Two novel factor IX promoter mutations: incremental progress towards ‘saturation in...
2
7995 Oxford University Press Human Molecular Genetics, 1995, Vol. 4, No. 4 769-770 Two novel factor IX promoter mutations: incremental progress towards 'saturation in vivo mutagenesis' of a human promoter region Rhett P.Ketterling, Jing-zhong Liu 1 , Dongzhou Liao, Carol K.Kasper 2 , Raul Ambriz 3 , Rogelio Paredes 4 and Steve S.Sommer* Department of Biochemistry and Molecular Biology, Mayo Clinic/Foundation, Rochester, MN 55905, USA, 'institute of Basic Medical Science, Chinese Academy of Medical Science, Beijing, China, ^Orthopaedic Hospital, Los Angeles, CA 90007, USA, 3 Banco Central de Sangre del C.M.N. Siglo XXI, Mexico, DF and "institute Nacional de Pediatria, Mexico, DF Received December 3, 1994; Revised and Accepted January 18, 1995 Patients with the X-linked coagulopathy, hemophilia B, have mutations within the factor IX gene. A subset of hemophilia B patients possess mutations in the promoter region of the factor IX gene (Fig. 1). These unusual patients have a novel phenotype known as 'Hemophilia B Leyden'. Hemophilia B Leyden [named after the first patient described in Leyden, The Netherlands (1)] is characterized by low factor IX coagulant levels during childhood with spontaneous recovery after puberty. At least 13 different mutations at seven different nucleotides have been identified that produce this novel phenotype [reviewed in (2)]. These patient samples have been useful tools for studying human liver transcription in vivo (3,4). Each of these mutations disrupts a transcriptional factor binding site [described in (4)]. Recently, Crossley et al. (3) described a patient (factor IX Brandenber g) w l t h a Q^Q mutat i on at bp - 2 6 in the 5' region of the factor IX gene [numbering of (5)]. The patient had severe hemophilia B in both infancy and adulthood, with factor IX coagulant levels of <1% at 3 months, 13, 17, 19 and 20 years old. Bandshift assays suggested that this mutation occurs in a 6 bp segment overlapping both a binding site for the transcription factor (LF-A1) and an androgen receptor consensus binding sequence (ARE) (Fig. 1). The patient's intractable disease is presumably due to disruption of both the constitutive and androgen inducible promoters. Herein, we report two novel sequence changes that occur in the 50 bp factor IX promoter region of two Mexican patients with hemophilia B: a G—>C transversion at bp - 1 9 [numbering system of (5)] in patient HB396 and a C—>T transition at bp - 2 3 in patient HB388 (Figs 1 and 2). These sequence changes are not common sequence variants because they have not been observed previously in >1350 patients with hemophilia B [(2), Sommer et al., unpublished]. In addition, no other sequence changes were found in the regions of likely functional significance in the factor IX gene (2.2 kb). We conclude that these promoter sequence changes are the causative mutations. Analysis of these mutations in the context of previous work suggests that the clinical outcomes for patients HB396 and HB388 are likely to differ. Patient HB396 is a 12-year-old male with a factor IX coagulant level of 3%. He has a transversion at bp - 1 9 which disrupts only the LF-A1 binding site (Fig. 1). This patient also has an affected cousin of unknown age. Due to the location of this mutation and the spontaneous recovery in patients with mutations at bp —20 and —21 [reviewed in (2)], spontaneous postpubertal recovery is likely for this patient. Patient HB388 is a 4-year-old male with a factor IX coagulant level of 2%. He has a C—»T transition at bp —23 which is part of the consensus sequence for both the LF-A1 binding site and the ARE. There is no family history of hemophilia B and the patient's mother has five putatively unaffected brothers. Given the absence of postpubertal recovery in the one other patient with a mutation disrupting the LF-A1 and ARE consensus sequences (factor ix Brandenber 8), this patient is not expected to recover postpubertally. However, this patient must be followed closely to verify or refute this prediction. The likely divergence of clinical outcomes in these two cases illustrates the challenge for reference DNA diagnostic laboratories that perform testing for inborn errors of metabolism: even with a gene as well studied as the factor IX gene, optimal clinical interpretation of mutational data requires careful attention to the large evolving scientific literature. However, the limited case volume and scarce clinical resources available to any one diagnostic laboratory make this careful attention difficult, especially when a laboratory performs tests on many diseases. The two promoter mutations described herein are at novel sites in the factor IX gene, thereby increasing by 25% the nucleotides in the factor IX promoter region that have been AGTAAATACAGCTCAGCTTGTACTTTGGTACAACTAATCGACCTTACCACTTTCACOATCTGCTi C/EBP AGCAAAGQT ARE LF-A1/HNF4 Figure 1. Schematic of the factor IX gene with specific sequence of the 5' promoter region [bp —45 to +28; numbering of (5)]. Newly defined mutations at basepairs —19 and —23 are indicated. Previously identified mutations are indicated above the normal sequence (A = deleted base). Specific factor IX promoter sequences [reviewed in (4)] are indicated as follows: ARE = androgen response element; LF-AI = liver factor Al; C/EBP = CAAT7 enhancer binding protein. XXXXXX = six basepair overlap region between ARE and LF-AI binding site. ARE consensus sequence = AGNACANNNTGTN(£->T)T; (10); LF-AI consensus sequence = TGGA(C->T)TTT(G->C)GCCC; (11). Parentheses indicate mutations at bp - 2 3 (C->T) and -19 (G->C). *To whom correspondence should be addressed at Tufts University on September 26, 2014 http://hmg.oxfordjournals.org/ Downloaded from
Transcript of Two novel factor IX promoter mutations: incremental progress towards ‘saturation in...
7995 Oxford University Press Human Molecular Genetics, 1995, Vol. 4, No. 4 769-770
Two novel factor IX promoter mutations: incremental progress towards'saturation in vivo mutagenesis' of a human promoter regionRhett P.Ketterling, Jing-zhong Liu1, Dongzhou Liao, Carol K.Kasper2, Raul Ambriz3, Rogelio Paredes4 and SteveS.Sommer*
Department of Biochemistry and Molecular Biology, Mayo Clinic/Foundation, Rochester, MN 55905, USA, 'institute of Basic Medical Science,Chinese Academy of Medical Science, Beijing, China, ^Orthopaedic Hospital, Los Angeles, CA 90007, USA, 3Banco Central de Sangre delC.M.N. Siglo XXI, Mexico, DF and "institute Nacional de Pediatria, Mexico, DF
Received December 3, 1994; Revised and Accepted January 18, 1995
Patients with the X-linked coagulopathy, hemophilia B, havemutations within the factor IX gene. A subset of hemophiliaB patients possess mutations in the promoter region of thefactor IX gene (Fig. 1). These unusual patients have a novelphenotype known as 'Hemophilia B Leyden'. Hemophilia BLeyden [named after the first patient described in Leyden, TheNetherlands (1)] is characterized by low factor IX coagulantlevels during childhood with spontaneous recovery afterpuberty. At least 13 different mutations at seven differentnucleotides have been identified that produce this novelphenotype [reviewed in (2)]. These patient samples have beenuseful tools for studying human liver transcription in vivo(3,4). Each of these mutations disrupts a transcriptional factorbinding site [described in (4)].
Recently, Crossley et al. (3) described a patient (factorIXBrandenberg) w l t h a Q^Q m u t a t i o n a t bp - 2 6 in the 5' regionof the factor IX gene [numbering of (5)]. The patient hadsevere hemophilia B in both infancy and adulthood, with factorIX coagulant levels of < 1 % at 3 months, 13, 17, 19 and 20years old. Bandshift assays suggested that this mutation occursin a 6 bp segment overlapping both a binding site forthe transcription factor (LF-A1) and an androgen receptorconsensus binding sequence (ARE) (Fig. 1). The patient'sintractable disease is presumably due to disruption of both theconstitutive and androgen inducible promoters.
Herein, we report two novel sequence changes that occurin the 50 bp factor IX promoter region of two Mexican patientswith hemophilia B: a G—>C transversion at bp - 1 9 [numberingsystem of (5)] in patient HB396 and a C—>T transition at bp- 2 3 in patient HB388 (Figs 1 and 2). These sequence changesare not common sequence variants because they have not beenobserved previously in >1350 patients with hemophilia B [(2),Sommer et al., unpublished]. In addition, no other sequencechanges were found in the regions of likely functionalsignificance in the factor IX gene (2.2 kb). We conclude thatthese promoter sequence changes are the causative mutations.
Analysis of these mutations in the context of previous worksuggests that the clinical outcomes for patients HB396 andHB388 are likely to differ. Patient HB396 is a 12-year-oldmale with a factor IX coagulant level of 3%. He has atransversion at bp - 1 9 which disrupts only the LF-A1 bindingsite (Fig. 1). This patient also has an affected cousin ofunknown age. Due to the location of this mutation and thespontaneous recovery in patients with mutations at bp —20and —21 [reviewed in (2)], spontaneous postpubertal recoveryis likely for this patient.
Patient HB388 is a 4-year-old male with a factor IXcoagulant level of 2%. He has a C—»T transition at bp —23which is part of the consensus sequence for both the LF-A1binding site and the ARE. There is no family history ofhemophilia B and the patient's mother has five putativelyunaffected brothers. Given the absence of postpubertal recoveryin the one other patient with a mutation disrupting the LF-A1and ARE consensus sequences (factor ixBrandenber8), this patientis not expected to recover postpubertally. However, this patientmust be followed closely to verify or refute this prediction.
The likely divergence of clinical outcomes in these twocases illustrates the challenge for reference DNA diagnosticlaboratories that perform testing for inborn errors ofmetabolism: even with a gene as well studied as the factor IXgene, optimal clinical interpretation of mutational data requirescareful attention to the large evolving scientific literature.However, the limited case volume and scarce clinical resourcesavailable to any one diagnostic laboratory make this carefulattention difficult, especially when a laboratory performs testson many diseases.
The two promoter mutations described herein are at novelsites in the factor IX gene, thereby increasing by 25% thenucleotides in the factor IX promoter region that have been
AGTAAATACAGCTCAGCTTGTACTTTGGTACAACTAATCGACCTTACCACTTTCACOATCTGCTi
C/EBP
AGCAAAGQT
ARE
LF-A1/HNF4
Figure 1. Schematic of the factor IX gene with specific sequence of the 5'promoter region [bp —45 to +28; numbering of (5)]. Newly defined mutationsat basepairs —19 and —23 are indicated. Previously identified mutations areindicated above the normal sequence (A = deleted base). Specific factor IXpromoter sequences [reviewed in (4)] are indicated as follows: ARE =androgen response element; LF-AI = liver factor Al; C/EBP = CAAT7enhancer binding protein. XXXXXX = six basepair overlap region betweenARE and LF-AI binding site. ARE consensus sequence =AGNACANNNTGTN(£->T)T; (10); LF-AI consensus sequence =TGGA(C->T)TTT(G->C)GCCC; (11). Parentheses indicate mutations at bp- 2 3 (C->T) and -19 (G->C).
*To whom correspondence should be addressed
at Tufts U
niversity on September 26, 2014
http://hmg.oxfordjournals.org/
Dow
nloaded from
770 Human Molecular Genetics, 1995, Vol. 4, No. 4
s . « .
Figure 2. Sequencing autoradiograph illustrating two new mutations in thefactor IX promoter region. Sequencing reactions (ATGC) show the antisensestrand with mutations indicated by arrows. I = wild-type sequence; 2 =HB388 (G->A); and 3 = HB396 (C->G).
implicated in the in vivo transcription of this liver-specificgene. Currently, a total of 14 different base substitutions andtwo single-base deletions have been described at ten siteshinting that the 'target size' of promoter disrupting mutationsresulting in hemophilia B is relatively small.
Analysis of missense mutations in patients with hemophiliaB supports this conclusion. Factor IX mutations at methylatedCpG dinucleotides, which are hotspots of mutation, are nearlysaturated. Conversely, mutations at the 15 non-CpGdinucleotides occur with much lower, essentially equalfrequencies (6). It is estimated that single-base substitutionscan occur at 439 sites in the factor IX gene that would resultin a deleterious missense mutation (7). Currently, missensemutations have been observed at 266 sites (60.6%) [(2),Sommer et al., unpublished]. If factor IX promoter mutationsare delineated at a rate similar to missense mutations (whichis likely because this region is part of the segments of likelyfunctional significance that are generally examined in patientswith hemophilia B), the target size for promoter mutations inthe region - 4 5 to +28 (see Fig. 1) is estimated at 17 (10/0.606). These calculations are based on the inference thatabout 40% of the amino acids in factor IX are critical forfunction while about 60% are spacer residues, i.e., the residueis unimportant but the main chain is necessary to keep thecritical residues in proper register (7,8).
A second calculation can be made which does not dependon the existence of spacer residues. This calculation focuseson generically conserved amino acids, i.e., those amino acidsconserved in all known sequences in the four members of thefactor IX gene family, factor IX, factor VII, factor X, andprotein C (6). These residues have been conserved during atleast 2.5 billion years of evolution assuming 65 million yearsof divergence among the mammalian classes and at least 450million years of divergence between each of factor IX, factorX, factor VII, and protein C (9). In patients with hemophiliaB, mutations have been observed at 145 of the 281 possiblenucleotides (51.6%) that would produce either a missense ornonsense change at these generically conserved amino acids.Assuming that promoter mutations in the region —45 to +28are identified with similar efficiency, the estimated mutationaltarget size for the factor IX promoter region is 19 nucleotides(10/0.516). Thus, the observation of 16 different promotermutations at ten sites, and the two estimates of the fraction of
total deleterious missense sites that have been observed inpatients with hemophilia B, suggest that mutations at many ofthe 53 nucleotides implicated within the factor IXtranscriptional binding sites (Fig. 1) will not causehemophilia B.
In conclusion, we describe two patients with hemophilia Bthat have mutations associated with decreased promoterfunction. These patients are hypothesized to have differentclinical outcomes. With the described mutations, tennucleotides have been implicated directly in factor IX promoteractivity in human liver in the intact organism. From availabledata, two estimates of the target size for promoter disruptingmutations are given in the region bp —45 to bp +28 (17 and19 bp, respectively).
REFERENCES1. Briet, E., Bertina, R.M., VanTilburg, N.H., and Veltkamp, J.J. (1982)
Hemophilia B Leyden: A sex linked hereditary disorder that improvesafter puberty. N. Engl. J. Med. 306, 788-792.
2. Giannelli, R, Green, P.M., High, K.A., Lozier, J.N., Lillicrap, D.P.,Ludwig, M, Olek, K., Reitsma, PH., Goossens, M, Yoshioka, A.,Sommer, S., and Brownlee, G.G. (1994) Haemophilia B: database ofpoint mutations and short additions and deletions. Nucleic Acids Res. 18,4053^059.
3. Crossley, M, Ludwig, M, Stowell, K.M., DeVos, P., Olek, K., andBrownlee, G.G. (1992) Recovery from hemophilia B Leyden: anandrogen-responsive element in the factor IX promoter. Science 257, 377-379.
4. Picketts, D.J., Lillicrap, D.P., and Mueller, C.R. (1993) Synergy betweentranscription factors DBP and C/EBP compensates for a haemophilia BLeyden factor IX mutation. Nature Genet. 3, 175-179.
5. Yoshitake, S., Schach, B.G., Foster, D.C., Davie, E.W., and Kurachi, K.(1985) Nucleotide sequence of the gene for human factor IX (anti-hemophilic factor B). Biochemistry 24, 3736-3750.
6. Bottema, C.D.K., Bottema, M.J., Ketterling, R.P., Yoon, H., Janco, R.L.,Phillips, J.A., III, and Sommer, S.S. (1991) Why does the human factorIX gene have a G + C content of 40%? Am. J. Hum. Genet. 49, 839-850.
7. Bottema, C.D.K., Ketterling, R.P., Ii, S., Yoon, H., Phillips, J.A., III, andSommer, S.S. (1991) Missense mutations and evolutionary conservationof amino acids: evidence that many of the amino acids in factor IX functionas 'spacer' elements. Am. J. Hum. Genet. 49, 820-838. 8. Sommer, S.S.(1992) Assessing the underlying pattern of human germline mutations:lessons from the factor IX gene. FASEB J. 6, 2767-2774.
9. Doolittle, R.R and Feng, D.F. (1987) Reconstructing the evolution ofvertebrate blood coagulation from a consideration of the amino acidsequences of clotting proteins. Cold Spring Harbor Symp. Quant. Biol.52, 869-874.
10. Martinex, E., Givel, F., and Wahli, W. (1991) A common ancestor DNAmotif for invertebrate and vertebrate hormone response elements. EMBOJ. 10, 263-268.
11. Ramji, D.P., Tadros, M.H., Hardon, E.M., and Cortese, R. (1991) Thetranscription factor LF-A1 interacts with a bipartite recognition sequencein the promoter regions of several liver-specific genes. Nucleic Acids Res.19, 1139-1146.
at Tufts U
niversity on September 26, 2014
http://hmg.oxfordjournals.org/
Dow
nloaded from
