Two Chloroplast Proteins Suppress ... - Purdue University

Two Chloroplast Proteins Suppress Drought Resistance byAffecting ROS Production in Guard Cells1

Zhen Wang2, Fuxing Wang2, Yechun Hong, Jirong Huang, Huazhong Shi*, and Jian-Kang Zhu*

Shanghai Center for Plant Stress Biology and Center for Excellence in Molecular Plant Sciences (Z.W., F.W., Y.H., J.-K.Z.),University of Chinese Academy of Sciences (Z.W., F.W., Y.H.), Chinese Academy of Sciences, Shanghai 200032, China;National Key Laboratory of Plant Molecular Genetics, CAS Center for Excellence in Molecular Plant Sciences, Institute ofPlant Physiology and Ecology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai200032, China (J.H.); Department of Chemistry and Biochemistry, Texas Tech University, Lubbock, Texas 79409 (H.S.);and Department of Horticulture and Landscape Architecture, Purdue University, West Lafayette, Indiana 47907 (J.-K.Z.)

ORCID IDs: 0000-0003-3817-9774 (H.S.); 0000-0001-5134-731X (J.-K.Z.).

Chloroplast as the site for photosynthesis is an essential organelle in plants, but little is known about its role in stomatal regulation anddrought resistance. In this study, we show that two chloroplastic proteins essential for thylakoid formation negatively regulate droughtresistance in Arabidopsis (Arabidopsis thaliana). By screening a mutant pool with T-DNA insertions in nuclear genes encoding chloroplasticproteins, we identified an HCF106 knockdown mutant exhibiting increased resistance to drought stress. The hcf106 mutant displayedelevated levels of reactive oxygen species (ROS) in guard cells, improved stomatal closure, and reduced water loss under droughtconditions. The HCF106 protein was found to physically interact with THF1, a previously identified chloroplastic protein crucial forthylakoid formation. The thf1 mutant phenotypically resembled the hcf106mutant and displayed more ROS accumulation in guard cells,increased stomatal closure, reduced water loss, and drought resistant phenotypes compared to the wild type. The hcf106thf1 doublemutant behaved similarly as the thf1 single mutant. These results suggest that HCF106 and THF1 form a complex to modulate chloroplastfunction and that the complex is important for ROS production in guard cells and stomatal control in response to environmental stresses.Our results also suggest that modulating chloroplastic proteins could be a way for improving drought resistance in crops.

Drought is a frequently occurring environmental con-dition that causes enormous economic losses in agriculture.Under drought conditions, plants as sessile organismshave to deal with water deficit by increasing water uptakeand reducingwater loss. Building a deeper and larger rootsystem helps ensure water absorption from the soil. Plantscan also adjust physiologically to increase water use effi-ciency in order to maintain growth under drought condi-tions.Minimizingwater loss is often a common strategy forplants to copewithwater deficit, which is largely executedthrough stomatal closure.

Stomatal closure under drought and other stress condi-tions is mediated by signaling molecules such as abscisicacid (ABA), reactiveoxygenspecies (ROS),Ca2+, etc. (Murata

et al., 2015). Drought stress promotes ABA accumulation,and ABA triggers an increase in cytosolic Ca2+. The increasein [Ca2+]cyt helps to activate plasma membrane anion chan-nels, causing the efflux of anions such as Cl2 and NO32,whichdepolarizes theplasmamembraneof guard cells. Thisprocess in turn enhances K+ efflux through the outwardrectifying K+ channel (Kim et al., 2010). Consequently, theturgor pressure of guard cells decreases due to solutes andwater efflux and the stoma closes. Early signaling events inABA-triggered stomatal closure include binding of ABA tothe RCAR/PYR1/PYL receptors; the ABA-bound receptorproteins then interact with clade A protein phosphatase 2Cs(PP2Cs), resulting in the disruption of PP2C-SnRK2 proteincomplexes and activation of the SNF1-related protein kinaseSnRK2s. The active SnRK2s phosphorylate downstream ef-fector proteins, leading to stomatal closure and other ABAresponses (Munemasa et al., 2015).

TheOPEN STOMATAL1 (OST1) is one of the SnRK2sactivated by ABA (Mustilli et al., 2002). OST1 can di-rectly phosphorylate the anion channel SLAC1, thuspromoting anion efflux and stomatal closure (Vahisaluet al., 2008). Moreover, the plasma membrane-boundNADPH oxidase RbohF is also a direct target of OST1.Phosphorylation of RbohF activates its production ofO2

.2 and subsequent formation of H2O2 in the apoplasticcompartment (Sirichandra et al., 2009; Acharya et al.,2013). ROS are thought to be key secondmessengers thatintegrate stress and ABA signaling in stomatal movement.ROS could be sensed by AtGPX3 and the PP2C proteins

1 This work was supported by the Chinese Academy of Sciences.2 These authors contributed equally to the article.* Address correspondence to [email protected] or jkzhu@

sibs.ac.cn.The author responsible for distribution of materials integral to the

findings presented in this article in accordance with the policy de-scribed in the Instructions for Authors (www.plantphysiol.org) is:Jian-Kang Zhu ([email protected]).

J.-K.Z. and Z.W. conceived the genetic screen; H.S. and Z.W. de-signed the experiments and analyzed the data; Z.W. and F.W. per-formed most of the experiments; J.H. provided thf1-1 seeds and THF1antibodies; Y.H. provided technical assistance; H.S. and Z.W. draftedthe article; J.-K.Z. and H.S. revised and finalized the manuscript.

www.plantphysiol.org/cgi/doi/10.1104/pp.16.00889

Plant Physiology�, December 2016, Vol. 172, pp. 2491–2503, www.plantphysiol.org � 2016 American Society of Plant Biologists. All Rights Reserved. 2491 www.plantphysiol.org on December 6, 2016 - Published by www.plantphysiol.orgDownloaded from

Copyright © 2016 American Society of Plant Biologists. All rights reserved. www.plantphysiol.org on December 6, 2016 - Published by www.plantphysiol.orgDownloaded from

















Copyright © 2016 American Society of Plant Biologists. All rights reserved.

http://orcid.org/0000-0003-3817-9774

http://orcid.org/0000-0001-5134-731X

mailto:[email protected]



http://www.plantphysiol.org


http://www.plantphysiol.org/cgi/doi/10.1104/pp.16.00889

http://www.plantphysiol.org/




































ABI1 and ABI2. AtGPX3 was proposed to resemble theyeast GPX-like enzyme ORP1 and to function as a ROStransducer and scavenger in guard cells. AtGPX3physically interacts with ABI2 and ABI1, and oxidizedAtGPX3 significantly reduces the phosphatase activ-ity of ABI2 in vitro (Miao et al., 2006). DownstreamROS targets include the components of the MAP kinasecascade MPK3, MPK9, and MPK12. These MAPKs areactivated by ABA and H2O2 and are involved in ROS-mediatedABA signaling in stomatal closure (Zhang et al.,2014). In addition, GHR1, a plasma membrane receptor-like kinase, also plays an important role in ABA- andH2O2-mediated stomatal closure. GHR1 physically inter-acts with, phosphorylates, and activates SLAC1, whileABI2 antagonizes the activation of SLAC1 byGHR1 (Huaet al., 2012).

The apoplastic ROS burst generated by the plasmamembrane NADPH oxidases is believed to be themajorsource of ROS for ABA signaling in stomatal closure.However, other sources ofROSproduced through cellwall-associated peroxidases and enzymes in the peroxisome alsocontribute to ROS-mediated stomatal closure (Murata et al.,2015). Interestingly, chloroplast as a major ROS producerunder both normal and stress conditions has not beenconsidered as an important source of ROS-mediatingstomatal closure. Chloroplast has been implicated inCa2+-regulated stomatalmovement (Weinl et al., 2008), butwhether chloroplast-originated ROS are involved in sto-matal regulation in response to stress conditions is unclear.

HCF106 is a component of the thylakoid twin-Argtranslocation (cpTat) system, and cpTat is one of the twothylakoid protein translocation systems responsible fortranslocating stromal proteins into the lumen (Robinsonand Bolhuis, 2004). The cpTat translocase includes Tha4,HCF106, and cpTatC, which correspond to the bacterialcounterparts TatA, TatB, and TatC, respectively. The cpTattransports photosynthetic components, including proteinsfor bothPSII andPSI, thusmaking this translocation systemessential, and null mutants of each of the complex proteinsare chlorotic and unviable at seedling stage (Voelker andBarkan, 1995; Motohashi et al., 2001). Thylakoid formation1 (THF1) is a chloroplastic protein located in the outermembrane and the stroma. Mutation in the THF1 generesults in variegated leaves (Wang et al., 2004; Huang et al.,2006). THF1 interacts with the G protein a-subunit GPA1,regulates the FtsH protease activity and is vital for chloro-plast development (Huang et al., 2006; Zhang et al., 2009).

In this study, we screened a T-DNA insertional mu-tant pool for mutations conferring drought resistance inArabidopsis (Arabidopsis thaliana). Several mutant linesshowing an increased drought resistance were isolated,and one of the mutant lines was identified as a weakallele of the hcf106mutant. HCF106 physically interactswith THF1, and mutations in both genes resulted indrought resistance. Both hcf106 and thf1-1 mutantsdisplayed reduced stomatal aperture and reduced wa-ter loss.We deduce thatmutations inHCF106 and THF1resulted in increased ROS accumulation in guard cells,thus promoting stomatal closure, preventing waterloss, and conferring drought resistance.

RESULTS

Identification of the Drought-Resistant hcf106 Mutant

To establish the role of chloroplastic proteins in droughtresistance in plants, we collected more than 1000 mutantlines with T-DNA insertions in the nuclear genes encodingchloroplastic proteins from the ABRC and performed ascreening formutants showing altered response to droughtstress. Several mutants exhibiting drought resistance wereidentified, and one of the drought-resistant mutants,SALK_067017C, showed a reduced wilting phenotypecompared with the wild-type (Columbia-0) plants underdrought stress (Supplemental Fig. S1). The SALK_067017Cline has a T-DNA insertion in the promoter region of thenuclear gene AT5G52440 previously named as High Chlo-rophyll Fluorescence 106 (HCF106); thus, this mutant wasdesignated as hcf106-1. To confirm that the hcf106-1 muta-tion is responsible for thedrought-resistant phenotype, fouradditional T-DNA insertion mutant alleles of the HCF106gene, SALK_044421C, SALK_020680, SAIL_760_H06, andSAIL_831_E01 were obtained from the ABRC, and thehomozygous lines were renamed as hcf106-2, hcf106-3,hcf106-4, and hcf106-5, respectively (Fig. 1B). The hcf106-2and hcf106-3mutants have T-DNA insertions in the 59UTRand the fourth exon of the HCF106 gene, respectively, andthe hcf106-4 and hcf106-5 have T-DNA insertions in thepromoter region of theHCF106 gene (Fig. 1A).Quantitativereal-time (qRT)-PCR analysis revealed that the transcriptlevel of HCF106 was markedly reduced in hcf106-1 to -4mutants, but was not significantly altered in the hcf106-5mutant (Fig. 1C). The hcf106-2 and hcf106-3 mutantsexhibited albino lethal phenotype under normal growthconditions (Supplemental Figs. S2A and S6A), indicatingthat HCF106 is an essential gene for Arabidopsis. Thehcf106-1mutant exhibited amore severe growthphenotypethan the hcf106-4 mutant at the etiolated seedling stage,whereas both hcf106-1 and hcf106-4 performed similarlyduring mature plant stage (Supplemental Fig. S2). Underthe drought stress condition tested, both hcf106-1 andhcf106-4 mutants showed a clear resistant phenotype as in-dicatedbyboth survival rate andmorphological appearance,whilehcf106-5, inwhich theHCF106geneexpressionwasnotaffected, was as sensitive as the wild type (Fig. 1, D and E).These results confirm that thedrought-resistant phenotype isindeed attributed to the mutations in the HCF106 gene.

Molecular Complementation of the hcf106 Mutant

The genomic sequence of the HCF106 gene with its na-tive promoter was fused with 33FLAG tag to createHCF106pro:HCF106-33FLAG construct. This constructwas introduced into hcf106-1 and hcf106-4 mutants byAgrobacterium tumefaciens-mediated transformation. Morethan 20 transgenic lines expressingHCF106were obtained,and these transgenic lines displayed similar growth anddevelopmental phenotypes with the wild type under normalgrowthconditions.Twotransgenic lines,hcf106-1/HCF106pro:HCF106:33FLAGandhcf106-4/HCF106pro:HCF106:33FLAG,were selected for furtheranalysis (Fig. 2A). qRT-PCRanalysis

2492 Plant Physiol. Vol. 172, 2016

Wang et al.

www.plantphysiol.org on December 6, 2016 - Published by www.plantphysiol.orgDownloaded from Copyright © 2016 American Society of Plant Biologists. All rights reserved.

http://www.plantphysiol.org/cgi/content/full/pp.16.00889/DC1





indicated that the HCF106 transcript levels in these twolines were recovered to the wild type level (Fig. 2B), andimmunoblotting assay showed that HCF106-33FLAG fu-sion protein was expressed in the transgenic plants (Fig.2A). Twenty-one-day-oldwild-type (Col-0),hcf106-1,hcf106-4, and the complementation transgenic plants grown in soilwere subjected to drought treatment for 10 d. After rewa-tering for 5d,nearly 90%of thehcf106-1andhcf106-4mutantplants survived, while the survival rates of hcf106-1/HCF106pro:HCF106:33FLAG (;8%)andhcf106-4/HCF106pro:HCF106:33FLAG (;4%) lines were comparable to that ofthewild type (;6%; Fig. 2, C andD). These results indicatedthat the HCF106 gene complemented the hcf106 mutantphenotype and is thus a negative regulator of plant droughtresistance.

Subcellular Localization and Tissue-Specific Expressionof HCF106

The maize HCF106 is a homolog of the E. coli tatB andis located in the thylakoidswith its C-terminal region andamphipathic helix in the stroma (Settles et al., 1997). Inorder to assess the subcellular localization of the Arabi-dopsis HCF106, transgenic plants expressing genomic

HCF106 fused with the green fluorescent protein(HCF106-GFP) driven by theHCF106 native promoter orCaMV35S promoter were generated. Confocal micros-copy revealed that the HCF106-GFP fusion protein wasspecifically localized in the chloroplasts with some dis-crete bright spots (Fig. 3A; Supplemental Fig. S3, A andB). This observation indicated that Arabidopsis HCF106protein is also a chloroplast protein. To determine thetissue expression pattern of HCF106, transgenic Arabi-dopsis plants containing aGUS reporter gene driven bytheHCF106 promoter were analyzed. GUS activity wasobserved in most of the tissues in a seedling, withstrongGUS staining in leaf cells and the vascular tissuesof the root (Fig. 3B; Supplemental Fig. S3, C and D). Inthe leaf, GUS activity was mainly detected in guardcells (Fig. 3C). Additionally, we examined whether theexpression of HCF106 is responsive to drought stressand exogenous ABA. qRT-PCR analysis showed thatthe HCF106 transcript was down-regulated by air dryfor 3 to 18 h but that the expressionwas not significantlyaltered by ABA treatment for 1 to 24 h (Fig. 3, D and E).

To assess whether overexpression of HCF106 in Ara-bidopsis could affect drought resistance, we examinedtwo independent 35S:HCF106-GFP transgenic lines with

Figure 1. HCF106mutants exhibit drought resistance phenotype. A, The schemeof T-DNA insertions of thehcf106mutant alleles. B. PCRverification of the homozygous T-DNA insertion alleles of hcf106. LP, left primer. RP, right primer. LB, primer of T-DNA left border. C,Quantitative measurement of the relative expression level of HCF106 in hcf106-1, hcf106-2, hcf106-3, hcf106-4, hcf106-5, and Col-0.Values aremeans6 SD (n=3).D,The survival rate of 21-d-oldplants ofhcf106-1,hcf106-4,hcf106-5, andCol-0 grownunder drought stressin soil for 12dand recovered for 5d.Values aremeans6 SD (n=3). E,Drought resistance assayofhcf106-1,hcf106-4,hcf106-5, andCol-0.Twenty-one-day-old plants were drought stressed for 10 d and rewatered for 5 d.

Plant Physiol. Vol. 172, 2016 2493

HCF106 and THF1 and Drought Resistance







two independent 35S:GFP transgenic lines as controls.qRT-PCR assay confirmed that HCF106 expression wasincreased more than 10 times in the two overexpressionlines relative to the GFP-only control plants (SupplementalFig. S4B). Drought assay (Supplemental Fig. S4, A and C)and water loss analysis (Supplemental Fig. S4D) indicatedthat drought resistance remained unaffected in theHCF106overexpression transgenic lines compared with the GFP-only controls.

HCF106 Is Important for Stomatal Control and AffectsH2O2 Accumulation in Guard Cells

To elucidate the physiological mechanism of droughtresistance conferred by the hcf106 mutations, we first ex-amined the rate of water loss in Col-0, hcf106-1, hcf106-4,and hcf106-5. The detached leaves of hcf106-1 and hcf106-4showed less water loss than those of Col-0 and hcf106-5plants (Fig. 4D). This indicates that drought resistance in thehcf106mutants is probably due to a decrease in water loss.Since stomata are the major sites in leaves that regulatewater loss in response to drought conditions, we then ex-amined the stomatal aperture (ratio of thewidth to length ofthe aperture) of Col-0 and hcf106 mutant leaves. Undernormalgrowthconditions, the stomatal aperturesofhcf106-1,

hcf106-4, and hcf106-5 mutants were 53.4%, 52.2%, and60.4%, respectively, compared with 62.4% in Col-0 (Fig. 4B).After drought treatment, the stomatal apertures of hcf106-1,hcf106-4, and hcf106-5 mutants were 28.5%, 29.6%, and44.0%, respectively, comparedwith 56.3% in Col-0 (Fig. 4C).The stomatal density and guard cell size were also mea-sured. The hcf106 mutants had no significant difference instomatal density (Fig. 4A) and guard cell size (SupplementalFig. S9C)whencomparedwith thewild-typeCol-0.ABAisawell-known hormonal regulator of stomatalmovement andpromotes stomatal closure in response to drought stress.Wetherefore measured the endogenous ABA contents, and thedata revealed no significant difference between wild typeand the hcf106 mutants under drought stress conditions(Supplemental Fig. S5A). Seedgermination ofCol-0, hcf106-1, and hcf106-4 also did not show difference in responseto exogenous ABA (Supplemental Fig. S5B).

ROS were implicated in stomatal closure; thus, thelevels of H2O2 and superoxide accumulation in wild typeand mutant leaves were assayed by using histochemicalstaining. The levels of H2O2 and superoxide in themutantleaveswere higher than those in thewild-type leaves afterdrought stress treatment (Supplemental Fig. S9, A and B).Furthermore, H2O2 accumulation in guard cells wasmeasured byusing thefluorescent probeCM-H2DCFDA.The relative fluorescence intensities in the guard cells of

Figure 2. Molecular complementation of the drought-tolerant phenotype of hcf106 mutants. A, The phenotype of hcf106 andcomplementation plants at early seedling stage. Top, 7-d-old seedlings; bottom, immunoblot analysis of HCF106-33FLAG;b-ACTIN was used as a loading control; bar = 1 cm. B, HCF106 expression level in Col-0, hcf106-1, hcf106-4, hcf106-1 com-plementation line, and hcf106-4 complementation line. Values are means6 SD (n = 3). C, Survival rate of the complementationplants after drought and rewatering treatment (n = 4 biological replicates, 16 plants of each replicate). Data represent means6 SD.D, Col-0, hcf106-1, hcf106-4, hcf106-1 complementation line, and hcf106-4 complementation line grown under normal growthconditions for 21 d, drought treated for 10 d, and then recovered for 5 d.


Wang et al.













hcf106-1 and hcf106-4 mutants were significantly higherthan that in the wild type (Fig. 4, E and F), indicating thatthe guard cells of the mutants accumulated more H2O2than those of the wild type under drought condition.

HCF106 Physically Interacts with THF1

The essential role ofHCF106 in chloroplast developmentwas investigated by using ultrastructural analysis. Thechloroplasts in the leaves of 6-d-old hcf106-2 and hcf106-3seedlings were filled with numerous vesicles and failed toaccumulate stromal lamellae, which resembles the struc-tural defects of chloroplasts in the previously reported thf1mutant (Supplemental Fig. S6B). The role of HCF106 inthylakoids formation was further studied by identifyingHCF106-intercting proteins using coimmunoprecipitation(co-IP) of chloroplastic proteins followed by mass spec-trometry analysis. The immunoprecipitation-mass spec-trometry analysis showed that most of the potentialHCF106-associated proteins are photosynthesis systemproteins, including PSI components, PSII subunits, ATPase,and oxidase (Supplemental Table S1). Interestingly, THF1was also coimmunoprecipitated with HCF106 protein, sug-gesting an interaction between these two proteins.HCF106-THF1 interaction was further verified by usingbimolecular fluorescence complementation (BiFC) andfirefly luciferase complementation imaging assay (LCI;Chen et al., 2008). Transient expression of both HCF106-

CYFP and THF1-NYFP fusion genes in Arabidopsis meso-phyll protoplasts of Col-0 resulted in yellow fluorescencein the chloroplasts (Fig. 5A), which indicates an interactionbetween HCF106 and THF1. The LCI assay in Nicotianabenthamiana leaf further supported the interaction betweenHCF106 and THF1 (Fig. 5C). To further test whetherHCF106 directly interacts with THF1, we used recombi-nant 63His-fused HCF106 and MBP-tagged THF1 pro-teins purified from Escherichia coli and performed a Hispull-down assay. This assay indicated that HCF106 phys-ically interacts with THF1 in vitro (Fig. 5B). The transcriptlevel of THF1 was not affected by the hcf106 mutations(Supplemental Fig. S7D), but the THF1 protein level (thenonphosphorylated form) appeared slightly decreased inthe hcf106-1 and hcf106-4 mutants (Fig. 5D). This suggeststhat, by forming a complex,HCF106may help stabilize theTHF1 protein in the chloroplasts.

Knockout of THF1 Gene Enhances Drought Resistance

The tissue-specific expression of THF1 gene was inves-tigated by using promoter-GUS analysis. GUS assay in-dicated an expression pattern of THF1 similar to that ofHCF106, with both genes mainly expressed in leaves (Fig.3B; Supplemental Fig. S7A). The expression of THF1 wasfound to be down-regulated rapidly after 6 h of air dryingin Col-0 (Supplemental Fig. S7B), which resembles theHCF106 gene in its gene expression response to drought

Figure 3. Subcellular localization andtissue-specific expression ofHCF106. A,Subcellular localization ofHCF106-GFP inhypocotyl of transgenic Arabidopsis seed-lings expressing genomic HCF106-GFPdriven by the 35S promoter. Chlorophyll,autofluorescence of chlorophyll. BF, brightfield. Bars = 20mm. B and C, GUS activityin the rosette leaves (B) and leaf epidermis(C) of 21-d-old transgenic Arabidopsiscontaining the fusionHCF106pro-GUS. Dand E, HCF106 expression level in 21-d-old plant leaves treated with air drying (D)or 50 mM ABA (E). Values are means 6 SD

(n = 3).











(Fig. 3D). To dissect the function of THF1 in plant responseto drought stress, an Arabidopsis thf1 null mutant, thf1-1 (Huang et al., 2006), was used in drought resistanceassays. 21-d-old plants of Col-0, hcf106-1, hcf106-4, andthf1-1 grown under normal growth conditions were trea-tedwithdrought stress for 10dor 14d and then rewatered(Fig. 6A). Approximately 81%, 83%, and 100% of thehcf106-1, hcf106-4, and thf1-1 mutant plants, respectively,survived following a subsequent 5 d recovery period after10 d drought stress, compared with 8% of the wild-typeCol-0 plants (Fig. 6B). After 14 d of drought treatment,approximately 95% of thf1-1 plants still survived afterrewatering, only 21% for hcf106-1 and 36% for hcf106-4,whereaswild-type plants all died after this severe droughttreatment (Fig. 6C). Furthermore, drought assays of thf1-1 complementation lines demonstrated that the THF1gene complements the thf1-1 drought resistance pheno-type (Supplemental Fig. S8). These results indicate thatthf1-1 is the most drought-tolerant mutant among thetested genotypes.

THF1 Resembles HCF106 in the Control of StomatalAperture and H2O2 Accumulation

The aperture and density of stomata in Col-0, hcf106-1,hcf106-4, and thf1-1 plants weremeasured and analyzed todetermine whether THF1 and HCF106 function in thesame way in drought response. There was no significantdifference in stomatal density among thf1-1, hcf106-1,hcf106-4, and Col-0 (Fig. 6D). However, the stomatal ap-erture in response to drought treatment exhibited a cleardifference among these genotypes. The values of stomatalaperture were approximately 15.9% in thf1-1, 19.5% inhcf106-1, 19.1% in hcf106-4, and 33.1% in Col-0 (Fig. 6E).Consistent with the stomatal aperture results, the rate ofwater loss in the detached leaves of thf1-1was lower thanthat in hcf106-1 and hcf106-4, and the wild-type Col-0 dis-played highest water loss rate (Fig. 6F). These resultsindicate that the enhanced drought resistance of thf1-1mu-tant is also likely due to a decreased stomatal aperture andreduced water loss under drought conditions. Similar

Figure 4. Knockdown HCF106 enhances stomatal closure, reduces water loss, and increases H2O2 accumulation. A, Stomataldensity and B, stomatal aperture of the middle leaves of 4-week-old Col-0, hcf106-1, hcf106-4, and hcf106-5 under normalgrowth conditions. Data represent means6 SD (n = 3). C, Stomatal aperture of the middle leaves of 3-week-old Col-0, hcf106-1,hcf106-4, and hcf106-5 after drought stress for 7 d. D, Water loss in Col-0, hcf106-1, hcf106-4, and hcf106-5 leaves (n = 3, eachcontaining five fully expanded leaves from 4-week-old plants). Data represent means 6 SD (n = 3). E, Quantitative analysis ofH2O2 levels in guard cells of Col-0, hcf106-1, hcf106-4, and hcf106-5 (n = 4 leaves, 12 stomata per leaf from 21-d-old plants afterdrought stress for 7 d). Data represent means6 SD. F, H2O2 accumulation in guard cells of Col-0, hcf106-1, hcf106-4, and hcf106-5 labeled with CM-H2DCFDA (n = 3 leaves, 15 stomata per leaf from 21-d-old plants following drought stress for 7 d).


Wang et al.





to hcf106 mutants, the endogenous ABA content in thf1-1 leaves did not show significant difference when com-pared with that in the wild type (Supplemental Fig. S5A),which also suggests that the decreased stomatal aperture inthf1-1mutant is not due to excessive ABA. Resembling thehcf106mutants, the thf1-1mutant also accumulated a higher

level of H2O2 in leaves than the wild type (SupplementalFig. S9A). Furthermore, the assay using CM-H2DCFDAfluorescence dye showed that the guard cells of thf1-1 ac-cumulated more H2O2 than in the Col-0 wild-type plants(Fig. 6, G and H). The role of ROS in promoting stomatalclosure was further studied by applying the commonly

Figure 5. HCF106physically interactswith THF1.A,BiFCassay inArabidopsis protoplasts showing the interactionbetweenHCF106andTHF1. B, In vitro pull-down ofMBP-tagged THF1 using 63His-taggedHCF106 as determined by immunoblotting with anti-His antibodyand anti-MBPantibody. C, Luciferase imaging of N. benthamiana leaf coinfiltrated with the Agrobacteria strains containing THF1-NLucand/or CLuc-HCF106. D, THF1 protein levels in leaves of 4-week-old Col-0, hcf106-1, hcf106-4, hcf106-5, and thf1-1 determined withimmunoblots. pTHF1, phosphorylated form of THF1; b-ACTIN was used as a loading control.

Figure 6. Knockout of THF1 leads toH2O2 accumulation, enhanced stomatal aperture closure, reducedwater loss, and increasedtolerance to drought stress. A, Drought resistance assay. Col-0, hcf106-1, hcf106-4, and thf1-1 plants grown under normal growthcondition for 21 d were treated with drought stress for 10 d, or 14 d, and then rewatered for 5 d. Survival rate of Col-0, hcf106-1,hcf106-4, and thf1-1 after drought treatment for 10 d (B) and 14 d (C; n = 4 biological replicates, 16 plants of each replicate).Stomatal density (D) and stomatal aperture (E) of themiddle leaves of Col-0, hcf106-1, hcf106-4, and thf1-1 after drought stress for7 d. F, Water loss in Col-0, hcf106-1, hcf106-4, and thf1-1 leaves (n = 3, each containing five fully expanded leaves from 4-week-old plants following drought stress for 7 d). G, Quantitative analysis of H2O2 levels in guard cells of Col-0, hcf106-1, hcf106-4,and thf1-1 (n = 3 leaves, 15 stomata per leaf leaves of 4-week-old plants following drought stress for 7 d). Data represent means6SD. H, H2O2 accumulation in guard cells of Col-0, hcf106-1, hcf106-4, and thf1-1 labeled with CM-H2DCFDA probe.









used cell-permeable ROS scavenger N-acetyl-Cys (NAC;Wang et al., 2016). After applyingNAC, ROS accumulationin the guard cells and stomatal aperture were measured inthe leaves of drought-stressed hcf106-4, thf1-1, and Col-0.The results showed that, without NAC treatment, theguard cells of hcf106-4 and thf1-1 accumulated more H2O2than that of wild type as expected, while comparable levelsof H2O2 in all these three genotypes were observed afterNAC treatment (Supplemental Fig. S10A). Consequently,the stomatal apertures of hcf106-4 and thf1-1 reached asimilar size with that of the wild type after applying NAC(Supplemental Fig. S10B). These results suggest thathigher accumulation ofH2O2 in the guard cells of hcf106 andthf1-1 mutants may result in decreased stomatal aperture,reduced water loss, and thus enhanced drought resistance.

HCF106 and THF1 Interact Genetically

To further corroborate the observation that HCF106 andTHF1 form a complex and function together in the controlof stomatal aperture anddrought resistance,we constructeddouble mutants thf1-1hcf106-1 and thf1-1hcf106-4 throughgenetic crosses (Supplemental Fig. S11) and then tested thedrought resistance of the double and single mutants. Allphenotypic analysis revealed that the double mutants be-haved similarly as the thf1-1 single mutant (Fig. 7D). Undersevere drought stress, the double mutants exhibitedan approximately 80% survival rate, compared withapproximately 74% in thf1-1 single mutant, which are sig-nificantly higher than 18%, 20%, and 0% in hcf106-1, hcf106-4, and Col-0, respectively (Fig. 7A). Consistent with thesurvival rates, the stomatal apertures in the leaves of 21-d-old single and double mutants after 7 d drought treatmentwere approximately 10.9% in thf1-1hcf106-1, 12.6% in thf1-1hcf106-4, 15.0% in thf1-1, 22.6% in hcf106-1, 18.4% in hcf106-4, and 32.7% in Col-0 (Fig. 7B), and the rate of water loss inthe detached leaves of the double mutants was lower thanthat in the single mutants and the wild type (Fig. 7C).Collectively, these results indicate that the HCF106 andTHF1 genes are likely to genetically interact and function inthe samepathway tomediatedrought resistance.However,both proteins may also act independently to modulatestomatal opening andwater loss under drought conditionssince the double mutants showed slightly stronger pheno-types than the thf1-1 single mutant (Fig. 7, B and C).

DISCUSSION

Chloroplast Function Is Crucial for Stomatal Regulation

The stoma is a multicellular complex on the leafsurface that is crucial for many important physiologicalprocesses such as photosynthesis and response to en-vironmental changes. The stomatal complex consists ofa pair of guard cells and subsidiary cells that are dif-ferentiated from epidermal cells. Interestingly, guardcells are the only epidermal cells possessing chloroplastsin many plant species, but guard cells have fewer andless-developed chloroplasts than mesophyll cells(Allaway and Setterfield, 1972). Guard cell chloroplasts

may be involved in regulating stomatal movement. Astrong argument against this notion came from theobservation that the guard cells from plant species suchas Paphiopedilum species lack chloroplasts but are stillfunctional in controlling stomatal movement (Damelioand Zeiger, 1988). However, many studies on stomatalguard cells with chloroplasts suggested that chloro-plasts do contribute to stomatal opening and closing.Although the underlying mechanisms are still unclear,guard cell chloroplasts could participate in stomatalmovement via generating sugars as osmolytes, eitherby converting starch or by photosynthetic carbon re-duction and/or via providing ATP for the activity ofthe plasma membrane H+-ATPase, which drives theinflux of K+ (Lawson, 2009). A recent study showed thatan Arabidopsis mutant having guard cells withoutchloroplasts has a significant reduction in stomatalopening when compared with the wild-type Arabi-dopsis (Wang et al., 2014), which supports the in-volvement of chloroplasts in stomatal function. Guardcell chloroplasts were also found to be essential for bluelight-dependent stomatal opening in Arabidopsis(Suetsugu et al., 2014). In our study, we found thatmutations in the nuclear-encoded chloroplast geneHCF106 promote stomatal closing under drought con-dition (Fig. 4C). The HCF106 gene is an essential genefor chloroplast development, and null mutants of thisgene are lethal at the seedling stage (Supplemental Figs.S2Aand S6A). Furthermore, theTHF1 gene is an essentialgene for chloroplast formation, and the thf1-1 mutationalso promotes stomatal closing (Fig. 6E). HCF106 andTHF1 physically interact in the chloroplast (Fig. 5). Theseresults further support the important role of chloroplastsin guard cells in stomatal regulation.

Chloroplast Originated ROS and Stomatal Movement

Among several signaling molecules such as Ca2+,ABA, and other phytohormones, ROS have been welldocumented to play a signaling role in stomatal regu-lation (Song et al., 2014; Murata et al., 2015). Multiplesources of ROS have been proposed in guard cells inresponse to stress conditions. Apoplastic ROS can begenerated through the activity of plasma membraneNADPH oxidases and cell wall-associated enzymessuch as peroxidases, amine oxidases, and quinone re-ductases, while intracellular ROS are produced in sev-eral locations including chloroplasts, mitochondria,and peroxisomes (Marino et al., 2012; Kärkönen andKuchitsu, 2015). The apoplastic ROS, particularly thoseproduced via the plasma membrane NADPH oxidasesand cell wall peroxidases, have been thought to be themajor source of ROS in response to both biotic andabiotic stress. The Arabidopsis respiratory burst oxi-dase homologs (AtRbohs) are the plasma membraneNADPH oxidases that have been extensively studied.As the name indicated, Rboh enzymes are responsiblefor the fast production of ROS to form a ROS burstduring the early stage of the responses. AtRbohs playkey roles in stomatal closure in response to diverse


Wang et al.









factors, including ABA and other phytohormones,abiotic stress, and pathogenic elicitors by generating aburst of ROS and triggering downstream signalingevents. In addition, AtRbohs are also involved in manyother developmental processes, such as root hair for-mation and pollen tube growth (Marino et al., 2012;Baxter et al., 2014; Murata et al., 2015). Although in-tracellular organelles such as chloroplasts, mitochon-dria, and peroxisomes are well-known sites of ROSproduction, whether and how the ROS from these in-tracellular sources contribute to the regulation of sto-matal movement has not been well understood.Chloroplasts generate ROS under both normal and

stress conditions. Various forms of ROS including sin-glet oxygen, oxygen anion, and H2O2 can be generatedin chloroplasts, and stress conditions such as droughtand heat enhance the production of chloroplastic ROS(Galvez-Valdivieso and Mullineaux, 2010; Miller et al.,2010). Although chloroplasts are major sites of ROSproduction (Asada, 2006), its role in ROS-mediatedstomatal closure is unclear. In this study, we found thatmutations in the nuclear encoded chloroplastic proteinsHCF106 and THF1 resulted in an increase in ROS pro-duction in guard cells (Fig. 4, E and F; Fig. 6, G and H),

and the increased ROS in guard cells coincidedwith theenhanced stomatal closure in these mutants in responseto drought stress (Figs. 4C and 6E). The increased sto-matal closure in the mutants under drought stress wasabolished by exogenously applied ROS scavenger NAC(Supplemental Fig. S10). We deduce that disruption ofHCF106 or THF1 may have resulted in malfunction ofthe photosystems in chloroplasts in guard cells, whichthen causes excessive ROS production especially underdrought stress conditions, and the elevated ROS in thechloroplasts, together with apoplastic ROS, enhancestomatal closure under drought stress. The chloroplasticROS in guard cells may provide the basal level of ROSthat modulates the intensity and duration of stomatalclosure in response to relatively long-term stress condi-tions such as drought.

How chloroplastic ROS regulate stomatal movementis still an unanswered question. A recent study indi-cated that ROS in guard cell chloroplasts were tripledafter ABA and methyl jasmonate treatments, and theincreased ROS were observed to coincide with starchgrain accumulation (Leshem and Levine, 2013). Sugarsfrom chloroplasts have long been proposed to serve asosmolytes to regulate water potential in guard cells

Figure 7. The thf1hcf106 double mutants resemble the thf1-1 single mutant. A, Survival rate after drought treatment for 14 d (n = 3 bi-ological replicates, 18 plants in each replicate).Data representmeans6 SD. B, Stomatal aperture of themature leaves of 3-week-oldCol-0,hcf106-1, hcf106-4, thf1-1, thf1-1hcf106-1, and thf1-1hcf106-4 after drought stress for 7 d. C, Water loss in Col-0, hcf106-1, hcf106-4,thf1-1, thf1-1hcf106-1, and thf1-1hcf106-4 leaves (n = 5, each containing three fully expanded leaves from 4-week-old plants). Datarepresentmeans6 SD (n=3). D,Drought resistance assay. Col-0, hcf106-1, hcf106-4, thf1-1 plants grown under normal growth conditionfor 21 d were treated with drought stress for 10 or 15 d and then rewatered for 5 d.







thus control stomatal movement (Lawson, 2009). H2O2accumulation was shown to inhibit a-amylase activityrequired for starch degradation to produce sugars(Sparla et al., 2006). These lines of evidence support thenotion that increased chloroplastic ROS in hcf106 andthf1-1 mutants could inhibit starch degradation andthus reduce sugar accumulation, and reduced sugarcontent in guard cells results in higher water potentialand water efflux from the guard cells, and as a result,the stomata close. It is also possible that higher chlo-roplastic ROS work together with apoplastic ROS tomediate stronger signaling response in guard cells topromote stomatal closure. Another possibility is thatreduced photosynthetic capacity in guard cells of themutants may result in reduced photosynthetic pro-duction of sugars thus causing stomatal closure. Allthese possibilities need to be experimentally examined.

Manipulating Nuclear Genes Encoding ChloroplastProteins in Guard Cells Could Be a Way to ImproveDrought Resistance in Crops

Both conventional breeding and modern genetic manip-ulation have been extensively attempted to create drought-resistant crops.Drought resistance is a complex trait that canbe attributed to root morphological characters such asdeep and large root system and/or shoot-related traitssuch as stomatal conductance.Major efforts on improvingdrought resistance have beenmade on utilizing key genesin drought response pathways through genetic engi-neering (Hu and Xiong, 2014). ABA as the vital phyto-hormone for drought stress response in plants has beenthe focal molecule for manipulating drought resistance incrops, and key genes in the ABA biosynthetic and sig-naling pathways have been tested in conferring droughtresistance. Also, systems approaches including variousomics analyses have recently been used for identifyingdrought resistance-relatedgenes. The identified candidategenes are valuable for evaluation of natural variationsbetween resistant and sensitive varieties and could beeventually used for breeding drought-resistant crops(Jogaiah et al., 2013; Krannich et al., 2015; Zhu et al., 2016).

Although plants have evolved diverse mechanisms toresist drought stress, control of stomatal movement is acommon strategy for most plants to respond to droughtconditions. Stomata close in order to preserve water underdrought conditions, which is modulated by a battery ofsignaling events, including ABA signaling. Stomata are thesites of water transpiration and account for most of thewater loss inplants. Thus,manipulationof stomata in leavesis one of the favorable strategies for improving drought re-sistance. One of the ways to modulate stomatal movementis to express genes specifically in guard cells in a spatial andtemporalmanner topromote stomatal closure in response todrought stress. This approach would be useful for improv-ing drought resistance via specifically targeting stomatawhile minimizing potential yield penalty by avoiding sideeffects in other cells. Chimeric promoters that are droughtinducible and guard cell specific have been developed(Rusconi et al., 2013; Na andMetzger, 2014), but application

of these promoters in drought resistance has yet to be tested.Another way of manipulating stomata is to alter stomataldensity, thus reducing water transpiration. In Arabidopsis,geneticmanipulationof the epidermalpatterning factorshasgenerated plant lines with a range of stomatal density(Richardson andTorii, 2013). Reduced stomatal densitywasfound to increase plant resistance to water deficit (Doheny-Adams et al., 2012; Hepworth et al., 2015).

In our study, we found that partial loss-of-function ofHCF106 gene conferred drought resistance in Arabidopsis(Fig. 1,D andE). ConsistentwithTHF1being an interactingpartner of HCF106, mutation in THF1 gene also causeddrought-resistant phenotype (Fig. 6, A–C). These resultssuggest that modulating chloroplast function via changingthe chloroplast proteins could be away to enhance droughtresistance in plants. However, many genes encoding chlo-roplastic proteins, including HCF106 and THF1, are essen-tial genes or important for chloroplast functions, and nullmutants of some of these genes are seedling lethal. There-fore, application of this strategy to crops requires targetedknockdown of the nuclear-encoded chloroplast genes inguard cells. Utilizing guard-cell-specific promoters and therecently developed CRISPR/Cas9 technology to specifi-cally manipulate chloroplasts in guard cells is a promisingapproach to creating drought-resistant plants.

MATERIALS AND METHODS

Plant Materials and Growth Conditions

All the Arabidopsis (Arabidopsis thaliana) geneticmaterials used in this studywere inthe Columbia-0 background. The T-DNA insertionmutants, hcf106-1, hcf106-2, hcf106-3,hcf106-4, and hcf106-5 were obtained from the ABRC (stock numbers SALK_067017C,SALK_044421C, SALK_020680, SAIL_760_H06, and SAIL_831_E01). The thf1-1 wasprovidedbyDr. JinrongHuang(Huanget al., 2006). The thf1-1hcf106-1and thf1-1hcf106-4double mutants were generated by genetic crossing and subsequent PCR-based geno-typing in the F2 population. For seedling growth in agar plate, seeds weresurface-sterilized and stored in sterilewater at 4°C for 48 h for stratification, followedbygermination at 22°C in 0.53Murashige and Skoogmedium (pH 5.8) with 1% Suc and0.6% (w/v) agar. Seven-day-old seedlingswere then transplanted in soil and grow in agrowth room at 22°C with 16 h light/8 h dark (long day) for observations of normalgrowth and development, seeds proliferation, and water loss experiments in detachedleaves. For drought resistance test, 8-d-old seedlings grown in agar plates were trans-ferred to soil andplaced at 22°C in a growth roomwith 10 h light/14 hdark (short day)cycle and continue growing for 2 weeks; the plants were then subjected to droughttreatment by withholding water for indicated days described in the figures.

To obtain theHCF106pro:GUS fusion construct, the 1645-bp promoter fragment ofHCF106 gene was cloned into the pMDC162 binary vector (Curtis and Grossniklaus,2003). For the HCF106pro:HCF106-GFP fusion, the genomic region containing theHCF106 genewith the 1645-bp promoterwas cloned into the pMDC110 binary vector(Curtis and Grossniklaus, 2003). The 35S:HCF106-GFP fusion was constructed byinserting the HCF106 coding sequence (CDS) into the pGWB5 binary vector(Nakagawa et al., 2007). All constructs were confirmed by sequencing and then in-troduced into Col-0 byAgrobacterium tumefaciensGV3101 using the floral dip method(Clough and Bent, 1998). For the HCF106pro:HCF106-33FLAG and THF1pro:THF1-33FLAG, the genomic regions containing the HCF106 and THF1 genes with at least1.5 kb native promoters were cloned into the pCAMBIA1305 binary vector (He et al.,2009). These constructs were introduced into hcf106-1, hcf106-4, or thf1-1 mutants formolecular complementation and co-IP experiments.

Measurement of Stomatal Aperture

For stomatal aperture measurement, 3-week-old plants of Col-0, hcf106-1,hcf106-4, hcf106-5, and thf1-1 grown in short day (10 h light/14 h dark) werewithheldwater for 1week, and then themature rosette leaveswere sampled. Toassess the effect of NAC on stomatal aperture, the mature rosette leaves wereapplied with 10 mM NAC separately for 0, 0.5, 1, 1.5, and 2 h and then sampled


Wang et al.




for analysis. The leaf surface imprint method was performed as describedpreviously (Yu et al., 2008). Briefly, a glass slide was coated with glue, and theleaf abaxial side was pressed on the glue-coated slide for 20 s. The leaf was tornoff, and the imprint on the glass slide was examined under a microscope. Forstatistical analysis of stomatal aperture, five leaves per line and five fields perleaves were analyzed.

Measurement of Water Loss in Detached Leaves

Tomeasurewater loss ofdetached leaves,mature leaveswereharvested from4-week-old Col-0, hcf106-1, hcf106-4, hcf106-5, and thf1-1 plants grown in agrowth room with 10-h-light/14-h-dark period under normal growth condi-tions. The detached leaves were placed on an electronic balance and periodi-cally weighed. Water loss was calculated as a percentage of the decreased freshweight to the initial fresh weight of the detached leaves. The experiment wasperformed three times, each time with two replicate leaves per genotype.

Co-IP

The chloroplasts of mature leaves of 5-week-old Col-0 and transgenicHCF106pro:HCF106-33FLAG plants were isolated (Huang et al., 2013) and in-cubated in the binding buffer (40 mM HEPES, pH 7.4, 2 mM EDTA, 10 mM

sodium pyrophosphate tetrabasic, 10 mM b-glycerophosphate disodium salthydrate, and 0.3% CHAPS hydrate) containing Proteinase inhibitor Cocktail(Roche) for 30 min at 4°C. After centrifugation, the supernatant of cell lysateswas incubated with anti-FLAG antibodies coupled to magnetic DynabeadsProtein G (Life Technologies) for 3 h at 4°C. The magnetic beads were thencollected by centrifugation and washed three times with the low-salt washingbuffer (40 mM HEPES, pH 7.4, 2 mM EDTA, 10 mM sodium pyrophosphatetetrabasic, 10 mM b-glycerophosphate disodium salt hydrate, 0.3% CHAPShydrate, and 150 mM NaCl). The immunoprecipitated proteins were digestedwith trypsin (Promega), and then analyzed by mass spectrometry usingnanoAcquity ultraperformance LC (Waters) coupled with an Orbitrap FusionTribrid mass spectrometer (Thermo Fisher Scientific).

BiFC Assays

The full-length CDS of HCF106 and THF1 genes were cloned into pSAT4-CYFPand pSAT4-NYFP BiFC system vectors, respectively, to create HCF106-CYFP andTHF1-NYFP. Two micrograms of each of these two plasmids were mixedand cotransformed into Arabidopsis mesophyll protoplasts using polyethyleneglycol-mediated transient transformation method (Yoo et al., 2007). After cul-turing in light at 22°C for 20 h, the fluorescence in the transformed cells wereimaged using a Nikon A1 spectral confocal microscope imaging system.

LCI Assay

The full-length CDS ofHCF106 and THF1were constructed into pCAMBIA-NLuc and pCAMBIA-CLuc system vectors, respectively, to produce CLuc-HCF106 and THF1-NLuc. The constructs were cotransferred into Nicotianabenthamiana leaves by using A. tumefaciens-mediated transient transformationmethod as described previously (Chen et al., 2008). One millimolar luciferinwas infiltrated into leaves, and the leaveswere kept in dark for 10min to quenchthe fluorescence. The LUC images were captured using a low-light cooled CCDimaging system (Lumazone; Roper Scientific).

Protein Expression and Pull-Down Assay

The HCF106 CDS was cloned into the vector pET28a, and the THF1 CDS wasinserted into the vector pMAL-c5x. The constructs were verified by sequencing andtransformed intoBL21competent cells. Thepull-downassaywasperformedaccordingto Cui et al. (2015)with somemodifications. Briefly,Escherichia coli cells expressingHisor His-HCF106 recombinant proteins were lysed with ultrasonic cell disruptor in 13PBS followed by centrifugation. The supernatant was incubated with 100 mLnickelmagnetic beads (Biotool) in 1mL binding buffer (20mM sodiumphosphate, pH7.4, 500 mM NaCl, and 50 mM imidazole) at 4°C for 2 h and washed three times with1 mL washing buffer (20 mM sodium phosphate, pH 7.4, 500 mM NaCl, and 100 mM

imidazole). After washing, the supernatants containing MBP or MBP-THF1 recombi-nant proteins were added to the beads and incubated for additional 2 h at 4°C. Thebeadswere collectedbycentrifugationandwashed three timeswith thebindingbuffer.The His pull-down proteins were then resuspended in elution buffer (20 mM sodium

phosphate, pH 7.4, 500 mM NaCl, and 500 mM imidazole) and eluted for 30 min. Theeluted proteins were separated by 12% SDS-PAGE and detected by immunoblottingwith anti-His antibodies (Abmart) and anti-MBP antibodies (Abmart).

H2O2 Measurement in Guard Cells

CM-H2DCFDAwasusedasthemoleculeprobetodetectH2O2contentinguardcells.The abaxial epidermal strips of the leaves from 4-week-old plants were floated in 0.1 M

potassium phosphate buffer (pH 7.2) for 30 min. Twomicromolar (final concentration)of CM-H2DCFDA (Sigma-Aldrich) was added to the solution, and the strips were in-cubated for 20min at 22°C in dark. To study the effect ofNAConROS level, epidermalstrips were transferred to 0.1 M potassium phosphate buffer (pH 7.0) containing 1 mM

NACfor 0, 10, 20, and 40min. Twomicromolar (final concentration) ofCM-H2DCFDAwas then added, and the stripswere incubated for 30min at room temperature in dark.The strips were washed twice with 0.1 mM KCl, 0.1 mM MgCl2 for 10 min to removeexcess stainingbuffer, and theguardcells in the stripswereobservedunderafluorescentmicroscope (OlympusDP72). All imageswere acquired under identical conditions. Thefluorescence emission of the guard cells was analyzed using the software equipped forthemicroscope. Each sample contained strips from ten independent leaves, and at leastseven randomly selected guard cells from each strip were analyzed.

Histochemical Staining and Confocal Microscopy Analysis

Hydrogen peroxide and superoxide in the expended leaves of 4-week-oldplants were detected by using DAB and NBT staining as previously described(Jin et al., 2014). Staining for GUS activity was performed as previously de-scribed (Wang et al., 2015) with some modifications. The samples were incu-bated in GUS staining solution (0.1 M potassium phosphate buffer, pH 7.0,1 mmol/L ferrocyanide, 1 mmol/L ferricyanide, and 0.1% Triton X-100) con-taining 0.5 mg/mL X-gluc at 37°C in dark for 2 h. GUS images were taken byusing the Olympus DP72 and SZX7 microscopes. For detection of GFP, 7-d-oldtransgenic seedlings harboring 35S:HCF106-GFP or HCF106pro:HCF106-GFPwere used for detection of GFP and chlorophyll autofluorescence using a con-focal microscope. The images were captured using Leica SP8 confocal micro-scope, and at least five independent transgenic lines were examined.

qRT-PCR Analysis

Total RNAwas extracted from the shoots of 18-d-old seedlings using TRIzolreagent (Invitrogen) and reverse transcription was performed by using theiScript cDNA synthesis kit (Bio-Rad). After inactivation of the enzymes byheating, a 0.5-mL aliquot was used for real-time quantitative PCR. All quanti-tative real-time PCR analyses were performed using the AceQ qPCR SYBRGreen Master Mix (Vazyme) according to the manufacturer’s protocol. UBQ5,ACT2, and ACT7 were used as internal controls in qRT-PCR. Each analysisconsisted of three biological replicates. Each sample had three qPCR reactions.The primers used in this study were listed in Supplemental Table S1.

Analysis of Chloroplast Ultrastructure

Cotyledons of 7-d-old seedlings were collected for transmission electronmicroscopy. The cotyledons were fixed in 2.5% glutaraldehyde and postfixedovernight at 4°C in 1% OsO4. After dehydration using an ethanol series, thesamples were gradually infiltrated with a series of epoxy resin in epoxy pro-pane, and then embedded in Epon 812 resin. The embeddedmaterials were thinsectioned, stained in uranium acetate followed by lead citrate, and photo-graphed with a Phillips CM120 transmission electron microscope.

Accession Numbers

Sequence data from this article can be found in The Arabidopsis InformationResource (http://www.arabidopsis.org/) under the following accession num-bers:HCF106 (AT5G52440), THF1 (AT2G20890), ACT2 (AT3G18780), ACT7(AT5G09810), and UBQ5 (AT3G62250).

Supplemental Data

The following supplemental materials are available.

Supplemental Figure S1. Drought resistance assay of SALK_067017C.

Supplemental Figure S2. Developmental phenotype of the hcf106 mutants.





http://www.arabidopsis.org/





Supplemental Figure S3. Subcellular localization of HCF106-GFP and rootexpression pattern of HCF106.

Supplemental Figure S4. Drought assay of the overexpression lines ofHCF106.

Supplemental Figure S5. ABA contents and germination assay of hcf106and thf1 mutants.

Supplemental Figure S6. Ultrastructure of chloroplasts in the hcf106 andthf1 mutants.

Supplemental Figure S7. Expression pattern of THF1.

Supplemental Figure S8. Drought assay of thf1-1 complementation lines.

Supplemental Figure S9. Determination of ROS and guard cell size inhcf106 and thf1 mutants.

Supplemental Figure S10. ROS affects the stomatal aperture in hcf106 andthf1 mutants.

Supplemental Figure S11. Identification of the double mutant thf1hcf106.

Supplemental Table S1. Proteins interacting with HCF106 as identified bymass spectrometry in chloroplast.

Supplemental Table S2. Primers used in this study.

ACKNOWLEDGMENTS

We thank the Arabidopsis Biological Resource Center at Ohio State Univer-sity for seed stocks, Dr. Yimin She for assistance with mass spectrometry, andDr. Minjie Cao for his constructive discussion and help.

Received June 3, 2016; accepted October 13, 2016; published October 15, 2016.

LITERATURE CITED

Acharya BR, Jeon BW, Zhang W, Assmann SM (2013) Open Stomata1 (OST1) is limiting in abscisic acid responses of Arabidopsis guard cells.New Phytol 200: 1049–1063

Allaway WG, Setterfield G (1972) Ultrastructural observations on guardcells of vicia-faba and allium-porrum. Can J Bot 50: 1405–1413

Asada K (2006) Production and scavenging of reactive oxygen species inchloroplasts and their functions. Plant Physiol 141: 391–396

Baxter A, Mittler R, Suzuki N (2014) ROS as key players in plant stresssignalling. J Exp Bot 65: 1229–1240

Chen H, Zou Y, Shang Y, Lin H, Wang Y, Cai R, Tang X, Zhou JM (2008)Firefly luciferase complementation imaging assay for protein-proteininteractions in plants. Plant Physiol 146: 368–376

Clough SJ, Bent AF (1998) Floral dip: a simplified method for Agrobacterium-mediated transformation of Arabidopsis thaliana. Plant J 16: 735–743

Cui LG, Shan JX, Shi M, Gao JP, Lin HX (2015) DCA1 acts as a tran-scriptional co-activator of DST and contributes to drought and salt tol-erance in rice. PLoS Genet 11: e1005617

Curtis MD, Grossniklaus U (2003) A gateway cloning vector set for high-throughput functional analysis of genes in planta. Plant Physiol 133: 462–469

D’Amelio ED, Zeiger E (1988) Diversity in guard-cell plastids of the or-chidaceae—a structural and functional study. Canadian Journal of Bot-any 66: 257–271

Doheny-Adams T, Hunt L, Franks PJ, Beerling DJ, Gray JE (2012) Geneticmanipulation of stomatal density influences stomatal size, plant growthand tolerance to restricted water supply across a growth carbon dioxidegradient. Philos Trans R Soc Lond B Biol Sci 367: 547–555

Galvez-Valdivieso G, Mullineaux PM (2010) The role of reactive oxygen species insignalling from chloroplasts to the nucleus. Physiol Plant 138: 430–439

He XJ, Hsu YF, Zhu S, Wierzbicki AT, Pontes O, Pikaard CS, Liu HL,Wang CS, Jin H, Zhu JK (2009) An effector of RNA-directed DNAmethylation in arabidopsis is an ARGONAUTE 4- and RNA-bindingprotein. Cell 137: 498–508

Hepworth C, Doheny-Adams T, Hunt L, Cameron DD, Gray JE (2015)Manipulating stomatal density enhances drought tolerance withoutdeleterious effect on nutrient uptake. New Phytol 208: 336–341

Hu H, Xiong L (2014) Genetic engineering and breeding of drought-resistant crops. Annu Rev Plant Biol 65: 715–741

Hua D, Wang C, He J, Liao H, Duan Y, Zhu Z, Guo Y, Chen Z, Gong Z(2012) A plasma membrane receptor kinase, GHR1, mediates abscisicacid- and hydrogen peroxide-regulated stomatal movement in Arabi-dopsis. Plant Cell 24: 2546–2561

Huang W, Chen Q, Zhu Y, Hu F, Zhang L, Ma Z, He Z, Huang J (2013)Arabidopsis thylakoid formation 1 is a critical regulator for dynamics ofPSII-LHCII complexes in leaf senescence and excess light. Mol Plant 6:1673–1691

Huang J, Taylor JP, Chen JG, Uhrig JF, Schnell DJ, Nakagawa T, KorthKL, Jones AM (2006) The plastid protein THYLAKOID FORMATION1and the plasma membrane G-protein GPA1 interact in a novel sugar-signaling mechanism in Arabidopsis. Plant Cell 18: 1226–1238

Jin H, Liu B, Luo L, Feng D, Wang P, Liu J, Da Q, He Y, Qi K, Wang J, et al(2014) HYPERSENSITIVE TO HIGH LIGHT1 interacts with LOWQUANTUM YIELD OF PHOTOSYSTEM II1 and functions in protectionof photosystem II from photodamage in Arabidopsis. Plant Cell 26:1213–1229

Jogaiah S, Govind SR, Tran LS (2013) Systems biology-based approachestoward understanding drought tolerance in food crops. Crit Rev Bio-technol 33: 23–39

Kärkönen A, Kuchitsu K (2015) Reactive oxygen species in cell wall me-tabolism and development in plants. Phytochemistry 112: 22–32

Kim TH, Böhmer M, Hu H, Nishimura N, Schroeder JI (2010) Guard cellsignal transduction network: advances in understanding abscisic acid,CO2, and Ca2+ signaling. Annu Rev Plant Biol 61: 561–591

Krannich CT, Maletzki L, Kurowsky C, Horn R (2015) Network candidategenes in breeding for drought tolerant crops. Int J Mol Sci 16: 16378–16400

Lawson T (2009) Guard cell photosynthesis and stomatal function. NewPhytol 181: 13–34

Leshem, Y, Levine, A 2013. Zooming into sub-organellar localization ofreactive oxygen species in guard cell chloroplasts during abscisic acidand methyl jasmonate treatments. Plant Signal Behav 8: 10.4161/psb.25689

Marino D, Dunand C, Puppo A, Pauly N (2012) A burst of plant NADPHoxidases. Trends Plant Sci 17: 9–15

Miao Y, Lv D, Wang P, Wang XC, Chen J, Miao C, Song CP (2006) AnArabidopsis glutathione peroxidase functions as both a redox trans-ducer and a scavenger in abscisic acid and drought stress responses.Plant Cell 18: 2749–2766

Miller G, Suzuki N, Ciftci-Yilmaz S, Mittler R (2010) Reactive oxygenspecies homeostasis and signalling during drought and salinity stresses.Plant Cell Environ 33: 453–467

Motohashi R, Nagata N, Ito T, Takahashi S, Hobo T, Yoshida S, Shinozaki K(2001) An essential role of a TatC homologue of a Delta pH-dependentprotein transporter in thylakoid membrane formation during chloroplastdevelopment in Arabidopsis thaliana. Proc Natl Acad Sci USA 98: 10499–10504

Munemasa S, Hauser F, Park J, Waadt R, Brandt B, Schroeder JI (2015)Mechanisms of abscisic acid-mediated control of stomatal aperture. CurrOpin Plant Biol 28: 154–162

Murata Y, Mori IC, Munemasa S (2015) Diverse stomatal signaling and thesignal integration mechanism. Annu Rev Plant Biol 66: 369–392

Mustilli AC, Merlot S, Vavasseur A, Fenzi F, Giraudat J (2002) Arabi-dopsis OST1 protein kinase mediates the regulation of stomatal apertureby abscisic acid and acts upstream of reactive oxygen species produc-tion. Plant Cell 14: 3089–3099

Na JK, Metzger JD (2014) Chimeric promoter mediates guard cell-specificgene expression in tobacco under water deficit. Biotechnol Lett 36: 1893–1899

Nakagawa T, Kurose T, Hino T, Tanaka K, Kawamukai M, Niwa Y,Toyooka K, Matsuoka K, Jinbo T, Kimura T (2007) Development ofseries of gateway binary vectors, pGWBs, for realizing efficient con-struction of fusion genes for plant transformation. J Biosci Bioeng 104:34–41

Richardson LG, Torii KU (2013) Take a deep breath: peptide signalling instomatal patterning and differentiation. J Exp Bot 64: 5243–5251

Robinson C, Bolhuis A (2004) Tat-dependent protein targeting in prokar-yotes and chloroplasts. Biochim Biophys Acta 1694: 135–147

Rusconi F, Simeoni F, Francia P, Cominelli E, Conti L, Riboni M, SimoniL, Martin CR, Tonelli C, Galbiati M (2013) The Arabidopsis thalianaMYB60 promoter provides a tool for the spatio-temporal control of geneexpression in stomatal guard cells. J Exp Bot 64: 3361–3371


Wang et al.















Settles AM, Yonetani A, Baron A, Bush DR, Cline K, Martienssen R(1997) Sec-independent protein translocation by the maize Hcf106 pro-tein. Science 278: 1467–1470

Sirichandra C, Gu D, Hu HC, Davanture M, Lee S, Djaoui M, Valot B,Zivy M, Leung J, Merlot S, et al (2009) Phosphorylation of the Arabi-dopsis AtrbohF NADPH oxidase by OST1 protein kinase. FEBS Lett 583:2982–2986

Song Y, Miao Y, Song CP (2014) Behind the scenes: the roles of reactiveoxygen species in guard cells. New Phytol 201: 1121–1140

Sparla F, Costa A, Lo Schiavo F, Pupillo P, Trost P (2006) Redox regulationof a novel plastid-targeted beta-amylase of Arabidopsis. Plant Physiol141: 840–850

Suetsugu N, Takami T, Ebisu Y, Watanabe H, Iiboshi C, Doi M, Shimazaki K(2014) Guard cell chloroplasts are essential for blue light-dependent stomatalopening in Arabidopsis. PLoS One 9: e108374

Vahisalu T, Kollist H, Wang YF, Nishimura N, Chan WY, Valerio G,Lamminmäki A, Brosché M, Moldau H, Desikan R, et al (2008) SLAC1is required for plant guard cell S-type anion channel function in stomatalsignalling. Nature 452: 487–491

Voelker R, Barkan A (1995) Two nuclear mutations disrupt distinct path-ways for targeting proteins to the chloroplast thylakoid. EMBO J 14:3905–3914

Wang WH, He EM, Chen J, Guo Y, Chen J, Liu X, Zheng HL (2016) Thereduced state of the plastoquinone pool is required for chloroplast-mediated stomatal closure in response to calcium stimulation. Plant J86: 132–144

Wang SW, Li Y, Zhang XL, Yang HQ, Han XF, Liu ZH, Shang ZL, AsanoT, Yoshioka Y, Zhang CG, et al (2014) Lacking chloroplasts in guardcells of crumpled leaf attenuates stomatal opening: both guard cell

chloroplasts and mesophyll contribute to guard cell ATP levels. PlantCell Environ 37: 2201–2210

Wang Z, Mao JL, Zhao YJ, Li CY, Xiang CB (2015) L-Cysteine inhibits rootelongation through auxin/PLETHORA and SCR/SHR pathway inArabidopsis thaliana. J Integr Plant Biol 57: 186–197

Wang Q, Sullivan RW, Kight A, Henry RL, Huang J, Jones AM, Korth KL(2004) Deletion of the chloroplast-localized Thylakoid formation1 geneproduct in Arabidopsis leads to deficient thylakoid formation and var-iegated leaves. Plant Physiol 136: 3594–3604

Weinl S, Held K, Schlücking K, Steinhorst L, Kuhlgert S, Hippler M,Kudla J (2008) A plastid protein crucial for Ca2+-regulated stomatalresponses. New Phytol 179: 675–686

Yoo SD, Cho YH, Sheen J (2007) Arabidopsis mesophyll protoplasts: aversatile cell system for transient gene expression analysis. Nat Protoc 2:1565–1572

Yu H, Chen X, Hong YY, Wang Y, Xu P, Ke SD, Liu HY, Zhu JK, OliverDJ, Xiang CB (2008) Activated expression of an Arabidopsis HD-STARTprotein confers drought tolerance with improved root system and re-duced stomatal density. Plant Cell 20: 1134–1151

Zhang T, Chen S, Harmon AC (2014) Protein phosphorylation in stomatalmovement. Plant Signal Behav 9: e972845

Zhang L, Wei Q, Wu W, Cheng Y, Hu G, Hu F, Sun Y, Zhu Y, SakamotoW, Huang J (2009) Activation of the heterotrimeric G protein alpha-subunit GPA1 suppresses the ftsh-mediated inhibition of chloroplastdevelopment in Arabidopsis. Plant J 58: 1041–1053

Zhu M, Monroe JG, Suhail Y, Villiers F, Mullen J, Pater D, Hauser F, JeonBW, Bader JS, Kwak JM, et al (2016) Molecular and systems approachestowards drought-tolerant canola crops. New Phytol 210: 1169–1189






Control Drought

Control Re-waterC

ol-0

SA

LK_0

6701

7CC

ol-0

SA

LK_0

6701

7C

A

B

Supplemental Figure 1. Drought resistance assay of SALK_067017C(A) Col-0 wild type and SALK_067017C plants were grown under normal conditions with 16-h-light / 8-h-dark for 21 days and then drought stressed for 7 days. (B) Re-watered for 3 days. Control, well-watered plants.

Supplemental Figure 2. Developmental phenotype of the hcf106 mutants(A) Phenotypes of 10-day-old Col-0, hcf106-1, hcf106-2, hcf106-3, hcf106-4, and hcf106-5 seedlingsunder normal growth conditions. (B) Phenotypes of 21-day-old Col-0, hcf106-1, hcf106-4, and hcf106-5plants grown in soil under normal growth conditions.

A

B

GFP Chlorophyll BF MergeA

B GFP Chlorophyll BF Merge

Supplemental Figure 3. Subcellular localization of HCF106-GFP and root expression pattern of HCF106(A) and (B) Subcellular localization of HCF106-GFP. Transgenic Arabidopsis seedlings expressing genomic HCF106-GFP driven by its native promoter. GFP, green fluorescence protein. Chlorophyll, auto-fluorescence of chlorophyll. BF, bright field. Scale bars, 20 μm. (C) and (D) GUS activity in the roots of 10-day-old seedlings containing HCF106pro-GUS. Scale bars, 100 μm.

coty

ledo

nhy

poco

tyl

C

D

Control

Drought for 7 days

35S:GFP 35S:HCF106-GFP#1-3 #2-1 #1-1 #5-3

A B C

Supplemental Figure 4. Drought assay of the over-expression lines of HCF106(A) Transgenic lines of 35S:GFP and 35S:HCF106:GFP grown under normal growth conditions for 21 days were treated with drought for 7 days or 10 days and recovered for 3 days. Control, well-watered plants. (B) HCF106transcript levels in the 35S:GFP and 35S:HCF106:GFP transgenic lines. Values are means ±SD (n = 3). (C) Survival rate of the HCF106 overexpression plants after drought and re-watering (for 3 days) treatment (n = 4 biological replicates, 20 plants of each replicate). Data represent means ±SD (n = 3). (D) Water loss in the transgenic plantleaves (n=4, each containing 3 fully expanded leaves from 30-day-old plants). Data represent means ± SD (n = 3). #1-3 and #2-1, two independent transgenic lines of 35S:GFP ; #1-1 and #5-3, two independent transgenic lines of 35S:HCF106:GFP.

Drought for 10 days D

Re-water for 3 days

A B

Supplemental Figure 5. ABA contents and germination assay of hcf106 and thf1 mutants(A) ABA contents in the leaves of 4-week-old Col-0, hcf106-1, hcf106-4, and thf1-1 plants after drought stress for 7 days. (B) Seed germination rate of Col-0, hcf106-1, hcf106-4, and thf1-1 at the seventh day in 1/2 MS with different concentrations of exogenous ABA. Values are means ±SD (n = 3).

Col-0 hcf106-1 hcf106-2 hcf106-3 hcf106-4 hcf106-5 thf1-1A

B Col-0 hcf106-1 hcf106-2 hcf106-3 hcf106-4 hcf106-5 thf1-1

Supplemental Figure 6. Ultrastructure of chloroplasts in the hcf106 and thf1 mutants(A) Phenotypes of 6-day-old Col-0, hcf106-1, hcf106-2, hcf106-3, hcf106-4, hcf106-5 and thf1-1seedlings under normal growth conditions. (B) Ultrastructure of chloroplasts from cotyledons of 6-day-old Col-0, hcf106-1, hcf106-2, hcf106-3, hcf106-4, hcf106-5 and thf1-1. A representative chloroplast is shown on the upper panel, and the magnified structure is shown on the lower panel. Black arrows, grana thylakoid; White arrow, stromal thylakoid.

Supplemental Figure 7. Expression pattern of THF1(A) GUS activity in rosette leaves of 21-day-old Arabidopsis containing the fusion THF1pro-GUS. (B) and (C) HCF106 expression levels in 21-day-old plant leaves treated with air drying (B), or 50 μM ABA (C). (D) Relative expression levels of THF1 in leaves of thf1-1, Col-0, hcf106-1, hcf106-4, hcf106-5, hcf106-1complementation line, and hcf106-4 complementation line. Values are means ±SD (n = 3).

A D

B C

Col-0 thf1-1

thf1-1 / THF1p:THF1:3×FLAG

Dro

ught

R

e-w

ater

C

A

Com #1 Com #7

B

Supplemental Figure 8. Drought assay of thf1-1 complementation lines(A) THF1 expression levels in Col-0, thf1-1, and the complementation lines. Values are means ±SD (n=3) (B) Survival rate of the complementation plants after drought and re-watering (for 5 days) treatment (n = 4 biological replicates, 16 plants of each replicate). Data represent means ±SD (n = 3). (C) Col-0, thf1-1, Com #1 and Com #7 of the complementation lines grown under normal growth conditions for 21 days and then drought for 12 days, and recovered for 5 days.

A

B

Supplemental Figure 9. Determination of ROS and guard cell size in hcf106 and thf1 mutants(A) DAB staining and (B) NBT staining of the mature leaves of Col-0, hcf106-1, hcf106-4, and thf1-1 from 21-day-old plants following drought stress for 7 days. (C) Measurement of guard cell size of Col-0, hcf106-1, hcf106-4, and thf1-1 (n = 5 leaves, 5 stomata per leaf of 28-day-old plants). Data represent means ± SD.

C

Supplemental Figure 10. ROS affects the stomatal aperture in hcf106 and thf1 mutants(A) H2O2 level in guard cells obtained from CM-H2DCFDA fluorescence imaging in 21-day-old Col-0, hcf106-4, thf1-1 after drought for 7 days. Values are displayed as the mean pixel intensities after treatment with 1 mM NAC for 0, 10, 20, and 40 min (n > 30; mean ±SD). (B) Responses of the stomatal aperture to 10 mM NAC at the indicated time in leaves of 21-day-old Col-0, hcf106-4, and thf1-1 after drought for 7 days. Values are means ± SD (n ≥ 50).

BA

A

LP+R

P

LB+R

P

LP+R

P

LB+R

P

LP+R

P

LB+R

P

LP+R

P

LB+R

P

LP+R

P

LB+R

P

LP+R

P

LB+R

P

hcf106-1

hcf106-4

thf1-1

B C

Supplemental Figure 11. Identification of the double mutant thf1hcf106. (A) Genotyping of thf1-1hcf106-1, thf1-1hcf106-4. LP, left primer. RP, right primer. LB, primer of T-DNA left border. (B) and (C) Expression levels of THF1 and HCF106 in Col-0, hcf106-1, hcf106-4, thf1-1, thf1-1hcf106-1, and thf1-1hcf106-4. Values are means ± SD (n=3).

Supplemental Table S1. Proteins interacting with HCF106 as identified by mass spectrometry in chloroplast

Protein Name Accession Number Description

Number of peptides identified

HCF106 AT5G52440 Bacterial sec-independent translocation protein mttA/Hcf106 55 THF1, PSB29 AT2G20890 photosystem II reaction center PSB29 protein 6 SOQ1 AT1G56500 haloacid dehalogenase-like hydrolase family protein 39 PSAD-2 AT1G03130 photosystem I subunit D-2 32 PSAD-1 AT4G02770 photosystem I subunit D-1 32 LOX2, ATLOX2 AT3G45140 lipoxygenase 2 27 PSBQ, PSBQA, PSBQ-1 AT4G21280 photosystem II subunit QA 26 AOS, CYP74A, DDE2 AT5G42650 allene oxide synthase 19 ATPF ATCG00130 ATPase, F0 complex, subunit B/B~, bacterial/chloroplast 15 VAR1, FTSH5 AT5G42270 FtsH extracellular protease family 15 LHCB4.2 AT3G08940 light harvesting complex photosystem II 14 AT5G08670 ATP synthase alpha/beta family protein 12 FTSH1 AT1G50250 FTSH protease 1 12 LHB1B2, LHCB1.5 AT2G34420 photosystem II light harvesting complex gene B1B2 12 LHCA3 AT1G61520 photosystem I light harvesting complex gene 3 11 MFP1 AT3G16000 MAR binding filament-like protein 1 11 TAPX AT1G77490 thylakoidal ascorbate peroxidase 11 GOX1 AT3G14420 GLYCOLATE OXIDASE 1, Aldolase-type TIM barrel family protein 11 APG2, UNE3, PGA2, TATC AT2G01110 Sec-independent periplasmic protein translocase 10 ATPC1 AT4G04640 ATPase, F1 complex, gamma subunit protein 10 AAC1 AT3G08580 ADP/ATP carrier 1 10

TLP18.3 AT1G54780 thylakoid lumen 18.3 kDa protein 10 PDE334 AT4G32260 ATPase, F0 complex, subunit B/B~, bacterial/chloroplast 9 ATTIC62, TIC62 AT3G18890 NAD(P)-binding Rossmann-fold superfamily protein 9 PSBP-1, PSII-P, OE23 AT1G06680 photosystem II subunit P-1 9 GOX2 AT3G14415 GLYCOLATE OXIDASE 2, Aldolase-type TIM barrel family protein 8 ATPD AT4G09650 ATP synthase delta-subunit gene 8 FIB4 AT3G23400 Plastid-lipid associated protein PAP / fibrillin family protein 8 AT1G26090 P-loop containing nucleoside triphosphate hydrolases superfamily protein 8 TROL AT4G01050 thylakoid rhodanese-like 8 PSAG AT1G55670 photosystem I subunit G 8 AT1G18170 FKBP-like peptidyl-prolyl cis-trans isomerase family protein 7 AT1G74470 Pyridine nucleotide-disulphide oxidoreductase family protein 6 AT1G51110 Plastid-lipid associated protein PAP / fibrillin family protein 6 MPPBETA AT3G02090 Insulinase (Peptidase family M16) protein 6 RCA AT2G39730 rubisco activase 6 AT3G61870 unknown protein 5 AT5G03880 Thioredoxin family protein 5 AT2G21960 unknown protein 5 PETB ATCG00720 photosynthetic electron transfer B 5 CCB1 AT3G26710 cofactor assembly of complex C 5 PSBH ATCG00710 photosystem II reaction center protein H 5 ATPE ATCG00470 ATP synthase epsilon chain 5 ATLFNR1, FNR1 AT5G66190 ferredoxin-NADP(+)-oxidoreductase 1 5 LPA1 AT1G02910 tetratricopeptide repeat (TPR)-containing protein 5 FTSH8 AT1G06430 FTSH protease 8 4

AT3G26080 plastid-lipid associated protein PAP / fibrillin family protein 4 AAC3, ATAAC3 AT4G28390 ADP/ATP carrier 3 4 AT4G02530 chloroplast thylakoid lumen protein 4 PGR5-LIKE A AT4G22890 PGR5-LIKE A 4 AT2G35490 Plastid-lipid associated protein PAP / fibrillin family protein 4 LHCA4, CAB4 AT3G47470 light-harvesting chlorophyll-protein complex I subunit A4 4 CRD1, CHL27, ACSF AT3G56940 dicarboxylate diiron protein, putative (Crd1) 4 NDF2, NDH45 AT1G64770 NDH-dependent cyclic electron flow 1 4 ENH1 AT5G17170 rubredoxin family protein 4 ATG4, G4, CHLG AT3G51820 UbiA prenyltransferase family protein 4 APX4, TL29 AT4G09010 ascorbate peroxidase 4 4 AT2G34460 NAD(P)-binding Rossmann-fold superfamily protein 4 PSAA ATCG00350 Photosystem I, PsaA/PsaB protein 4 PTAC8, TMP14, PSAP AT2G46820 photosystem I P subunit 4 PSAH2, PSAH-2, PSI-H AT1G52230 photosystem I subunit H2 4 AT2G47710 Adenine nucleotide alpha hydrolases-like superfamily protein 4 PSBG ATCG00430 photosystem II reaction center protein G 4 AT2G32640 Lycopene beta/epsilon cyclase protein 4 PSAC ATCG01060 iron-sulfur cluster binding;electron carriers;4 iron, 4 sulfur cluster binding 4 FLU AT3G14110 Tetratricopeptide repeat (TPR)-like superfamily protein 4 WLIM1 AT1G10200 GATA type zinc finger transcription factor family protein 4 FBA1 AT2G21330 fructose-bisphosphate aldolase 1 4 CRR31, NDHS AT4G23890 CHLORORESPIRATORY REDUCTION 31, NADH dehydrogenase-like complex 4

Supplemental Table S2. Primers used in this study

Name Sequence (5'>3') Purpose SALK_067017C LP GACCTCCTCTCAAGTTTTGAG hcf106-1 genotyping SALK_067017C RP AACCTGGGTTTGAAGATTTCG hcf106-1 genotyping SALK_044421C LP TCAAATGGCTCCGTATAGACG hcf106-2 genotyping SALK_044421C RP ATCCCTATGATTCGACGTTTG hcf106-2 genotyping SALK_020680 LP GTCTCTGTTTGGTGTTGGAGC hcf106-3 genotyping SALK_020680 RP AGCGGGAGACAAAGCTTTTAG hcf106-3 genotyping SAIL_760_H06 LP GCCAAAAGGTCATCTATCTCTAGC hcf106-4 genotyping SAIL_760_H06 RP CCATGTTGACATCAGTCAAAAC hcf106-4 genotyping SAIL_831_E01 LP GACCTCCTCTCAAGTTTTGAGC hcf106-5 genotyping SAIL_831_E01 RP AACCTGGGTTTGAAGATTTCG hcf106-5 genotyping SALK_094925 LP GGATCAGTAGCACTTGCAAGC thf1-1 genotyping SALK_094925 RP TAACGTGGACAGACAAGGGAC thf1-1 genotyping HCF106_qFP CGATTAGAGAGCTACAGGATG qPCR HCF106_qRP GTGATTGTGAATCATTGGGATC qPCR THF1_qFP TGAGGATCCTAAGCAATACCG qPCR THF1_qRP CCGATCCACGCTTTTCTTGTT qPCR UBQ5_qFP AGAAGATCAAGCACAAGCAT qPCR UBQ5_qRP CAGATCAAGCTTCAACTCCT qPCR ACT2_qFP TTGTGCTGGATTCTGGTGATG qPCR ACT2_qRP CGCTCTGCTGTTGTGGTG qPCR ACT7_qFP CATTCAATGTCCCTGCCATGT qPCR ACT7_qRP GGTTGTACGACCACTGGCATAG qPCR HCF106pg _EcoR I_FP G GAATTC CGGTCGTTATCTAGTCCAGCT HCF106p:HCF106:3×FLAG HCF106pg _Sal I_RP TTT GTCGAC ATCTTGCCTTGGAGGAGATGC HCF106p:HCF106:3×FLAG THF1pg_Kpn I_FP GG GGTACC AACAACAACTACATGCTCTGTCT THF1p:THF1:3×FLAG THF1pg_Pst I_RP TTT CTGCAG AGATTTCCGTTCAACCAAGAAAG THF1p:THF1:3×FLAG THF1pro_attB1_FP GGGGACAAGTTTGTACAAAAAAGCAGGCT GC GATGCTTCCTCTACGTCTCCA THF1p:GUS

THF1pro_attB2_RP GGGGACCACTTTGTACAAGAAAGCTGGGT C CGCTAAATTGAAGTGAGAAAGAG THF1p:GUS HCF106pro_attB1_FP GGGGACAAGTTTGTACAAAAAAGCAGGCT GC GATGGTTCATGGTTCCTTTCCT HCF106p:GUS HCF106pro_attB2_RP GGGGACCACTTTGTACAAGAAAGCTGGGT C GGGCAGCTTCGAAATTGTAATAT HCF106p:GUS HCF106 CDS_attB1_FP GGGGACAAGTTTGTACAAAAAAGCAGGCT GC ATGGCCATGGCGTTACAGATTA 35S:HCF106:GFP HCF106 CDS_attB2_RP GGGGACCACTTTGTACAAGAAAGCTGGGT C ATCTTGCCTTGGAGGAGATGC 35S:HCF106:GFP HCF106pg_attB1_FP GGGGACAAGTTTGTACAAAAAAGCAGGCT GC CGGTCGTTATCTAGTCCAGCT HCF106p:HCF106:GFP HCF106pg_attB2_RP GGGGACCACTTTGTACAAGAAAGCTGGGT CC ATCTTGCCTTGGAGGAGATGC HCF106p:HCF106:GFP THF1 CDS_Sal I_FP TTT GTCGAC ATGGCTGCAACTGCAATCTCT THF1-NYFP THF1 CDS_Kpn I_RP GG GGTACC G AGATTTCCGTTCAACCAAGAAAG THF1-NYFP HCF106 CDS_Sal I_FP TTT GTCGAC ATGGCCATGGCGTTACAGATTA HCF106-CYFP HCF106 CDS_Kpn I_RP GG GGTACC G ATCTTGCCTTGGAGGAGATGC HCF106-CYFP THF1 CDS_Nde I_FP TTT CATATG ATGGCTGCAACTGCAATCTCTT MBP-THF1 THF1 CDS_Sal I_RP TTT GTCGAC CTAAGATTTCCGTTCAACCAAGA MBP-THF1 HCF106 CDS_EcoR I_FP G GAATTC ATGGCCATGGCGTTACAGATTA His-HCF106 HCF106 CDS_Sal I_RP TTT GTCGAC G ATCTTGCCTTGGAGGAGATGC His-HCF106 THF1 CDS_Kpn I_FP CGG GGTACC ATGGCTGCAACTGCAATCTCTT THF1-NLuc THF1 CDS_Sal I_RP TTT GTCGAC AGATTTCCGTTCAACCAAGAAAG THF1-NLuc HCF106 CDS_Kpn I_FP CGG GGTACC ATGGCCATGGCGTTACAGATTA CLuc-HCF106 HCF106 CDS_Pst I_RP TTT CTGCAG TCAATCTTGCCTTGGAGGAGAT CLuc-HCF106

Two Chloroplast Proteins Suppress ... - Purdue University

Documents

Transcript of Two Chloroplast Proteins Suppress ... - Purdue University