Twonewspeciesofrainbowfishes (Melanotaenia ...4)_Melanotaenia.pdf · Rainbowfishes are prized by...

AbstractTwo new species of rainbowfishes are described from the

southwestern Birds Head region of western New Guinea(Papua Barat Province, Indonesia). Melanotaenia ammerin. sp. is described on the basis of 19 specimens, 46.5-82.2mm SL, collected near Gusimawa Village, Arguni Bay. It ismost closely related to M. kokasensis n. sp., also describedas new from 25 specimens, 27.2-68.5 mm SL, collectednear Kokas Village on the northern Fakfak Peninsula. Thetwo species are easily distinguished on the basis of colourpattern: M. ammeri has a distinctive pattern of alternatingmauve to greyish blue and yellow stripes and the colourpattern of M. kokasensis is dominated by a broad, blackmidlateral stripe. In addition, males of M. ammeri are sig-nificantly deeper bodied (maximum body depth as % ofstandard length 39.3 versus 34.5) than those of M. kokasen-sis. Analysis of genetic relationships based on cytochromeb sequences indicates a close relationship between the twospecies and demonstrates that they are part of the uniquerainbowfish clade found mainly on the Vogelkop Peninsulaand some offshore islands. The new species differed intheir mean Kimura 2-parameter genetic divergences by2.4% from each other. Both were between 5.4 and 5.6%divergent from M. parva, the next most closely relatedspecies that we obtained genetic data for.

ZusammenfassungBeschrieben werden zwei neue Regenbogenfisch-Arten aus

der südwestlichen Birds-Head-Region des westlichenNeuguinea (Provinz Papua Barat, Indonesien). Melanotaeniaammeri n. sp. wird auf der Grundlage von 19 Exemplarenmit 46,5-82,2 mm SL, gesammelt nahe Gusimawa Village,Arguni Bay, beschrieben. Nahe verwandt ist die zweite neueArt M. kokasensis n. sp., beschrieben nach 25 Exemplarenmit 27,2-68,5 mm SL, gefangen nahe Kokas Village auf dernördlichen Fakfak-Halbinsel. Nach der Farbgebung lassensich die beiden Arten leicht unterscheiden. M. ammeri zeigtein auffälliges Muster aus abwechselnden malven- bisgraublauen und gelben Streifen, während die Farbe von M.kokasensis von einem breiten schwarzen Streifen auf der

Flankenmitte beherrscht wird. Außerdem haben die Män-nchen von M. ammeri einen deutlich tieferen Rumpf (mit-tlere Tiefe in % der Standardlänge 39,3 im Vergleich zu34,5) als M. kokasensis. Die Analyse der genetischen Ver-wandtschaft auf der Basis der Sequenzen von Cytochrom bbestätigt die nahe Verwandtschaft der beiden neuen Artenund zeigt, dass sie zur einzigartigen Regenbogenfisch-Kladegehören, deren Vertreter sich hauptsächlich auf derVogelkop-Halbinsel und einigen küstennahen Inselnfinden. Nach dem mittleren Kimura-2-Parameter genetis-cher Divergenzen unterscheiden sich die beiden neuenArten um 2,4% voneinander. Beide unterscheiden sich aberum 5,4 bzw. 5,6% von M. parva, der nächstverwandten Art,zu der genetische Daten zur Verfügung standen.

RésuméDeux nouvelles espèces de poissons arc-en-ciel, du sud-

ouest de la péninsule du Vogelkop, Papouasie Occidentale(province de Papua Barat, Indonésie) sont décrites. Melano-taenia ammeri n. sp. est décrit sur base de 19 spécimens, de46,5 à 82,2 mm de LS, collectés près de Gusimawa Village,Arguni Bay. Il est très proche de M. kokasensis n. sp., égale-ment décrit comme nouvelle espèce, sur base de 25 spéci-mens, de 27,2 à 68,5 mm de LS, collectés près de Kokas Vil-lage, au nord de la péninsule de Fakfak. Les deux espèces sedistinguent facilement par leur patron de coloration. M.ammeri arbore un patron caractéristique de lignes alternéesmauves à bleu grisâtre et jaunes, et le patron de colorationde M. kokasensis est dominé par une large bande latéralemédiane noire. En outre, les mâles de M. ammeri sont net-tement plus hauts de corps (hauteur maximale du corps en% par rapport à la longueur standard : 39,3 au lieu de 34,5)que ceux de M. kokasensis. L’analyse des relations génétiquesbasée sur des séquences de cytochrome b révèle une parentéétroite entre les deux espèces et prouve qu’elles font partie del’unique clade de poissons arc-en-ciel trouvé principalementdans la péninsule du Volgelkop et quelques îles au large. Lesnouvelles espèces diffèrent, par leurs principales divergencesdu paramètre génétique Kimura 2, de 2,4% l’une de l’autre.Les deux divergent de 5,4 a 5,6% de M. parva, l’autre

aqua vol. 14 no. 4 - 15 October 2008209

aqua, International Journal of Ichthyology

Two new species of rainbowfishes (Melanotaenia: Melanotaeniidae),from, western New Guinea (Papua Barat Province, Indonesia)

Gerald R. Allen1, Peter J. Unmack2 and Renny K. Hadiaty3

1) Western Australian Museum, Locked Bag 49, Welshpool DC, Perth, Western Australia 6986.E-mail: [email protected]

2) Department of Biology, WIDB 401, Brigham Young University, Provo UT 84602, U.S.A.3) Ichthyology Laboratory, Division of Zoology, Research Center for Biology,

Indonesian Institute of Sciences (LIPI), Jalan Raya Bogor, Km 46, Cibinong 16911, Indonesia.

Received: 24 July 2008 – Accepted: 30 September 2008

espèce la plus proche pour laquelle nous avons obtenu desdonnées génétiques.

SommarioIn questo articolo sono descritte due nuove specie di pesci

arcobaleno originari della parte sudoccidentale della regionenota come Birds Head (Provincia di Papua Barat, NuovaGuinea occidentale, Indonesia). Melanotaenia ammeri n. sp.è descritta sulla base di 19 esemplari di 46.5-82.2 mm SL,raccolti presso Gusimawa Village, Arguni Bay. Appare stret-tamente imparentata a M. kokasensis n. sp., anch’esso descrit-ta come nuova sulla base di 25 esemplari di 27.2-68.5 mmSL, raccolti presso Kokas Village nella parte settentrionaledella penisola di Fakfak. Le due nuove specie sono facil-mente distinguibili in base alla colorazione: M. ammeri hauna caratteristica livrea costituita da strie alterne le une di uncolore che va dal malva al grigio-blu, le altre gialle, mentre lacolorazione di M. kokasensis è dominata da un’ampia strianera mediolaterale. In aggiunta, gli individui maschi diM. ammeri hanno un corpo significativamente più alto(altezza massima del corpo come % della lunghezza standard39.3 versus 34.5) di quelli di M. kokasensis. L’analisi geneticabasata sulle sequenze del citocromo b indica una parentelastretta tra le due specie e dimostra che entrambe fanno partedi un’unica linea monofiletica diffusa principalmente sullapenisola Vogelkop e in alcune isole al largo di essa. Le nuovespecie mostrano una divergenza genetica in base al Kimura2-parametri del 2.4%. Entrambe sono divergenti per il5.4% e il 5.6% da M. parva, la specie filogeneticamente piùvicina e per la quale abbiamo ottenuto dati genetici.

INTRODUCTIONThe colourful rainbowfishes of the family Mela-

notaeniidae are common freshwater inhabitantsthroughout New Guinea and northern Australia.Several revisions and reviews were provided by thefirst author and various colleagues (Allen 1980,1985, 1989, 1995; Allen & Cross 1982; Allen etal. 2002). A total of 74 species in seven genera arecurrently recognized. Their greatest diversityoccurs on the island of New Guinea where newspecies are still being discovered, particularly inremote, previously unsampled regions. The presentpaper describes two new species of MelanotaeniaGill, 1862 that were collected during an explor-atory cruise by the first author to Arguni Bay andthe neighbouring Bomberai Peninsula during Jan-uary 2008 (Fig. 1).Melanotaeniids belong to the order Atherini-

formes (Nelson 2006) and typically possess a com-pressed body covered in relatively large scales, twoseparate dorsal fins (the first with 3-7 spines andthe second with a single spine and 6-22 segmentedrays), a long-based anal fin, and no lateral line. Sex-

ual dimorphism is often apparent; males tend to bedeeper-bodied and more vividly coloured thanfemales.Rainbowfishes are prized by aquarists for their

bright colouration and placid nature. Aquariumspawning has been achieved for many species.Males initiate spawning by ‘flashing’ vivid colours,often including a bright stripe on the nape, toattract a mate. The pair swims above aquatic vege-tation and releases eggs and sperm with a vigorousshudder of the body. The eggs are demersal andhave adhesive threads which attach to the foliage.Females typically release a small number of eggsdaily. The eggs hatch within 7 to 18 days and mostspecies attain sexual maturity by the end of the firstyear. In the natural habitat, rainbowfishes oftenform large shoals near the surface. The diet consistsof a variety of insects and their larvae, micro-crus-taceans, and some algae.Allen (1990) reviewed the seven species that were

known at that time from the mainland portion ofthe Birds Head region (Fig. 1) at the extreme west-ern end of New Guinea (Papua Barat Province,Indonesia). The coverage included Melanotaeniaajamaruensis Allen & Cross, 1980, M. angfa Allen,1990, M. arfakensis Allen, 1990, M. boesemaniAllen & Cross, 1980, M. fredericki (Fowler, 1939),M. irianjaya Allen, 1985, and M. parva Allen,1990. Several additional species including M.catherinae (De Beaufort, 1919), M. batanta Allen& Renyaan, 1996, M. misoolensis Allen, 1982, andM. synergos Allen & Unmack, 2008 are knownfrom the nearby Raja Ampat Islands (Allen &Unmack 2008). The authors are currently studyinggenetic relationships within the family using mito-chondrial and nuclear DNA sequence analysis. Thespecies inhabiting the Birds Head region are of par-ticular interest and constitute our current researchfocus. They appear to form a separate clade withinthe genus Melanotaenia that is well differentiatedfrom those found in Australia and the remainder ofNew Guinea (McGuigan et al. 2000). However, weare yet to clearly establish the origins of the BirdsHead species.

MATERIALS AND METHODSCounts and measurements that appear in paren-

theses refer to the range for paratypes if differentfrom the holotype. Type specimens are deposited atthe Australian Museum, Sydney (AMS), ResearchCenter for Biology, Indonesian Institute of Sci-ences, Bogor, Indonesia (MZB), United States

aqua vol. 14 no. 4 - 15 October 2008 210

Two new species of rainbowfishes (Melanotaenia: Melanotaeniidae), from, western New Guinea (Papua Barat Province, Indonesia)

National Museum of Natural History, Washing-ton, D.C. (USNM), and the Western AustralianMuseum, Perth (WAM).The methods of counting and measuring are as

follows: dorsal and anal rays – the last ray of theanal and second dorsal fins is divided at the baseand counted as a single ray; lateral scales – numberof scales in horizontal row from upper edge of pec-toral-fin base to caudal-fin base, excluding thesmall scales posterior to the hypural junction;transverse scales – number of scales in vertical rowbetween anal fin origin and base of first dorsal fin;predorsal scales – number of scales along midlineof nape in front of first dorsal fin; cheek scales –total number of scales covering the suborbital andpreoperculum; standard length (SL) – measuredfrom the tip of the upper lip to the caudal-fin base;head length (HL) – measured from the tip of the

upper lip to the upper rear edge of the gill opening;caudal peduncle depth is the least depth, and cau-dal peduncle length is measured between two ver-tical lines, one passing through the base of the lastanal ray and the other through the caudal-fin base;caudal concavity is the horizontal distance betweenverticals at the tips of the shortest and longest rays.DNA material: a number of rainbowfish species

from the Birds Head region were included forDNA sequence comparison to the new species.This included the following species: M. ammeri(from type locality, see below), M. kokasensis (fromtype locality, see below), M. misoolensis (Wai TamaRiver, 1°51.635’S 129°55.401’E, Misool Island,Raja Ampat Islands); M. fredericki (Kali Doktur,1°01.036’S 130°39.943’E, Salawati Island, RajaAmpat Islands), M. parva (obtained via aquariumtrade, originally collected from Lake Kurumoi,


Gerald R. Allen, Peter J. Unmack and Renny K. Hadiaty

Fig. 1. Map of the Birds Head (Vogelkop) region, Papua Barat Province, Indonesia with inset map of New Guinea. Theapproximate collections locations of Melanotaenia ammeri and M. kokasensis are shown by a star and triangle respectively. Theknown collection locations for M. irianjaya and M. parva are indicated by circles and a diamond respectively.

2°09.528’S 134°05.217’E, Papua Barat Province),M. batanta (Warmon Creek, 0°49.948’S130°43.123’E, Batanta Island, Raja AmpatIslands), M. catherinae (Waisam Creek, 0°17.415’S130°57.079’E, Waigeo Island, Raja AmpatIslands), M. synergos (Wei Bin Stream, 0o49.774’S130o45.874’E, Batanta Island, Raja AmpatIslands). Two populations of M. affinis from theGogol River and Sepik River, Papua New Guineawere included as outgroup taxa.The second author extracted genomic DNA from

muscle tissue from each specimen using theDNeasy Tissue Kit (QIAGEN Inc., ChatsworthCA). The cytochrome b (cyt b) gene was amplifiedusing two primers (Glu31 5’-GTGACTTGAAAAACCACCGTT-3’ andRF.Thr48 5’-GCAGTAGGAGGGAATTTAAC-CTTCG-3’) that flanked the entire gene. Whenthis failed to produce sufficient PCR product thegene was amplified in two halves using Glu31 –HD and rainL505 – RF.Thr48. Primer HD (5’GGGTTGTTTGATCCTGTTTCGT 3’) is fromT. Schmidt as given in Dowling & Naylor (1997)while primers Glu31, RF.Thr48, and rainL505 (5’TCYGTAGATAATGCCACCCT 3’) weredesigned by us. Final concentrations for poly-merase chain reaction (PCR) components per25 µL reaction were as follows: 25 ng templateDNA, 0.25 µM of each primer, 0.625 units of TaqDNA polymerase, 0.1 mM of each dNTP, 2.5 µLof 10X reaction buffer and 2.5 mM MgCl2.Amplification parameters were as follows: 95°C for2 min followed by 35 cycles of 95°C for 30 sec,48°C for 30 sec, and 72°C for 90 sec, and 72°C for7 min. The PCR products were examined on a1.5% agarose gel using SYBR safe DNA gel stain(Invitrogen, Eugene, OR, USA). The PCR prod-ucts were purified using a Montage PCR 96 plate(Millipore, Billerica, MA, USA). Most sequencingreactions and clean up were performed using a Par-allab 350 (Parallabs, Worcester, Massachusetts,USA). Some were also obtained via cycle sequenc-ing with Big Dye 3.0 dye terminator ready reactionkits using 1/16th reaction size (Applied Biosystems,Foster City, CA). Sequencing reactions were runwith an annealing temperature of 52°C. Sequencedproducts were purified by passing reactionsthrough sephadex columns. Sequences wereobtained with an Applied Biosystems 3730 XLautomated sequencer at the Brigham Young Uni-versity DNA Sequencing Center.DNA sequences were edited using Chromas Lite

2.0 (Technelysium, Tewantin, Queensland, Aus-tralia) and then imported into BioEdit 7.0.5.2(Hall, 1999) and aligned by eye. Sequences werechecked for unexpected frame shift errors or stopcodons in Mega 4.0 (Tamura et al. 2007). Phylo-genetic analyses were performed using both parsi-mony and likelihood approaches using PAUP*4.0b10 (Swofford 2003). Maximum parsimony(MP) was conducted via a heuristic search with1,000 random additions and TBR branch swap-ping. For Maximum likelihood (ML) analysis weidentified the best fitting model of molecular evo-lution using the Akaike Information Criterion(AIC) in Modeltest 3.7 (Posada & Crandall 1998).The best model of evolution found by Modeltestwas the K81uf+G with the following parameters:Lset Base=(0.2583 0.3097 0.1416) Nst=6Rmat=(1.0000 11.3616 0.2421 0.2421 11.3616)Rates=gamma Shape=0.2118 Pinvar=0. Robust-ness of nodes was estimated with PAUP* by boot-strap with 1,000 replicates for MP using a heuris-tic search with 10 random additions of taxa andTBR branch-swapping, and 1000 replicates forML via a heuristic search with five random addi-tions of taxa and TBR branch-swapping. All treelengths reported for MP include both informativeand uninformative characters. Among species vari-ation was calculated using Kimura 2-parameterdivergences in MEGA 4.0.

Melanotaenia ammeri n. sp.(Figs 2-3; Tables I, II)

Holotype: MZB 16455, male, 82.2 mm SL, smallcreek near Gusimawa , 3°02.438’S 133°52.844’E,Arguni Bay, Papua Barat Province, Indonesia, 0-0.5 m, seine net, G. R. Allen and M. Ammer, 12January 2008.Paratypes (collected with holotype): AMSI.44640-001, 4 specimens, 46.5-66.5 mm SL;MZB 16456, 4 specimens, 55.9-71.5 mm SL;USNM 391630, 5 specimens, 46.1-71.6 mm SL;WAM P. 33011-001, 5 specimens: 53.8-73.5 mmSL.Comparative material examined: Melanotaenia

irianjaya – MZB 4952, 50.0 mm SL (holotype),Fruata, 2°58.980’S 133°31.977’E, BomberaiPeninsula, Papua Barat Province, Indonesia; WAMP. 27863-001, 12 specimens (paratypes), 20.0-51.0 mm SL, Fruata; WAM P.29955-001, 10 spec-imens, 26.8-64.6 mm SL, Kali Satu, 2°05.913’S



133°30.930’E, Bintuni, Papua Barat Province,Indonesia; WAM P.29960-001, 53 specimens,29.9-78.1 mm SL, Kali Tujuh, 2°05.959’S133°29.988’E, Bintuni, Papua Barat Province,Indonesia; Melanotaenia parva – WAM P.29970-001, 125 specimens (paratypes), 21.2-52.6 mmSL, Lake Kurumoi, 2°09.528’S 134°05.217’E,Papua Barat Province, Indonesia.Diagnosis: A species of melanotaeniid rainbow-

fish distinguished by the following combination ofcharacters: dorsal rays IV to VI-I,12 to 15 (usually13 or 14); anal rays I,20-25 (usually I,21 to 23);pectoral rays 12 to 14 (usually 13 or 14); lateralscales 34-36 (usually 35), predorsal scales 17 to 19(usually 17 or 18); total gill rakers on first arch 16to 18 (usually 16); colour in life generally bluishdorsally with series of alternating mauve to blue-grey and pale yellow stripes (one per scale row) onside of body, midlateral blue stripe usually muchdarker than others; median fins generally yellow,brighter in adult males.Description: Dorsal rays IV-I,14 (IV to VI,12 to

15); anal rays I,22 (I,20 to 25); pectoral rays 12 (12

to 14); pelvic rays I,5; branched caudal rays 16; lat-eral scales 35 (34 or 36); transverse scales 11 (10 or11); predorsal scales 19 (17-19); cheek scales 12(11-15); total gill rakers on first arch 18 (16-18).Body depth 2.5 (2.3-3.4) in SL, head length 3.8

(3.4-3.8) in SL; greatest width of body 2.8 (2.3-3.3) in greatest body depth; snout length 3.2 (2.8-3.1) in HL; eye diameter 3.6 (3.1-3.9) in HL;interorbital width 2.9 (2.8-3.2) in HL; depth ofcaudal peduncle 2.1 (2.1-2.7) in HL; length ofcaudal peduncle 1.7 (1.6-2.1) in HL.Jaws about equal, oblique, premaxilla with an

abrupt bend between the anterior horizontal por-tion and lateral part; maxilla ends below anterioredge of eye; maxillary length 2.8 (2.6-2.8) in HL;lips thin; teeth conical with slightly curved tips,extending on to outer surface of lips; teeth of upperjaw in 4-5 irregular rows anteriorly, reduced to asingle row posteriorly, where they are exposedwhen mouth is closed; teeth in lower jaw in about7-8 irregular rows anteriorly, reduced to 1 or 2rows posteriorly; narrow row containing severalsmall, conical teeth on vomer and palatines.



Holotype Paratype Paratype Paratype Paratype Paratype ParatypeMZB WAM USNM USNM WAM WAM USNM16455 P.33011 391630 391630 P.33011 P.33011 391630

Sex male female male male female male femaleStandard length (mm) 82.2 73.5 69.2 62.4 58.0 53.8 46.1Body depth 39.3 31.7 35.4 34.9 32.4 32.5 31.7Body width 14.2 13.9 12.9 13.5 12.9 12.3 13.2Head length 26.5 26.4 26.0 27.9 27.1 28.3 28.9Snout length 8.4 9.5 9.0 9.5 9.3 9.7 9.8Maxillary length 9.4 9.4 9.5 10.9 10.2 10.6 11.1Eye diameter 7.3 6.8 7.7 7.7 8.4 9.1 9.3Bony interorbital width 9.2 8.6 9.2 9.3 9.5 9.5 9.8Depth of caudal peduncle 12.9 11.0 12.3 11.7 11.2 11.9 10.6Length of caudal peduncle 15.5 14.7 16.3 13.8 14.3 17.5 15.8Predorsal distance 48.3 49.4 49.3 51.1 48.6 48.7 49.9Preanal distance 49.6 50.3 52.0 51.3 51.6 50.4 51.2Prepelvic distance 36.1 37.7 38.4 38.8 38.3 37.9 38.82nd dorsal fin base 29.2 25.6 24.7 23.9 24.7 23.8 21.5Anal fin base 42.2 40.0 39.5 39.9 38.1 37.5 35.4Pectoral fin length 18.4 19.3 19.7 21.6 20.3 19.1 20.6Pelvic fin length 19.7 17.4 17.8 22.3 18.6 19.3 16.1Longest ray 1st dorsal fin 16.3 11.8 15.5 15.5 11.6 15.6 13.0Longest ray 2nd dorsal fin 19.5 9.9 15.9 14.4 13.4 14.3 12.8Longest anal ray 18.5 14.6 16.8 17.3 15.5 17.8 25.8Caudal fin length 21.8 23.7 22.8 23.9 24.7 23.2 24.9Caudal concavity 5.7 5.9 7.7 7.1 7.4 6.5 8.0

Table I. Proportional measurements of selected type specimens of Melanotaenia ammeri expressed as % of the standardlength.

Scales of body cycloid, relatively large, andarranged in regular horizontal rows; scale marginsweakly crenulate; predorsal scales extending for-ward to about middle of interorbital space; preop-ercle with 2-3 scale rows between its posteriorangle and eye.Predorsal length 2.1 (1.9-2.1) in SL; preanal

length 2.0 (1.9-2.0) in SL; prepelvic length 2.8(2.5-2.7) in SL; length of second-dorsal fin base3.4 (3.8-4.7); length of anal-fin base 2.4 (2.4-2.8).First dorsal fin origin about level with anal fin ori-

gin; longest spines (usually second to fourth) offirst dorsal fin 1.6 (1.7-2.3) in HL, its depressed tipreaching spine or first soft ray of second dorsal finin females and reaching to about base of second orthird soft ray in mature males; longest rays (gener-ally anterior ones in females and middle ones in

males) of second dorsal fin 1.4 (1.6-2.7) in HL, thedepressed posterior rays extending about one halfto two-thirds length of caudal peduncle in femalesand full length of caudal peduncle in mature males;longest (middle rays in males and females) analrays 1.4 (1.1-2.0) in HL; pelvic fin tips whendepressed reaching to base of fourth or fifth softanal fin ray in mature adults; length of pelvic fins1.3 (1.2-1.8); length of pectoral fins 1.4 (1.3-1.5)in HL; length of caudal fin 1.2 (1.1-1.2) in HL;caudal fin moderately forked, caudal concavity 4.6(3.3-5.5) in head length.Co l o u r o f m a l e h o l o t y p e i n l i f e (Fig.

2, upper fish): blue on upper back; eight mauve toblue-grey stripes, corresponding with horizontalscale rows on side of body, alternating with narrowerpale yellow stripes; midlateral stripe (at level of



Fig. 2. Aquarium photograph of Melanotaenia ammeri, male holotype (upper), 82.2 mm SL, and female paratype (WAMP.33011-001), 73.5 mm SL, Gusimawa, Papua Barat Province, Indonesia. Photo by G. R. Allen.

upper pectoral-fin base) generally darkest with bluestripes below progressively more inconspicuous andforming interrupted dotted lines; broad, horizon-tally bluish streak immediately above abdomen;upper portion of head blue grayish, lower half silverywhite; breast white; dorsal, anal, pelvic and caudalfins pale yellow; pectoral fins translucent with whitebase. Colour pattern of female similar to that ofmale except blue and yellow hues of body stripesgenerally less vivid and median fins mainly translu-cent, only slightly yellow.Co l o u r o f h o l o t y p e i n a l c o h o l (Fig. 3):

overall tan including narrow stripe between eachhorizontal scale row of body; 2-3 uppermost hori-zontal scale rows with broad, elongate brown botchcovering most of each scale; similar, but muchdarker (brown to blackish) markings on two mid-lateral scale rows, these merging to form broad,dark brown stripe on posterior half of body; hori-zontal scale row immediately below midlateralrows with faint rectangular brown blotch on eachscale; ventral third of side tan with very faint indi-cation of brown stripe along middle of each hori-zontal scale row; upper portion of head grey browngrading to tan on cheek and opercle; pectoral finstranslucent; remaining fins variable dusky brown.Paratypes similar in colour to holotype, but inten-sity of two midlateral stripes highly variable, rang-

ing from intense blackish to barely darker thanadjacent scale rows.Sexual dimorphism: Similar to most Melanotae-

nia, males are generally deeper bodied than femalesand have a more elongate, pointed shape posteri-orly on the soft dorsal fin. The longest soft dorsal-fin rays of males are located in the posteriormostportion of the fin, in contrast to that of females,which are situated in the anterior half of the fin. Inaddition, the depressed first dorsal fin of adultmales extends to the base of the second or thirdsoft ray of the second dorsal fin, compared with thespine or first ray in females. The body depth (as %of SL) of 13 males, 53.8-82.2 mm SL, ranged from32.5-39.3 with an average of 34.7; that of 6females, 46.1-73.5 mm SL, was 29.7-32.6 with anaverage of 31.4.Comparisons: The distinctive pattern of alternat-

ing mauve to blue-grey and yellow stripes is uniqueamong species of Melanotaenia. Genetic analysis(see below) revealed that M. ammeri and M. koka-sensis n. sp. (described below) are closely related,forming a subclade with M. parva Allen, 1990(Fig. 4) that is well separated from other membersof the genus. Although we presently lack tissuesamples for M. irianjaya Allen, 1985 (Fig. 5), thisspecies is possibly a member of the same speciesgroup, judging from meristic and morphological



Fig. 3. Melanotaenia ammeri, preserved male, holotype, 82.2 mm SL, Gusimawa, Papua Barat Province, Indonesia. Photo byG. R. Allen.

similarities. All four species inhabit the Bomberai/Birds Neck region of western New Guinea, butexhibit allopatric distributions (Fig. 1).The members of this species group or subclade

are clearly distinguished on the basis of colour pat-tern (Figs 2, 4, 5, 7) and also exhibit modal differ-ences related to several meristic features (Table II).Melantoaenia ammeri and M. parva tend to have alower number of soft anal-fin rays, most often 21or 22 (mean 22.1 and 21.2 respectively) comparedwith M. kokasensis and M. irianjaya that most fre-quently possess 23 or 24 rays (mean 22.8 and 23.8respectively). Furthermore, M. ammeri has a lowermodal number of pectoral-fin rays, usually 12 or13 rays (mean 12.7), compared with an equalspread of 13 or 14 rays (mean 13.5) in M. kokasen-sis, and a usual count of 14 rays for M. irianjayaand M. parva (mean 14.0 and 14.1 respectively).Melanotaenia kokasensis has a higher mean number

of total gill rakers on the first branchial arch (17.3)compared with M. parva (16.5), M. ammeri (16.4),and M. irianjaya (16.3). Additionally, M. kokasen-sis and M. irianjaya usually have 36 lateral scales(mean 36.0 and 35.9 respectively) compared withusual counts of 35 for M. ammeri (mean 35.1) and34-35 (mean 34.4) for M. parva. Finally, M.ammeri tends to have slightly more predorsal scales(mean 17.7) compared to M. irianjaya (mean17.2), M. parva (mean 16.9), and M. kokasensis(mean 16.6).Zoogeography and habitat: The new species is

currently known only from the type locality (Fig.6), a small creek flowing into the northern part ofArguni Bay. It no doubt occurs in nearby streams,but the exact limits of distribution remain to bedetermined. The type locality consists of a narrow(to about 2-3 m wide), relatively shallow (to about0.5 m) stream with gradual gradients flowing



First Dorsal Fin Spines Soft Dorsal Rays

IV V VI 11 12 13 14 15 16

M. ammeri 8 10 1 2 6 8 3M. kokasensis 8 17 1 12 12M. irianjaya 11 20 1 10 15 7 1M. parva 24 9 4 13 13 3

Soft Anal Rays

19 20 21 22 23 24 25 26 27

M. ammeri 1 6 6 4 1 1M. kokasensis 1 5 17 2M. irianjaya 1 5 6 12 7 1 1M. parva 1 6 13 12 1

Pectoral Rays Gill Rakers

12 13 14 15 14 15 16 17 18 19

M. ammeri 6 12 1 13 4 2M. kokasensis 3 20 2 5 8 11 1M. irianjaya 3 23 7 7 14 6 5M. parva 1 15 16 1 1 5 10 12 5

Lateral Scales Predorsal Scales

33 34 35 36 37 38 14 15 16 17 18 19

M. ammeri 2 13 4 9 6 4M. kokasensis 3 20 2 11 12 2M. irianjaya 8 20 3 1 6 14 12M. parva 1 18 13 1 1 2 6 15 9

Table II. Summary of dorsal, anal, pectoral fin-ray, gill-raker, lateral-scale, and predorsal-scale counts for Melanotaeniaammeri, M. kokasensis, M. irianjaya, and M. parva.



Fig. 4. Aquarium photograph of Melanotaenia parva, males, approximately 50 mm SL, Lake Kurumoi, Papua Barat Province,Indonesia. Photo by N. Khardina.

Fig. 5. Aquarium photograph of Melanotaenia irianjaya, male, approximately 55 mm SL, Fruata, Papua Barat Province,Indonesia. Photo by N. Khardina.



Holotype Paratype Paratype Paratype Paratype Paratype ParatypeMZB WAM USNM WAM WAM USNM WAM16453 P.33010 391629 P.33010 P.33010 391629 P.33010

Sex male male male female female male femaleStandard length (mm) 56.5 68.5 64.0 59.4 52.9 51.8 47.9Body depth 31.9 32.4 32.2 34.5 31.2 33.0 31.3Body width 11.7 13.0 11.6 13.3 11.0 10.4 11.3Head length 26.7 26.4 25.9 27.9 27.0 26.8 28.0Snout length 9.4 9.6 9.1 9.4 9.5 8.9 9.4Maxillary length 9.4 10.1 9.8 10.1 9.6 9.3 10.4Eye diameter 8.1 7.7 8.3 8.4 8.5 8.1 9.0Bony interorbital width 9.7 9.8 9.8 9.9 10.0 9.7 10.2Depth of caudal peduncle 11.7 11.5 11.3 11.3 11.2 11.8 11.5Length of caudal peduncle 17.9 16.6 17.8 16.0 17.4 17.8 17.1Predorsal distance 49.4 48.8 49.5 49.3 49.1 48.8 50.7Preanal distance 50.6 50.1 48.4 51.7 49.9 49.6 52.6Prepelvic distance 37.5 38.4 37.0 38.7 37.2 38.0 37.22nd dorsal fin base 22.8 23.1 20.9 25.1 23.4 23.9 22.8Anal fin base 38.1 36.8 38.1 38.6 38.0 36.9 37.8Pectoral fin length 19.8 21.5 19.7 20.2 19.3 18.9 19.4Pelvic fin length 17.5 20.7 18.0 19.0 16.1 17.6 18.0Longest ray 1st dorsal fin 12.7 13.1 12.7 13.0 12.1 15.8 12.7Longest ray 2nd dorsal fin 12.9 13.3 13.8 12.6 12.9 13.3 14.4Longest anal ray 13.1 15.2 14.7 14.3 13.4 15.6 14.0Caudal fin length 24.8 24.1 22.7 25.1 19.1 24.1 23.6Caudal concavity 7.3 10.4 damaged 9.1 7.9 8.9 6.7

Table III. Proportional measurements of selected type specimens of Melanotaenia kokasensis expressed as % of the standardlength.

Fig. 6. Habitat of Melanotaenia ammeri at type locality, Gusimawa, Papua Barat Province, Indonesia. Photo by G. R. Allen.

through second growth forest, about one kilometreupstream from the sea. The type specimens werecollected over sand and gravel bottoms with sub-stantial leaf litter and dead tree branches.Etymology: The new species is named ammeri to

honour Max Ammer of Sorong, Papua BaratProvince. His enthusiasm for nature exploration isinfectious and he has provided invaluable logisticsupport, beginning in 1998, enabling the secondauthor to travel and collect extensively around theBirds Head region of western New Guinea.

Melanotaenia kokasensis n. sp.(Figs 7-8; Tables II, III)

Holotype. MZB 16453, male, 56.5 mm SL, smallcreek above waterfall (at edge of sea) near Kokas,2°.185’S 132°25.697’E, northern Fakfak Penin-sula, Papua Barat Province, Indonesia, 0-0.5 m,seine net, G. R. Allen and M. Ammer, 16 January2008.Paratypes (collected with holotype): MZB 16454,

10 specimens, 27.2-52.9 mm SL; USNM 391629,7 specimens, 36.2-64.0 mm SL; WAM P. 33010-001, 7 specimens, 40.7-68.5 mm SL.Diagnosis: A species of melanotaeniid rainbow-

fish distinguished by the following combination ofcharacters: dorsal rays IV or V-I,11 to 14 (usually13 or 14); anal rays I,21-24 (usually I,22 or 23);pectoral rays 13 to 15 (usually 14); lateral scales35-37 (usually 36); predorsal scales 16 to 18 (usu-ally 16 or 17); total gill rakers on first arch 16 to 19(usually 17 or 18); colour of adult male in life gen-erally pale blue grey with blackish midlateral stripeat level of upper pectoral-fin base (sometimes fainton anterior part of body); narrow orange stripebetween each scale row on upper half of body;broad, horizontally bluish streak immediatelyabove abdomen; pelvic and anal fins pale yellowish,remaining fins mainly colourless or slightly greyexcept narrow white margin on second dorsal finand narrow blackish dorsal and ventral margins oncaudal fin.Description: Dorsal rays IV-I,13 (IV or V,11 to

14); anal rays I,23 (I,21 to 24); pectoral rays 14 (13



Fig. 7. Aquarium photograph of Melanotaenia kokasensis, male (upper) and female paratypes (WAM P. 33010-001), 68.5 mmand 59.4 mm SL, near Kokas, Papua Barat Province, Indonesia. Photo by G. R. Allen.

to 15); pelvic rays I,5; branched caudal rays 15; lat-eral scales 37 (35 or 37); transverse scales 11 (10 or11); predorsal scales 17 (16-18); cheek scales 15(13-16); total gill rakers on first arch 18 (16-19).Body depth 3.1 (3.0-3.5) in SL, head length 3.7

(3.6-3.9) in SL; greatest width of body 2.7 (2.5-3.2) in greatest body depth; snout length 2.8 (2.8-3.0) in HL; eye diameter 3.3 (3.1-3.4) in HL;interorbital width 2.7 (2.6-2.9) in HL; depth ofcaudal peduncle 2.3 (2.3-2.5) in HL; length ofcaudal peduncle 1.5 (1.5-1.7) in HL.Jaws about equal, oblique, premaxilla with an

abrupt bend between the anterior horizontal por-tion and lateral part; maxilla ends below anterioredge of eye; maxillary length 2.8 (2.6-2.9) in HL;lips thin; teeth conical with slightly curved tips,extending on to outer surface of lips; teeth of upperjaw in about four irregular rows anteriorly, reducedto a single row posteriorly, where they are exposedwhen mouth is closed; teeth in lower jaw in about7-8 irregular rows anteriorly, reduced to 1 or 2

rows posteriorly; narrow row containing severalsmall; several small conical teeth on vomer;palatines edentate.Scales of body cycloid, relatively large, and

arranged in regular horizontal rows; scale marginscrenulate; predorsal scales extending forward toabout middle of interorbital space; preopercle with3-4 scale rows between its posterior angle and eye.Predorsal length 2.0 (2.0-2.1) in SL; preanal

length 2.0 (1.9-2.1) in SL; prepelvic length 2.7(2.6-2.7) in SL; length of second-dorsal fin base4.4 (4.0-4.8); length of anal-fin base 2.6 (2.6-2.7).First dorsal fin origin about level with anal fin ori-

gin; longest spines (usually second to fourth) offirst dorsal fin 2.1 (1.7-2.2) in HL, its depressed tipreaching first or second soft ray of second dorsalfin; longest rays (generally anterior ones in bothfemales and males) of second dorsal fin 2.1 (1.9-2.2) in HL, the depressed posterior rays extendingabout one-half to two-thirds length of caudalpeduncle; longest (middle rays in males and



ammeri kokas. parva misool. fredericki batanta catherin. synergos affinis-G

M. ammeri

M. kokasensis 0.024

M. parva 0.054 0.056

M. misoolensis 0.109 0.108 0.105

M. fredericki 0.105 0.106 0.100 0.018

M. batanta 0.102 0.103 0.101 0.024 0.015

M. catherinae 0.130 0.127 0.131 0.119 0.128 0.128

M. synergos 0.126 0.121 0.121 0.109 0.118 0.123 0.027

M. affinis Gogol 0.165 0.165 0.160 0.150 0.156 0.155 0.171 0.167

M. affinis Sepik 0.162 0.160 0.158 0.150 0.158 0.156 0.166 0.163 0.010

Table IV. Mean Kimura 2-parameter divergences between rainbowfish species for cytochrome b.

Fig. 8. Melanotaenia kokasensis, preserved male, holotype, 56.5 mm SL, near Kokas, Papua Barat Province, Indonesia. Photoby G. R. Allen.

females) anal rays 2.0 (1.7-2.0) in HL; pelvic fintips when depressed reaching to base of third orfourth soft anal fin ray; length of pelvic fins 1.5(1.0-1.7); length of pectoral fins 1.3 (1.2-1.4) inHL; length of caudal fin 1.1 (1.1-1.4) in HL; cau-dal fin moderately forked, caudal concavity 3.7(2.5-4.2) in head length.Co l o u r o f m a l e h o l o t y p e i n l i f e (Fig.

7): overall pale blue grey with blackish midlateralstripe at level of upper pectoral-fin base, the stripemore or less solid on rear half of body, but incom-plete anteriorly where it is composed of darkenedposterior scale margins; narrow orange stripebetween each scale row on upper half of body;most of scales on upper two-thirds of side with nar-row greyish margins; upper portion of head grey-ish, lower half white; a poorly defined stripe, aboutequal to pupil width, from rear edge of eye toimmediately above pectoral-fin base where itmerges with midlateral body stripe; belly whitish

with broad, oblong blue blotch extending fromjust below pectoral-fin base to above middle of analfin; dorsal fins mainly greyish blue with narrowwhite margin on second dorsal fin; caudal finwhitish with slightly dusky grey basal half and faintblackish dorsal and ventral margins; anal fin duskyyellow; pelvic fins bright yellow; pectoral finstranslucent with small black spot on upper baseand smaller silvery-white spot just above. Colourpattern of females similar to that of holotypeexcept generally less vivid and pelvic fins whitish.C o l o u r o f h o l o t y p e i n a l c o h o l (Fig. 8):

upper half of body brown, white on lower half;dark midlateral stripe about 1-1.5 scales wideextending from below level of first dorsal fin originto base of caudal fin; dorsal surface of head greybrown, grading to white or tan on side and ventralregion; a dusky blackish stripe from rear edge ofeye to upper rear margin of operculum; pectoraland pelvic fins translucent; median fins dusky pale



Fig. 9. Habitat of Melanotaenia kokasensis at type locality near Kokas, Papua Barat Province, Indonesia. Photo by G. R. Allen.



Fig. 10. Maximum likelihood tree for rainbowfish species based on analysis of cytochrome b sequences (1,140 bp) sampledfrom 10 individual fish. Branch lengths were estimated using maximum likelihood assuming the K81uf+G model of evolu-tion. Bootstrap values were obtained from 1,000 replicates from Maximum Parsimony and Maximum Likelihood (MP/ML).The tree was rooted with Melanotaenia affinis.

grey; caudal fin with narrow blackish dorsal andventral margins. Paratypes similar in colour toholotype with variable intensity and extent of darkmidlateral stripe (extends forward to edge of upperoperculum in some specimens); many specimenshave horizontally elongate brown area just aboveabdomen.Sexual dimorphism: Unlike most members of

Melanotaenia, males and females are difficult todifferentiate on the basis of body depth or otherexternal features. The body depth (as % of SL) of19 males, 36.2-68.5 mm SL, ranged from 29.0-33.0 with an average of 32.4; that of four females,47.9-59.4 mm SL, was 31.2-34.5 with an averageof 32.5.Comparisons: Genetic and morphological data

suggest that this species is most closely related toM. ammeri (see above comparisons for M.ammeri).Zoogeography and habitat: The new species is

currently known only from the type locality (Fig.9), a small stream flowing along a limestone creekbed through primary forest. The stream plungesdown a steep 20 m-high ramp next to the sea intoa mangrove-lined inlet near the village of Kokas onthe northern Fakfak Peninsula (Fig. 1). The fishwas located about one kilometre upstream, in a cir-cular pool with an approximate diameter of 15-20 m and maximum depth of about 0.5 m. Thispool was situated only about 20 m downstreamfrom a series of limestone fissures that appear to bethe stream’s underground origin.Etymology: The new species is named kokasensis

in reference to the nearby village of Kokas, whichis the major landmark in the area.

DNA ANALYSIS OF MELANOTAENIA FROMTHE BIRDS HEAD REGIONA total of 17 individuals representing nine species

(Table IV) were sequenced for 1,140 bp of cytb,including two samples of each species except for asingle sample of M. parva. The final analysis con-sisted of a single individual per species except M.affinis as all individuals were identical except forone individual of M. catherinae which differed by asingle base pair. Of 1,140 bp, 855 were constant,43 variable characters were parsimony uninforma-tive, and 242 characters were parsimony informa-tive. A heuristic search via Maximum Likelihood(ML) recovered one tree with a -ln score of -3395.27721 (Fig. 10). Maximum Parsimony (MP)analysis with all characters weighted equally recov-

ered two most parsimonious trees with a length of400 (CI=0. 775, RI=0.806) (Fig. 10). The two MPtrees differed slightly in that the positions of M.batanta and M. misoolensis flipped. In one tree, M.batanta is the sister species to M. misoolensis andM. fredericki, in the other M. misoolensis is the sis-ter to M. batanta and M. fredericki (the latter treewas the same result as that recovered by ML) (Fig.10). All nodes except two received very high boot-strap support for MP/ML (>99) (Fig. 10). Betweenspecies the mean Kimura 2-parameter geneticdivergences varied between 1.5 and 17.1% (TableIV). The two new species, M. ammeri and M.kokasensis were most closely related to each other,differing by 2.4%. The next closest species was, M.parva, which differed by 5.4- 5.6% (Table IV).Note that we are not suggesting that M. parva isthe true sister species to M. ammeri and M.kokasensis as we are lacking other species from oursequence dataset from this region that may bemore closely related (e.g. M. irianjaya). These lev-els of genetic divergence between species are simi-lar to those exhibited by many other rainbowfishes.For example, based on the first 601 bp of cytbmost pairwise species comparisons within the “aus-tralis,” “maccullochi,” and “nigrans” species groups(clades A-C respectively in McGuigan et al., 2000)differ by only 2-5% (15 species total; Unmack,2005).

ACKNOWLEDGEMENTSWe thank Conservation International’s Birds

Head Conservation Program, and particularly theefforts of Mark Erdmann, for supporting the firstauthor’s research on fishes. We are also indebted toMax Ammer, who organized and funded theexploratory trip to Arguni Bay and the FakfakPeninsula during January 2008. We are particularlygrateful for the excellent logistic support extendedby the crew of our survey vessel, Helena. HeikoBleher and Natasha Khardina generously providedphotographs of M. irianjaya and M. parva. TheDNA sequencing was conducted in the laborato-ries of Thomas Dowling (Arizona State University)and Jerald Johnson (Brigham Young University),their help is gratefully acknowledged. This projectwas aided by instrumentation provided by NSFDBI-0520978.



REFERENCESALLEN, G. R. 1980. A generic classification of the rain-bowfishes (family Melanotaeniidae). Records of the West-ern Australian Museum 8 (3): 449-490.

ALLEN, G. R. 1985. Three new rainbowfishes (Melano-taeniidae) from Irian Jaya and Papua New Guinea. Revuefrançasise d’Aquariologe 12 (2): 53-62.

ALLEN, G. R. 1990. Les poisons arc-en-ciel (Melanotaeni-idae) de la Péninsule de Vogelkop, Irian Jaya, avecdescription de trios nouvelle espèces. Revue françaised’Aquariologe 16 (4) (1989): 101-112.

ALLEN, G. R. 1995. Rainbowfishes in Nature and in theAquarium. Tetra Verlag, Melle, Germany.

ALLEN, G. R. & CROSS, N. J. 1982. Rainbowfishes of Aus-tralia and Papua New Guinea. T.F.H. Publications, Nep-tune, New Jersey, 141 pp.

ALLEN, G. R., MIDGLEY, H. & ALLEN, M. 2002. Fieldguide to the freshwater fishes of Australia. Western Aus-tralian Museum, Perth, 394 pp.

ALLEN, G. R. & Unmack, P. J. 2008. A new species ofrainbowfish (Melanotaeniidae: Melanotaenia) fromBatanta Island, western New Guinea. aqua, InternationalJournal of Ichthyology 13 (3-4): 109-120.

DOWLING, T. E. & NAYLOR, G. J. P. 1997. Evolutionaryrelationships of minnows in the genus Luxilus (Teleostei:

Cyprinidae) as determined from cytochrome b se-quences. Copeia, 1997: 758-765.

HALL, T. A. 1999. BioEdit: a user-friendly biologicalsequence alignment editor and analysis program forWindows 95/98/NT. Nucleic Acids Symposium Series 41:95-98.

MCGUIGAN, K., ZHU, D., ALLEN, G. R. & MORITZ, C.2000. Phylogenetic relationships and historical biogeog-raphy of melanotaeniid fishes in Australia and NewGuinea. Marine and Freshwater Research 51: 713-723.

NELSON, J.S. 2006. Fishes of the World. Fourth Edition.John Wiley & Sons, New York, 624 pp.

POSADA, D. & CRANDALL, K. A. 1998. Modeltest: testingthe model of DNA substitution. Bioinformatics 14: 817-818.

SWOFFORD, D. L. 2003. PAUP. Phylogenetic analysisusing parsimony (and other methods), version 4.0b10.Sinauer, Sunderland.

TAMURA, K., DUDLEY, J., NEI, M. &, KUMAR, S. 2007.MEGA4: molecular evolutionary genetics analysis(MEGA) software version 4.0. Molecular Biology andEvolution 24: 1596–1599.

UNMACK, P. J. 2005. Historical biogeography and a priorihypotheses based on freshwater fishes. PhD thesis,Department of Biology, Arizona StateUniversity.



Twonewspeciesofrainbowfishes (Melanotaenia ...4)_Melanotaenia.pdf · Rainbowfishes are prized by...

Documents

Transcript of Twonewspeciesofrainbowfishes (Melanotaenia ...4)_Melanotaenia.pdf · Rainbowfishes are prized by...