TrueTag DNA Donor Kit - Thermo Fisher Scientific · Product information Product description The...
Transcript of TrueTag DNA Donor Kit - Thermo Fisher Scientific · Product information Product description The...
![Page 1: TrueTag DNA Donor Kit - Thermo Fisher Scientific · Product information Product description The Invitrogen™ TrueTag™ DNA Donor Kit enables the user to construct and purify a linear](https://reader034.fdocuments.in/reader034/viewer/2022050502/5f94d91f989bc700761fcff0/html5/thumbnails/1.jpg)
For Research Use Only. Not for use in diagnostic procedures.
TrueTag™ DNA Donor KitUSER GUIDE
Catalog Numbers A42992 , A42993 , and A42994Publication Number MAN0018537
Revision A.0
![Page 2: TrueTag DNA Donor Kit - Thermo Fisher Scientific · Product information Product description The Invitrogen™ TrueTag™ DNA Donor Kit enables the user to construct and purify a linear](https://reader034.fdocuments.in/reader034/viewer/2022050502/5f94d91f989bc700761fcff0/html5/thumbnails/2.jpg)
Life Technologies Corporation | 5781 Van Allen Way | Carlsbad, CA 92008For descriptions of symbols on product labels or product documents, go to thermofisher.com/symbols-definition.
The information in this guide is subject to change without notice.
DISCLAIMER: TO THE EXTENT ALLOWED BY LAW, THERMO FISHER SCIENTIFIC INC. AND/OR ITS AFFILIATE(S) WILL NOT BE LIABLE FOR SPECIAL,INCIDENTAL, INDIRECT, PUNITIVE, MULTIPLE, OR CONSEQUENTIAL DAMAGES IN CONNECTION WITH OR ARISING FROM THIS DOCUMENT,INCLUDING YOUR USE OF IT.
Revision history: Pub. No. MAN0018537
Revision Date DescriptionA.0 17 April 2019 Baseline version for document.
Important Licensing Information: These products may be covered by one or more Limited Use Label Licenses. By use of these products, you acceptthe terms and conditions of all applicable Limited Use Label Licenses.TRADEMARKS: All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
©2019 Thermo Fisher Scientific Inc. All rights reserved.
![Page 3: TrueTag DNA Donor Kit - Thermo Fisher Scientific · Product information Product description The Invitrogen™ TrueTag™ DNA Donor Kit enables the user to construct and purify a linear](https://reader034.fdocuments.in/reader034/viewer/2022050502/5f94d91f989bc700761fcff0/html5/thumbnails/3.jpg)
Contents
■ Product information . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 5
Product description . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 5
Contents and storage . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 5Assembly Kit . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 6Clean Up Kit . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 6
Required materials not supplied . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 7
Ordering custom oligos and gRNA . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 7
Workflow . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 8
■ Methods . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 10
Overview . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 10Design . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 10Editing nucleases . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 13PCR . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 14Transfection . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 14Selection/kill curve . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 14Analysis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 14
Donor design . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 15Design TrueTag™ Donor DNA . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 15Choosing your donor template . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 15Selecting a CRISPR-Cas9 site . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 15Selecting a TALEN site . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 16Design of donor homology arm PCR primers . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 17Design of validation primers . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 22
Generating your TrueTag™ donor DNA . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 23
Delivery of the TrueTag™ DNA donor and editing tools into target cells . . . . . . . . . . . . . . . . 24General CRISPR/gRNA transfection guidelines . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 24Recommended delivery options . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 25Preparing your gRNA . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 25
Transfection methods . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 27Transfect cells with TrueTag™ donor, TrueCut™ Cas9 protein v2 and gRNAusing Lipofectamine™ CRISPRMAX™ Transfection Reagent . . . . . . . . . . . . . . . . . . . . . . 27Transfect cells with TrueTag™ donor, TrueCut™ cas9 protein v2 and gRNAusing the Neon™ transfection system . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 29Transfect cells with TrueTag™ donor, CRISPR nuclease mRNA, and gRNAusing the Neon™ transfection system . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 32
TrueTag™ DNA Donor Kit User Guide 3
![Page 4: TrueTag DNA Donor Kit - Thermo Fisher Scientific · Product information Product description The Invitrogen™ TrueTag™ DNA Donor Kit enables the user to construct and purify a linear](https://reader034.fdocuments.in/reader034/viewer/2022050502/5f94d91f989bc700761fcff0/html5/thumbnails/4.jpg)
Transfect cells with TrueTag™ donor, CRISPR nuclease mRNA, and gRNAusing the Lipofectamine™ MessengerMAX™ Transfection Reagent . . . . . . . . . . . . . . . . 34Transfect cells with TrueTag™ donor, and TALEN pair, using theLipofectamine™ MessengerMAX™ Transfection Reagent . . . . . . . . . . . . . . . . . . . . . . . . 35Transfect cells with TrueTag™ donor and TALEN mRNA pairs using theNeon™ transfection system . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 36Transfect cells with TrueTag™ donor and CRISPR nuclease vector usingLipofectamine™ 3000 Transfection Reagent . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 38
Verify editing . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 40For GFP and RFP . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 40For luciferase . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 40Verify correct integration of tag by junction PCR and sequencing . . . . . . . . . . . . . . . . . 40
Enrich with antibiotic selection . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 41
■ APPENDIX A Troubleshooting . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 42
■ APPENDIX B Additional procedures . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 44
Antibiotic toxicity assay (kill curve) with PrestoBlue™ cell viability reagent . . . . . . . . . . . . 44
Clonal isolation . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 46Limiting dilution cloning (LDC) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 46Example LDC procedure using 293FT cells . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 46Example single cell sorting procedure in a 96-well plate using flow cytometer . . . . 47
Confirmation of Cas9 or TALEN cutting activity by GCD or sequencing . . . . . . . . . . . . . . . . . 48Genomic Cleavage Detection Kit . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 48Sequence analysis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 48
Removal of antibiotic selection by Cre/Lox . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 48
Control ACTB donor reaction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 49
■ APPENDIX C Transfection tables . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 50
CRISPRMAX™ transfection table . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 51
Neon™ transfection table . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 52
■ APPENDIX D Safety . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 53
Chemical safety . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 54
Biological hazard safety . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 55
■ APPENDIX E Documentation and support . . . . . . . . . . . . . . . . . . . . . . . . . . . . 56
Customer and technical support . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 56
Limited product warranty . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 56
Contents
4 TrueTag™ DNA Donor Kit User Guide
![Page 5: TrueTag DNA Donor Kit - Thermo Fisher Scientific · Product information Product description The Invitrogen™ TrueTag™ DNA Donor Kit enables the user to construct and purify a linear](https://reader034.fdocuments.in/reader034/viewer/2022050502/5f94d91f989bc700761fcff0/html5/thumbnails/5.jpg)
Product information
Product description
The Invitrogen™ TrueTag™ DNA Donor Kit enables the user to construct and purify alinear dsDNA donor molecule. This molecule can be used to tag any endogenous geneof interest with EmGFP, tagRFP, or a non-secreted luciferase, at the amino or carboxytermini.
This kit includes donor templates for puromycin and blasticidin selection markers.This enables enrichment of the edited cell population using the endogenous promoter,thereby minimizing random insertion. The carboxy donor templates have a loxP sitebracketed antibiotic marker so that removal can be performed by the addition of Crerecombinase after enrichment. The donor can be prepared in a few hours and iscompatible with various gene editing tools, including CRISPR and TALEN basedmethods.
Contents and storage
The TrueTag™ DNA Donor Kit consists of an Assembly Kit (with control primers) anda Cleanup Kit. Each kit provides sufficient reagents to make 10 donor molecules(produces >5 µg donor/prep).
Product Catalog Number
TrueTag™ Donor DNA Kit, GFP A42992
TrueTag™ Donor DNA Kit, RFP A42993
TrueTag™ Donor DNA Kit, Luciferase A42994
TrueTag™ DNA Donor Kit User Guide 5
![Page 6: TrueTag DNA Donor Kit - Thermo Fisher Scientific · Product information Product description The Invitrogen™ TrueTag™ DNA Donor Kit enables the user to construct and purify a linear](https://reader034.fdocuments.in/reader034/viewer/2022050502/5f94d91f989bc700761fcff0/html5/thumbnails/6.jpg)
The Assembly Kit contains Phusion™ Flash High Fidelity PCR Master Mix, donortemplates for fluorescent reporters or luciferase with selection markers, and pre-mixed human ACTB Control Primers.
Component Cat. No.A42992
Cat. No.A42993
Cat. No.A42994 Amount Storage
TrueTag™ donor templates N-Puro-GFP N-Puro-RFP N-Puro-Luc
400 ng(20 ng/µL)
each−20°C
N-Blast-GFP N-Blast-RFP N-Blast-Luc
C-Puro(Cre-Lox)-GFP
C-Puro(Cre-Lox)-RFP
C-Puro(Cre-Lox)-Luc
C-Blast(Cre-Lox)-GFP
C-Blast(Cre-Lox)-RFP
C-Blast(Cre-Lox)-Luc
Phusion™ Flash High FidelityPCR Master Mix ✓ ✓ ✓ 500 µL −20°C
Human ACTB Control Primers(forward and reverse) ✓ ✓ ✓ 100 µL −20°C
Control Primers
Control Primers are provided to create ACTB donor molecules. The forward andreverse N-terminal human ACTB primers are supplied at a concentration of 10 µMeach, and come pre-mixed in a single tube.
Sequence for Control Primers [1]
Forward primer
5’-CFOAGCGCGCCCGGCTATTCTCGCAGCTCACCATGGGAGGTAAGCCCTTGCATTCG-3’
Reverse primer
5’-COETTGTCGACGACGAGCGCGGCGATATCATCATCACCGCTTCCACTACCTGAACC-3’
[1] The primers have 2X phosphorothioate modifications at the 5’ ends.
The Clean Up Kit is designed for rapid and efficient purification of DNA from PCRreaction mixtures.
Component Amount Storage
Binding Buffer 4.8 mL
Room temperatureWash Buffer (concentrated) 1.8 mL
Elution Buffer 3 mL
Purification columns/spin tubes 10 each
Assembly Kit
Clean Up Kit
Product informationContents and storage
6 TrueTag™ DNA Donor Kit User Guide
![Page 7: TrueTag DNA Donor Kit - Thermo Fisher Scientific · Product information Product description The Invitrogen™ TrueTag™ DNA Donor Kit enables the user to construct and purify a linear](https://reader034.fdocuments.in/reader034/viewer/2022050502/5f94d91f989bc700761fcff0/html5/thumbnails/7.jpg)
Required materials not supplied
Unless otherwise indicated, all materials are available through thermofisher.com.MLS: Fisher Scientific (fisherscientific.com) or other major laboratory supplier.
Item Source
Primers
Custom DNA oligos to add homology arms to the TrueTag™ DonorDNA
MLS
Instrument
A fluorescence microscope with appropriate filters for EmGFP ortagRFP
MLS
A programmable thermal cycler MLS
Genome editing nuclease, one of the following:
TrueCut™ Cas9 v2 protein and a TrueGuide™ sgRNA A36498 and A35514
CRISPR Nuclease mRNA A29378
CRISPR Nuclease Vector with OFP or CD4 Reporter Kit A21174/A21175
TALEN mRNA pair A43763
Consumables
Cell line appropriate plastics and media MLS
Reagents
TurboLuc™ Luciferase One-Step Glow Assay Kit 88263
Genomic Cleavage Detection Kit A24372
Ethanol 95–99%, molecular biology grade MLS
Transfection reagent or electroporation system such as:
• Lipofectamine™ CRISPRMAX™ Cas9 Transfection Reagent
• Neon™ Transfection System
• CMAX00003
• MPK1025
Ordering custom oligos and gRNA
• Order custom DNA oligos from Thermo Fisher Scientific by visiting thermofisher.com/oligos or contact our technical support team at [email protected]. We recommend adding 2 phosphorothioatemodifications to the 5’ ends of the oligos to inhibit nuclease digestion of thedonor. Standard 50 nM scale with desalted purification is recommended.
• Order custom gRNA from Thermo Fisher Scientific by visiting https://www.thermofisher.com/order/custom-oligo/crispr. We recommend ordering 1-piece sgRNA modified for best performance and stability.
Product informationRequired materials not supplied
TrueTag™ DNA Donor Kit User Guide 7
![Page 8: TrueTag DNA Donor Kit - Thermo Fisher Scientific · Product information Product description The Invitrogen™ TrueTag™ DNA Donor Kit enables the user to construct and purify a linear](https://reader034.fdocuments.in/reader034/viewer/2022050502/5f94d91f989bc700761fcff0/html5/thumbnails/8.jpg)
Workflow
1. Design and order target specific oligos to add the homology arms to the suppliedtemplate.
2. Use the custom homology arms oligos to amplify the desired TrueTag™ template.
3. Purify the PCR reaction with the included purification spin columns.
4. Co-transfect the donor DNA with the TrueCut™ Cas9 v2 protein and TrueGuide™
gRNA (1 piece sgRNA or 2 piece crRNA:tracrRNA) or a TALEN pair (plasmidbased and mRNA based methods are also acceptable).
5. (Optional) Enrich by antibiotic selection of the edited cells.
6. (Optional) Remove antibiotic selection cassette by Cre/Lox.
7. Confirm successful tagging and clonal cell line generation.
Select Gene
Insertion /cut site
STOPGenomic Target Target gene
Forward Primer Reverse Primer
P2 AReporter Resistancemarker
Lox P Lox P
PCRClean up column
Target gene P2 AReporter Resistancemarker
Lox P Lox P
STOP
Lox P
Cre(2 days)
Target gene P2 AReporter STOP
HA P2 A HAReporter Resistancemarker
Transfect cells
+ Cas9/gRNA
Lox P Lox P
* HA = Homology arm
DAY 3
DAY 10-12
Prepare Donor● Premade Cassette● Design 2 oligos with homology arms● PCR to add Homology Arms (HA)● Spin column purification
Transfection Reaction● Donor● Cas9/gRNA● Neon/ CRISPRMax
Donor tag inserted into genome
Selection enrichment
Cre removal of marker
DAY 3-10
DAY 1
Day 3 Day 10
Puro
Figure 1 TrueTag™ workflow.
Product informationWorkflow
8 TrueTag™ DNA Donor Kit User Guide
![Page 9: TrueTag DNA Donor Kit - Thermo Fisher Scientific · Product information Product description The Invitrogen™ TrueTag™ DNA Donor Kit enables the user to construct and purify a linear](https://reader034.fdocuments.in/reader034/viewer/2022050502/5f94d91f989bc700761fcff0/html5/thumbnails/9.jpg)
Live Cell
0% / 0
25.5% / 3585
95.5% / 12952
99.9% / 36088
FACS
Experimental Workf low for gene Tagging in 293FT cells
Day 1Prepare donor DNATransfection (~3hr)
Day 3-4Cell visualizationReporter assayStart selection
Day 10
Generation of stable cell poolRemoval of selection marker
via transfection with Cre (Optional)
Day 12Generation of cell pool
without marker (optional)
%GFP / Mean Flourescence
Figure 2 Workflow example targeting ACTB with carboxyl GFP tag showingenrichment by microscope and flow cytometry.
Product informationWorkflow
TrueTag™ DNA Donor Kit User Guide 9
![Page 10: TrueTag DNA Donor Kit - Thermo Fisher Scientific · Product information Product description The Invitrogen™ TrueTag™ DNA Donor Kit enables the user to construct and purify a linear](https://reader034.fdocuments.in/reader034/viewer/2022050502/5f94d91f989bc700761fcff0/html5/thumbnails/10.jpg)
Methods
Overview
In order to add a tag to a gene of interest, the natural HDR (Homology DirectedRepair) pathway is used to repair the genomic DNA at the site of a double-strandedbreak, caused by an endonuclease. This double-stranded break can be generated byCRISPR-Cas9 nucleases or Transcription activator-like effector nucleases (TALEN).Repair and insertion of the tagging DNA is accomplished by designing a donortemplate that has matching homology arms on each side of the tag.
Donor template for insertion of a C- terminal tag
Genomic Target
Donor
Tagged Target
STOP
Cut site
ReporterTarget gene STOP
5' Homology arm 3' Homology arm5' 3'
Short homology arms (30–35 bases each) can be used for efficient insertion ofTrueTag™ donors, and allows for easy construction of the donor molecule where thehomology arms are added by PCR to a premade tagging template. Using a PCRproduct without unnecessary vector backbone minimizes the size of the donor,eliminating the risk of toxic E. coli elements being integrated into the cell and resultsin overall higher editing efficiency.
For amino termini (N-terminal) tagging, the TrueTag™ donor should be insertedimmediately after the start ATG with the homology arms located to the left and rightof the start ATG. For carboxy (C-terminal) tagging, the TrueTag™ donor should beinserted immediately before the stop codon with the homology arms located to theleft and right of the stop codon. When choosing between N and C-terminal tagging,we recommend C-terminal tagging for the following reasons:
• The tag is at the end of the gene transcript and has less impact on the regulationof the gene.
• If using selection, insertion of the selection marker requires successful in frameinsertion of the tag resulting in lower background.
Design
10 TrueTag™ DNA Donor Kit User Guide
![Page 11: TrueTag DNA Donor Kit - Thermo Fisher Scientific · Product information Product description The Invitrogen™ TrueTag™ DNA Donor Kit enables the user to construct and purify a linear](https://reader034.fdocuments.in/reader034/viewer/2022050502/5f94d91f989bc700761fcff0/html5/thumbnails/11.jpg)
Features of Donor DNA
The donor templates (Figure 3) are designed to make a fusion between the target geneand either GFP, RFP, or luciferase linked to puromycin or blasticidin by a 2A self-cleaving peptide so both markers can be expressed off the endogenous promoter. Thefusion includes a GSGSGSG linker to minimize steric hindrance of the fusion protein.The amino donor templates and carboxy donor templates have separate universalForward and Reverse priming sequences to ease the design of the PCR primers forgenerating the donor. In the C-terminal tag versions, the antibiotic marker is flankedby loxP sites so that the marker can be easily removed by Cre to allow for iterativetagging or minimizing the size of the insertion.
ATG
Uni Resistance marker P2 A Reporter Linker
Reporter P2 ALinker Iox P66 Iox P71STOP
2
1
3
4
Figure 3 Amino and Carboxyl Tag designs. Add the gene specific 35 base homology armsto 5’ ends.
1 Primer FN
• 35 base homology arms withendogenous ATG
• 21 base UniF-N2 Primer RN
• 35 base homology arms• 21 base UniR-N
3 Primer FC
• 35 base homology arms• 21 base UniF-C
4 Primer RC
• 35 base homology arms withendogenous STOP codon
• 21 base UniR-C
The available tags are monomeric proteins and include Emerald GFP (EmGFP),tagRFP, or non-secreted TurboLuc™16 luciferase.
Table 1 Fluorescent tags
Tag Color ExcitationWavelength (nm)
EmissionWavelength (nm)
EmGFP Green 487 509
tagRFP Red 555 584
The TurboLuc™ (Tluc16) luciferase has been modified to reduce its size, increase itsbrightness, and to have it expressed intracellularly (non-secreted). Tluc16 is muchbrighter than other commonly used luciferases, including firefly and Renilla, makingit the ideal gene-reporter for bioluminescent assays. The intense bioluminescencegreatly enhances sensitivity of Tluc luciferase-based assays, enabling detection of very
MethodsOverview
TrueTag™ DNA Donor Kit User Guide 11
![Page 12: TrueTag DNA Donor Kit - Thermo Fisher Scientific · Product information Product description The Invitrogen™ TrueTag™ DNA Donor Kit enables the user to construct and purify a linear](https://reader034.fdocuments.in/reader034/viewer/2022050502/5f94d91f989bc700761fcff0/html5/thumbnails/12.jpg)
minute amounts of luciferase enzyme. For more information on TurboLuc™, see theTurboLuc™ Luciferase One-Step Glow Assay Kit User Guide (Cat. No. 88263).
Table 2 Universal Primers for Standard tags
Add the gene specific 35 base homology arms to 5’ ends of the sequences in the table.These primers are not included in the TrueTag™ Donor DNA Kits.
Amino donorUniF-N 5’ GGAGGTAAGCCCTTGCATTCG 3’
UniR-N 5’ ACCGCTTCCACTACCTGAACC 3’
Carboxy donorUniF-C 5’ GGAAGTGGCTCAGGTTCTGGA 3’
UniR-C 5’ CTTGGCCGATCGCATACAGAG 3’
If the intended application cannot utilize antibiotic selection, alternative primers maybe used to generate TrueTag™ donors that will still tag the protein withGFP/RFP/luciferase fusions but will not include the sequence of the antibioticselection marker.
Table 3 Universal primers for tagging without the selection marker
Add the gene specific 35 base homology arms to 5’ ends of the sequences in the table.These primers are not included in the TrueTag™ Donor DNA Kits.
Amino donor
UniF-N GFP 5’ ATGGTGAGCAAGGGCGAGGAGCTG 3’
UniF-N RFP 5’ ATGGTGTCTAAGGGCGAAGAGCTG 3’
UniF-N Luc 5’ ATGGAGGCCGAGGCCGAGAGAGGG 3’
UniR-N 5’ ACCGCTTCCACTACCTGAACC 3’
Carboxy donor
UniF-C 5’ GGAAGTGGCTCAGGTTCTGGA 3’
UniR-C GFP 5’ TTACTTGTACAGCTCGTCCATGCC 3’
UniR-C RFP 5’ TTAATTAAGTTTGTGCCCCAGTTTGC 3’
UniR-C Luc 5’ TTAATCACCGGCGAGGCCCTTG 3’
MethodsOverview
12 TrueTag™ DNA Donor Kit User Guide
![Page 13: TrueTag DNA Donor Kit - Thermo Fisher Scientific · Product information Product description The Invitrogen™ TrueTag™ DNA Donor Kit enables the user to construct and purify a linear](https://reader034.fdocuments.in/reader034/viewer/2022050502/5f94d91f989bc700761fcff0/html5/thumbnails/13.jpg)
N-Terminal Tagging
C-Terminal Tagging
ATG
Uni Resistance marker P2 A Reporter Linker
Reporter P2 ALinker Iox P66 Iox P71STOP
GSGSGSG
GSGSGSG
2
1
3
4
Figure 4 Tag fusions without selection markers.1 Forward primer (N-terminal)
• 35 base homology arms with ATG• 21 base UniF-N GFP
2 Reverse primer (N-terminal)
• 35 base homology arms• 21 base UniR-N
3 Forward primer (C-terminal)
• 35 base homology arms• 21 base UniF-C
4 Reverse primer (C-terminal)
• 35 base homology arms withendogenous STOP codon
• 21 base UniR-C GFP
CRISPR
Editing can be done using the TrueCut™ Cas9 Protein v2 (Cat A36496, 10 µg) which isthe Streptococcus pyogenes cas9 with optimized N and C-terminal NLS. Cas9 mRNA(Cat. A29378) is a human codon optimized Streptococcus pyogenes Cas9 with N andC-terminal NLS, 5’ cap and polyadenylation for efficient nuclear localization of thetranslated protein.
Invitrogen™ TrueGuide™ Synthetic gRNAs are ready-to-use, synthetic gRNAs thatboth maximize the performance of your CRISPR-Cas9 genome editing experimentsand simplify the workflow allowing you to focus on building new models andmaking new discoveries instead of spending time developing editing tools.TrueGuide™ Synthetic gRNAs are available as a 2-piece crRNA:tracrRNA system forstandard editing tasks as well as 1-piece sgRNA and modified sgRNA formats todrive maximum editing efficiency when working with difficult-to-edit and valuablecells such as primary cells, immune cells, and stem cells. The nuclease site should beplaced as close to the insertion site as possible, ideally within 10 bases. ForCRISPR/Cas9, the cut site is 3 bases upstream of the PAM (NGG).
Editing nucleases
MethodsOverview
TrueTag™ DNA Donor Kit User Guide 13
![Page 14: TrueTag DNA Donor Kit - Thermo Fisher Scientific · Product information Product description The Invitrogen™ TrueTag™ DNA Donor Kit enables the user to construct and purify a linear](https://reader034.fdocuments.in/reader034/viewer/2022050502/5f94d91f989bc700761fcff0/html5/thumbnails/14.jpg)
TALENS
TAL effector proteins consist of constant N and C terminal domains (containingtranslocation and nuclear localization/activation signals respectively) flanking acentral repeat domain. Each repeat is 34–35 amino acids in length, with two centrallylocated residues that make up a repeat variable domain (RVD) that dictates theaffinity of the repeat for different nucleotide targets. Combination and order ofvarious repeat types define the genomic target site specificity of a particular TALeffector. With TAL effector nucleases (TALEN) exact DNA loci can be cleaved, and thedesign does not depend on context sequence (i.e., protospace adjacent motifs, PAMsites.) If the desired tag site does not have suitable PAM sites or unique crRNAsequences, TALENs can be a good alternative to CRISPR-Cas9.
PCR is done using the custom ordered homology arm primers, the donor templateand the included Phusion™ Flash High Fidelity PCR Master Mix. The Phusion™
master mix has very high fidelity to minimize the chance of PCR introduced errors.The template is provided in a linear format for more robust PCR amplification. Formore information, see the Phusion™ Flash High Fidelity PCR Master Mix User Guide(Pub. No. MAN0012774).
The donor and nuclease can be delivered by Neon™ electroporation orLipofectamine™ transfection (Lipofectamine™ CRISPRMAX™ for Cas9/gRNAribonucleic proteins, Lipofectamine™ MessengerMAX™ for Cas9 or TALEN mRNA,Lipofectamine™ 3000 for Cas9 plasmids). See “Delivery of the TrueTag™ DNA donorand editing tools into target cells“ on page 24 for more details, and “Transfectionmethods“ on page 27 for seven different transfection protocols.
To enrich for edited cells, puromycin or blasticidin selection can be used. For your cellline, a kill curve needs to be conducted to determine the concentration of antibioticrequired to kill the unedited population. Generally efficient killing of the uneditedand recovery of the edited populations take 5–10 days. See Appendix B, “Additionalprocedures“ for more details.
Edited cells can be analyzed in multiple ways. We recommend both visualconfirmation if using the EmGFP or tagRFP. For well-expressed genes, the fluorescenttag can become visible as early as 1–2 days after transfection. We also recommendsequencing at the pool and clonal level using junction PCR of TOPO™ clonedamplicons. The Genomic Cleavage Detection Kit (Cat. No. A24372) can be used with ano donor control to confirm that the nuclease is cutting efficiently. For troubleshootingit is important to understand how well your nuclease is causing double-strandedDNA breaks. Poor performing CRISPR-Cas9 or TALEN designs will make HDR andprotein tagging very difficult.
PCR
Transfection
Selection/killcurve
Analysis
MethodsOverview
14 TrueTag™ DNA Donor Kit User Guide
![Page 15: TrueTag DNA Donor Kit - Thermo Fisher Scientific · Product information Product description The Invitrogen™ TrueTag™ DNA Donor Kit enables the user to construct and purify a linear](https://reader034.fdocuments.in/reader034/viewer/2022050502/5f94d91f989bc700761fcff0/html5/thumbnails/15.jpg)
Donor design
To begin the design of your TrueTag™ Donor DNA, we recommend following thesegeneral steps
1. Choose gene to be tagged
2. Choose amino (at ATG start codon) or carboxy fusion (before stop codon)
3. Choose tag (EmGFP, tagRFP, non-secreted luciferase)
4. Choose selection marker (puromycin, blasticidin)
5. Identify nuclease (CRISPR or TALEN) to cut near insertion site
6. Design gene specific PCR oligos to add homology arms to premade donortemplates
The first step is to choose the appropriate tag (EmGFP, tagRFP, or luciferase) for yourdownstream analysis. Each kit includes templates for making amino or carboxy genefusions with either puromycin or blasticidin antibiotic selection.
Next, choose the location for the tag. For gene fusions, the C-terminal is less likely toimpact on the upstream regulatory elements of the gene. In addition, our C-terminalconstructs include the option to remove the selection cassette using Cre/lox. Someproteins can be inhibited by having additional amino acids on one terminus than theother due to steric hindrance, blocking an active site, or preventing proteininteractions. You may need to test both termini to determine which works best foryour protein of interest and cell type.
For N-terminal fusions, the ideal insertion site should be immediately after the startATG. For C-terminal fusions, the ideal insertion site should be immediately before thestop codon (TAA,TAG,TGA).
Once you have determined where you want to add the tag, you need to identify theclosest Cas9 cut site. Proximity of the cut site to the insert position strongly influencesinsertion efficiency and we recommend selecting a gRNA that cuts within 10 bases ofthe insertion site.
A second consideration when using Cas9 is to ideally select a PAM/gRNA sequencethat lies across the insertion site to prevent the Cas9/gRNA complex from targetingyour donor molecule or recutting the edited genome resulting in indels. Whenchoosing a gRNA that lies across the insertion site, the donor will disrupt the gRNAsite (Figure 5.) If gRNAs are only available completely to the left or right of theinsertion site, consider adding a mutation to the PAM site or in the first 10 bases of thegRNA region. If this is within a coding region, changes at a codon wobble position
Design TrueTag™
Donor DNA
Choosing yourdonor template
Selecting aCRISPR-Cas9 site
MethodsDonor design
TrueTag™ DNA Donor Kit User Guide 15
![Page 16: TrueTag DNA Donor Kit - Thermo Fisher Scientific · Product information Product description The Invitrogen™ TrueTag™ DNA Donor Kit enables the user to construct and purify a linear](https://reader034.fdocuments.in/reader034/viewer/2022050502/5f94d91f989bc700761fcff0/html5/thumbnails/16.jpg)
will give you the most flexibility to disrupt the gRNA without changing the aminoacid sequence.
Spacing between PAM andgRNA seed region is disrupted
Homology Directed Repair
gRNA
PAM and gRNA seed sequence undisturbed, donor may be cut in-vitro, recutting of genome after HDR
Insertion Site
Target gene
gRNA
Homology Directed Repair
gRNA
Insertion Site
gRNA
Target gene
Figure 5 Choosing a gRNA.
The final consideration for gRNA choice is to select one with low off target potentialto minimize unwanted changes to the genome.
If a good PAM site is not available, TALENs can be a good alternative. Thepredictability with which Invitrogen™ TAL effector nucleases bind to exact DNAsequences makes it possible to position the cut site directly at the ATG or STOP codonposition without sequence limitations.
From designing, synthesizing and validating your TALEN, we offer end-to-endservices to support every step in genome editing. For more information regardingTALEN designs, contact technical support at [email protected] or visit https://www.thermofisher.com/us/en/home/global/forms/gene-editing-crispr-quote-request.html
Selecting a TALENsite
MethodsDonor design
16 TrueTag™ DNA Donor Kit User Guide
![Page 17: TrueTag DNA Donor Kit - Thermo Fisher Scientific · Product information Product description The Invitrogen™ TrueTag™ DNA Donor Kit enables the user to construct and purify a linear](https://reader034.fdocuments.in/reader034/viewer/2022050502/5f94d91f989bc700761fcff0/html5/thumbnails/17.jpg)
Once you decided on your genome editing method and have your proposed cut site,you will need to design your custom DNA oligos to add homology arms to theTrueTag™ DNA Donor template. The N-terminal and C-terminal donors haveuniversal priming sites that will be incorporated into your oligo design.
The universal donor PCR oligo sequences are:
N-terminal donorUniF-N 5’ GGAGGTAAGCCCTTGCATTCG 3’
UniR-N 5’ ACCGCTTCCACTACCTGAACC 3’
C-terminal donorUniF-C 5’ GGAAGTGGCTCAGGTTCTGGA 3’
UniR-C 5’ CTTGGCCGATCGCATACAGAG 3’
The following examples will walk through how to design the donor molecule usingCRISPR and the standard Streptococcus pyogenes Cas9 with a NGG PAM.
We recommend adding 2 phosphorothioate modifications to the 5’ ends of the oligosto inhibit nuclease digestion of the donor. Standard 50 nM scale with desaltedpurification is recommended.
Example 1
Genome 5' 3'2nd codon
5' 3'Forward primer
3' 5'Reverse primer
Genomic target
35nt 21nt
35nt21nt
Count ~35ntupstream of CUT
5' universal seqof N Donor
3' universal seqof N Donor
Count ~35ntdownstream of 2nd codon
Figure 6 Design N-terminal primers: cut site upstream of ATG start
Forward primer
1. Identify 35 bases upstream from the CUT position and place this sequence at the5' end of the forward primer.
2. Add the sequence for the region between CUT and through the ATG codon as aspacer in the center of the forward primer.
3. Add the sequence for the universal N-terminal donor sequence (UniF-N) to the 3'end of the forward primer.
Design of donorhomology armPCR primers
MethodsDonor design
TrueTag™ DNA Donor Kit User Guide 17
![Page 18: TrueTag DNA Donor Kit - Thermo Fisher Scientific · Product information Product description The Invitrogen™ TrueTag™ DNA Donor Kit enables the user to construct and purify a linear](https://reader034.fdocuments.in/reader034/viewer/2022050502/5f94d91f989bc700761fcff0/html5/thumbnails/18.jpg)
Reverse primer
1. Identify 35 bases after the ATG codon, obtain the reverse compliment and placethe sequence at the 5' end of the reverse primer.
2. Add the sequence for the universal N-terminal donor sequence (UniR-N) to the 3'end of the reverse primer.
Example 2
Genome 5'
Reverse primer
Count ~35ntupstream of ATG
3' universal seqof N Donor
Count ~35ntdownstream of CUT
35nt 21nt
Forward primer5' 3'
35nt21nt3' 5'
3'
2nd
codon
5' universal seqof N Donor
Genomic target
Figure 7 Design N-terminal primers: cut site downstream of ATG start
Forward primer
1. Identify 35 bases upstream and including the ATG and place this sequence at the5' end of the forward primer.
2. Add the sequence for the universal N-terminal donor sequence (UniF-N) to the 3'end of the forward primer.
Reverse primer
1. Identify the bases immediately after the ATG and up to the CUT position as aspacer, then identify 35 bases downstream from the CUT position.
2. Obtain the reverse compliment of the bases identified above, and place thesequence at the 5' end of the reverse primer.
3. Add the sequence for the universal N-terminal donor sequence (UniR-N) to the 3'end of the reverse primer.
MethodsDonor design
18 TrueTag™ DNA Donor Kit User Guide
![Page 19: TrueTag DNA Donor Kit - Thermo Fisher Scientific · Product information Product description The Invitrogen™ TrueTag™ DNA Donor Kit enables the user to construct and purify a linear](https://reader034.fdocuments.in/reader034/viewer/2022050502/5f94d91f989bc700761fcff0/html5/thumbnails/19.jpg)
Example 3
5' 3'
5' 3'
3' 5'
Count ~35ntupstream of CUT
5' universal seqof C Donor
35nt 21nt
35nt21nt
3' universal seqof C Donor
Count ~35ntdownstream of STOP
Forward primer
Genome
Reverse primer
Figure 8 Design C-terminal primers: cut site upstream of STOP codon
Forward primer
1. Identify 35 bases upstream from the CUT position and place this sequence at the5' end of the forward primer.
2. Add the sequence for the region between the CUT position and before the STOPcodon as a spacer in the center of the forward primer.
3. Add the sequence for the universal C-terminal donor sequence (UniF-C) to the 3'end of the forward primer.
Reverse primer
1. Identify 35 bases downstream and including the STOP codon, obtain the reversecompliment and place the at the 5' end of the reverse primer.
2. Add the sequence for the universal C-terminal donor sequence (UniR-C) to the 3'end of the reverse primer.
MethodsDonor design
TrueTag™ DNA Donor Kit User Guide 19
![Page 20: TrueTag DNA Donor Kit - Thermo Fisher Scientific · Product information Product description The Invitrogen™ TrueTag™ DNA Donor Kit enables the user to construct and purify a linear](https://reader034.fdocuments.in/reader034/viewer/2022050502/5f94d91f989bc700761fcff0/html5/thumbnails/20.jpg)
Example 4
Genome 5'
Count ~35ntupstream of STOP
3' universal seqof N Donor
Count ~35ntdownstream of CUT
35nt 21nt
3'
5' universal seqof N Donor
5'
3' 5'
3'Forward primer
Reverse primer
21nt 35nt
Figure 9 Design C-terminal primers: cut site downstream of STOP codon
Forward primer
1. Identify 35 bases upstream of the STOP codon and place this sequence at the 5'end of the forward primer.
2. Add the sequence for the universal C-terminal donor sequence (UniF-C) to the 3'end of the forward primer.
Reverse primer
1. Identify the bases including the stop codon and up-to the CUT position as aspacer, and then identify 35 bases downstream from the CUT position.
2. Obtain the reverse compliment of the bases identified above, and place thesequence at the 5' end of the reverse primer.
3. Add the sequence for the universal C-terminal donor sequence (UniR-C) to the 3'end of the reverse primer.
MethodsDonor design
20 TrueTag™ DNA Donor Kit User Guide
![Page 21: TrueTag DNA Donor Kit - Thermo Fisher Scientific · Product information Product description The Invitrogen™ TrueTag™ DNA Donor Kit enables the user to construct and purify a linear](https://reader034.fdocuments.in/reader034/viewer/2022050502/5f94d91f989bc700761fcff0/html5/thumbnails/21.jpg)
Example 5
In this case, the gRNA design does not cross the insertion site. This may result in theCas9 complex cutting the donor directly or recutting a successful genomic editthereby lowering editing efficiency. We recommend avoiding gRNAs like this ifpossible. In order to avoid this possibility, a mutation that disrupts the PAM site in thedonor can be made. You may minimize the impact of the mutation in coding regionsby changing the PAM at a codon wobble position for a silent change (same amino acidis still made).
Figure 10 Design primers: gRNA does not cross the insertion site
Forward primer
1. Identify 35 bases upstream from the CUT position and place this sequence at the5' end of the forward primer.
2. Add the sequence for the region between the CUT position and through the ATGcodon as a spacer in the center of the forward primer.
3. Identify the gRNA binding site within this sequence above, and modify a singlebase in the seed region of the gRNA or the PAM site. If this were part of thecoding region of your gene, mutations in the wobble position are least likely tocause missense mutations.
4. Add the sequence for the universal N-terminal donor sequence (UniF-N) to the 3'end of the forward primer.
Reverse primer
1. Identify 35 bases after the ATG codon, obtain the reverse compliment and placethe sequence at the 5' end of the reverse primer.
2. Add the sequence for the 3' universal N-terminal donor sequence (UniR-N) to the3' end of the reverse primer.
MethodsDonor design
TrueTag™ DNA Donor Kit User Guide 21
![Page 22: TrueTag DNA Donor Kit - Thermo Fisher Scientific · Product information Product description The Invitrogen™ TrueTag™ DNA Donor Kit enables the user to construct and purify a linear](https://reader034.fdocuments.in/reader034/viewer/2022050502/5f94d91f989bc700761fcff0/html5/thumbnails/22.jpg)
Once you have edited your genomic target, PCR and sequencing can be used toconfirm that the tag is in the correct location and the junctions are accurate.
Analysis by PCR ReporterTarget gene
F1
ResistancemarkerP2 A
F2
R2 R1
We recommend designing genomic target specific forward primers (F1) that is 100–300 bases upstream of the left donor junction and a reverse primer (R1) that is 100–300 bases after the left junction. For the internal primers F2 and R2 you can designyour own, again 100–300 bases internal of the junctions or order the ones needed fromthe list below. Overall each amplicon should be 200–600 bases. Standard 25 nMdesalted are recommended. For more discussion of verification, see “Confirmation ofCas9 or TALEN cutting activity by GCD or sequencing“ on page 48.
Tag Donor Donorsize (bp)
Verification Primer R2 (notprovided)
Verification Primer F2 (notprovided)
GFP
N-Puro-GFP 1416 GGGTAATCGGCGAAGGCAGCGG GTCCGCCCTGAGCAAAGACCCC
N-Blast-GFP 1215 CCACGAGTTCTGCACAAGGTCC GTCCGCCCTGAGCAAAGACCCC
C-Puro(Cre-Lox)-GFP 1494 CTTGTGGCCGTTTACGTCGCCG GCCCTAGAACCTGGTGCATGAC
C-Blast(Cre-Lox)-GFP 1293 CTTGTGGCCGTTTACGTCGCCG TGCGGACGGTGCCGACAGGTGC
RFP
N-Puro-RFP 1410 GGGTAATCGGCGAAGGCAGCGG GCTAAGAACCTCAAGATGCCCG
N-Blast-RFP 1209 CCACGAGTTCTGCACAAGGTCC GCTAAGAACCTCAAGATGCCCG
C-Puro(Cre-Lox)-RFP 1488 GGCTTGCCTTCGCCCTCGGATG GCCCTAGAACCTGGTGCATGAC
C-Blast(Cre-Lox)-RFP 1287 GGCTTGCCTTCGCCCTCGGATG TGCGGACGGTGCCGACAGGTGC
Luc
N-Puro-Luc 1143 GGGTAATCGGCGAAGGCAGCGG CGGTGCGCCGACTGCACCACCG
N-Blast-Luc 942 CCACGAGTTCTGCACAAGGTCC CGGTGCGCCGACTGCACCACCG
C-Puro(Cre-Lox)-Luc 1221 TCAGGCAGCCTCTGGTACAGCC GCCCTAGAACCTGGTGCATGAC
C-Blast(Cre-Lox)-Luc 1020 TCAGGCAGCCTCTGGTACAGCC TGCGGACGGTGCCGACAGGTGC
Design ofvalidation primers
MethodsDonor design
22 TrueTag™ DNA Donor Kit User Guide
![Page 23: TrueTag DNA Donor Kit - Thermo Fisher Scientific · Product information Product description The Invitrogen™ TrueTag™ DNA Donor Kit enables the user to construct and purify a linear](https://reader034.fdocuments.in/reader034/viewer/2022050502/5f94d91f989bc700761fcff0/html5/thumbnails/23.jpg)
Generating your TrueTag™ donor DNA
This protocol will generate >5 µg of linear dsDNA donor with the desired genespecific homology arms.
1. Set up 50-µL PCR reactions
2X Phusion™ Flash High Fidelity PCR Master Mix 25 µL
Forward primer (10 µM) 1 µL
Reverse primer (10 µM) 1 µL
Donor template (20 ng/µL) 1 µL
Water 22 µL
2. PCR parameters:
Step Cycles Temperature Time
Denature 1 98°C 10 seconds
Amplification 30
98°C 1 seconds
55°C 5 seconds
72°C 30 seconds
Final extension 1 72°C 2 minutes
Final hold 1 4°C HOLD
3. Confirm successful PCR reaction by running 2 µL of PCR on 1–2% agarose gel. Asuccessful PCR will have a single band around 1.3–1.5 kb in size.
4. PCR Cleanup using the TrueTag™ PCR Purification module. All steps should becarried out at room temperature. All centrifugations should be carried out in atable-top microcentrifuge at >12000 × g (10000–14000 rpm, depending on therotor type).
• Prior to the initial use of the purification module, dilute the Wash Buffer(concentrated) with 9 mL of ethanol (96–100%)
• Examine the Binding Buffer for precipitate before each use. Re-dissolve anyprecipitate by warming the solution to 37°C and cooling to 25°C.
a. Combine the two completed 50-µL PCR reactions for each donor into 1 tube
b. Add a 100 µL of Binding Buffer to completed PCR mixture (1:1). Mixthoroughly. Check the color of the solution. A yellow color indicates anoptimal pH for DNA binding. If the color of the solution is orange or violet,add 10 µL of 3 M sodium acetate, pH 5.2 solution and mix. The color of themix will become yellow.
c. Transfer the 200 µL of the solution from step b to the GeneJET™ purificationcolumn. Centrifuge for 30–60 seconds. Discard the flow-through.
d. Add 700 µL of Wash Buffer (diluted with ethanol) to the GeneJET™
purification column. Centrifuge for 30–60 seconds. Discard the flow-throughand place the purification column back into the collection tube.
MethodsGenerating your TrueTag™ donor DNA
TrueTag™ DNA Donor Kit User Guide 23
![Page 24: TrueTag DNA Donor Kit - Thermo Fisher Scientific · Product information Product description The Invitrogen™ TrueTag™ DNA Donor Kit enables the user to construct and purify a linear](https://reader034.fdocuments.in/reader034/viewer/2022050502/5f94d91f989bc700761fcff0/html5/thumbnails/24.jpg)
e. Centrifuge the empty GeneJET™ purification column for an additional1 minute to completely remove any residual wash buffer.
Note: This step is essential as the presence of residual ethanol in the DNAsample may inhibit subsequent reactions.
f. Transfer the GeneJET™ purification column to a clean 1.5 mLmicrocentrifuge tube (not included). Add 50 µL of Elution Buffer (10 mMTris-HCl, pH 8.5) or nuclease-free water to the center of the GeneJET™
purification column membrane and centrifuge for 1 minute.
g. Discard the GeneJET™ purification column and store the purified DNA at−20°C.
h. Concentration can be measured by A260. If higher concentration is requireda SpeedVac™ vacuum concentrator can be used.
Delivery of the TrueTag™ DNA donor and editing tools into targetcells
• The efficiency with which mammalian cells are transfected with gRNA variesaccording to cell type and the transfection reagent used. See Table 4 for deliveryreagent recommendations.
• For gene editing, the highest editing efficiency is achieved with a 1:1 molar ratioof gRNA to TrueCut™ Cas9 Protein v2. In some cell types such as iPSC and THP1,it may be necessary to use up to 2 µg of TrueCut™ Cas9 Protein v2 and 400 ng ofgRNA per well in a 24-well format.
• Use 200 ng (0.2 pmol) to 500 ng (0.5 pmol) of donor DNA (average size forTrueCut™ is ~1500 bp) per well for best results in a 24-well format. Higheramounts often results in decrease in cell viability and editing efficiency.
• The optimal cell density for transfection varies depending on cell size and growthcharacteristics. In general, 30–70% confluence on the day of transfection whenusing lipid-mediated delivery, or 70–90% confluence for electroporation using theNeon™ Transfection System is recommended.
• After the optimal cell number and dosage of TrueCut™ Cas9 Protein v2/gRNAthat provides maximal gene editing efficiency is determined , do not vary theseconditions across experiments for a given cell type to ensure consistency.For an overview of the factors that influence transfection efficiency, refer to the“Transfection Basics” chapter of the Gibco™ Cell Culture Basic Handbook,available at thermofisher.com/cellculturebasics.
• Use the TrueGuide™ Positive Controls (human AVVS1, CDK4, HPRT1, or mouseRosa 26) and negative control gRNA (non-coding) to determine gRNA amountand transfection conditions that give the optimal gene editing efficiency withhighest cell viability. The TrueGuide™ Positive and Negative sgRNA and crRNAControls are available separately from Thermo Fisher Scientific. For moreinformation, refer to thermofisher.com/trueguide.
GeneralCRISPR/gRNAtransfectionguidelines
MethodsDelivery of the TrueTag™ DNA donor and editing tools into target cells
24 TrueTag™ DNA Donor Kit User Guide
![Page 25: TrueTag DNA Donor Kit - Thermo Fisher Scientific · Product information Product description The Invitrogen™ TrueTag™ DNA Donor Kit enables the user to construct and purify a linear](https://reader034.fdocuments.in/reader034/viewer/2022050502/5f94d91f989bc700761fcff0/html5/thumbnails/25.jpg)
• The cell number and other recommendations provided in the followingprocedures are initial guidelines based on cell types that have been tested in-house. For multiple wells, prepare a master mix of components to minimizepipetting error, then dispense the appropriate volumes into each reaction well.When making a master mix for replicate wells, preparing extra volume to accountfor any pipetting variations is recommended.
• Choosing the right delivery reagent is critical for transfection and gene editingefficiency. See our recommendations in Table 4. For more information ontransfection reagents, see thermofisher.com/transfection.
Table 4 Recommended delivery options for Cas9 and TALENs.
Cas9 format Transfection reagent
TrueCut™ Cas9 Protein v2+ gRNA
Lipofectamine™ CRISPRMAX™ Cas9 TransfectionReagent (Cat. No. CMAX00001)
Cas9 mRNA + gRNA Lipofectamine™ MessengerMAX™(Cat. No. LMRNA003)
Cas9 plasmid Lipofectamine™ 3000 (Cat. No. L3000015)
TALEN mRNA Lipofectamine™ MessengerMAX™ (Cat. No. LMRNA003)
• For maximum efficiency in difficult-to-transfect cell types, performelectroporation using the Neon™ Transfection System (Cat. Nos. MPK5000,MPK1025).
Note: To optimize the electroporation conditions for a particular cell line, followthe Neon™ transfection 24-well optimization protocol described in the Neon™
Transfection System user guide. Each of the 24 optimized conditions are varied inpulse voltage, pulse width, and the number of pulses to determine whichcondition works best with your cell line. Alternative electroporation systems maybe used, but optimal conditions will vary.
• For cell line specific transfection conditions using the Lipofectamine™
CRISPRMAX™ Transfection Reagent or the Neon™ Transfection System, see the Appendix C, “Transfection tables“.
Prepare working stock of TrueGuide™ synthetic gRNA
If you are using the TrueGuide™ Synthetic gRNA, resuspend the gRNA (sgRNA,crRNA, or tracrRNA) in 1X TE buffer to prepare 100 µM (100 pmol/µL) stocksolutions.
1. Before opening, centrifuge each TrueGuide™ Synthetic gRNA tube at low speed(maximum RCF 4,000 × g) to collect the contents at the bottom of the tube, thenremove the cap from the tube carefully.
2. Using a pipette and sterile tips, add the required volume of 1X TE buffer toprepare 100 µM (100 pmol/µL) stock solutions.
3. Vortex the tube to resuspend the oligos, briefly centrifuge to collect the contentsat the bottom of the tube, then incubate at room temperature for 15–30 minutes toallow the gRNA oligos to dissolve.
4. Vortex the tube again to ensure that all the contents of the tube are resuspended,then briefly centrifuge to collect the contents at the bottom of the tube.
Recommendeddelivery options
Preparing yourgRNA
MethodsDelivery of the TrueTag™ DNA donor and editing tools into target cells
TrueTag™ DNA Donor Kit User Guide 25
![Page 26: TrueTag DNA Donor Kit - Thermo Fisher Scientific · Product information Product description The Invitrogen™ TrueTag™ DNA Donor Kit enables the user to construct and purify a linear](https://reader034.fdocuments.in/reader034/viewer/2022050502/5f94d91f989bc700761fcff0/html5/thumbnails/26.jpg)
5. Optional: Check the concentration of the resuspended oligos using theNanoDrop™ Spectrophotometer (or equivalent) or a UV-base plate reader.
6. Optional: Create aliquots of the working stock for storage.
7. Use working stocks immediately or freeze at –20°C until use.
Anneal crRNA and tracrRNA
If you are using the TrueGuide™ Synthetic crRNA:tracrRNA format, you must annealthe crRNA with tracrRNA in 1X Annealing Buffer (final concentration) to prepare thecrRNA:tracrRNA duplex before performing transfections. Skip this step if you areusing the TrueGuide™ Synthetic sgRNA format or in vitro transcribed (IVT) gRNA.
1. Mix 10 µL each of the TrueGuide™ crRNA and TrueGuide™ tracrRNA (100 µM)in a PCR tube containing 10 µL of 5X Annealing Buffer and 20 µL of nuclease-free water for a final crRNA:tracrRNA duplex concentration of 20 µM.
2. Mix the contents and anneal in thermocycler:
Temperature Time
95°C 5 minutes
95°C to 78°C –2°C/second ramp rate
78°C 10 minutes
78°C to 25°C –0.1°C/second ramp rate
25°C 5 minutes
3. Store the annealed product (crRNA:tracrRNA duplex) at –20℃ until required foruse. For further dilution of annealed products, use 1X annealing buffer.
(Optional) Prepare 5X annealing buffer
If you are using the TrueGuide™ crRNA:tracrRNA format and need additional 5XAnnealing Buffer for the annealing and subsequent dilution steps, prepare a solutionof 30 mM HEPES, 100 mM potassium acetate, and 2 mM magnesium acetate innuclease-free water, then adjust to pH 7.4 using 1 M potassium hydroxide.
(Optional) Generate gRNA by in vitro transcription
If you wish to use in vitro transcribed gRNA for use with TrueCut™ Cas9 Protein v2 inCRISPR-Cas9-mediated genome editing, we recommend that you use the PrecisiongRNA Synthesis Kit to synthesize your gRNA. For detailed instructions on how togenerate full length gRNA, refer to the Precision gRNA Synthesis Kit User Guide(Pub. No. MAN0014538), available for download at thermofisher.com.
MethodsDelivery of the TrueTag™ DNA donor and editing tools into target cells
26 TrueTag™ DNA Donor Kit User Guide
![Page 27: TrueTag DNA Donor Kit - Thermo Fisher Scientific · Product information Product description The Invitrogen™ TrueTag™ DNA Donor Kit enables the user to construct and purify a linear](https://reader034.fdocuments.in/reader034/viewer/2022050502/5f94d91f989bc700761fcff0/html5/thumbnails/27.jpg)
Transfection methods
The following protocol is provided as a starting point for transfecting cells withTrueTag™ donor, TrueCut™ Cas9 Protein v2, and gRNA using the Lipofectamine™
CRISPRMAX™ Transfection Reagent.
IMPORTANT! Add the reagents in the order indicated. Prepare TrueTag™ donor,TrueCut™ Cas9 Protein v2/gRNA/Cas9 PLUS™ reagent solution (Tube 1) beforediluting the Lipofectamine™ CRISPRMAX™ Reagent (Tube 2).
Day 0 - seed cells
The day before transfection, seed your adherent cells according to the followingguidelines so that they are 30–70% confluent on the day of transfection.
96-well 24-well 6-well
Cell density per well 8,000–18,000 cells
40,000–90,000 cells
250,000–450,000 cells
Final volume of media per well 100 µL 0.5 mL 2 mL
Day 1 – transfect cells
1. Prepare Tube 1: TrueTag™ Donor + TrueCut™ Cas9 Protein v2 + gRNA solutionwith Cas9 PLUS™ Reagent in Opti-MEM™ I Medium
IMPORTANT! Always prepare the TrueCut™ Cas9 Protein v2/gRNA/Cas9PLUS™ reagent solution (Tube 1) before diluting the Lipofectamine™
CRISPRMAX™ Reagent (Tube 2).
a. If you are using the standard two-piece gRNA format (crRNA:tracrRNA),anneal the TrueGuide™ crRNA and TrueGuide™ tracrRNA in 1X annealingbuffer to generate the crRNA:tracrRNA duplex. See the TrueCut™ Cas9Protein v2 User Guide (Pub. No. MAN0017066) for detailed instructions. Forone-piece format (sgRNA), skip this step and proceed with Step b.
Transfect cellswith TrueTag™
donor, TrueCut™
Cas9 protein v2and gRNA usingLipofectamine™
CRISPRMAX™
TransfectionReagent
MethodsTransfection methods
TrueTag™ DNA Donor Kit User Guide 27
![Page 28: TrueTag DNA Donor Kit - Thermo Fisher Scientific · Product information Product description The Invitrogen™ TrueTag™ DNA Donor Kit enables the user to construct and purify a linear](https://reader034.fdocuments.in/reader034/viewer/2022050502/5f94d91f989bc700761fcff0/html5/thumbnails/28.jpg)
b. Mix the TrueTag™ Donor, TrueCut™ Cas9 Protein v2, gRNA, Lipofectamine™
Cas9 PLUS™ Reagent, and Opti-MEM™ I Reduced Serum Medium in a fresh,RNAse-free microcentrifuge tube according to the appropriate table below.Mix well.
IMPORTANT! Add the Lipofectamine™ Cas9 PLUS™ Reagent last.
Reagent 96-well 24-well 6-well
Opti-MEM™ I Medium 5 µL 25 µL 125 µL
TrueCut™ Cas9 Protein v2 250 ng(1.5 pmol)
1250 ng(7.5 pmol)
6250 ng(37.5 pmol)
gRNA (crRNA:tracrRNA orsgRNA)
50 ng(1.5 pmol)
240 ng(7.5 pmol)
1200 ng(37.5 pmol)
TrueTag™ Donor 100 ng 500 ng 2500 ng
Lipofectamine™ Cas9PLUS™ Reagent 0.5 µL 2.5 µL 12.5 µL
2. Prepare Tube 2: Dilute Lipofectamine™ CRISPRMAX™ reagent in Opti-MEM™ IMedium
Reagent 96-well 24-well 6-well
Opti-MEM™ I Medium 5 µL 25 µL 125 µL
Lipofectamine™
CRISPRMAX™ Reagent 0.3 µL 1.5 µL 7.5 µL
3. Incubate Tube 2 for 1 minute at room temperatureIncubate the Lipofectamine™ CRISPRMAX™ Reagent diluted in Opti-MEM™ IMedium (Tube 2) at room temperature for 1 minute. Do not leave Tube 2 at roomtemperature for longer than 5 minutes.
Note: You can incubate the gRNA/ Opti-MEM™ I solution at room temperaturefor longer than 1 minute. We have observed no change in transfection efficiencywhen Tube 1 was left at room temperature for up to 30 minutes.
4. Mix Tube 1 + Tube 2Add the diluted Lipofectamine™ CRISPRMAX™ Reagent (Tube 2) to theTrueTag™+RNP/ Opti-MEM™ I solution (Tube 1) and mix well by pipetting.
Note: For high-throughput setup (e.g., 96-well format or others), always add thecontents of Tube 2 into Tube 1 because you can prepare Tube 2 as a bulk mastermix.
5. Incubate for 10–15 minutes at room temperatureIncubate the Tube 1 + Tube 2 mixture (i.e., transfection complex) for 10–15 minutes at room temperature.
MethodsTransfection methods
28 TrueTag™ DNA Donor Kit User Guide
![Page 29: TrueTag DNA Donor Kit - Thermo Fisher Scientific · Product information Product description The Invitrogen™ TrueTag™ DNA Donor Kit enables the user to construct and purify a linear](https://reader034.fdocuments.in/reader034/viewer/2022050502/5f94d91f989bc700761fcff0/html5/thumbnails/29.jpg)
6. Add the transfection complex to cells and incubate at 37°Ca. Add the transfection complex (from step 5) to your adherent cells at 30–70%confluence according to the following table:
Reagent 96-well 24-well 6-well
TrueTag™
+RNP/transfectionreagent complex
10 µL 50 µL 250 µL
b. Incubate the cells in a humidified 37°C, 5% CO2 incubator for 48–72 hours.
Day 2–4 – verify editing
Verify editing efficiency and proceed to downstream applications1. When the cells have reached 80–100% confluence you are ready to proceed to the
next steps.
The following protocol is provided as a starting point for transfecting wild-type cellswith TrueCut™ Cas9 Protein v2 and gRNA using the Neon™ Transfection System. Forcell specific transfection conditions using TrueCut™ Cas9 Protein v2 and TrueGuide™
Synthetic gRNA, see the Appendix C, “Transfection tables“.
IMPORTANT! The following recommendations are for a single well in 24-well formatusing the 10 µL Neon™ tip. For multiple wells, prepare a master mix of componentswith extra volume to minimize pipetting errors, and then dispense the appropriatevolumes into each well. Avoid creating bubbles while mixing and dispensing. Fordetails on optimizing the Neon™ electroporation conditions and scaling down/up fordifferent plate formats, refer to the Neon™ Transfection System User Guide (Pub. No.MAN0001557), available for download at thermofisher.com.
Note: To optimize the electroporation conditions for a particular cell line, follow theNeon™ transfection 24-well optimization protocol described in the Neon™ TransfectionSystem user guide. Each of the 24 optimized conditions are varied in pulse voltage,pulse width, and the number of pulses to determine which condition works best withyour cell line. Alternative electroporation systems may be used, but optimalconditions will vary.
Day 0 - seed cells
1–2 days before transfection, transfer your adherent cells to a new flask with freshgrowth medium so that they are 70–90% confluent on the day of transfection.
Transfect cellswith TrueTag™
donor, TrueCut™
cas9 protein v2and gRNA usingthe Neon™
transfectionsystem
MethodsTransfection methods
TrueTag™ DNA Donor Kit User Guide 29
![Page 30: TrueTag DNA Donor Kit - Thermo Fisher Scientific · Product information Product description The Invitrogen™ TrueTag™ DNA Donor Kit enables the user to construct and purify a linear](https://reader034.fdocuments.in/reader034/viewer/2022050502/5f94d91f989bc700761fcff0/html5/thumbnails/30.jpg)
Day 1 – transfect cells
1. Prepare 24-well plate with mediaAdd 1000 µL of cell type-specific growth medium into each well of the 24-wellplate and place it in the 37℃ incubator to pre-warm.
2. Prepare Tube 1: TrueTag™ Donor + TrueCut™ Cas9 Protein v2 + gRNA inResuspension Buffer
a. If you are using the standard two-piece gRNA format (crRNA:tracrRNA),anneal the TrueGuide™ crRNA and TrueGuide™ tracrRNA in 5X annealingbuffer to generate the crRNA:tracrRNA duplex. See the TrueCut™ Cas9Protein v2 User Guide (Pub. No. MAN0017066) for detailed instructions. Forpremium one-piece format (sgRNA), skip this step and proceed with Step3b.
b. Mix the TrueCut™ Cas9 Protein v2, gRNA, and Resuspension Buffer R in afresh, RNase-free microcentrifuge tube according to the appropriate tablebelow. Mix well.
IMPORTANT! Maintain TrueCut™ Cas9 Protein v2:gRNA at a 1:1 molarratio. Use high concentration TrueCut™ Cas9 Protein v2 and ensure that thetotal volume of the RNP complex (TrueCut™ Cas9 Protein v2 + gRNA) doesnot exceed 1/10th of the total reaction volume (e.g., 1 µL of Cas9 protein +gRNA in 10 µL total reaction volume).
For TrueGuide™ gRNA (crRNA:tracrRNA duplex or sgRNA), use thefollowing table:
Reagent Amount per well of 24-well plate
TrueCut™ Cas9 Protein v2 1250 ng (7.5 pmol)
gRNA (crRNA:tracrRNA duplex orsgRNA) 240 ng (7.5 pmol)
TrueTag™ Donor 500 ng
Resuspension Buffer R to 10 µL
c. Incubate the TrueTag™ Donor + TrueCut™ Cas9 Protein v2 + gRNA inResuspension Buffer R at room temperature for 5–20 minutes.
3. Prepare Tube 2: Cells in Resuspension Buffer (Buffer R)
Note: Prepare extra amount (2X) of cells needed.
a. If you are using suspension cells, remove an aliquot and determine viablecell count. If you are using adherent cells, detach the cells from the cultureflask using Gibco™ TrypLE™ Dissociation Reagent, resuspend the cells in anappropriate volume of growth medium, then determine viable cell count.
MethodsTransfection methods
30 TrueTag™ DNA Donor Kit User Guide
![Page 31: TrueTag DNA Donor Kit - Thermo Fisher Scientific · Product information Product description The Invitrogen™ TrueTag™ DNA Donor Kit enables the user to construct and purify a linear](https://reader034.fdocuments.in/reader034/viewer/2022050502/5f94d91f989bc700761fcff0/html5/thumbnails/31.jpg)
b. Transfer the appropriate amount of cells into a 15-mL centrifuge tube, thenpellet the cells by centrifugation at 100–400 × g for 5 minutes at roomtemperature.
Note: Optimal cell number used for electroporation varies depending onthe cell type. For example, in case of iPSC and THP1, we had best resultswith 80,000 and 200,000 cells per electroporation respectively.
c. Wash the cells with PBS without Ca2+ or Mg2+ using the same volume asoriginal cell volume, then pellet the cells by centrifugation at 100–400 × g for5 minutes at room temperature.
d. Aspirate the PBS and resuspend the cell pellet in Resuspension Buffer R or T(depending on cell type) at the desired concentration. For example, to use100,000 cells/reaction, resuspend the cells at 2.0 × 107 cells/mL, then use 5 µLof the resuspended cells per reaction. Gently pipette the cells to obtain asingle cell suspension.
4. Add Tube 2 (cells) to Tube 1a. Pipette the cells in Resuspension Buffer (from step 3) up and down to
resuspend any cells that might have settled at the bottom of the tube.
b. Add 5 µL of the cell suspension to tube 1 from Step 2.
5. Electroporate using the cell type-specific Neon™ conditiona. Using the 10 µL Neon™ tip, aspirate 10 µL of the cell + editing mix in
Resuspension Buffer, then electroporate using your cell type-specific Neon™
condition (see the Appendix C, “Transfection tables“).
IMPORTANT! Avoid creating bubbles that can hinder electroporation.
b. After electroporation, transfer the contents of the Neon™ tip immediatelyinto one well of the 24-well culture plate containing 1000 µL of pre-warmedgrowth medium (from step 1).
c. Incubate the cells in a humidified 37°C, 5% CO2 incubator for 48–72 hours.
Days 2–4 – verify editing
Verify editing efficiency and proceed to downstream applications1. When the cells have reached 80-100% confluence you are ready to proceed to the
next steps.
MethodsTransfection methods
TrueTag™ DNA Donor Kit User Guide 31
![Page 32: TrueTag DNA Donor Kit - Thermo Fisher Scientific · Product information Product description The Invitrogen™ TrueTag™ DNA Donor Kit enables the user to construct and purify a linear](https://reader034.fdocuments.in/reader034/viewer/2022050502/5f94d91f989bc700761fcff0/html5/thumbnails/32.jpg)
The following protocol is provided as a starting point for transfecting wild-type cellswith TrueTag™ Donor, CRISPR Nuclease mRNA and gRNA using the Neon™
Transfection System.
IMPORTANT! The following recommendations are for a single well in 24-well formatusing the 10 µL Neon™ tip. For multiple wells, prepare a master mix of componentswith extra volume to minimize pipetting errors, and then dispense the appropriatevolumes into each well. Avoid creating bubbles while mixing and dispensing. Fordetails on optimizing the Neon™ electroporation conditions and scaling down/up fordifferent plate formats, refer to the Neon™ Transfection System User Guide (Pub. No.MAN0001557), available for download at thermofisher.com.
Day 0 - seed cells
1–2 days before transfection, transfer your adherent cells to a new flask with freshgrowth medium so that they are 70–90% confluent on the day of transfection.
Day 1 – transfect cells
1. Prepare 24-well plate with mediaAdd 1000 µL of cell type-specific growth medium into each well of the 24-wellplate and place it in the 37℃ incubator to pre-warm.
2. Prepare Tube 1: TrueTag™ donor + CRISPR Nuclease mRNA + gRNA inResuspension Buffer
a. If you are using the two-piece gRNA format (crRNA:tracrRNA), anneal theTrueGuide™ crRNA and TrueGuide™ tracrRNA in 5X annealing buffer togenerate the crRNA:tracrRNA duplex.
b. Mix the TrueTag™ donor, CRISPR Nuclease mRNA, gRNA, andResuspension Buffer R in a fresh, RNase-free microcentrifuge tubeaccording to the appropriate table below. Mix well.For TrueGuide™ gRNA (crRNA:tracrRNA duplex or sgRNA) or IVT gRNA,use the following table:
Reagent Amount per well of 24-well plate
TrueTag™ donor 500 ng
CRISPR Nuclease mRNA 500 ng
gRNA (crRNA:tracrRNA duplex orsgRNA) 100 ng
Resuspension Buffer R to 10 µL
3. Prepare Tube 2: Cells in Resuspension Buffer (Buffer R)
Note: Prepare extra amount (2X) of cells needed.
a. If you are using suspension cells, remove an aliquot and determine viablecell count. If you are using adherent cells, detach the cells from the cultureflask using Gibco™ TrypLE™ Dissociation Reagent, resuspend the cells in anappropriate volume of growth medium, then determine viable cell count.
Transfect cellswith TrueTag™
donor, CRISPRnuclease mRNA,and gRNA usingthe Neon™
transfectionsystem
MethodsTransfection methods
32 TrueTag™ DNA Donor Kit User Guide
![Page 33: TrueTag DNA Donor Kit - Thermo Fisher Scientific · Product information Product description The Invitrogen™ TrueTag™ DNA Donor Kit enables the user to construct and purify a linear](https://reader034.fdocuments.in/reader034/viewer/2022050502/5f94d91f989bc700761fcff0/html5/thumbnails/33.jpg)
b. Transfer the appropriate amount of cells into a 15-mL centrifuge tube, thenpellet the cells by centrifugation at 100–400 × g for 5 minutes at roomtemperature.
Note: Optimal cell number used for electroporation varies depending onthe cell type. For example, in case of iPSC and THP1, we had best resultswith 80,000 and 200,000 cells per electroporation respectively.
c. Wash the cells with PBS without Ca2+ or Mg2+ using the same volume asoriginal cell volume, then pellet the cells by centrifugation at 100–400 × g for5 minutes at room temperature.
d. Aspirate the PBS and resuspend the cell pellet in Resuspension Buffer R atthe desired concentration. For example, to use 100,000 cells/reaction,resuspend the cells at 2.0 × 107 cells/mL, then use 5 µL of the resuspendedcells per reaction. Gently pipette the cells to obtain a single cell suspension.
4. Add Tube 2 to Tube 1 : Cells to Editing Mixa. Pipette the cells in Resuspension Buffer (from step 3) up and down to
resuspend any cells that might have settled at the bottom of the tube.
b. Add 5 µL of the cell suspension to Tube 1 from step 2.
5. Electroporate using the cell type-specific Neon™ conditiona. Using the 10 µL Neon™ tip, aspirate 10 µL of the cell + Editing Mix in
Resuspension Buffer, then electroporate using your cell type-specific Neon™
condition.
IMPORTANT! Avoid creating bubbles that can hinder electroporation.
b. After electroporation, transfer the contents of the Neon™ tip immediatelyinto one well of the 24-well culture plate containing 1000 µL of pre-warmedgrowth medium (from step 1).
c. Incubate the cells in a humidified 37°C, 5% CO2 incubator for 48–72 hours.
Days 2–4 – verify editing
Verify editing efficiency and proceed to downstream applications1. When the cells have reached 80-100% confluence you are ready to proceed to the
next steps.
MethodsTransfection methods
TrueTag™ DNA Donor Kit User Guide 33
![Page 34: TrueTag DNA Donor Kit - Thermo Fisher Scientific · Product information Product description The Invitrogen™ TrueTag™ DNA Donor Kit enables the user to construct and purify a linear](https://reader034.fdocuments.in/reader034/viewer/2022050502/5f94d91f989bc700761fcff0/html5/thumbnails/34.jpg)
The following protocol is provided as a starting point for transfecting cells withTrueTag™ donor, TrueCut™ Cas9 Protein v2, and gRNA using the Lipofectamine™
MessengerMAX™ Transfection Reagent.
Day 0 - seed cells
The day before transfection, seed your adherent cells according to the followingguidelines so that they are 30–70% confluent on the day of transfection.
96-well 24-well 6-well
Cell density per well 8,000–18,000 cells
40,000–90,000 cells
250,000–450,000 cells
Final volume of media per well 100 µL 0.5 mL 2 mL
Day 1 – transfect cells
1. Prepare Tube 1: TrueTag™ Donor + TrueCut™ Cas9 Protein v2 + gRNA solution inOpti-MEM™ I Medium
a. If you are using the standard two-piece gRNA format (crRNA:tracrRNA),anneal the TrueGuide™ crRNA and TrueGuide™ tracrRNA in 1X annealingbuffer to generate the crRNA:tracrRNA duplex. See the TrueCut™ Cas9Protein v2 User Guide (Pub. No. MAN0017066) for detailed instructions. Forone-piece format (sgRNA), skip this step and proceed with substep 1b.
b. Mix the TrueTag™ Donor, CRISPR Nuclease mRNA, gRNA, and Opti-MEM™
I Reduced Serum Medium in a fresh, RNAse-free microcentrifuge tubeaccording to the appropriate table below. Mix gently.For TrueGuide™ gRNA (crRNA:tracrRNA duplex or sgRNA), use thefollowing table:
Reagent 96-well 24-well 6-well
Opti-MEM™ I Medium 5 µL 25 µL 125 µL
CRISPR Nuclease mRNA 100 ng 500 ng 2500 ng
gRNA (crRNA:tracrRNA orsgRNA) 20 ng 100 ng 500 ng
TrueTag™ Donor 100 ng 500 ng 2500 ng
2. Prepare Tube 2: Dilute Lipofectamine™ MessengerMAX™ reagent in Opti-MEM™
I Medium, then mix gently and incubate for 10 minutes at room temperature.
Reagent 96-well 24-well 6-well
Opti-MEM™ I Medium 5 µL 25 µL 125 µL
Lipofectamine™
MessengerMAX™ Reagent 0.3 µL 1.5 µL 7.5 µL
3. Mix Tube 1 + Tube 2Add the diluted Lipofectamine™ MessengerMAX™ Reagent (Tube 2) to theEditing Mix (Tube 1) and mix well by pipetting.
Transfect cellswith TrueTag™
donor, CRISPRnuclease mRNA,and gRNA usingtheLipofectamine™
MessengerMAX™
TransfectionReagent
MethodsTransfection methods
34 TrueTag™ DNA Donor Kit User Guide
![Page 35: TrueTag DNA Donor Kit - Thermo Fisher Scientific · Product information Product description The Invitrogen™ TrueTag™ DNA Donor Kit enables the user to construct and purify a linear](https://reader034.fdocuments.in/reader034/viewer/2022050502/5f94d91f989bc700761fcff0/html5/thumbnails/35.jpg)
Note: For high-throughput setup (e.g., 96-well format or others), always add thecontents of Tube 2 into Tube 1 because you can prepare Tube 2 as a bulk mastermix.
4. Incubate for 5 minutes at room temperature.
5. Add the transfection complex to cells and incubate at 37°C.a. Add the transfection complex (from step 4) to your adherent cells at 30–70%confluence according to the following table:
Reagent 96-well 24-well 6-well
TrueTag™ Donor + mRNA+ gRNA/transfectionreagent complex
10 µL 50 µL 250 µL
b. Incubate the cells in a humidified 37°C, 5% CO2 incubator for 48–72 hours.
Day 2–4 – verify editing
Verify editing efficiency and proceed to downstream applications1. When the cells have reached 80–100% confluence you are ready to proceed to the
next steps.
The following protocol is provided as a starting point for transfecting cells withTrueTag™ donor and a mRNA TALEN pair using the Lipofectamine™
MessengerMAX™ Transfection Reagent.
Day 0 - seed cells
The day before transfection, seed your adherent cells according to the followingguidelines so that they are 30–70% confluent on the day of transfection.
96-well 24-well 6-well
Cell density per well 8,000–18,000 cells
40,000–90,000 cells
250,000–450,000 cells
Final volume of media per well 100 µL 0.5 mL 2 mL
Day 1 – transfect cells
1. Prepare Tube 1: TrueTag™ Donor + mRNA TALEN pair in Opti-MEM™ I Mediuma. Mix the TrueTag™ Donor, mRNA TALEN pair, and Opti-MEM™ I Reduced
Serum Medium in a fresh, RNAse-free microcentrifuge tube according to theappropriate table below. Mix gently.
Reagent 96-well 24-well 6-well
Opti-MEM™ I Medium 5 µL 25 µL 125 µL
Left TALEN mRNA 50 ng 200 ng 1000 ng
Right TALEN mRNA 50 ng 200 ng 1000 ng
TrueTag™ Donor 100 ng 500 ng 2500 ng
Transfect cellswith TrueTag™
donor, and TALENpair, using theLipofectamine™
MessengerMAX™
TransfectionReagent
MethodsTransfection methods
TrueTag™ DNA Donor Kit User Guide 35
![Page 36: TrueTag DNA Donor Kit - Thermo Fisher Scientific · Product information Product description The Invitrogen™ TrueTag™ DNA Donor Kit enables the user to construct and purify a linear](https://reader034.fdocuments.in/reader034/viewer/2022050502/5f94d91f989bc700761fcff0/html5/thumbnails/36.jpg)
2. Prepare Tube 2: Dilute Lipofectamine™ MessengerMAX™ reagent in Opti-MEM™
I Medium, then mix gently.
Reagent 96-well 24-well 6-well
Opti-MEM™ I Medium 5 µL 25 µL 125 µL
Lipofectamine™
MessengerMAX™ Reagent 0.3 µL 1.5 µL 7.5 µL
3. Mix Tube 1 + Tube 2Add the diluted Lipofectamine™ MessengerMAX™ Reagent (Tube 2) to theEditing Mix (Tube 1) and mix gently by pipetting.
Note: For high-throughput setup (e.g., 96-well format or others), always add thecontents of Tube 2 into Tube 1 because you can prepare Tube 2 as a bulk mastermix.
4. Incubate for 5 minutes at room temperature
5. Add the transfection complex to cells and incubate at 37°Ca. Add the transfection complex (from step 4) to your adherent cells at 30–70%confluence according to the following table
Reagent 96-well 24-well 6-well
TrueTag™
+TALEN/transfectionreagent complex
10 µL 50 µL 250 µL
b. Incubate the cells in a humidified 37°C, 5% CO2 incubator for 48–72 hours.
Day 2–4 – verify editing
Verify editing efficiency and proceed to downstream applications1. When the cells have reached 80–100% confluence you are ready to proceed to the
next steps.
The following protocol is provided as a starting point for transfecting wild-type cellswith TrueTag™ Donor and TALEN mRNA pairs using the Neon™ Transfection System.
IMPORTANT! The following recommendations are for a single well in 24-well formatusing the 10 µL Neon™ tip. For multiple wells, prepare a master mix of componentswith extra volume to minimize pipetting errors, and then dispense the appropriatevolumes into each well. Avoid creating bubbles while mixing and dispensing. Fordetails on optimizing the Neon™ electroporation conditions and scaling down/up fordifferent plate formats, refer to the Neon™ Transfection System User Guide (Pub. No.MAN0001557), available for download at thermofisher.com.
Day 0 - seed cells
1–2 days before transfection, transfer your adherent cells to a new flask with freshgrowth medium so that they are 70–90% confluent on the day of transfection.
Transfect cellswith TrueTag™
donor and TALENmRNA pairs usingthe Neon™
transfectionsystem
MethodsTransfection methods
36 TrueTag™ DNA Donor Kit User Guide
![Page 37: TrueTag DNA Donor Kit - Thermo Fisher Scientific · Product information Product description The Invitrogen™ TrueTag™ DNA Donor Kit enables the user to construct and purify a linear](https://reader034.fdocuments.in/reader034/viewer/2022050502/5f94d91f989bc700761fcff0/html5/thumbnails/37.jpg)
Day 1 – transfect cells
1. Prepare 24-well plate with mediaAdd 1000 µL of cell type-specific growth medium into each well of the 24-wellplate and place it in the 37°C incubator to pre-warm.
2. Prepare Tube 1: TrueTag™ donor + TALEN mRNA pair in Resuspension Buffera. Mix the TrueTag™ donor, TALEN mRNA pair and Resuspension Buffer R in
a fresh, RNase-free microcentrifuge tube according to the appropriate tablebelow. Mix well.
Reagent Amount per well of 24-well plate
TrueTag™ donor 500 ng
Left TALEN mRNA 100 ng
Right TALEN mRNA 100 ng
Resuspension Buffer R to 10 µL
3. Prepare Tube 2: Cells in Resuspension Buffer (Buffer R)
Note: Prepare extra amount (2X) of cells needed.
a. If you are using suspension cells, remove an aliquot and determine viablecell count. If you are using adherent cells, detach the cells from the cultureflask using Gibco™ TrypLE™ Dissociation Reagent, resuspend the cells in anappropriate volume of growth medium, then determine viable cell count.
b. Transfer the appropriate amount of cells into a 15-mL centrifuge tube, thenpellet the cells by centrifugation at 100–400 × g for 5 minutes at roomtemperature.
Note: Optimal cell number used for electroporation varies depending onthe cell type. For example, in case of iPSC and THP1, we had best resultswith 80,000 and 200,000 cells per electroporation respectively.
c. Wash the cells with PBS without Ca2+ or Mg2+ using the same volume asoriginal cell volume, then pellet the cells by centrifugation at 100–400 × g for5 minutes at room temperature.
d. Aspirate the PBS and resuspend the cell pellet in Resuspension Buffer R atthe desired concentration. For example, to use 100,000 cells/reaction,resuspend the cells at 2.0 × 107 cells/mL, then use 5 µL of the resuspendedcells per reaction. Gently pipette the cells to obtain a single cell suspension.
4. Add Tube 2 to Tube 1 : Cells to Editing Mixa. Pipette the cells in Resuspension Buffer (from Step 4) up and down to
resuspend any cells that might have settled at the bottom of the tube.
b. Add 5 µL of the cell suspension to Tube 1 from Step 3.
MethodsTransfection methods
TrueTag™ DNA Donor Kit User Guide 37
![Page 38: TrueTag DNA Donor Kit - Thermo Fisher Scientific · Product information Product description The Invitrogen™ TrueTag™ DNA Donor Kit enables the user to construct and purify a linear](https://reader034.fdocuments.in/reader034/viewer/2022050502/5f94d91f989bc700761fcff0/html5/thumbnails/38.jpg)
5. Electroporate using the cell type-specific Neon™ conditiona. Using the 10 µL Neon™ tip, aspirate 10 µL of the cell + Editing Mix in
Resuspension Buffer, then electroporate using your cell type-specific Neon™
condition.
IMPORTANT! Avoid creating bubbles that can hinder electroporation.
b. After electroporation, transfer the contents of the Neon™ tip immediatelyinto one well of the 24-well culture plate containing 1000 µL of pre-warmedgrowth medium (from step 1).
c. Incubate the cells in a humidified 37°C, 5% CO2 incubator for 48–72 hours.
Days 2–4 – verify editing
Verify editing efficiency and proceed to downstream applications1. When the cells have reached 80–100% confluence you are ready to proceed to the
next steps.
The following protocol is provided as a starting point for transfecting cells withTrueTag™ donor and a CRISPR Nuclease Vector using the Lipofectamine™ 3000Transfection Reagent.
Day 0 - seed cells
The day before transfection, seed your adherent cells according to the followingguidelines so that they are 30–70% confluent on the day of transfection.
96-well 24-well 6-well
Cell density per well 8,000–18,000 cells
40,000–90,000 cells
250,000–450,000 cells
Final volume of media per well 100 µL 0.5 mL 2 mL
Day 1 – transfect cells
1. Prepare Tube 1: TrueTag™ Donor + CRISPR plasmid in Opti-MEM™ I Mediuma. CRISPR Nuclease Vector with OFP (Cat. No. A21174) or CD4 (Cat. No.
A21175) is an all-in-one vector that expresses Cas9 nuclease and customgRNA along with an orange fluorescent protein (OFP) or CD4 surfacemarker which can be used for sorting the transfected cell population. Thisvector requires cloning the gRNA sequence into the vector prior to use.Alternatively, other plasmids expressing the Cas9 and gRNA componentsmay be used.
b. The correct dose of Lipofectamine™ 3000 Transfection Reagent variesamongst cell lines, the following protocol tests two common concentrations.For repeat use in the same cell line use whichever works best or furthertitrate the dose.
Transfect cellswith TrueTag™
donor and CRISPRnuclease vectorusingLipofectamine™
3000 TransfectionReagent
MethodsTransfection methods
38 TrueTag™ DNA Donor Kit User Guide
![Page 39: TrueTag DNA Donor Kit - Thermo Fisher Scientific · Product information Product description The Invitrogen™ TrueTag™ DNA Donor Kit enables the user to construct and purify a linear](https://reader034.fdocuments.in/reader034/viewer/2022050502/5f94d91f989bc700761fcff0/html5/thumbnails/39.jpg)
c. Mix the TrueTag™ Donor, CRISPR Nuclease Vector, and Opti-MEM™ IReduced Serum Medium in a fresh, RNAse-free microcentrifuge tubeaccording to the appropriate table below. Mix gently.
Reagent 96-well 24-well 6-well
Opti-MEM™ I Medium 10 µL 50 µL 250 µL
CRISPR Nuclease Vector 100 ng 500 ng 1000 ng
TrueTag™ Donor 100 ng 500 ng 2500 ng
P3000 Reagent (2 µL/µgDNA) 0.4 µL 2 µL 7 µL
2. Prepare Tube 2: Set up 2 Lipofectamine™ 3000 Transfection Reagent dilutions inOpti-MEM™ I Medium, then mix gently.
Reagent 96-well 24-well 6-well
Opti-MEM™ I Medium 5 µL × 2 25 µL × 2 125 µL × 2
Lipofectamine™ 3000Transfection Reagent
0.15 µL and0.3 µL
0.75 µL and1.5 µL
3.75 µL and7.5 µL
3. Mix Tube 1 + Tube 2Add half of Tube 1 (Donor and CRISPR plasmid) to each dilution ofLipofectamine™ 3000 Transfection Reagent (Tube 2) and mix gently by pipetting.
4. Incubate for 10–15 minutes at room temperature
5. Add the transfection complex to cells and incubate at 37°Ca. Add the transfection complex to your adherent cells at 30–70% confluence
according to the following table: (or do you add the whole volume?)
Reagent 96-well 24-well 6-well
Donor +Plasmid/transfectionreagent complex
10 µL 50 µL 250 µL
b. Incubate the cells in a humidified 37°C, 5% CO2 incubator for 48–72 hours.
Day 2–4 – verify editing
Verify editing efficiency and proceed to downstream applications1. When the cells have reached 80–100% confluence you are ready to proceed to the
next steps.
MethodsTransfection methods
TrueTag™ DNA Donor Kit User Guide 39
![Page 40: TrueTag DNA Donor Kit - Thermo Fisher Scientific · Product information Product description The Invitrogen™ TrueTag™ DNA Donor Kit enables the user to construct and purify a linear](https://reader034.fdocuments.in/reader034/viewer/2022050502/5f94d91f989bc700761fcff0/html5/thumbnails/40.jpg)
Verify editing
Once the cell are reaching confluency, usually 2-4 days post transfection, they are beready for screening for the edited population. Alternatively, if you wish to move tohighly enriched populations directly you can begin antibiotic selection. The followingassays can be done before and after selection to monitor the population.
We recommend that a portion of the edited cells be maintained while the various testsare conducted. If more cells are needed for the tests, the cells can be split and grownup for a larger population.
• Visually confirm presence of fluorescent tag (for GFP and RFP) by observationwith a fluorescent microscope with the proper filter set. The appropriateexcitation and emission filters for these proteins can be found in Table 1.
• Flow cytometry can be used to measure population of tagged and untagged cell.a. Flow cytometry generally needs greater than 104 cells for an accurate countb. FACS™ can be used to enrich the GFP+ or RFP+ cell population and generally
needs >106 cells as a starting population.c. For more information on flow cytometry, visit thermofisher.com/attune
• Use TurboLuc™ Luciferase One-Step Glow Assay Kit on a portion of the cells todetermine if luciferase is present.
– Dilute 50X TurboLuc™ One-Step Substrate 1:50 into TurboLuc™ One-StepAssay Buffer and mix well (e.g., for 100 reactions, add 200 µL of 50XTurboLuc™ One-Step Substrate to 10 mL of TurboLuc™ One-Step AssayBuffer). Prepare sufficient reagent to allow for dispensing errors andequipment void volumes. Use a volume of working solution equal to thesample volume present in each well of the test plate (e.g., if the samplevolume is 100 µL, then add 100 µL of working solution).
– Remove the cell culture plates from the incubator and allow the plate(s) toequilibrate to room temperature for 15 minutes. Add an equal volume ofworking solution as the sample volume present in each well of themicroplate. Shake the plate on a plate shaker at medium speed for10 minutes. Finally, read luminescence and compare to untreated cells.
• We recommend confirmation of the correct insertion of the tag cassette. This canbe done by using junction primers on the pooled or clonal populations.
• On pool populations, junction PCR (one primer on the genome and one in thecassette) only can tell you that the junction exists but is not accurate for thepercentages. We recommend junction PCR over amplifying the full tag becausePCR will be biased towards the smallest amplicon and will heavily enrich theshort indel amplicons over the long tag amplicons.
• On clonal populations, both method can work and we recommend doing both.You may be able to determine homozygous from heterozygous populations byusing Copy Number Variation Analysis TaqMan® assays. For more information,visit https://www.thermofisher.com/us/en/home/life-science/pcr/real-time-pcr/real-time-pcr-assays/cnv-analysis-using-taqman.html
For GFP and RFP
For luciferase
Verify correctintegration of tagby junction PCRand sequencing
MethodsVerify editing
40 TrueTag™ DNA Donor Kit User Guide
![Page 41: TrueTag DNA Donor Kit - Thermo Fisher Scientific · Product information Product description The Invitrogen™ TrueTag™ DNA Donor Kit enables the user to construct and purify a linear](https://reader034.fdocuments.in/reader034/viewer/2022050502/5f94d91f989bc700761fcff0/html5/thumbnails/41.jpg)
• The junction PCR amplicon can be TOPO™ cloned and then sequenced to give arepresentation of the accuracy of the junctions. On clonal populations, this canalso be used to confirm the tagging of the individual alleles. For moreinformation, visit https://www.thermofisher.com/us/en/home/life-science/cloning/topo/topo-ta-cloning/topo-ta-for-sequencing.html?SID™=fr-topo-4
Enrich with antibiotic selection
Once the cells have recovered and are reaching confluency, antibiotic selection can beused to further enrich the edited population. With antibiotic selection, a population of>99% positive cells can be obtained and used for downstream applications
1. Split the cells:a. take 1/5 of cells for junction PCR or other assays
b. 1/5 of cells for maintenance (no selection)
c. 1/5 of cells (antibiotic dose 1)
d. 1/5 of cells (dose 2)
e. 1/5 of cells (dose 3).
2. Maintain the no selection cells as normal in case the selection fails.
3. For the antibiotic selection we recommend using the antibiotic dose dilutions at,and 1 dilution above and below the minimum killing dosage as determined bykill curve.
a. Some endogenous promoters are weak and may only produce a low level ofthe antibiotic resistance gene so the lower dosage may still provide adequateselection.
4. Maintain the cells at these 3 doses for 5–10 days is usually sufficient for selectiona. Enrichment can be monitored by microscope with GFP and RFP tags.
5. Once selection is completed, the cells can be assayed again to characterize thepopulation
MethodsEnrich with antibiotic selection
TrueTag™ DNA Donor Kit User Guide 41
![Page 42: TrueTag DNA Donor Kit - Thermo Fisher Scientific · Product information Product description The Invitrogen™ TrueTag™ DNA Donor Kit enables the user to construct and purify a linear](https://reader034.fdocuments.in/reader034/viewer/2022050502/5f94d91f989bc700761fcff0/html5/thumbnails/42.jpg)
Troubleshooting
Observation Possible cause Recommended action
Cells not expressing tag Poor cleavage efficiency. Validate the cleavage efficiency of the gRNA orTALEN mRNA pair with a Genomic CleavageDetection Assay. For successful HDR, westrongly recommend using gRNA or TALENthat cleave >50%.
Use validated gRNA sequences that havedemonstrated high level editing efficiency withup to 90% editing efficiency or greater inseveral cell types.
Poor transfection efficiency. Check if the transfection reagent used wassuitable for the cell line (refer to thetransfection reagent recommendations at thermofisher.com/transfection).
Use validated gRNA sequences that havedemonstrated high level editing efficiency withup to 90% editing efficiency or greater inseveral cell types
Perform a positive control reaction with thehuman ACTB primers and the N-term donortemplate if working in a human cell line.
Donor design out of frame. Check donor oligos to ensure that the readingframe is kept intact for both N-terminal and C-terminal tags. It is also important to insurethat any bases between the cut site and theinsertion site are added back to the forward orreverse primer design, to ensure framecontinuity and produce a scarless insertion.
Target protein not expressed. TrueTag™ fusion tags are expressed off of theendogenous promoter. If the tagged protein isexpressed at low levels, it may be difficult tovisualize the florescent tag, or performantibiotic selection. However, HDR may haveoccurred and can observed via PCR orsequencing.
A
42 TrueTag™ DNA Donor Kit User Guide
![Page 43: TrueTag DNA Donor Kit - Thermo Fisher Scientific · Product information Product description The Invitrogen™ TrueTag™ DNA Donor Kit enables the user to construct and purify a linear](https://reader034.fdocuments.in/reader034/viewer/2022050502/5f94d91f989bc700761fcff0/html5/thumbnails/43.jpg)
Observation Possible cause Recommended action
Low DNA yield Inefficient DNA binding. Verify that a 1:1 volume of Binding Buffer isadded to the reaction mixture.
Ensure the solutions are mixed well.
Check the color of the solution. A yellow colorindicates an optimal pH for DNA binding. If thesolution color is orange or violet, add 10 µL of3 M sodium acetate, pH 5.2 solution and mix.The color of the mix will become yellow.
Inefficient membrane wash. Ensure that the recommended volume ofethanol has been added to the Wash Buffer(concentrated) prior first use.
Inefficient DNA elution. Add Elution Buffer directly to the center of themembrane and not to the side of the GeneJET™
purification column.
Use 20–50 µL of Elution Buffer and ensure thatthe volume completely covers the surface ofthe membrane.
Increase the Elution Buffer volume twice orperform two elution cycles when purifyinglarger amounts of DNA. (e.g., >15 µg).
In step 5 of Protocol A (step 7 of Protocol B),ensure all residual wash buffer is removedfrom the membrane. Longer centrifugationtime (extra minute) can aid in removal of washbuffer.
Poor A260:A230 ratio Inefficient DNA elution. Add Elution Buffer directly to the center of themembrane and not to the side of the GeneJET™
purification column.
A low A260:A230 ratio is a sign of guanidiniumthiocyanate carry over. We have observed thattrace amount of guanidinium thiocyanate donot affect transfection or cell viability, but areobservable via spectrophotometry.
Appendix A TroubleshootingEnrich with antibiotic selection A
TrueTag™ DNA Donor Kit User Guide 43
![Page 44: TrueTag DNA Donor Kit - Thermo Fisher Scientific · Product information Product description The Invitrogen™ TrueTag™ DNA Donor Kit enables the user to construct and purify a linear](https://reader034.fdocuments.in/reader034/viewer/2022050502/5f94d91f989bc700761fcff0/html5/thumbnails/44.jpg)
Additional procedures
Antibiotic toxicity assay (kill curve) with PrestoBlue™ cell viabilityreagent
This assay will determine the level of antibiotic (Puromycin or Blasticidin) that is toxicfor your cell line. You may need to vary the starting cell amounts to avoidovergrowth. For your cell line we recommend you use the starting density usedduring passaging your cell line. This example uses HEK293 cells.
1. Harvest the HEK293 cells by trypsinization
2. Prepare a cell suspension at a concentration of 40,000 cells/mL in GrowthMedium.
3. Plate 100 µL of the cell suspension (∼4000 cells) in three rows (3 × 11 wells) of a96-well Plate. Add 100 µL growth medium to the 12th well (background control).Incubate in a 37°C incubator with a humidified atmosphere of 5% CO2 for 18 to24 hours.
Note: It is important to start with a relatively small number cells because theexperiment requires 7–8 days of continuous cultivation. Using more cells willrequire a replating step.
4. Prepare 1 mL of a 100 µg/mL Blasticidin or Puromycin stock solution in GrowthMedium in a 1.5-mL microcentrifuge tube. This is “Tube 1” of the serial dilution.
5. Prepare 9 additional 1.5-mL microcentrifuge tubes (numbered 2 to 10) containing0.5 mL growth medium.
6. Prepare a 10-point two-fold serial dilution by transferring 0.5 mL of theBlasticidin or Puromycin stock solution from tube 1 to tube 2 (mix by pipetting),followed by transferring 0.5 mL from tube 2 to tube 3 and so on until youreached tube 10. Use a new pipette tip for each dilution.
7. Add 100 µL of each dilution to one column of the 96-well plate containing thecells to get the following series (50, 25, 12.5, 6.3, 3.2, 1.6, 0.8, 0.4, 0.2, 0.1, 0 µg/mL).Add 100 mL of growth medium to column 11 (untreated control) and 12(background control)
8. Incubate the cells for ~72 hours in a 37°C incubator with a humidifiedatmosphere of 5% CO2.
9. After the incubation, remove the medium by aspiration and add 100 µL of freshGrowth Medium.
10. Prepare and add the new serial dilution as described in step 4.
B
44 TrueTag™ DNA Donor Kit User Guide
![Page 45: TrueTag DNA Donor Kit - Thermo Fisher Scientific · Product information Product description The Invitrogen™ TrueTag™ DNA Donor Kit enables the user to construct and purify a linear](https://reader034.fdocuments.in/reader034/viewer/2022050502/5f94d91f989bc700761fcff0/html5/thumbnails/45.jpg)
11. Repeat media exchange cycle (step 8) up to 3 times (for up to 14 days total). Thecells can be tested as early as 3 days post selection, but the curve is more accuratefor slow growing cells at 7–14 days.
12. Prepare PrestoBlue™ reagent by diluting it 1:10 in Growth Medium 1:10 (refer tothe PrestoBlue™ Cell Viability Reagent User Guide (Pub. No. MAN0018370).Prepare enough PrestoBlue™ reagent for 40 wells (33 wells for antibiotic serialdilution and 3 wells for no cell control wells).
13. Remove the medium by aspiration and add 100 mL of PrestoBlue™ reagent
14. Incubate the cells for at least 10 minutes at 37°C. Longer incubation timeincreases the sensitivity of detection.
15. Read the fluorescence or absorbance. Fluorescence is more sensitive thanabsorbance and is the preferred detection method (excitation 540–570 nm,emission 580–610 nm; for more information, refer to the instructions providedwith the PrestoBlue™ Cell Viability Reagent, which are also available at thermofisher.com).
16. Calculate and plot the results (the no-cell control values can be used to determinebackground fluorescence). Higher values correlate with higher metabolic activity.The target dose for selection is the dilution that kills all cells.
HEK293
Antibiotic (μg/mL)
untr
eate
d
No
cells
50 25 12.5
6.3
3.2
1.6
0.8
0.4
0.2
0.1
25000
20000
15000
10000
5000
0
-50000.01 0.1 1 10 100 1000
[Blasticidin], log (μg/mL)
RFU Lethal dose
Blasticidin Toxicity curve
Appendix B Additional proceduresAntibiotic toxicity assay (kill curve) with PrestoBlue™ cell viability reagent B
TrueTag™ DNA Donor Kit User Guide 45
![Page 46: TrueTag DNA Donor Kit - Thermo Fisher Scientific · Product information Product description The Invitrogen™ TrueTag™ DNA Donor Kit enables the user to construct and purify a linear](https://reader034.fdocuments.in/reader034/viewer/2022050502/5f94d91f989bc700761fcff0/html5/thumbnails/46.jpg)
Clonal isolation
• The number of single clones needed to obtain a desired tagged clonal cell line isestimated based on the editing efficiency and estimated cell viability.For example, if you desire a homozygous knock-in (KI) with tags in both copiesof a gene, and 10% of your cells are positive for GFP then the probability ofhaving both alleles knocked out in any cell is 1% (0.1 × 0.1 = 0.01).Some tags will disrupt the natural function of the gene and would be lethal ifhomozygous so you cannot always get biallelic tagging (e.g., ACTB). Of thetagged clones, usually >70% have perfect junctions.
• Perform limiting dilution by targeting 0.8 cells/well, which requires you toresuspend the transfected cells (post-counting) at a density of 8 cells/mL incomplete growth medium, then transferring 100 µL of this to each well of a96-well plate.If you plate at least ten 96-well plates in this manner and expect ~20% of cells tosurvive, the probability of having homozygous KI clones in the 192 survivingcells is ~1–2 cells (192 × 1%).The following formula can be used to determine minimum number of wells.
xMinimum no. wells = CA
B100 x
)( 100D
)(
A = Estimated cell recovery percentage after dilutionB = Minimum number of edited copies of the gene (1, for single copy; 2, for bi-allelic; moreif there are multiple copies of the gene)C = Number of desired successful clonesD = Editing percentageBy doing antibiotic selection you can significantly increase your chances andlower the workload. After selection we usually see >50% tagged and often >90% ifthe selection is stringent. Even at 50% tagged, the probability of biallelic is now25% and of the 192 cells, now ~134 are likely biallelic. In this case, instead ofscreening 10 plates, 1 plate may be sufficient.We recommend using at least five 96-well plates as it is much more time (3–6 weeks) to repeat the clonal dilution if you do not get you clone. If the editingfrequency is high, we may just process one plate initially and freeze the otherplates as backups.
• Single cell clone survivability varies by cell type. Some cells that do not like toremain as single cells need to be plated at a low density to get well separatedcolonies, which then have to be manually picked for further screening.
1. Wash the transfected cells in each well of the 24-well plate with 500 µL of PBS.Carefully aspirate the PBS and discard.
2. Add 500 µL of TrypLE™ cell dissociation reagent to the cells and incubate for 2–5 minutes at 37°C.
3. Add 500 µL of complete growth medium to the cells to neutralize thedissociation reagent. Pipette the cells up and down several times to break up cellaggregates. Make sure the cells are well separated and not clumped together.
4. Centrifuge the cells at 300 × g for 5 minutes to pellet.
Limiting dilutioncloning (LDC)
Example LDCprocedure using293FT cells
Appendix B Additional proceduresClonal isolationB
46 TrueTag™ DNA Donor Kit User Guide
![Page 47: TrueTag DNA Donor Kit - Thermo Fisher Scientific · Product information Product description The Invitrogen™ TrueTag™ DNA Donor Kit enables the user to construct and purify a linear](https://reader034.fdocuments.in/reader034/viewer/2022050502/5f94d91f989bc700761fcff0/html5/thumbnails/47.jpg)
5. Aspirate the supernatant, resuspend the cells in an appropriate volume of pre-warmed (37°C) growth medium, then perform a cell count.
6. After counting, dilute the cells to a density of 8 cells/mL of complete growthmedium. Prepare a total of 50 mL of cell suspension at this cell density andtransfer to a sterile reservoir.
Note: A serial dilution can be performed to get a better estimate of cell density.
7. Using a multichannel pipettor, transfer 100 µL of the cell suspension into eachwell of 96-well tissue culture plates until the desired number of plates is seeded.Make sure to mix the cells in between seeding the plates to avoid the formationof cell aggregates.
Note: In general, we seed ten 96-well plates to achieve a large number of clones.Number of plates to seed depends on the editing efficiency of pooled cellpopulation and viability of cells post single cell isolation.
8. Incubate the plates in a 37°C, 5% CO2 incubator.
9. Scan the plates for single cell colonies as soon as small aggregates of cells arevisible under a 4X microscope (usually after first week, depending on the growthrate of the cell line).
10. Continue incubating the plates for an additional 2–3 weeks to expand the clonalpopulations for further analysis and characterization.
You can sort single cells per well into a 96-well plate format using a flow cytometerwith single cell sorting capability. After sorting and expanding the single cell clones,analyze and characterize the clonal populations using suitable assays. The followingis an example single-cell sorting procedure with 293FT cells.
1. Wash the transfected 293FT cells in each well of the 24-well plate with 500 µL ofPBS. Carefully aspirate the PBS and discard.
2. Add 500 µL of TrypLE™ cell dissociation reagent to the cells and incubate for 2–5 minutes at 37°C.
3. Add 500 µL of complete growth medium to the cells to neutralize thedissociation reagent. Pipette the cells up and down several times to break up cellaggregates. Make sure the cells are well separated and not clumped together.
4. Centrifuge the cells at 300 × g for 5 minutes to pellet.
5. Aspirate the supernatant, then wash the cell pellet once with 500 µL of PBS.
6. Resuspend 1 × 106 cells in 1 mL of FACS™ buffer, then add propidium iodide (PI)to the cells at a final concentration of 1 µg/mL. Keep the resuspended cells on ice.
7. Filter the cells using suitable filters before analyzing them on a flow cytometerwith single cell sorting capability.
8. Sort PI-negative cells into a 96-well plate containing 100 µL of complete growthmedium. If desired, use 1X antibiotics with the complete growth medium.
Example singlecell sortingprocedure in a 96-well plate usingflow cytometer
Appendix B Additional proceduresClonal isolation B
TrueTag™ DNA Donor Kit User Guide 47
![Page 48: TrueTag DNA Donor Kit - Thermo Fisher Scientific · Product information Product description The Invitrogen™ TrueTag™ DNA Donor Kit enables the user to construct and purify a linear](https://reader034.fdocuments.in/reader034/viewer/2022050502/5f94d91f989bc700761fcff0/html5/thumbnails/48.jpg)
9. Incubate the plates in a 37°C, 5% CO2 incubator.
10. Scan the plates for single cell colonies as soon as small cell aggregates are visibleunder a 4X microscope. Colonies should be large enough to see as soon as 7–14 days (usually after first week, depending on the growth rate of the cell line).Perform image analysis to ensure that the colonies are derived from single cells.
11. After image analysis, continue incubating the plates for an additional 2–3 weeksto expand the clonal populations for further analysis and characterization.
Confirmation of Cas9 or TALEN cutting activity by GCD or sequencing
Tagging efficiency is dependent on efficient nuclease cutting of the target site.Generally 10–40% of the cut population is repaired by HDR, dependent on cell line.We recommend screening multiple gRNAs or TALENs that cut near the desired editsite to confirm the cutting efficiency.
• After transfections, use the Genomic Cleavage Detection Kit (Cat. No. A24372) toestimate the CRISPR-Cas9-mediated cleavage efficiency in a pooled cellpopulation.
• You can design and order target-specific primer sets for the GCD assay throughour CRISPR Search and Design tool, available at thermofisher.com/crisprdesign
• To perform the GCD assay for the positive control, you need the primers listed in Table 3. Target specific primer sets needed for the GCD assay can be customordered from https://www.thermofisher.com/order/custom-standard-oligo.
• You can set up the GCD assay in a 96-well plate format and analyze multiplegRNA-treated samples in parallel on a 2% E-Gel™ 48 agarose gel (48-well).
• Pick the clones that show the highest cleavage efficiency to use in yourexperiments. Note that the clone that shows the highest cleavage efficiency maynot always be the clone with the highest expression.
• For more information and detailed protocols, see the Genomic CleavageDetection Kit User Guide (Pub. No. MAN0009849)
• For Sanger sequencing-based editing efficiency analysis, refer to our applicationnote referenced at thermofisher.com/sangercrispr
• If you are experienced in next generation sequencing (NGS) and analysis, you canuse barcoded target-specific amplicon primers and perform multiplex analysisusing several gRNA-treated samples in parallel. Multiplex analysis using NGS isespecially useful when using the custom arrayed plate format for TrueGuide™
Synthetic gRNA transfections. For more information on NGS analysis, refer to IonTorrent™ targeted sequencing solutions at thermofisher.com/ionapliseqsolutions
Removal of antibiotic selection by Cre/Lox
For cells in a 24 well plate, transfect in 500 ng of Cre mRNA (Trilink Cat ##L-7211)following the recommendations for Lipofectamine™ MessengerMAX™ reagent. After3 days, proceed to clonal isolation and screening by sequencing to verify successfulremoval of the selection marker.
Genomic CleavageDetection Kit
Sequence analysis
Appendix B Additional proceduresConfirmation of Cas9 or TALEN cutting activity by GCD or sequencingB
48 TrueTag™ DNA Donor Kit User Guide
![Page 49: TrueTag DNA Donor Kit - Thermo Fisher Scientific · Product information Product description The Invitrogen™ TrueTag™ DNA Donor Kit enables the user to construct and purify a linear](https://reader034.fdocuments.in/reader034/viewer/2022050502/5f94d91f989bc700761fcff0/html5/thumbnails/49.jpg)
Control ACTB donor reaction
For new users to the TrueTag™ system, we recommend performing the reaction withthe control primers, N-terminal human ACTB and N- Puro-GFP/RFP/Luc donortemplate in a human cell line. This design work with a cleavage site between the Gand A of the second codon of ACTB.
ACTB gRNA = 5’ GCGGCGATATCATCATCCA 3’ (TGG=PAM)
Genome 5'
Reverse primer
Count ~35ntupstream of ATG
3' universal seqof N Donor
Count ~35ntdownstream of CUT
35nt 21nt
Forward primer5' 3'
35nt21nt3' 5'
3'
2nd
codon
5' universal seqof N Donor
CC GAT
ATG
GACTB gRNA = GCGGCGATATCATCATCCATGG
For the following primer sequences, bases in bold are the UniF-N and UniR-Nsequences, respectively. The non-bolded bases are the homologous sequences forhuman ACTB. The start codon, which needs to be added back in the forward primerin addition to 35 bases of homology, is underlined.
N-terminal human ACTB donor PCR primers for N-GFP/Puro tag
Forward primer
5’-CFOAGCGCGCCCGGCTATTCTCGCAGCTCACCATGGGAGGTAAGCCCTTGCATTCG-3’
Reverse primer
5’-COETTGTCGACGACGAGCGCGGCGATATCATCATCACCGCTTCCACTACCTGAACC-3’
The following primers can be used to verify successful knocking in of the tag. Thisexample is for the GFP donor.
Table 5 ACTB N-GFP/Puro tag verification junction PCR primers
Primer type Primer name Sequence
Gene specific ACTB-N F1 GACGCCTCCGACCAGTGTTTGCC
Tag specific N-Puro-GFP R2 GGGTAATCGGCGAAGGCAGCGG
Tag specific N-Puro-GFP F2 GTCCGCCCTGAGCAAAGACCCC
Gene specific ACTB N R1 GATGGAGGGGAAGACGGCCCGG
For Lipofectamine™ transfection in 293FT cells, follow the standard protocols
For Neon™ transfection with Cas9 RNPs in 293FT, follow the standard Neon™ RNPprotocol and we recommend using the following setting: 1150 V, 20 ms, 2 pulses.
Appendix B Additional proceduresControl ACTB donor reaction B
TrueTag™ DNA Donor Kit User Guide 49
![Page 50: TrueTag DNA Donor Kit - Thermo Fisher Scientific · Product information Product description The Invitrogen™ TrueTag™ DNA Donor Kit enables the user to construct and purify a linear](https://reader034.fdocuments.in/reader034/viewer/2022050502/5f94d91f989bc700761fcff0/html5/thumbnails/50.jpg)
Transfection tablesC
50 TrueTag™ DNA Donor Kit User Guide
![Page 51: TrueTag DNA Donor Kit - Thermo Fisher Scientific · Product information Product description The Invitrogen™ TrueTag™ DNA Donor Kit enables the user to construct and purify a linear](https://reader034.fdocuments.in/reader034/viewer/2022050502/5f94d91f989bc700761fcff0/html5/thumbnails/51.jpg)
CRISPRMAX™ transfection table
The following cell line-specific conditions are provided as a starting point for transfecting wild-type cells withTrueGuide™ Synthetic gRNA and TrueCut™ Cas9 Protein v2 using the Lipofectamine™ CRISPRMAX™ TransfectionReagent. Further optimization of the transfection conditions may be necessary for best results.
Celltype Media
Cell seeding density/well (×103) one day before
transfection
TrueCut™ Cas9 Protein v2/gRNA(ng/pmoles)
Lipofectamine™ Cas9 Plus™
Reagent/well (μL)
Lipofectamine™
CRISPRMAX™ Reagent/well(μL)
Wellformat — 96-well 24-well 6-well 96-well 24-well 6-well 96-well 24-well 6-well 96-well 24-well 6-well
HEK293 DMEM 18 90 450 250/1.5 1250/7.5 6250/37.5 0.5 2.5 12.5 0.4 2 10
U2OS McCoy5A 10 50 250 250/1.5 1250/7.5 6250/37.5 0.5 2.5 12.5 0.3 1.5 7.5
A549 DMEM 10 50 250 250/1.5 1250/7.5 6250/37.5 0.5 2.5 12.5 0.3 1.5 7.5
THP1 RPMI 10 50 250 400/2.4 2000/12 10000/60 0.8 4 20 0.3 1.5 7.5
K562 [1] RPMI 10 50 250 250/1.5 1250/7.5 6250/37.5 0.5 2.5 12.5 0.3 1.5 7.5
iPSC [1] Essential 8™
Medium 8 40 200 300/2 1500/10 7500/50 0.6 3 15 0.3 1.5 7.5
HepG2 DMEM 10 50 250 250/1.5 1250/7.5 6250/37.5 0.5 2.5 12.5 0.3 1.5 7.5
MDA-MB231 DMEM 10 50 250 250/1.5 1250/7.5 6250/37.5 0.5 2.5 12.5 0.3 1.5 7.5
N2A DMEM 10 50 250 250/1.5 1250/7.5 6250/37.5 0.5 2.5 12.5 0.3 1.5 7.5
[1] Use the Neon™ Transfection System for higher editing efficiency.
Appendix C
Transfection tablesCR
ISPRM
AX™ transfection table
C
TrueTag™ D
NA D
onor Kit U
ser Guide
51
![Page 52: TrueTag DNA Donor Kit - Thermo Fisher Scientific · Product information Product description The Invitrogen™ TrueTag™ DNA Donor Kit enables the user to construct and purify a linear](https://reader034.fdocuments.in/reader034/viewer/2022050502/5f94d91f989bc700761fcff0/html5/thumbnails/52.jpg)
Neon™ transfection table
We recommend optimisation of the Neon™ protocol to find the best conditions for delivering your donor. We usuallyobserve that the higher voltage conditions work better for delivery of the donor but have lower viability.
Cell type Media Number of cells/10-μL reaction(× 103)
TrueCut™ Cas9 Protein v2/gRNA(ng/pmoles)
Neon™ electroporationconditions [1]
Well format — 24-well
HEK293 DMEM 150 1250/7.5 1150 V/20 ms/2 pulses
U2OS McCoy5A 150 1250/7.5 1400 V/15 ms/4 pulses
A549 DMEM 120 1250/7.5 1200 V/20 ms/4 pulses
THP1 RPMI 200 2000/12 1700 V/20 ms/1 pulse (#5)
K562 RPMI 200 1250/7.5 1700 V/20 ms/1 pulse (#5)
iPSC Essential 8™ Medium 80 1500/10 1200 V/20 ms/2 pulses (#14)
iPSC StemFlex™ Medium 80 1500/10 1200 V/30 ms/1 pulse (#7)
Human primary T cell OpTmizer™ + 2%human serum 200 1250/7.5 1600 V/10 ms/3 pulses (#24)
Jurkat T cell RPMI 200 1250/7.5 1700 V/20 ms/1 pulse (#5)
HepG2 DMEM 120 1250/7.5 1300 V/30 ms/1 pulse (#8)
N2A DMEM 100 1250/7.5 1400 V/30 ms/1 pulse (#9)
[1] Recommendations for the Neon™ electroporation settings are based on the culture conditions tested.
Appendix C
Transfection tablesN
eon™ transfection table
C52TrueTag
™ DN
A Donor K
it User G
uide
![Page 53: TrueTag DNA Donor Kit - Thermo Fisher Scientific · Product information Product description The Invitrogen™ TrueTag™ DNA Donor Kit enables the user to construct and purify a linear](https://reader034.fdocuments.in/reader034/viewer/2022050502/5f94d91f989bc700761fcff0/html5/thumbnails/53.jpg)
Safety
WARNING! GENERAL SAFETY. Using this product in a manner not specifiedin the user documentation may result in personal injury or damage to theinstrument or device. Ensure that anyone using this product has receivedinstructions in general safety practices for laboratories and the safetyinformation provided in this document.
· Before using an instrument or device, read and understand the safetyinformation provided in the user documentation provided by themanufacturer of the instrument or device.
· Before handling chemicals, read and understand all applicable Safety DataSheets (SDSs) and use appropriate personal protective equipment (gloves,gowns, eye protection, and so on). To obtain SDSs, see the “Documentationand Support” section in this document.
D
TrueTag™ DNA Donor Kit User Guide 53
![Page 54: TrueTag DNA Donor Kit - Thermo Fisher Scientific · Product information Product description The Invitrogen™ TrueTag™ DNA Donor Kit enables the user to construct and purify a linear](https://reader034.fdocuments.in/reader034/viewer/2022050502/5f94d91f989bc700761fcff0/html5/thumbnails/54.jpg)
Chemical safety
WARNING! GENERAL CHEMICAL HANDLING. To minimize hazards,ensure laboratory personnel read and practice the general safety guidelines forchemical usage, storage, and waste provided below. Consult the relevant SDSfor specific precautions and instructions:
· Read and understand the Safety Data Sheets (SDSs) provided by thechemical manufacturer before you store, handle, or work with any chemicalsor hazardous materials. To obtain SDSs, see the "Documentation andSupport" section in this document.
· Minimize contact with chemicals. Wear appropriate personal protectiveequipment when handling chemicals (for example, safety glasses, gloves, orprotective clothing).
· Minimize the inhalation of chemicals. Do not leave chemical containers open.Use only with sufficient ventilation (for example, fume hood).
· Check regularly for chemical leaks or spills. If a leak or spill occurs, followthe manufacturer cleanup procedures as recommended in the SDS.
· Handle chemical wastes in a fume hood.· Ensure use of primary and secondary waste containers. (A primary waste
container holds the immediate waste. A secondary container contains spillsor leaks from the primary container. Both containers must be compatiblewith the waste material and meet federal, state, and local requirements forcontainer storage.)
· After emptying a waste container, seal it with the cap provided.· Characterize (by analysis if needed) the waste generated by the particular
applications, reagents, and substrates used in your laboratory.· Ensure that the waste is stored, transferred, transported, and disposed of
according to all local, state/provincial, and/or national regulations.· IMPORTANT! Radioactive or biohazardous materials may require special
handling, and disposal limitations may apply.
WARNING! HAZARDOUS WASTE (from instruments). Waste produced bythe instrument is potentially hazardous. Follow the guidelines noted in thepreceding General Chemical Handling warning.
WARNING! 4L Reagent and Waste Bottle Safety. Four-liter reagent and wastebottles can crack and leak. Each 4-liter bottle should be secured in a low-densitypolyethylene safety container with the cover fastened and the handles locked inthe upright position.
Appendix D SafetyChemical safetyD
54 TrueTag™ DNA Donor Kit User Guide
![Page 55: TrueTag DNA Donor Kit - Thermo Fisher Scientific · Product information Product description The Invitrogen™ TrueTag™ DNA Donor Kit enables the user to construct and purify a linear](https://reader034.fdocuments.in/reader034/viewer/2022050502/5f94d91f989bc700761fcff0/html5/thumbnails/55.jpg)
Biological hazard safety
WARNING! Potential Biohazard. Depending on the samples used on thisinstrument, the surface may be considered a biohazard. Use appropriatedecontamination methods when working with biohazards.
WARNING! BIOHAZARD. Biological samples such as tissues, body fluids,infectious agents, and blood of humans and other animals have the potential totransmit infectious diseases. Conduct all work in properly equipped facilitieswith the appropriate safety equipment (for example, physical containmentdevices). Safety equipment can also include items for personal protection, suchas gloves, coats, gowns, shoe covers, boots, respirators, face shields, safetyglasses, or goggles. Individuals should be trained according to applicableregulatory and company/ institution requirements before working withpotentially biohazardous materials. Follow all applicable local, state/provincial,and/or national regulations. The following references provide generalguidelines when handling biological samples in laboratory environment.
· U.S. Department of Health and Human Services, Biosafety in Microbiologicaland Biomedical Laboratories (BMBL), 5th Edition, HHS Publication No. (CDC)21-1112, Revised December 2009; found at:https://www.cdc.gov/labs/pdf/CDC-BiosafetymicrobiologicalBiomedicalLaboratories-2009-P.pdf
· World Health Organization, Laboratory Biosafety Manual, 3rd Edition,WHO/CDS/CSR/LYO/2004.11; found at:www.who.int/csr/resources/publications/biosafety/Biosafety7.pdf
Appendix D SafetyBiological hazard safety D
TrueTag™ DNA Donor Kit User Guide 55
![Page 56: TrueTag DNA Donor Kit - Thermo Fisher Scientific · Product information Product description The Invitrogen™ TrueTag™ DNA Donor Kit enables the user to construct and purify a linear](https://reader034.fdocuments.in/reader034/viewer/2022050502/5f94d91f989bc700761fcff0/html5/thumbnails/56.jpg)
Documentation and support
Customer and technical support
Visit thermofisher.com/support for the latest service and support information.• Worldwide contact telephone numbers• Product support information
– Product FAQs– Software, patches, and updates– Training for many applications and instruments
• Order and web support• Product documentation
– User guides, manuals, and protocols– Certificates of Analysis– Safety Data Sheets (SDSs; also known as MSDSs)
Note: For SDSs for reagents and chemicals from other manufacturers,contact the manufacturer.
Limited product warranty
Life Technologies Corporation and/or its affiliate(s) warrant their products as set forthin the Life Technologies' General Terms and Conditions of Sale at www.thermofisher.com/us/en/home/global/terms-and-conditions.html. If you haveany questions, please contact Life Technologies at www.thermofisher.com/support.
E
56 TrueTag™ DNA Donor Kit User Guide
![Page 57: TrueTag DNA Donor Kit - Thermo Fisher Scientific · Product information Product description The Invitrogen™ TrueTag™ DNA Donor Kit enables the user to construct and purify a linear](https://reader034.fdocuments.in/reader034/viewer/2022050502/5f94d91f989bc700761fcff0/html5/thumbnails/57.jpg)
![Page 58: TrueTag DNA Donor Kit - Thermo Fisher Scientific · Product information Product description The Invitrogen™ TrueTag™ DNA Donor Kit enables the user to construct and purify a linear](https://reader034.fdocuments.in/reader034/viewer/2022050502/5f94d91f989bc700761fcff0/html5/thumbnails/58.jpg)
thermofisher.com/support | thermofisher.com/askaquestion
thermofisher.com
17 April 2019