Translesion Polymerase h Is Upregulated by Cancer ...Translesion Polymerase h Is Upregulated by...

Therapeutics, Targets, and Chemical Biology

Translesion Polymerase h Is Upregulated by CancerTherapeutics and Confers Anticancer Drug Resistance

Maja T. Tomicic, Dorthe Aasland, Steffen C. Naumann, Ruth Meise, Christina Barckhausen,Bernd Kaina, and Markus Christmann

AbstractDNA repair processes are a key determinant of the sensitivity of cancer cells to DNA-damaging chemother-

apeutics, which may induce certain repair genes as a mechanism to promote resistance. Here, we report theresults of a screen for repair genes induced in cancer cells treated with DNA crosslinking agents, which identifiedthe translesion polymerase h (PolH) as a p53-regulated target acting as one defense against interstrand crosslink(ICL)-inducing agents. PolH was induced by fotemustine, mafosfamide, and lomustine in breast cancer, glioma,andmelanoma cells in vitro and in vivo, with similar inductions observed in normal cells such as lymphocytes anddiploidfibroblasts. PolH contributions to the protection against ICL-inducing agentswere evaluated by its siRNA-mediated attenuation in cells, which elevated sensitivity to these drugs in all tumor cell models. Conversely, PolHoverexpression protected cancer cells against these drugs. PolH attenuation reduced repair of ICL lesions asmeasured by host cell reactivation assays and enhanced persistence of gH2AX foci. Moreover, we observed astrong accumulation of PolH in the nucleus of drug-treated cells along with direct binding to damaged DNA.Taken together, our findings implicated PolH in ICL repair as a mechanism of cancer drug resistance and normaltissue protection. Cancer Res; 74(19); 5585–96. �2014 AACR.

IntroductionBecause of the high toxicity in replicating cells, genotoxic

agents are being used as anticancer drugs. Most importantare drugs that induce DNA interstrand crosslinks (ICL),which are potent killing lesions (1). The ICL-inducing drugsinclude derivatives of nitrogen mustards and chloroethylnitrosoureas. One of the most often used nitrogen mustardis cyclophosphamide, whose active metabolite alkylates theN7 position of guanine yielding cytotoxic ICL (2). Chlor-oethyl nitrosoureas used in cancer therapy are carmustine(BCNU), lomustine (CCNU), nimustine (ACNU), and fote-mustine (Muphoran). Upon formation of a nucleophilicchloroethylenium ion, the O6-position of guanine becomesalkylated, leading to the formation of O6-chloroethylguanine(O6-ClG; ref. 3). O6-ClG can be repaired by the DNA repairprotein O6-methylguanine-DNA methyltransferase (MGMT;ref. 4). If not repaired, O6ClG undergoes intramolecularrearrangement to form N1-O6-ethenoguanine and finallyN1-guanine-N3-cytosine ICLs (5, 6). O6-chloroethylating

agents are being used for the treatment of glioblastoma,astrocytoma, and, albeit to a lesser extent, malignant mel-anoma, gastrointestinal, and pancreatic cancer, Hodgkinand non-Hodgkin lymphoma (7). Fotemustine is approvedfor the treatment of metastasizing melanoma and showsimproved response rates and an increased survival overdacarbazine in the treatment of disseminated cutaneousmelanoma (8). Also, it showed promising results in com-bination with ipilimumab (9), bevacizumab (10), and temo-zolomide (11).

Tumor cells are able of counteracting the killing effects ofthese anticancer drugs, using various strategies including DNArepair (12, 13). Activation of DNA repair by anticancer drugsoccurs on various levels, which includes the transcriptionalactivation of repair genes (14). An important factor involved intranscriptional regulation of DNA repair genes is p53, whichbecomes activated via the ATM/ATR pathway by DNA-dam-aging agents and ionizing radiation that cause DNA replicationarrest and DNA double-strand breaks (DSB; for review, seeref. 15). As a consequence, the cellular amount of p53, itsnuclear translocation, and its DNA-binding activity areenhanced and target genes become transcriptionally activated(16). Activation of p53 results in cell-cycle arrest, which occurseither in the G1 or G2–M phase (17) and upregulation of repairgenes (14), thereby causing resistance to anticancer drugs.

In glioblastoma cells, p53 mediates resistance against thetopoisomerase I inhibitors, topotecan and irinotecan (18–21)and the chloroethylating agent ACNU (22). In case of ACNU, theprotective effect was shown to be the result of p53-driveninduction of the nucleotide excision repair genes xpc and ddb2(22). Protection by p53 against chloroethylating agents was

Department of Toxicology, University Medical Center Mainz, Mainz,Germany.

Note: Supplementary data for this article are available at Cancer ResearchOnline (http://cancerres.aacrjournals.org/).

Corresponding Author: Markus Christmann, Department of Toxicology,University Medical Center Mainz, Obere Zahlbacher Str. 67, D-55131Mainz, Germany. Phone: 0049-6131-179066; Fax: 0049-6131-178499;E-mail: [email protected]

doi: 10.1158/0008-5472.CAN-14-0953

�2014 American Association for Cancer Research.

CancerResearch

www.aacrjournals.org 5585

on May 11, 2020. © 2014 American Association for Cancer Research. cancerres.aacrjournals.org Downloaded from

Published OnlineFirst August 14, 2014; DOI: 10.1158/0008-5472.CAN-14-0953

http://cancerres.aacrjournals.org/

also observed inmelanoma cells, where it was shown to triggerresistance against the anticancer drug fotemustine (23). Incontrast, p53 sensitizes melanoma cells to cisplatin by activa-tion of apoptosis (24).

To identify p53 target genes involved in DNA repair thatcontribute to protection ofmelanoma cells against chloroethy-lating agents, qRT-PCR arrays were performed, analyzing theexpression of all known DNA repair genes upon fotemustinetreatment of D05melanoma cells wild-type for p53. Besides thewell-characterized p53 targets ddb2 and xpc (25), a strong androbust induction of the translesion polymerase h (PolH) wasobserved. PolHplays an important role in tolerating replicationblockingDNA lesions by translesion synthesis (TLS; ref. 26) andis also involved in the replication at fragile sites in the absenceof exogenous stress (27, 28). Here, we show induction of PolHfollowing treatment with ICL-inducing drugs, which occurs inp53wt but not p53-mutated tumor cells. It was also observed innontransformed cells and in a mouse xenograft model in vivo.Furthermore, we show the induction contributes to resistanceagainst all tested ICL drugs: fotemustine, lomustine (CCNU),and the cyclophosphamide analogon mafosfamide. The pro-tective effect results from involvement of PolH in the repair ofDNA damage induced by these drugs. The data provide anexample of acquired drug resistance by upregulation of a TLSpolymerase. As upregulation of PolH was found in normal andcancer cells, the data have implications both for cancer cellresistance and protection of the normal tissue.

Materials and MethodsCell lines and anticancer drug treatment

The cell lines used (A375, D03, D05, MCF7, TK6, U87, LN229,U138, T98G, LN18, LN308, LN319, VH10tert) were describedpreviously (23, 25, 29, 30) and grown in RPMI orDMEMmediumcontaining 10% FBS, in 7% CO2 at 37�C. Fresh blood wasobtained from healthy donors obtained from the blood bank ofthe UniversityMedical CenterMainz (Mainz, Germany). Periph-eral blood lymphocytes (PBLC) were isolated using densitycentrifugation and Lymphoprep (PROGEN Biotechnik GmbH)as described (29). For growth stimulation, lymphocytes wereincubated for 24 hours in 24-well tissue culture plates containingplastic-bound anti-CD3 (BD PharMingen) plus anti-CD28 anti-bodies (BD PharMingen). If not differentially stated, cells werepre-exposed to 10 mmol/L O6-benzylguanine (O6BG) and onehour later exposed to fotemustine (diethyl1-[3-(2–chloroethyl)-3-nitrosoureido]ethylphosphate; Muphoran, Servier ResearchInternational), CCNU (Sigma Aldrich), or mafosfamide (ASTAMedica). The drugs remained in the medium until cell harvest.

Xenograft experimentsA375 cells (8 � 106) were injected in the left and the right

flank of immunodeficient mice (NOD.CB17-Prkdcscid/J).When tumors reached a suitable size, all animals wereinjected with O6BG (30 mg/kg i.p., dissolved in 1/3 PEG400 and 2/3 PBS). Two hours later, vehicle or fotemustine(70 mg/kg i.p., dissolved in 1/4 ethanol and 3/4 PBS) wasadministered. Forty hours later, the mice were sacrificed andtumors were isolated, immediately frozen in liquid nitrogen,and stored at �80�C. For expression analysis, the tissue was

disintegrated using a tissue lyser (Retsch) and RNA or proteinwas isolated as stated below.

Preparation of cell extracts and Western blot analysisWhole-cell extracts and nuclear cell extracts were prepared

as described (31). Antibodies used were: anti-PolH (ab17725,Abcam), anti-p53 (sc100, Santa Cruz Biotechnology), anti-phospho-p53Ser15 (9284, Cell Signaling Technology), anti-b-Actin (sc-47778, Santa Cruz Biotechnology), and anti-ERK2(sc-154, Santa Cruz Biotechnology).

Preparation of RNA, end point PCR, and qRT-PCRTotal RNA was isolated using the RNA II Isolation Kit

(Machery andNagel) and cDNA synthesis was performed usingthe Verso cDNA Kit (Thermo Scientific). Endpoint PCR wasperformed using Red-Taq Ready Mix (Sigma-Aldrich) andquantitative real-time PCR (qRT-PCR) using the SensiMixSYBR Green & Fluorescein Kit (Bioline). The specific primersare depicted in Supplementary Table S1.

Chromatin immunoprecipitation assayChromatin immunoprecipitation (ChIP) was performed as

described (32). PCR was performed using specific primersflanking the p53-binding site of polH [hPolH-CHIP-up:GAGCTCGAGAAATCAAGGCT, hPolH-CHIP low: AAATCTG-GAACCATCACGCT; (33) and as negative control, b-actin–specific primers (hActin-up: TCCGCTGCCCTGAGGCACTC,hActin-low: GAGCCGCCGATCCACACGGA].

Overexpression and knockdown of PolHFor transient transfection, 1 � 106 cells were seeded

per 10-cm dish. One day later, cells were transfected with2 mg of pcDNA3.1 or pcDNA3.1-polH vector, by use ofEffectene reagent (Qiagen). Knockdown of PolH was per-formed using the siRNA from Santa Cruz Biotechnology (sc-36289) and the Lipofectamine RNAiMAX Transfection Kit(Invitrogen).

Determination of apoptosisFor monitoring drug-induced apoptosis, ethanol-fixed cells

were stained with propidium iodide as described (34). The sub-G1 fraction was determined by flow cytometry. Experimentswere repeated at least three times, mean values � SD areshown, and data were statistically analyzed using Student ttest.

ImmunofluorescenceCells were seeded on coverslips. Following genotoxin

exposure, cells were washed with PBS and fixed with 4%paraformaldehyde. After washing with PBS/0.2% Tween, asecond fixation step was performed using 100% methanol,followed by additional washing steps with PBS/0.2% Tween.The antibodies used were anti-PolH (Abcam, ab 17725), anti-gH2AX (#05-164, Upstate), and as secondary antibody AlexaFluor 488 F(ab0) fragment of goat anti-rabbit IgG (Invitrogen,A11070). Nuclear staining was performed using TO-PRO3iodide (Invitrogen). Slides were mounted in Vectashieldmedium (Vector Laboratories Inc.) and analyzed using a

Tomicic et al.

Cancer Res; 74(19) October 1, 2014 Cancer Research5586




confocal laser scanning microscope (LSM 710, Zeiss) or theMetafer Scanning System (Metasystems). For removingnon–DNA-bound PolH, cells were washed with cold PBSand then treated with 0.1% NP40 in PBS for 40 seconds onice. After a quick PBS washing step, the cells were fixed andtreated as described above. For EdU (5-ethynyl-20-deoxyur-idine) costaining, cells were washed with PBS and thentreated with 10 mmol/L EdU (Click it EdU Imaging Kit,C10338 Alexa Fluor 555, Invitrogen) for 1 hour. After a quickPBS washing step, the cells were fixed as described above.Before the nuclear staining, the "Click it" reaction wasperformed as proposed in the manufacturers' instructions.

MTT assayThe metabolic activity of fotemustine-treated cells in com-

parison with untreated cells was determined by MTT assay.Seventy-two hours after exposure to the given anticancer drug,themediumwas removed and 50mLMTT solution (5mg/mL inPBS) and 100mLnoncoloredDMEMmediumwere added. After3 to 4 hours of incubation, themediumwas aspirated. The cellswere lysed and the blue redox product was dissolved by adding100 mL 0.04 mol/L HCl in isopropanol. The absorption at 570nm was determined; the 650 nm background absorption wassubtracted.

Host cell reactivation assayTo induce DNA damage, the firefly luciferase expression

vector pGL2-con (Promega) was ex vivo exposed to differentdoses of fotemustine in Tris-EDTA buffer at room temperaturefor 12 hours. Thereafter, the plasmid was purified by phenol/chloroform extraction. Two-hundred nanograms of plasmids(180 ng ofmodifiedpGL2-con and 20ng of theRenilla luciferaseexpression vector pRLEF-1a) were used for transfection (Effec-tene Transfection Kit, Qiagen). Twenty-four hours after DNAtransfection, the luciferase activities were measured usingDual-Glo luciferase assay. Reactivation of the pGL2-con plas-midwasmeasured as activity of thefirefly luciferase. Activity ofthe Renilla luciferase expressed by the cotransfected plasmidpRLEF-1a was used as control for transfection efficiency andsubtracted.

BrdUrd incorporationCells were cultured in RPMI (10% FBS) and after exposure to

fotemustine, bromodeoxyuridine (BrdUrd; 10 mmol/L) wasadded to the medium. One-hour later, the incorporation wasanalyzed by the BrdU Incorporation Kit (Roche Diagnostics).Experiments were repeated at least three times, mean values�SD are shown, and data were statistically analyzed usingStudent t test.

ICL repair measured by single-cell gel electrophoresisFor themodified comet assay (35), cells were treated with 10

mg/mL fotemustine and, after the indicated time periods,trypsinized and washed with ice-cold PBS. Thereafter, cellswere irradiated by 8 Gy. Alkaline cell lysis and electrophoresiswas performed as described (36). The results are expressed asrelative tail moment (%) ¼ fluorescence intensity tail (%) �distance head center to tail end.

ResultsExpression of PolH upon fotemustine exposure

In melanoma cells, toxicity induced by chloroethylatinganticancer drugs like fotemustine depends on the p53 andMGMT status (23, 37). The melanoma cell line D05 is p53 wild-type (wt) and expresses MGMT, whereas the melanoma cellline D03 is deficient for both proteins (23). Therefore, D05 cellsare highly resistant against fotemustine as compared with themelanoma cell line D03. Treatment with the p53 inhibitorpifithrin a (Ptha) or the MGMT inhibitor O6-benzylguanine(O6-BG) enhanced the cytotoxic potential of fotemustine inD05 cells (Fig. 1A). Combined treatment with the inhibitorsfurther sensitized D05 cells to fotemustine nearly to the levelobserved in D03 cells (Fig. 1A). Similar results were observedusing siRNA (data not shown). To further investigate themolecular mechanism underlying the protective effect ofp53 on D05 cells upon treatment with fotemustine, MGMTwas inhibited by O6-BG in all experiments to avoid repair offotemustine-induced O6-ClG adducts.

To identify DNA repair genes that contribute to p53-medi-ated protection against chloroethylating agents, qRT-PCRarrays were conducted, analyzing the expression of 180 DNArepair and DNA repair–associated genes. In this screening, weobserved the induction of the PolH in the p53wtmelanoma cellline D05 after fotemustine treatment (data not shown). Toverify the induction of PolH upon fotemustine, the time-dependent expression of polH mRNA was examined by endpoint PCR (Fig. 1B) and qRT-PCR (Fig. 1C). An enhancedexpression of polH mRNA was detectable 8 hours after treat-ment and was constantly increasing during the 24-hour post-incubation period. Induction of polHmRNA was accompaniedby an increase in the level of PolH protein (Fig. 1D). Theincreased expression of PolH was observed between 16 and32 hours after exposure and was preceded by nuclear accu-mulation of p53 (Fig. 1D). To clarify whether the induction ofpolH mRNA and protein is the result of promoter activation,cells were treated with the transcription-blocking agent acti-nomycin D (ActD). Treatment with the inhibitor only slightlyreduced the basal level of polH mRNA, but completely pre-vented the increase of polHmRNA upon fotemustine, suggest-ing the induction of polH mRNA to be dependent on RNA denovo synthesis (Fig. 1E).

Impact of p53 and replication arrest on fotemustine-induced PolH induction

Upregulation of polH was previously reported for humanfibroblasts upon treatment with ionizing radiation, with p53being involved (33). Therefore, we analyzed the fotemustine-mediated induction of polH in melanoma cell lines proficientand deficient for p53 (Supplementary Fig. S1A). Induction ofpolHmRNAwas only observed in p53-proficientmelanoma celllines (Supplementary Fig. S1B). We also observed induction ofthe canonical p53 targets p21, gadd45a, and fasR, substanti-ating the p53 wt status of the melanoma lines (SupplementaryFig. S1B). To further investigate the impact of p53 on polHinduction, p53was inhibited by Ptha, which has been shown toinhibit p53-dependent gene transcription (38). Pretreatment ofD05 cells with 10 mg/mL Ptha completely abrogated the

Involvement of Polymerase h in Anticancer Drug Resistance

www.aacrjournals.org Cancer Res; 74(19) October 1, 2014 5587




induction of PolH upon fotemustine exposure, both on mRNA(Fig. 2A) and on protein level (Fig. 2B), supporting the notionthat PolH is transcriptionally regulated by p53. Finally, ChIPexperiments showed in vivo binding of p53 protein to the p53-binding site of the polH promoter in D05 cells exposed tofotemustine (Fig. 2C).

An intriguing question is whether induction of PolH istriggered by fotemustine-induced ICL, by the formation ofDNA repair intermediates like DSBs, or DNA replication arrest.To clarify this, the activation of p53 was analyzed via immu-nodetection of p53Ser15 (Fig. 2D), the induction of PolH by qRT-PCR (Fig. 2E), replication blockage by BrdUrd assay (Fig. 2F)and the formation of DSBs via gH2AX foci (Fig. 2G). To inhibitreplication, we used hydroxyurea (HU), a typical DNA repli-cation blocking agent. Upon exposure of D05 cells to fotemus-tine or HU, activation of p53 and induction of polH mRNA wasobserved. At early time points, p53 activation and polH induc-tion was more pronounced in the HU-exposed cells, reachingits maximum already 2 hours after treatment (Fig. 2D and E).Upon fotemustine, p53 activation and polH induction wasobserved starting 8 hours postexposure. Measurement of cellproliferation showed a strong replication arrest between 2 and16 hours after HU exposure, whereas upon fotemustine expo-sure, replication decreased at late times, i.e., between 12 and 16hours (Fig. 2F). Concomitant with the activation of p53,

formation of DSBs was detected following fotemustine treat-ment (Fig. 2G and Supplementary Fig. S1D and S1E). Upon HUexposure, no DSBs were observed 2 to 8 hours after treatmentalthough a strong pan-staining of gH2AX was detected (datanot shown), indicating the replication arrest triggered activa-tion of the DNA damage response (DDR) and, concomitantly,induced polH. However, following fotemustine, which onlymodestly induced replication arrest in the dose range used,the formation of DSBs seems to play a predominant role inactivating the DDR and thereby the induction of polH. Asneither p53 activation nor polH induction was observed atearly time points following fotemustine, we conclude that themonoadducts formed by the agent do not activate theDDRanddo not induce polH.

Induction of PolH in tumor cells, melanoma xenografts,and nontransformed cells

To analyze whether the induction of PolH is restricted tomelanoma cells or is a common response of tumor cells tocrosslinking anticancer drugs, different cell systems wereanalyzed concerning the inducibility of PolH. In U87 gliomacells, a time-dependent induction of polHmRNA (Fig. 3A andB)and PolH protein (Fig. 3C) was observed following treatmentwith CCNU (used for glioma therapy). Similar to melanomacells, the induction of PolH was abrogated when cells were

4 8 16 24 Time (h)Con

polH

gapdh

8 16 8 16 Time (h)Con

polH

gapdh

8 16

ActD FM ActD + FM

PolH

Con 8 16 24 32 Time (h)

b-Actin

p53

b-Actin

Ind

uct

ion

(x-

fold

)

Time (h)

B

C

D

E

Cel

l via

bili

ty (

%)

FM (mg/mL)

0

20

40

60

80

100

120

50251052Con

D05 D05+Ptha D05+O6BG D05+O6BG+PTHa D03A

0

1

2

3

4

5

0 4 8 16 24

Figure 1. Fotemustine-triggeredinduction of PolH in melanomacells. A, sensitivity of D05 cells tofotemustine (FM) was analyzed byMTT assay upon inhibition ofMGMT by O6-BG, inhibition of p53by Ptha, or combined inhibition ofMGMT and p53. MGMT andp53-deficient D03 cells wereincluded for comparison. B and C,D05 cells were exposed to 10mg/mL fotemustine for differenttimes. B, end point PCR wasperformed using polH or, asloading control, gapdh-specificprimers. C, qRT-PCR wasperformed and the expression ofpolHwas normalized to gapdh andb-actin; the untreated control wasset to one. Data are the mean ofthree independent experiments�SD. D, D05 cells were exposed to10 mg/mL fotemustine. Expressionof PolH and p53 protein wasanalyzed by specific antibodies inwhole-cell and nuclear extracts,respectively. b-Actin was used asloading control. E, D05 cells wereexposed to 10 mg/mL fotemustinein the presence or absence of1 mmol/L actinomycin D (ActD) andexpression of polH mRNA wasanalyzed by end point PCR.

Tomicic et al.





pretreated with Ptha (Fig. 3D). To further analyze the p53dependency of polH induction in glioma cells, we used a panelof glioma cell lines well characterized to the p53 status (30). Byusing these lines, induction of polHmRNAwas only observed inthe p53-proficient glioma cell line LN229, but not the p53-deficient (LN308) or p53-mutated (T98G, LN18, LN319, U138)cells (Fig. 3E), indicating that p53 mutations impairing p53activity prevent polH upregulation following ICL drugtreatment.

Induction of polHmRNA was also observed in breast cancercells (MCF7) and lymphoblastoid cells (TK6) upon treatmentwithmafosfamide (Fig. 3F). As fotemustine, CCNU, andMAFallinduce ICLs, the data support the view that induction of PolH isa common response to ICL-inducing anticancer drugs.

To study whether PolH becomes upregulated in cells grownin a host in vivo, A375 melanoma cells wt for p53 were injectedinto immunodeficientmice. Upon tumor formation, mice wereeither mock-treated or treated with fotemustine (70 mg/kg,

8 16 24 Time (h)0

PolH

4 8 16 240Time (h)

polH

gapdh

FM - Ptha

8 16 240

FM + Ptha FM - Ptha

A

C

polH promoter

b-Actin cdsb-Actin

Con

Genomic DNA

FMConFM

IP-DNA

p53-Ab

FMConFMCon

no Ab ERK2-AbB

4 8 16 240

FM + Ptha

Brd

U in

corp

ora

tio

n

0

20

40

60

80

100

120

Con 2 4 8 12 16

FM HU

Time (h)

po

lH in

du

ctio

n (

x-fo

ld)

Time (h)

0

1

2

3

4

Con 2 4 8 12 16

FM HU

b-Actin

p-p53Ser15

2h 4hCon 8hCon 16hCon Con12hCon2h 4hCon 8hCon 16hCon Con12hConD

GFE

Time (h)

0

5

10

15

20

25

30

Con 2 4 8 12 16

FM HU

FM HU

Cel

ls >

3 gH

2AX

fo

ci (

%)

Figure 2. p53-dependent and fotemustine-triggered induction of PolH inmelanoma cells. A andB, D05 cells were exposed to 10 mg/mL fotemustine (FM) in thepresence or absence of 10 mmol/L Ptha. Expression of polH mRNA was analyzed by end point PCR (A) and expression of PolH protein was analyzed byWestern blot analysis using nuclear protein extracts (B). C, ChIP analysis was performed in untreated D05 cells and cells exposed to 10 mg/mL fotemustine for16 hours. One percent of cell extracts from each of the samples was taken as input. Protein-DNA complexes were immunoprecipitated with anti-p53,anti-ERK1/2, or without antibody and end point PCR was performed using primers flanking the p53-responsive element within the polH promoter or primersspecific for the b-actin coding sequence. D–G,D05 cells were exposed to 10mg/mL fotemustine or 1mmol/L HU for indicated times. D and E, phosphorylationof p53Ser15 was analyzed by Western blot analysis (D) and expression of polH mRNA by qRT-PCR (E). F, DNA replication was measured by BrdUrdincorporation. G, formation of gH2AX foci was analyzed by microscopy. Eight-hundred cells were scored for each time point and the percentage of cellsshowing >3 gH2AX foci are presented.






i.p.). Tumors were removed 40 hours thereafter and theexpression of PolH was measured on mRNA and protein level.As indicated by end point PCR (Supplementary Fig. S1C) andqRT-PCR (Fig. 4A), the expression of polHmRNAwas higher inall samples obtained from fotemustine-treated animals com-pared with samples obtained from untreatedmice, which wererandomly crosspaired. An enhanced expression of PolH andp53 was also observed on protein level in the melanomaxenografts following treatment of mice with fotemustine(Fig. 4B).

PolH induction is not a tumor-specific trait; it was also foundin nontransformed cells like human diploid fibroblasts(VH10tert; Fig. 4C) and in replicating (CD3/CD28 stimulated)PBLCs obtained from healthy donors (Fig. 4D and E) followingexposure to fotemustine. Of note, polH induction wasnot observed in nonstimulated PBLCs, which are in G0

(>95%; Fig. 4E). The lack of induction of polH in nonproliferat-ing PBLCs, along with lack of p53 activation (Fig. 4F), supportsthe view that not the primary DNA damage, but replication-associated lesions (DSB) trigger the response.

Impact of PolH on the sensitivity to chloroethylatinganticancer drugs

PolH was related to both, resistance and sensitivity togenotoxic stress. Thus, PolH deficiency renders human fibro-blasts sensitive to UV light, but resistant to ionizing radiation

(33). To analyze the impact of PolH on chloroethylatinganticancer drug-induced toxicity, PolH was downregulated viasiRNA or ectopically overexpressed. The determination of cellviability via the MTT assay showed a protective effect of PolHagainst several crosslink inducing anticancer drugs. In detail,PolH knockdown sensitized melanoma cells to fotemustine,glioma cells to CCNU, and breast cancer cells to MAF (Fig. 5A),drugs used in the treatment of the corresponding types oftumors. To further analyze the impact of PolH on cell death, thesub-G1 fraction was determined. Also in this assay, knockdownof PolHhad a strong impact on fotemustine-induced toxicity inD05 cells and clearly enhanced cell death (Fig. 5B). Theefficiency of PolH knockdown was verified in parallel experi-ments by Western blot analysis (Fig. 5B, left). To assess theimpact of PolH induction on fotemustine resistance, p53-deficient D03 melanoma cells, showing no induction of PolHupon fotemustine exposure (Supplementary Fig. S1B), weretransfected with a PolH expression vector (Fig. 5C, left plot forefficiency of PolH expression) and exposed to fotemustine.Overexpression of PolH clearly protected the cells againstfotemustine-induced cytotoxicity (Fig. 5C, right panel).

Impact of PolH on the repair of fotemustine-inducedDNA damage

Next, we analyzed whether PolH is involved in the repairof fotemustine-induced DNA damage. Therefore, host

Time (h)

b-Actin

PolH

8 16 24 Time (h)0

b-Actin

8 16 240

PolH

C

D – Ptha + Ptha

Time (h)

gapdh

polH

AU

87, C

CN

U

4 8 16 482 420 32

U87

, CC

NU

U87

, CC

NU

Ind

uct

ion

(x-

fold

)

Time (h)

F

Ind

uct

ion

(x-

fold

)

Time (h)

FAM ,6KTFAM ,7FCM

Ind

uct

ion

(x-

fold

)

Time (h)

4 8 16 482 420 32

B

0

1

2

3

4

0 8 16 24 480

2

4

6

0 8 16 24 48

0

2

4

6

8

0 8 16 24 48

0

1

2

3

4

U138LN319LN308LN18T98GLN229

Con824

E

Ind

uct

ion

(x-

fold

)

Figure 3. Induction of PolH bychloroethylating drugs in tumorcells. A–C, U87 glioma cells wereexposed to 20 mg/mL CCNU.Expression of polH mRNA wasanalyzed by end point PCR (A) andqRT-PCR (B); expression of PolHprotein was analyzed by Westernblot analysis (C). D, U87 cells wereexposed to 20 mg/mL CCNU in thepresence or absence of 10 mmol/LPtha and expression of PolHprotein was analyzed by Westernblot analysis. E, a panel of gliomacell lines were exposed to 20mg/mL CCNU for 8 or 24 hoursand the expression of polH mRNAwas analyzed by qRT-PCR. F,exponentially growing MCF7breast cancer cells and TK6lymphoblastoid cells wereexposed to 5 mg/mL MAF and theexpression of polH mRNA wasanalyzed by qRT-PCR.

Tomicic et al.





reactivation assays were performed, transfecting ex vivofotemustine-exposed pGL2-con plasmids into D05 cells.After dose-finding experiments (Supplementary Fig. S1F),pGL2-con plasmids alkylated with 5 and 25 mg/mL fotemus-tine were transfected either in polH siRNA-transfected,nonsilencing (ns) siRNA-transfected or nontransfected cellsand reactivation of the plasmid was determined 24 hourslater. The data clearly show that knockdown of PolH neg-atively affects the ability of cells to reactivate the plasmid(Fig. 6A), indicating its involvement in the repair of chlor-oethylating agent-induced DNA damage. Besides performinghost cell reactivation assays, we also analyzed the formationand repair of fotemustine-induced DNA damage in vivo.Therefore, the modified alkaline comet assay was used tomonitor the repair of DNA crosslinks. The data show thatPolH is not involved in the early step of ICL repair as itsknockdown does not affect ICL formation or its resolution(Fig. 6B).

ICLs represent a severe block of DNA replication, causingDSB at blocked replication forks. To analyze the impact of PolHon replication and DSB formation, replication was analyzed byBrdUrd assay and DSB formation by gH2AX foci. Knockdownof PolH clearly extended the fotemustine-induced block toreplication (Fig. 6C) and, in parallel, increased the amount ofgH2AX foci (Fig. 6D). Whereas the amount of gH2AX foci percell was <3 in untreated cells, fotemustine (10 mg/mL) inducedapproximately 40 gH2AX foci per cell 24 hours after exposure(Fig. 6D). Upon siRNA-mediated knockdown of PolH, thenumber of gH2AX foci was significantly enhanced 48 and 72hours after fotemustine in comparison with ns-siRNA–trans-fected cells (Fig. 6D). We should note that only a subfraction ofcells showed gH2AX foci. Therefore, only cells showing >3 fociper cell were included in the quantification. Also, the percent-age of cells showing >3 gH2AX foci upon fotemustine exposurewas higher in PolH siRNA-transfected cells (SupplementaryFig. S1G). Thefinding that only a subpopulation of cells showed

Time (h)

polH

gapdh

24 480

No

nst

imu

late

d

PB

LC

s

0 24 48 Time (h)72 96

polH

gapdh

48240 Time (h)9672

p53

ERK2

967248240

NonstimulatedStimulated

PolH

ERK2

ED

F

8 16 24 48 Time (h)0

polH

gapdh

Ind

uct

ion

(x-

fold

)

Time (h)

C

VH10tert, FM0

1

2

3

4

5

48241680

Sti

mu

late

d P

BL

Cs

polH

gapdhS

tim

ula

ted

T4

PolH

b-Actin

+_

Ind

uct

ion

(x-

fold

)

A B

p53

0

1

2

3

4

5

T1 T2 T3 mean

Figure 4. Fotemustine-triggeredinduction of PolH in the melanomaxenograft model andnontransformed cells. A and B,A375 cells were injected intoimmunodeficient (NOD.CB17-Prkdcscid/J) mice. Upon tumorformation, the mice were eithermock-treated or treated withfotemustine (70 mg/kg, i.p.). Fortyhours later, the expression of polHwas analyzed using qRT-PCR inthree paired animals (T1-T3; A) andthe expression of PolH and p53was analyzed by Western blotanalysis (B) in an additional animalpair (T4). C, human fibroblastswere exposed to 10 mg/mLfotemustine and the expression ofpolH mRNA was analyzed by endpoint PCR (left) and qRT-PCR(right). D–F, PBLCs were isolatedfrom different buffy coats obtainedfrom healthy donors and either notstimulated or stimulated toproliferate by anti-CD3 and anti-CD28 antibodies and exposed tofotemustine. D, expression of PolHwas analyzed by end point PCR(top) and Western blot analysis(bottom) in stimulated PBLCs.E, expression of polH wasanalyzed by end point PCR instimulated (top) and nonstimulated(bottom) PBLCs. F, expression ofp53 was analyzed by Western blotanalysis using nuclear extracts instimulated (left) and nonstimulated(right) PBLCs.






gH2AX foci indicates that its formation is associated withreplication. This is supported by EdU labeling experiments.Formation of gH2AX foci was observed predominantly inreplicating cells (Supplementary Fig. S2A); 24 hours afterfotemustine exposure, more than 85% of cells positive for EdUshowed gH2AX foci (Supplementary Fig. S2B), indicating thatDSB formation following fotemustine is restricted to S-phasecells.

To further prove that PolH is involved in the replication-associated repair of chloroethylating agent-inducedDNAdam-age, notably ICL, the cellular localization of PolHwas analyzed.Enhanced nuclear expression of PolH was observed in fote-mustine-exposed cells (Supplementary Fig. S2C). In experi-ments, in which strong washing conditions were applied toremove nonDNA-bound proteins (39), PolHwas not detectablein untreated cells (Fig. 6E). In fotemustine-treated cells, how-ever, a strong staining of PolH was observed in 20% to 30% ofthe cells. Parallel detection of EdU incorporation showed thatbinding of PolH to the DNA in fotemustine-treated cells occurspredominantly (>80%) in replicating (S-phase) cells (Fig. 6Eand Supplementary Fig. S2B).

DiscussionIn glioblastoma and melanoma cells, p53 is one of the

major factors influencing toxicity of anticancer drugs. Incase of the chloroethylating agents, ACNU (22) and fote-mustine (25), this protective effect was related to theinduction of the nucleotide excision repair genes xpc andddb2, which are robustly regulated by p53. To identifyadditional factors involved in p53-mediated resistance toICL-inducing agents, we analyzed the p53-mediated regu-lation of all known DNA repair genes and identified thePolH as an important p53-regulated factor involved in thecellular protection against fotemustine and other ICL-inducing anticancer drugs.

Induction of PolH by fotemustine was found in melanomacell lines, normal fibroblasts, and proliferating PBLCs on thelevel of mRNA and protein. Furthermore, induction of PolHwas observed in glioma cells upon exposure to CCNU used inglioma therapy and in breast cancer cells upon exposureto MAF, a derivative of the crosslink inducing anticancerdrug cyclophosphamide used in breast cancer therapy. PolHinduction was mediated by p53 as substantiated by ChIP

b-Actin

b-Actin

PolH

ns-

siR

NA

po

lH-s

iRN

A

ns-

siR

NA

po

lH-s

iRN

A

ns-

siR

NA

po

lH-s

iRN

A

D05

PolH

vec-

po

lH

vec-

con

D03

B

C

****

Su

bG

1 (%

)

0

5

10

15

20

25

30

35

con Fote ns-siFMpolH-sins-siConFM

polH-siFM

***

Ind

uce

d s

ub

G1

(%)

FM (mg/mL)

20

40

60

80

100

50251052Con

D05-ns-siD05-polH-si

A

Cel

l via

bili

ty (

%)

FM (mg/mL)

** ***

20

40

60

80

100

1005025105Con

U87-ns-siU87-polH-si

CCNU (mmol/L)

**

20

40

60

80

100

50251052Con

MCF7-ns-siMCF7-polH-si

MAF (mg/mL)

****

**ve

c-p

olH

vec-

con

vec-

po

lH

vec-

con

0

10

20

30

40

5 10 25 50

vec-con vec-polH

*

Figure 5. Impact of PolHon cell death triggered bychloroethylating agents. A, U87,D05, and MCF7 cells weretransiently transfected withpolH-specific siRNA (polH-si) orns-si and 24 hours later, exposedto different doses of CCNU,fotemustine (FM), or MAF,respectively. Cytotoxicity wasmeasured using MTT assay. B andC, D05 cells were transientlytransfected with polH-specificsiRNA (polH-si) or ns-si (B) ortransiently transfected using aPolH expression vector (vec-polH)or mock-transfected (vec-con; C).Twenty-four hours later, theexpression of PolH was analyzedby Western blot analysis (left) orthe cells were exposed to 10mg/mL fotemustine (B) or differentdoses of fotemustine (C) for 72hours and the cytotoxicity wasmeasured as sub-G1 fraction(right). A–C, data are the mean ofthree independent experiments�SD. �, P < 0.05; ��, P < 0.01.

Tomicic et al.





experiments and experiments using the p53 inhibitor Ptha.This notion is in line with a previous report showing p53-dependent induction of PolH by IR and camptothecin (33).The observation of PolH induction in tumor cell lines grown

in vitro and as xenografts, and in PBLCs upon exposure tovarious crosslink-inducing agents clearly hints to an importantandwidely spread biologic function of PolH upregulation. PolHseems to play different roles in cellular toxicity according to thetype of DNA damage. Thus, knockdown of PolH on the onehand enhanced the sensitivity to UV light and, on the other,enhanced cellular resistance to IR (33). To analyze the impactof PolH on anticancer drug–induced cytotoxicity, PolH wasdownregulated using siRNA. Downregulation of PolH clearlysensitized melanoma cells to fotemustine, glioma cells toCCNU, and MCF7 cells to MAF, indicating that PolH is ageneral player involved in the protection of cancer cells againstcrosslink-inducing agents. Furthermore, ectopic expression ofPolH in D03 melanoma cells rendered them more resistant to

fotemustine, supporting the notion that PolH induction con-tributes to ICL drug resistance.

Our data suggest that PolH represents a potential marker ofcancer cell resistance. How is PolH expressed in tumors? Asdata are scarce, we initially analyzed the expression of PolH inmalignant glioma cell lines (Supplementary Fig. S3A) and inhuman breast cancer and corresponding normal tissue (Sup-plementary Fig. S3B and S3C). The results showed clear varia-tions in the PolH expression, which was overall slightly higherin cancer than in the normal tissue, indicating that PolHmightbe upregulated during tumor development. However, morestudies concerning the expression of PolH in tumors areneeded to clarify this point.

We also analyzed whether PolH is directly involved in therepair of chloroethylating agent–derived DNA adducts. Fote-mustine chloroethylates the O6-position of guanine, formingO6-ClG, which thereafter undergoes intramolecular rearrange-ment to form an ICL (5). WhereasO6-ClG is repaired byMGMT

FMControlE

TO

-PR

O3

Po

lH

Ove

rlay

Ed

U

TO

-PR

O3

Po

lH

Ove

rlay

Ed

U

BA

0

20

40

60

80

100

4824Con

ns-si

polH-si

Rel

ativ

e ta

il m

om

ent

(%)

Lu

cife

rase

act

ivit

y

**

*

Time (h)FM (mg/mL)

0

20

40

60

80

100

0 5 25

ntns-sipolH-si

D

gH2A

X f

oci

/cel

l

C

Time (h)

**

0

20

40

60

80

100

0 24 48 72

ns-sipolH-si

*

Time (h)

Brd

U in

corp

ora

tio

n (

%)

0

10

20

30

40

50

24 48 72

ns-sipolH-si

**

*

Figure 6. Impact of PolH on therepair of fotemustine-triggeredDNA damage. A–D, D05 cells wereeither nontransfected (nt) ortransfected with ns-siRNA orpolH-specific siRNA. A, host cellreactivation assay. Cells weretransfected 24 hours later with theplasmid pGL2-con, which wasex vivo exposed to 5 or 25 mg/mLfotemustine (FM) and with theplasmid pRLEF-1a. Sixteen hourslater, the cells were harvested,protein extracts isolated, andsubjected to the dual luciferaseassay. B, ICL repair was measuredby modified comet assay at 24 and48 hours after fotemustine (10mg/mL) treatment. C, DNAreplication was measured byBrdUrd incorporation assay 24, 48,and 72 hours after fotemustine(10 mg/mL) treatment. D, formationof gH2AX foci was analyzed byconfocal laser scanningmicroscopy at 24, 48, and 72 hoursafter fotemustine (10 mg/mL)treatment. Fifty cells (showing >3foci) were scored for each timepoint. A–D, data are the mean ofthree independent experiments�SD. �, P < 0.05; ��, P < 0.01.E, binding of PolH to fotemustine-damaged DNA was determinedusing immunofluorescence andconfocal laser scanningmicroscopy 16 hours afterexposure to 10 mg/mL fotemustine.Nuclear staining was performedusing TO-PRO3 and detection ofreplicating cells was analyzed byEdU incorporation.






(40) the repair of ICL is complex, involving multiple repairmechanisms (1). Also to consider, ICL repair differs betweenreplicating and nonreplicating cells. In nonreplicating cells, therepair depends on nucleotide excision repair (NER)-mediatedrecognition of the crosslink and dual NER-mediated incision atpositions flanking the crosslinked DNA. After flipping theexcised DNA fragment out of the helix, resynthesis of DNAoccurs and a second cycle of NER finally removes the flipped-out crosslink (1). Whether resynthesis of DNA is accomplishedby replicative or translesion polymerases is unclear. In repli-cating cells, when the crosslink encounters the replication fork,NER, TLS, and HR are implicated in the repair (1).

To analyze the role of PolH in the repair of fotemustine-induced DNA adducts, host reactivation assays were per-formed. Upon knockdown of PolH, a clear decrease inplasmid reactivation was observed, indicating that PolH isinvolved in the repair of fotemustine-induced DNA damage.An intriguing question is whether PolH is involved in therepair of the monoadducts or ICL. In vitro, conversion of amonoadduct to a crosslink occurs within a period of 3 hours(5). In cells upon exposure to chloroethylating drugs, theformation of ICL was finished within 8 hours (41). As ex vivomodification of the plasmid was performed in our experi-ments for 12 hours, O6-ClG adducts should not be presentanymore, supporting the notion that PolH is involved in therepair of ICL. This is in line with data showing repair ofmitomycin C-induced ICL using in vivo reactivation assays.In these experiments, using xeroderma pigmentosumpatient–derived XPV cells, partial requirement for PolH wasobserved (42). Moreover, XPV cells are hypersensitive tocisplatin (43, 44), and PolH was associated with processingof psoralen-induced crosslinks (45).

We also performed modified alkaline comet assays to mea-sure the repair of ICL in vivo. No difference was observed in theformation and initial cleavage of ICL, indicating that PolH isnot involved in the first steps of ICL repair, namely recognitionand incision. However, a prolonged replication block and anenhanced persistence of gH2AX foci were observed, indicatingthat the efficient execution of later steps of ICL repair isreduced in PolH-compromised cells. Besides its role in TLS,PolH displays an important function in mitotic gene conver-sion and homologous recombination (46). Furthermore, PolHpossesses a dual role at stalled replication forks, promotingTLS and reinitiating DNA synthesis during HR by primerextension ofD-loop structures (47).More recently it was shownthat PolH provides a supportive role for PolD during normalreplication (48). Therefore, the question arises whether thefunction of PolH in ICL repair following anticancer drugs isassociated with replication events. To address this, we ana-lyzed whether PolH can directly interact with fotemustine-damaged DNA in vivo and whether this reaction is associatedwith replication. Upon removal of non-DNA–bound PolH, theremaining DNA-bound PolHwas only detected in fotemustine-treated, but not in unexposed cells. Parallel detection of EdUincorporation showed that binding of PolH to the DNA offotemustine-exposed cells occurs predominantly in replicatingcells (>80% of PolH-positive cells were at the same timepositive for EdU incorporation), indicating a role for PolH in

replication-associated repair of ICL. This finding is in contrastto data showing that DNA damage–induced PolH recruitmenttakes place independently of the cell-cycle phase (49). This,however, was observed after treatment with UV light, whichinduces intrastrand crosslinks that are repaired independentlyof replication, whereas ICL are more severe lesions that arerepaired predominantlywithin the S-phase, which is supportedby a large fraction of the cells showing gH2AX foci in the S-phase upon fotemustine treatment.

Upregulation of PolH following anticancer drug treatmentwas not only observed inmalignant cells, but also in fibroblastsand PBLCs isolated from healthy individuals. As PolH plays aprotective role, the data suggest that PolHmay also protect thenormal tissue from the therapeutic side effects of ICL-inducinganticancer drugs. We should also note another interesting sideeffect. As PolH, a low fidelity TLS polymerase, is able to insertwrong nucleotides opposite to the lesion in the DNA (26), itsactivity is error-prone, leading to the formation of mutations.Thesemight be a source of therapy-induced secondary tumors,which is indeed a serious deleterious side effect of ICL-induc-ing drugs such as nitrogen mustards and nitrosoureas (50).

In summary, we show for the first time upregulation of PolHupon exposure of cells to crosslink-inducing anticancer drugs.The process is dependent on p53 and was observed in mela-noma, glioma, and breast cancer cell lines. It was also observedin a mouse melanoma xenograft model in the absence ofsystemic toxicity, indicating that it occurs in a relevant doserange. Furthermore, we show that the elevated expression ofPolH enhances the resistance of cancer cells to crosslinkinganticancer drugs, including chloroethylating agents and cyclo-phosphamide derivatives, resulting from a participation ofPolH in the repair of DNA crosslinks.

Disclosure of Potential Conflicts of InterestNo potential conflicts of interest were disclosed.

Authors' ContributionsConception and design: M.T. Tomicic, B. Kaina, M. ChristmannDevelopment of methodology: D. AaslandAcquisition of data (provided animals, acquired and managed patients,provided facilities, etc.): R. Meise, C. Barckhausen, M. ChristmannAnalysis and interpretation of data (e.g., statistical analysis, biostatistics,computational analysis): M.T. Tomicic, R. Meise, B. Kaina, M. ChristmannWriting, review, and/or revision of themanuscript:M.T. Tomicic, B. Kaina,M. ChristmannAdministrative, technical, or material support (i.e., reporting or orga-nizing data, constructing databases): S.C. Naumann, B. KainaStudy supervision: M. Christmann

AcknowledgmentsThe authors thank Birgit Rasenberger for excellent technical assistance.

Grant SupportThe work was supported by a grant from the Deutsche Forschungsge-

meinschaft (DFG CH 665/2-2).The costs of publication of this article were defrayed in part by the

payment of page charges. This article must therefore be hereby markedadvertisement in accordance with 18 U.S.C. Section 1734 solely to indicate thisfact.

Received April 4, 2014; revised June 7, 2014; accepted June 30, 2014;published OnlineFirst August 14, 2014.

Tomicic et al.





References1. Muniandy PA, Liu J, Majumdar A, Liu ST, Seidman MM. DNA inter-

strand crosslink repair in mammalian cells: step by step. Crit RevBiochem Mol Biol 2010;45:23–49.

2. Emadi A, Jones RJ, Brodsky RA. Cyclophosphamide and cancer:golden anniversary. Nat Rev Clin Oncol 2009;6:638–47.

3. Ludlum DB. The chloroethylnitrosoureas: sensitivity and resistance tocancer chemotherapy at the molecular level. Cancer Invest 1997;15:588–98.

4. Pegg AE. Repair of O(6)-alkylguanine by alkyltransferases. Mutat Res2000;462:83–100.

5. Tong WP, Kirk MC, Ludlum DB. Formation of the cross-link 1-[N3-deoxycytidyl),2-[N1-deoxyguanosinyl]ethane in DNA treated with N,N0-bis(2-chloroethyl)-N-nitrosourea. Cancer Res 1982;42:3102–5.

6. Fischhaber PL, Gall AS, Duncan JA, Hopkins PB. Direct demonstrationin synthetic oligonucleotides that N,N0-bis(2-chloroethyl)-nitrosoureacross links N1 of deoxyguanosine to N3 of deoxycytidine on oppositestrands of duplex DNA. Cancer Res 1999;59:4363–8.

7. Brulikova L, Hlavac J, Hradil P. DNA interstrand cross-linking agentsand their chemotherapeutic potential. Curr Med Chem 2012;19:364–85.

8. Avril MF, Aamdal S, Grob JJ, Hauschild A, Mohr P, Bonerandi JJ, et al.Fotemustine compared with dacarbazine in patients with disseminat-ed malignant melanoma: a phase III study. J Clin Oncol 2004;22:1118–25.

9. Di Giacomo AM, Ascierto PA, Pilla L, Santinami M, Ferrucci PF,Giannarelli D, et al. Ipilimumab and fotemustine in patients withadvanced melanoma (NIBIT-M1): an open-label, single-arm phase 2trial. Lancet Oncol 2012;13:879–86.

10. Del VecchioM,Mortarini R,CanovaS,DiGuardoL, Pimpinelli N, SertoliMR, et al. Bevacizumab plus fotemustine as first-line treatment inmetastatic melanoma patients: clinical activity and modulation ofangiogenesis and lymphangiogenesis factors. Clin Cancer Res2010;16:5862–72.

11. Guida M, Cramarossa A, Fistola E, Porcelli M, Giudice G, Lubello K,et al. High activity of sequential low dose chemo-modulating Temo-zolomide in combination with Fotemustine in metastatic melanoma. Afeasibility study. J Transl Med 2010;8:115.

12. Hoeijmakers JH. DNA damage, aging, and cancer. N Engl J Med2009;361:1475–85.

13. ChristmannM, TomicicMT, RoosWP, KainaB.Mechanisms of humanDNA repair: an update. Toxicology 2003;193:3–34.

14. Christmann M, Kaina B. Transcriptional regulation of human DNArepair genes following genotoxic stress: triggermechanisms, inducibleresponses and genotoxic adaptation. Nucleic Acids Res 2013;41:8403–20.

15. Harper JW, Elledge SJ. The DNA damage response: ten years after.Mol Cell 2007;28:739–45.

16. Lakin ND, Jackson SP. Regulation of p53 in response to DNA damage.Oncogene 1999;18:7644–55.

17. Kastan MB, Onyekwere O, Sidransky D, Vogelstein B, Craig RW.Participation of p53 protein in the cellular response to DNA damage.Cancer Res 1991;51:6304–11.

18. Tomicic MT, Christmann M, Kaina B. Topotecan-triggered degrada-tion of topoisomerase I is p53-dependent and impacts cell survival.Cancer Res 2005;65:8920–6.

19. Tomicic MT, Christmann M, Kaina B. Topotecan triggers apoptosis inp53-deficient cells by forcing degradation of XIAP and survivin therebyactivating caspase-3-mediated Bid cleavage. J Pharmacol Exp Ther2010;332:316–25.

20. Tomicic MT, Kaina B. Topoisomerase degradation, DSB repair, p53and IAPs in cancer cell resistance to camptothecin-like topoisomeraseI inhibitors. Biochim Biophys Acta 2013;1835:11–27.

21. Wang Y, Zhu S, Cloughesy TF, Liau LM, Mischel PS. p53 disruptionprofoundly alters the response of human glioblastoma cells to DNAtopoisomerase I inhibition. Oncogene 2004;23:1283–90.

22. Batista LF, Roos WP, Christmann M, Menck CF, Kaina B. Differentialsensitivity of malignant glioma cells to methylating and chloroethylat-ing anticancer drugs: p53 determines the switch by regulating xpc,ddb2, andDNAdouble-strand breaks. CancerRes 2007;67:11886–95.

23. NaumannSC,RoosWP, Jost E,BelohlavekC, LennerzV,SchmidtCW,et al. Temozolomide- and fotemustine-induced apoptosis in humanmalignant melanoma cells: response related to MGMT, MMR, DSBs,and p53. Br J Cancer 2009;100:322–33.

24. Li G, Tang L, Zhou X, Tron V, Ho V. Chemotherapy-induced apo-ptosis in melanoma cells is p53 dependent. Melanoma Res 1998;8:17–23.

25. Barckhausen C, Roos WP, Naumann SC, Kaina B. Malignant mela-noma cells acquire resistance to DNA interstrand cross-linking che-motherapeutics by p53-triggered upregulation of DDB2/XPC-mediat-ed DNA repair. Oncogene 2014;33:1964–74.

26. Hoffmann JS, Cazaux C. Aberrant expression of alternative DNApolymerases: a source of mutator phenotype as well as replicativestress in cancer. Semin Cancer Biol 2010;20:312–9.

27. Rey L, Sidorova JM, Puget N, Boudsocq F, Biard DS, Monnat RJ Jr,et al. Human DNA polymerase eta is required for common fragile sitestability during unperturbed DNA replication. Mol Cell Biol 2009;29:3344–54.

28. Bergoglio V, Boyer AS,Walsh E, Naim V, LegubeG, LeeMY, et al. DNAsynthesis byPol eta promotes fragile site stability by preventing under-replicated DNA in mitosis. J Cell Biol 2013;201:395–408.

29. Roos W, Baumgartner M, Kaina B. Apoptosis triggered by DNAdamage O6-methylguanine in human lymphocytes requires DNA rep-lication and is mediated by p53 and Fas/CD95/Apo-1. Oncogene2004;23:359–67.

30. Wischhusen J, Naumann U, Ohgaki H, Rastinejad F, Weller M. CP-31398, a novel p53-stabilizing agent, induces p53-dependent andp53-independent glioma cell death. Oncogene 2003;22:8233–45.

31. Christmann M, Kaina B. Nuclear translocation of mismatch repairproteins MSH2 and MSH6 as a response of cells to alkylating agents.J Biol Chem 2000;275:36256–62.

32. Christmann M, Tomicic MT, Aasland D, Berdelle N, Kaina B. Threeprime exonuclease I (TREX1) is Fos/AP-1 regulated by genotoxicstress and protects against ultraviolet light and benzo(a)pyrene-induced DNA damage. Nucleic Acids Res 2010;38:6418–32.

33. Liu G, Chen X. DNA polymerase eta, the product of the xerodermapigmentosum variant gene and a target of p53, modulates the DNAdamage checkpoint and p53 activation. Mol Cell Biol 2006;26:1398–413.

34. Tomicic MT, Friedrichs C, Christmann M, Wutzler P, Thust R, Kaina B.Apoptosis induced by (E)-5-(2-bromovinyl)-20-deoxyuridine in varicellazoster virus thymidine kinase-expressing cells is driven by activation ofc-Jun/activator protein-1 and Fas ligand/caspase-8. Mol Pharmacol2003;63:439–49.

35. Spanswick VJ, Hartley JM, Ward TH, Hartley JA. Measurement ofdrug-induced DNA interstrand crosslinking using the single-cell gelelectrophoresis (comet) assay. Methods Mol Med 1999;28:143–54.

36. Tomicic MT, Thust R, Sobol RW, Kaina B. DNA polymerase betamediates protection of mammalian cells against ganciclovir-induced cytotoxicity and DNA breakage. Cancer Res 2001;61:7399–403.

37. Christmann M, Pick M, Lage H, Schadendorf D, Kaina B. Acquiredresistanceofmelanomacells to the antineoplastic agent fotemustine iscaused by reactivation of the DNA repair gene MGMT. Int J Cancer2001;92:123–9.

38. Komarov PG, Komarova EA, Kondratov RV, Christov-Tselkov K, CoonJS, Chernov MV, et al. A chemical inhibitor of p53 that protects micefrom the side effects of cancer therapy. Science 1999;285:1733–7.

39. Andersen PL, Xu F, Ziola B, McGregor WG, Xiao W. Sequentialassembly of translesion DNA polymerases at UV-induced DNA dam-age sites. Mol Biol Cell 2011;22:2373–83.

40. KainaB,ChristmannM,NaumannS,RoosWP.MGMT: key node in thebattle against genotoxicity, carcinogenicity and apoptosis induced byalkylating agents. DNA Repair 2007;6:1079–99.

41. Brent TP, Lestrud SO, Smith DG, Remack JS. Formation of DNAinterstrand cross-links by the novel chloroethylating agent 2-chlor-oethyl(methylsulfonyl)methanesulfonate: suppression by O6-alkyl-guanine-DNA alkyltransferase purified from human leukemic lympho-blasts. Cancer Res 1987;47:3384–7.






42. Zheng H, Wang X, Warren AJ, Legerski RJ, Nairn RS, Hamilton JW,et al. Nucleotide excision repair- and polymerase eta-mediated error-prone removal of mitomycin C interstrand cross-links. Mol Cell Biol2003;23:754–61.

43. Albertella MR, Green CM, Lehmann AR, O'Connor MJ. A role forpolymerase eta in the cellular tolerance to cisplatin-induced damage.Cancer Res 2005;65:9799–806.

44. Chen YW,Cleaver JE, Hanaoka F, Chang CF, ChouKM. A novel role ofDNA polymerase eta in modulating cellular sensitivity to chemother-apeutic agents. Mol Cancer Res 2006;4:257–65.

45. Mogi S, Butcher CE, OhDH. DNApolymerase eta reduces the gamma-H2AX response to psoralen interstrand crosslinks in human cells. ExpCell Res 2008;314:887–95.

46. Kawamoto T, Araki K, Sonoda E, Yamashita YM, Harada K, KikuchiK, et al. Dual roles for DNA polymerase eta in homologous DNA

recombination and translesion DNA synthesis. Mol Cell 2005;20:793–9.

47. McIlwraith MJ, Vaisman A, Liu Y, Fanning E, Woodgate R, West SC.Human DNA polymerase eta promotes DNA synthesis from strandinvasion intermediates of homologous recombination. Mol Cell2005;20:783–92.

48. Sneeden JL, Grossi SM, Tappin I, Hurwitz J, HeyerWD. Reconstitutionof recombination-associated DNA synthesis with human proteins.Nucleic Acids Res 2013;41:4913–25.

49. Soria G, Belluscio L, van Cappellen WA, Kanaar R, Essers J, GottifrediV.DNAdamage inducedPol eta recruitment takesplace independentlyof the cell cycle phase. Cell Cycle 2009;8:3340–8.

50. TuckerMA,Meadows AT, Boice JD Jr., Stovall M, Oberlin O, Stone BJ,et al. Leukemia after therapy with alkylating agents for childhoodcancer. J Natl Cancer Inst 1987;78:459–64.


Tomicic et al.




2014;74:5585-5596. Published OnlineFirst August 14, 2014.Cancer Res Maja T. Tomicic, Dorthe Aasland, Steffen C. Naumann, et al. and Confers Anticancer Drug Resistance

Is Upregulated by Cancer TherapeuticsηTranslesion Polymerase

Updated version

10.1158/0008-5472.CAN-14-0953doi:

Access the most recent version of this article at:

Material

Supplementary

http://cancerres.aacrjournals.org/content/suppl/2014/08/16/0008-5472.CAN-14-0953.DC1

Access the most recent supplemental material at:

Cited articles

http://cancerres.aacrjournals.org/content/74/19/5585.full#ref-list-1

This article cites 50 articles, 20 of which you can access for free at:

Citing articles

http://cancerres.aacrjournals.org/content/74/19/5585.full#related-urls

This article has been cited by 3 HighWire-hosted articles. Access the articles at:

E-mail alerts related to this article or journal.Sign up to receive free email-alerts

Subscriptions

Reprints and

[email protected]

To order reprints of this article or to subscribe to the journal, contact the AACR Publications Department at

Permissions

Rightslink site. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC)

.http://cancerres.aacrjournals.org/content/74/19/5585To request permission to re-use all or part of this article, use this link



http://cancerres.aacrjournals.org/lookup/doi/10.1158/0008-5472.CAN-14-0953

http://cancerres.aacrjournals.org/content/suppl/2014/08/16/0008-5472.CAN-14-0953.DC1

http://cancerres.aacrjournals.org/content/74/19/5585.full#ref-list-1

http://cancerres.aacrjournals.org/content/74/19/5585.full#related-urls

http://cancerres.aacrjournals.org/cgi/alerts

mailto:[email protected]

http://cancerres.aacrjournals.org/content/74/19/5585


Translesion Polymerase h Is Upregulated by Cancer ...Translesion Polymerase h Is Upregulated by...

Documents

Transcript of Translesion Polymerase h Is Upregulated by Cancer ...Translesion Polymerase h Is Upregulated by...