeting EMBO 1st International Workshop on Molecular Medicine of Sphingolipids,

October 2012, Ramot, Israel.


melanoma vaccine candidate using polymeric nanoparticles, XXVI Scientific Meeting GTRV

– Group Thematique de Recherche sur la Vectorisation, 5th December 2011, Université

Catholique de Louvain, Brussels, Belgium.



Curriculum vitae

199

ligands as adjuvants into polymeric nanoparticles, 38th Annual Meeting & Exposition of the

Controlled Release Society – Innovative and Low-cost Technologies for Healthcare and

Consumer Products, 2nd August 2011, Maryland, USA.



ligands as adjuvants into polymeric nanoparticles, Louvain Drug Research Institute

Inauguration, March 12th 2011, Université Catholique de Louvain, Brussels, Belgium.


melanoma vaccine candidate: coencapsulation of a melanoma peptide antigen and a CpG

oligonucleotides as an adjuvant into polymeric nanoparticles using polymeric nanoparticles,

2nd iMed.UL Post-Graduate Students Meeting, 3rd December 2010, Faculty of Pharmacy

University of Lisbon, Portugal.

Universidade de Lisboa Faculdade de Farmácia Departamento de...

Documents

Transcript of Universidade de Lisboa Faculdade de Farmácia Departamento de...