Mutation Research 570 (2005) 149–161

Transcriptome profiling reveals similarities and differencesin plant responses to cadmium and lead

Igor Kovalchuka, Victor Titova, Barbara Hohnb, Olga Kovalchuka,∗

a Department of Biological Sciences, University of Lethbridge, Alta., Canada T1K 3M4b Friedrich Miescher Institute for Biomedical Research, Maulbeerstrasse 66, CH4058 Basel, Switzerland

Received 28 July 2004; received in revised form 2 September 2004; accepted 5 October 2004Available online 22 December 2004

Abstract

We analyzed the influence of salts of two heavy metals—lead and cadmium (Pb2+ and Cd2+) on plants, including plant androot size, plant genome stability as well as global genome expression. Measurement of the metal uptake showed that there wasa significantly higher incorporation of Cd than of Pb, 0.6 and 0.15 uM per gram of dry weight, respectively. The analysis of theroot length and plant size showed a dose dependent decrease in plants exposed to cadmium. In contrast there was little differencein the size of plants exposed to lead, although there was nearly four-fold increase of the root length. Analysis of the genomestability revealed that cadmium led to a dose dependent increase of homologous recombination whereas lead had no effect.

Analysis of the global genome expression of plants chronically exposed to 50 uM of Cd and Pb revealed 65 and 338 up- anddown-regulated genes by Cd and 19 and 76 by Pb, respectively. Interestingly, half of the genes that changed their expressioni Cd reflectsg©

K

1

asc

f

et-toxicen-

yto-

ina-d int ofandw

0

n Pb-treated plants also changed their expression in Cd-treated ones. The greater number of genes regulated byenerally higher genome instability of plants as well as higher uptake as compared to Pb.2004 Elsevier B.V. All rights reserved.

eywords:Cadmium; Lead genotoxicity; Plant genome stability; Global genome expression

. Introduction

Contamination of our environment with heavy met-ls is a significant health threat. Active heavy metalalts accumulated in soil and water are capable of effi-iently entering the food chain using plants and animals

∗ Corresponding author. Tel.: +1 403 329 2579;ax: +1 403 329 2242.

E-mail address:olga.kovalchuk@uleth.ca (O. Kovalchuk).

as transit vehicles. Based on their toxic abilities, mals can be grouped as: essential and relatively non-(e.g. zinc); essential, but quite toxic at higher conctrations (e.g. copper), or non-essential but highly ctoxic (e.g. cadmium, lead)[1,2].

By the end of last century continuous contamtion of the environment with heavy metals resultea worldwide annual release of Cd in the amoun22,000 tons, Cu—954,000 tons, Pb—796,000 tonsZn—1,372,000 tons[3]. Heavy metals are able to slo

027-5107/$ – see front matter © 2004 Elsevier B.V. All rights reserved.doi:10.1016/j.mrfmmm.2004.10.004

150 I. Kovalchuk et al. / Mutation Research 570 (2005) 149–161

down plant growth significantly, contributing to a de-crease in crop yields. A number of previous studieshave shown the toxic effects of various heavy metals[4–13]. The toxic action of metals could be attributedto either cytotoxic or genotoxic effects. The toxicityof metals greatly depends on their ability to changetheir oxidation status, and thus to be involved in re-dox reactions involving the Fenton reaction. Metalssuch as Fe and Cu are believed to be the cofactorsin the conversion of hydrogen peroxide (H2O2) intohydroxyl radical (OH•−), an extremely toxic molec-ule.

The genotoxic affect of heavy metals lies in theirability to cause DNA damage leading to changes in ge-netic material[5,14]. Constant exposure to heavy met-als thus could significantly contribute to the inheritedchange of many phenotypical traits in the progeny ofexposed plants. Thus, evaluation of the mutagenecityof heavy metals is of the utmost importance in environ-mental studies. Analysis of the Cd and Pb toxicity is ofparticular importance as both are non-essential metalsthat can accumulate in the organism due to their longbiological half life—Cd, 18–30 years; Pb, 1500 years[15]. Cadmium is a mutagen that inhibits mismatchrepair by reducing the capacity for MMR of small mis-alignments and base–base mismatches[44]. It is alsobelieved that Cd carcinogenicity is associated with theinhibition of 8-oxoguanine-DNA glycosylase activity[11]. Importantly, Cd2+ does not catalyze Fenton-typereactions because it does not accept or donate electronsu -c syn-tr asc ndfi ltsi stab-l ist

no-t lantb r-rt ntlyd na tals.A neo stem

based on transgenic plants carrying a recombination-or mutation-reporter transgene allowing direct scor-ing of DNA damage repair (strand breaks for the re-combination reporter and point mutations for the mu-tation reporter), in a known but non-essential targetsequence. These plants, carrying disabled versions ofthe�-glucuronidase (GUS) gene have also been used tomonitor the mutagenic effects of oxidative stress gener-ating compounds, ionizing radiation or UV[22,24–26].Using these assay plants, we monitored heavy metalpolluted soil as well as analyzed the dose dependentinfluence of various concentrations of essential andnon-essential heavy metal salts on the genome stabilityof plants[23]. Despite existing research on the toxic-ity of heavy metal salts in plants, there are no reportsaddressing the changes that occur to global genometranscription. Which genes and pathways change theirexpression upon exposure to heavy metals? Are theeffects similar upon exposure to different heavy met-als? How do plants respond to non-essential heavymetals?

We report the toxicity analysis of two non-essential heavy metals, Cd and Pb, and show di-rect correlation between cytotoxicity (plant size androots length), and genotoxicity (frequency of homol-ogous recombination), with the uptake of metals byplants.

2. Materials and methods

2

teda ple-m Pb,f ndt ina-t 50a i-c d to5 ly-s

2

F ted

nder physiological conditions[16,17]. Cadmium acumulation in plants causes reductions in photohesis, diminishes water and nutrient uptake[18], andesults in visible symptoms of injury in plants suchhlorosis, growth inhibition, browning of root tips, anally death[19]. Lead accumulation in plants resun less severe effects. Although it has never been eished that Pb2+ is involved in the Fenton reaction, itheoretically possible.

The mechanisms of heavy metal toxicity and geoxicity have not been adequately investigated. Pioassays, such as theAllium cepachromosome abeation and micronucleus tests[20], the Tradescantiaests[21] and a number of transgenic tests receeveloped by our laboratory[22,23], have all beepplied to study the genetic effects of heavy mell varied in their sensitivity to the metals tested. Of the most sensitive tests, however, was the sy

.1. Plant growth and sampling

Plants of transgenic #651 line were germinand grown on agar containing MS medium supented with various concentrations of Cd and

rom 0 to 250�M. The relative size of the plants ahe roots was measured three weeks after germion. Approximately 200–300 plants exposed tond 100�M of Cd or Pb were taken for histochemal staining. Another group of the plants expose0�M of Cd or Pb was used for microchip anais.

.2. Histochemical staining procedure

Histochemical staining was done according to[57].or destructive staining plants were vacuum infiltra

I. Kovalchuk et al. / Mutation Research 570 (2005) 149–161 151

2× 10 min in sterile staining buffer containing 100 mg5-bromo-4-chloro-3-indolyl glucuronide (X-glu) sub-strate (Jersey Labs Inc., USA) in 300 mL 100 mM phos-phate buffer (pH 7.0), 0.05% NaN3, 0.05% Tween80, 1 mL dimethylformamide. Afterwards plants wereincubated at 37◦C during 48 h and bleached withethanol.

2.3. RNA preparation and microchip hybridization

Total RNA was isolated from ct and exposed toCd or Pb Arabidopsis tissue using Trizol reagent(Life Technologies) following the supplier’s proto-col. RNA was then further purified using the RNeasytotal RNA clean up protocol (Qiagen). The in-tegrity of the RNA samples was assessed by run-ning an aliquot of samples on RNA 6000 NanoLabChip (Agilent) using the 2100 bioanalyzer (Ag-ilent). Probe synthesis, hybridization and scanningwere done according to Affymetrix protocol. Twomicrochips per each treatment group (ct, Pb, Cd)were hybridized. Statistical analyses of the scanswere done with the help of the Kensington Dis-covery Edition version 1.8 (Inforsense). Mean val-ues of gene expression were calculated for eachgroup of two RNA samples prepared from 20 plantseach. The expression values of the treatment groupswere related to the respective controls and signifi-cance of the differences between the mean expres-sion values was assessed using a Student’st-test, two-t se-lc than1

2

CRw tis-s ple-m pere weret n-u hes Qi-a ibo-Gp was

performed in a total volume of 33�L for 1 h at 37◦Caccording to manufacturer protocol (You-Prime-First-Strand Kit, Amersham, UK).

2.5. Real-time PCR analysis

The following genes and primers were used forreal-time PCR: isocitrate lyase (AT3G21720), sense(5′ atggctgcatctttctctgtcc 3′), antisense (5′ tcacgggcagt-gtaagggcgcc 3′); glycosyl hydrolase (AT2G44460),sense (5′ taataacctcatggttgtcgg 3′), antisense (5′ ccac-cttcgcttgttgcacc 3′); cation transport protein chaC(AT5G26220), sense (5′ ttctttgatctggaacccag 3′), an-tisense (5′ ctccggtggattgctccagcg 3′); beta-glucosidase(AT3G60140), sense (5′ tttgggacagctgcctcggcg 3′), an-tisense (5′ ttttatgtcatccttgtaacg 3′); senescence-specificcysteine protease SAG12 (AT5G45890), sense (5′ ctc-catcactctttctcgtc 3′), antisense (5′ ttcacatccgcgtaga-cac 3′); pyruvate decarboxylase-1 Pdc1 (AT4G33070),sense (5′ caagccgacgaacggcgacg 3′), antisense (5′cgcgtcgcagtagttgatgg 3′); MADS-box protein AGL20(AT2G45660), sense (5′ ctttgtgatgctgaagtttctc 3′), an-tisense (5′ cttcagaaaccggtttggtgc 3′); wound-inducedprotein (AT4G10270), sense (5′ aagcaaagcatggacagtgg3′), antisense (5′ ggtaacggctgcggagacag 3′). Real-timePCR was performed in a total volume of 25�L using1�L of the 1st strand cDNA synthesis mixture as a tem-plate, 300 nM forward primer, 300 nM reverse primerand 12.5�L of 2× SYBRGreen PCR Master Mix (Ap-plied Biosystems). The duplicate reactions were carriedo ndc id,S clesa . Theu rec-oc go sti-m e ex-p A int taf n-t onicf werec , theaG -G ied

ailed, paired. For further in depth analysis weected those genes that had significantly (p< 0.05) in-reased or decreased their expression by more.5-fold.

.4. RNA preparation and reverse transcription

The total RNA samples used for the real-time Pere prepared exactly the same way, from treatedue of plants grown on normal agar or agar supented with Pb or Cd. Two independent samplesach treatment group were prepared. The samples

reated with DNAse I (Invitrogen) according to mafacturer’s instructions. After DNAse inactivation tamples were purified with RNEasy Mini-columns (gen). The RNA yields were measured using Rreen assay (Molecular Probes). Using 1.0�g of theurified RNA as a template, reverse transcription

ut with the 1:3 and 1:15 dilutions of the 1st straDNA synthesis mixture. A SmartCycler (Cepheunnyvale, CA) was used to perform the PCR cynd fluorescence was quantified against standardsniversal thermal cycling parameters were used asmmended (10 min activation at 95◦C, followed by 40ycles of 15 s at 95◦C and 30 s at 58–68◦C, dependinn primer pair). The melting temperatures were eated for every gene product. The standards for thression of each gene were amplified from the cDN

he following dilutions: 1�L, 1:4, 1:20, 1:100. The darom all three individual animals in every group (corol female and male, acute female and male, chremale and male) were combined and the averagesalculated. The actin RNA was used as a controlctin primers sequence was: sense 5′ ACTGGCATG-CCTTCCG 3′, antisense 5′ CAGGCGGCACGTCAATC 3′. Similarly, the actin reactions were carr

152 I. Kovalchuk et al. / Mutation Research 570 (2005) 149–161

in 1:3 and 1:15 dilutions. The data for all genes werestandardized against the actin data. Control wells con-taining SYBER Green PCR master mix and primerswithout sample cDNA emitted no fluorescence after40 cycles.

3. Results

3.1. Plants used in the paper

We used transgenicArabidopsis thalianaplants toanalyze homologous recombination (HR) events in a�-glucuronidase transgene in response to Cd and Pb. Thehomozygous transgenic line 651 used in the experimentcarries one copy per haploid genome of an overlapping,non-functional, truncated version the GUS marker geneas a recombination substrate[24] (Fig. 1A). The trans-gene activity can be restored via strand break-inducedhomologous recombination between the two repeats.Thus, cells in which events of HR have occurred canbe visualized due to restoration of the marker gene(Fig. 1B). These plants were also used for analysis ofthe phenotypical performance of plants, metal uptakeby plants as well as the microchip analysis of plantperformance.

Fs atione

3.2. Correlation of plant and root size with themetal uptake

We analyzed the relative size of the plants exposed tovarious concentrations (0–150�M) of Cd and Pb. Thesize of the plants exposed to Cd decreased proportion-ally to the increase in the concentration of cadmiumin agar and consisted of 10% of that of the controlwhen grown on 150�M. The relative size of plants ex-posed to Pb however did not change (Fig. 2). The sizeof the plants grown on Cd positively correlated withroot size (r = 0.79) and strongly negatively correlatedwith concentration of Cd in the agar and in the plant(r =−0.97 andr =−0.75) (Table 1). The size of theplants grown on Pb only weakly correlated with rootsize (r = 0.52) and concentration of the metal in the agar(r =−0.59).

Another interesting phenotypical change observedin exposed plants was the size of the roots. The root sizein plants exposed to Cd strongly negatively correlatedwith the concentration of cadmium in the agar and in theplant (r =−0.91 andr =−0.98, respectively) (Table 1).In contrast, the roots in plants exposed to 25–100�Mof Pb increased four-fold over the control; there wasa moderate positive correlation between the root size

F ; con-c s andt fm inp

ig. 1. Detection of recombination events inArabidopsis. (A) Thetructure of recombination substrate. (B) Detection of recombinvents inArabidopsisleaves.

ig. 2. Phenotypic appearance of plants exposed to Cd and Pbentration of metals in plants. The relative average size of planthe length of roots (in cm) are shown on “X” axis. Concentration oetals in the agar is shown on “Y” axis. Concentration of metalslants (in�M per gram of dry weight) is shown on “X” axis.

I. Kovalchuk et al. / Mutation Research 570 (2005) 149–161 153

Table 1Correlation between heavy metal (Cd, Pb) concentration in agar (Ca),in plant (Cp) and size of plant (Sp) and roots (Sr)

Gene Ca Sp Sr

CdSp −0.97 N/A N/ASr −0.91 0.79 N/ACp 0.98 −0.75 −0.98

PbSp −0.59 N/A N/ASr 0.31 0.52 N/ACp 0.98 −0.18 0.70

Correlation analysis (Excel 2000 software) was performed betweenconcentration of heavy metals in agar (Ca), in plant (Cp), size of plants(Sp) and roots (Sr). Negative numbers represent inversed correlation,whereas positive numbers represent direct correlation.

and lead concentration in plants (r = 0.70). We have noexplanation to this interesting phenomenon and foundno papers describing it. Importantly, similar data wasobtained for two different salts of Pb, Pb(CH3COO)2and Pb(NO3)2 (data not shown).

To analyze whether the phenotypical changes ob-served in plants exposed to Cd and Pb are related to themetal uptake, we analyzed the amount of metals accu-mulated in dry tissue weight and found a strong positivecorrelation between the amount of heavy metal in plantsand in agar (r = 0.98 for both, Cd and Pb) (Table 1).Interestingly, Cd accumulated in plants to a higher de-gree than Pb: the concentration of Cd in plants grownon agar with 100�M of the metal reached 0.6�M pergram of dry weight (gdw), whereas the concentrationof Pb reached only 0.17�M/gdw (Fig. 2).

3.3. Homologous recombination in plants exposedto Cd and Pb

To analyze whether there could be an additional ex-planation of the effect of Cd and Pb on plants, we com-pared the influence of similar concentrations of Cd andPb on plant genome stability. As a reflection of plantgenome stability we have chosen the analysis of homol-ogous recombination frequency. We analyzed the re-combination in plants exposed to 50 and 100�M of Cdor Pb. Surprisingly, we found recombination increasedonly in plants exposed to Cd—there was 2.7-fold in-crease in plants grown on 100�M of Cd (Fig. 3). Inc owno ad a

Fig. 3. Recombination frequency in plants exposed to Cd and Pb.Plants were grown on the medium supplemented with Cd and Pb of50 and 100�M. The “X” axis the average number of recombinationevents per plant as counted on 200–300 plants.

concentration dependent decrease in the plant and rootsize, increase of metal uptake and increase in the ho-mologous recombination. In contrast, plants exposed toPb had no change of plant size, very strong increase ofroot length, moderate increase of uptake and no changein recombination frequency.

3.4. Profiling of the Arabidopsis tissue withmicrochips

To understand what kind of changes occurred at thetranscription level in exposed plants, we analyzed tis-sue ofArabidopsisplant exposed to 50�M of Cd or Pb.This concentration was chosen as it caused minimalvisible damage to plants. For the microchip analysiswe took two samples (20 plants each), of tissue fromplants exposed for 21 days to Cd or Pb.

The averages of hybridization data for two mi-crochips per group were calculated. The average datafor plant tissue exposed to Cd- or Pb- were related tothe average data for plants grown on regular medium.After the two cut-offs: 1.5-fold change of the activityand statistical significance (p< 0.05), the number of up-and down-regulated genes for each group was obtained.Our analysis revealed 65 up- and 338 down-regulatedgenes in plants exposed to cadmium and 19 up- and 76down-regulated genes in plants exposed to lead (Fig. 4).A cross comparison between these two groups showedthat as many as 50% of genes that changed their expres-sion in plants exposed to lead, were similarly regulatedb teda -g asc at Pba ugh

ontrast, the recombination frequency in plants grn Pb was unchanged. Thus, plants grown on Cd h

y cadmium: nine genes were similarly up-reguland 38 genes were down-regulated (Fig. 4). The deree (fold to control) of up- or down-regulation womparable in both groups. This data suggests thnd Cd might have similar effect on plants, altho

154 I. Kovalchuk et al. / Mutation Research 570 (2005) 149–161

Fig. 4. Venn diagrams of up-regulated and down-regulated genes,Genes that changed their expression significantly (p< 0.05) by 1.5-fold are presented. Genes that change their expression in plant tissueexposed to Pb are shown in red. Genes that change their expressionin plant tissue exposed to Cd are shown in green. Genes that arecommonly regulated by Pb and Cd are shown in yellow. “PbD” and“Cd D” show genes that are down-regulated (among 22,196 genes)and “PbI” and “Cd I” show genes that are up-regulated (among22,078 genes). (For interpretation of the references to color in thisfigure legend, the reader is referred to the web version of this article.)

the influence of cadmium causes more genes to changetheir expression.

3.5. Grouping the genes that changed theirexpression by the pathways

In order to understand the kinds of genes regulatedby Cd or Pb, we have grouped up- and down-regulatedgenes into several categories, including unknowns,pathogen resistance, cell wall associated, signal trans-duction, oxidative stress, hormone response, nucleic

acid metabolism, transcription factors, general stress,sugar and lipid metabolism, calmodulins, protein andamino acid metabolism, transport and development andmorphogenesis (Fig. 5). Interestingly, there were dif-ferences in percentile distribution between the up- ordown-regulated groups; there was a larger percentageof up-regulated genes than down-regulated genes inthe “general stress” group (15 and 11% versus 6 and6% for Pb and Cd, respectively). Similarly, there weremore up-regulated than down-regulated genes in “pro-tein and amino acid metabolism” (18 and 20% versus10 and 12%) and “transport” groups (11 and 13% ver-sus 4 and 3%) for Pb and Cd, respectively (Fig. 5).In contrast, there were less up-regulated than down-regulated genes in groups of “signal transduction” (0%for both versus 5 and 8%), “nucleic acid metabolism”(0 and 1% versus 3 and 5%) and “transcription factors”(4% for both versus 12 and 6%) for Pb and Cd, respec-tively (Fig. 5). The other groups did not differ signif-icantly. Additionally, there was a large percentage ofgenes belonging to “oxidative stress”, “general stress”,“transport” as well as “sugar and lipid metabolism”and “protein and amino acid metabolism”. These fivegroups represented more than 75% of all known genesthat changed their regulation upon heavy metal treat-ment.

Several genes that changed their activity in our ex-periment were also shown to be regulated by other

Fig. 5. Major groups of up- and down-regulated genes, Up- (“PbI” and “Cd dt well as e, transpoe

o 14-different groups, including genes with unknown function astc.

I”) and down-regulated (“PbD” and “Cd D”) genes were distributegenes involved in signal transduction, oxidative stress responsrt

I. Kovalchuk et al. / Mutation Research 570 (2005) 149–161 155

Table 2Some specific genes that changed their activity upon Cd and Pb exposure

Gene ID Genes Cd Pb Previously reported

248918at Cysteine proteinaseSAG12 8.2 2.0 Developmentally regulated[29]254915at Cysteine proteinaseRD21A −2.3 Draught and salt-inducible[30]253657at Cd ATPase 3.1 Cd regulated[31,58]257947at Isocitrate lyase 14.8 −14.9 Mg2+ and Mn2+ regulated[27]246884at Cation transporter 5.9 4.6 Regulated by various metals[32]260126at Serine hydroxy-methyltransferase 2.3 2.5 Binding Zn[33]; induced by Pb[34]262133at Sulfate transporter 2.5 2.0 Cd, Se induced sulfate uptake[35,36]255105at Sulfate transporter 4.6 1.6259133at Sugar transporter 3.9 2.4253203at Arginine decarboxylase 2.7 2.0 Induced by Cd[37]258362at Seryl-tRNA synthetase 1.6 2.9263515at Histidine biosynthesis 2.2 Histidine decarboxylase, Pb-induced[34]248434at Mitochondria heat shock protein 3.0 HPS70 was Pb-induced[34]264524at Branched-chain amino-transferase 2.9 2.2 Down-regulated by Pb[34]

Oxidative stress related266746s at GlutathionS-transferase, putative −1.5 −3.3 [7,47–50]262119s at GlutathionS-transferase, putative −2.6262518at GlutathionS-transferase 3.2 1.8266267at GlutathionS-transferase, putative 2.0253099s at Peroxidase-like −2.0246149at Peroxidase ATP N 3.0 2.3261606at Peroxidase, putative 2.9250798at Peroxidase 2.2264809at Superoxide dismutase (SOD) −2.7 1.9266165at SOD, Cu/Zn, putative −2.4 2.0

stress factors. The most interesting gene that we ob-served was isocitrate lyase. The gene was strongly up-regulated by Cd and strongly down-regulated by Pb(Table 2). It was also shown that Mg2+, Mn2+ andPO4

3− differentially influenced isocitrate lyase activ-ity: Mg2+ was activating, whereas Mn2+ and PO4

3− in-hibiting the conversion of fats to carbohydrates[27,28](Table 2). Cystein proteinaseSAG12was induced 2.0-fold by Pb and 8.2-fold by Cd in our experiment.It was previously shown to be specifically activatedby developmentally-controlled senescence pathwaysbut not by stress[29]. Draught and salt-inducible[30] cystein proteinaseRD21Awas down-regulatedby Cd (−2.3). It was previously shown that inhibi-tion of H(+)ATPase leads to Cd accumulation[31].Thus, it is possible that increase expression ofCdATPaseregulates the Cd uptake in plants (Table 2).Another gene similarly regulated by both Cd and Pb,was the cation transporterchaC(up-regulated 4.6- and5.9-fold, respectively). Cation transporters were gen-erally shown to be regulated by various heavy met-als [32]. Serine hydroxymethyltransferase was also

similarly up-regulated by Cd and Pb (2.3- and 2.5-fold) (Table 2). Katayama et al. showed this proteinto be a Zn-binding protein, thus, it is possible that itcould also be a Cd-binding protein[33]. It was alsoinduced in rat astrocytes upon 24 h exposure to lead[34]. We also found a number of sulfate transportersto be up-regulated by Cd and Pb (Table 2). Interest-ingly, Cd and Se in concentrations of 10–250�M in-duced sulfate uptake[35,36]. Another gene induced byCd, arginine decarboxylase, was also up-regulated inour experiment (2.7-fold by Cd and 2.0-fold by Pb)[37].

Besides the commonly regulated genes, there wasa number of genes differentially regulated by expo-sure to Cd and Pb (Fig. 4; Supplementary Table 1). Pbexposure selectively down-regulated four different cy-tochromes P450, WRKY1 transcription factor, GCN5-relatedN-acetyltransferase, peroxidase, calcium bind-ing protein and SPF-1-like protein (Table 1S). Ex-posure to Cd, on the other hand, resulted in down-regulation of a number of genes, including peroxi-dases, histon H1 and several major latex proteins. There

156 I. Kovalchuk et al. / Mutation Research 570 (2005) 149–161

Table 3Real-time PCR data

Gene Pb 50 Pb 100 Cd 50 Cd 100

Isocitrate lyase (257947at) −5.7 (−14.9) −4.5 17.1 (14.7) 40.8Glycosyl hydrolase (267389at) 3.8 (6.3) 4.3 11.3 (9.3) 8.7Cation transport protein chaC (246884at) 3.5 (4.6) 5.1 2.2 (5.9) 2.9beta-Glucosidase (251428at) 1.7 (N/C) 2.4 9.4 (13.9) 15.1Senescence-specific cysteine proteaseSAG12(248918at) 2.4 (2.0) 2.7 6.2 (8.2) 5.3Pyruvate decarboxylase-1 (253416at) −4.9 (−5.0) −3.3 −4.3 (−2.6) −4.1MADS-box protein (267509at) −3.2 (−2.0) −2.4 −6.2 (−5.3) −6.9Wound-induced protein (255807at) −2.3 (−2.5) −2.9 −3.7 (−2.3) −4.1

The real-time PCR data is presented as a ratio to control. Original data was calculated as an average from four reactions (two independent runsfrom each of two independent RNA preparations). The microchip data is in parentheses. “N/C” stands for not changed. Affimetrix gene ID is inparenthesis.

were also uniquely up-regulated genes in plants ex-posed to Cd only. Several different peroxidases, gluco-syltransferases,�-glucosidases, germin-like proteinsas well as alanine acetyl transferase, senescence spe-cific cystein protease (SAG12), PR1 precursor wereup-regulated by Cd only. Interestingly, we found Cdefflux adenosine triphosphatase (transporting ATPase)to be 3.1-fold up-regulated by exposure to Cd but notto Pb.

3.6. Real-time PCR confirmation of the geneexpression

In order to confirm the validity of the mi-crochip approach, we performed real-time PCRanalysis of the expression of eight genes com-monly or differentially up-regulated by Cd andPb. The following genes were analyzed: isocitratelyase (257947at); glycosyl hydrolase (267389at);cation transport protein chaC (246884at); beta-glucosidase (251428at); senescence- specific cysteineproteaseSAG12(248918at); pyruvate decarboxylase-1 (253416at); MADS-box protein (267509at) andwound-induced protein (255807at) (Table 3). Thegenes were selected based on the fact that they are sim-ilarly regulated by both metals and could be involved invarious types of stress response, including metal, saltand radiation stresses.

Importantly, most of the genes we analyzed byreal-time PCR had similar changes to those observedi imi-l , wec enesu -

ilar trend in regulation of these genes was observed(Table 3).

4. Discussion

We analyzed the influence of various concentrationsof Cd and Pb on the phenotypic and genotypic appear-ance ofArabidopsisplants. We found substantial dif-ferences in the plant response to these two metals. Itappeared that Cd was more cytotoxic to plants—therewas a significant decrease in plant size and root length.Similarly, we found Cd to be more genotoxic thanPb—there was an increase in recombination frequencyin plants exposed to Cd but not to Pb. Moreover, globalgenome expression analysis of tissue exposed to heavymetals revealed greater number genes changed their ac-tivity under the influence of Cd than of Pb. Importantly,it should be noted that most of the observed differencescould be due to the four-fold higher accumulation ofCd in plant tissue.

4.1. Changes in the plant size and the root length

It was shown that Scots pine roots accumulate upto 15�M of Cd while grown on medium containing50�M of cadmium[7]. In contrast,Arabidopsisplantsin our study accumulated Cd to a lesser extent, up to0.6�M. This study corroborates our previous data thatshowed Cd accumulated five-fold more efficiently thanP onso tes;C herc

n microchip analysis. To understand whether sar changes occur at higher metal concentrationshecked the expression of the aforementioned gnder the influence of 100�M of Cd or Pb. A sim

b[23]. Vazquez et al. showed different accumulatif Cd and Pb in different species of aquatic bryophyd appeared to accumulate intracellularly to a higoncentration than Pb[38].

I. Kovalchuk et al. / Mutation Research 570 (2005) 149–161 157

Inhibition of root growth by Cd was reported pre-viously;Arabidopsisplants grown for 10 days on ver-tical medium supplemented with 10�M of cadmiumhad a root size of only 15–20% of that of the plantsgrown without Cd[7,39]. In our paper, this inhibitionwas observed only in plants grown on medium con-taining 75–100�M of Cd. Such a difference could bedue to various factors, including the medium compo-sition, light intensity, length of the exposure as wellas the growth of plants on vertical plates[39] versushorizontal plates (current paper).

The fact of the induced root growth in plants exposedto Pb is of special interest as no papers report such aphenomenon. We further analyzed the root length inplants exposed to higher doses of lead, 200, 250 and300�M (data not shown). We noticed that plants grownon 200�M had roots twice as long as roots of plantsgrown on control medium. In contrast, plants grownon 250�M of Pb had roots half as long as roots ofplants grown on control medium. Further increase oflead concentration to 300�M resulted in severe rootgrowth inhibition; these plants had root size of about10% of that of control plants. It should be noted, how-ever, that concentrations of 250–300�M of Pb alsoresulted in inhibition of plant growth (data not shown).

4.2. Changes in recombination

Our current data shows a recombination increase inplants exposed to Cd but not to Pb. In contrast, ourp re-c ed et-a lt oft eent sizeo gousr rongc

tionb thea ho-c seD[a wasip

sulted in increased number of single- and double-strandbreaks at 1–10�M, and decreased number of breaksat 100�M [10]. Lead, at a concentration of 100�M,caused chromatin condensation[10]. Condensed chro-matin prevents the occurrence of homologous recom-bination. This could be a reason why we did not ob-serve the increase of HR upon the exposure of plantsto 50–100�M of Pb.

Lead did not prove to be a strong mutagen in mam-malian cells in culture, although it was reported to in-duce point mutations in CHO cells at concentrationsless than 0.4�M [41]. It was shown previously thatlead at a concentration of 3.8�g/m3 in the air, couldnot increase DNA single strand breaks in human lym-phocytes, although it did so in the presence of con-stant exposure to metals such as cobalt and cadmium(8�g/m3) [12].

Analysis of hundreds of cadmium sites in three-dimensional protein structures indicated that Cd hasa preference for cysteine, glutamate, aspartate andhistidine ligands in tetrahedral geometries[42]. Thehigh affinity for cysteine may promote specific bind-ing to MMR components, inhibiting enzyme functions[43,44]. Additionally, it was shown that Cd diminishesthe capacity of the cell to repair oxidative DNA damageby inactivating the mammalian 8-oxoguanin glycosy-lase Ogg1[11]. Cadmium (II) was shown to inhibitthe bacterial formamidopyrimidine-DNA glycosylase(Fpg), the mammalian xeroderma pigmentosum groupA protein (XPA), and the poly(adenosine diphosphate-r d-d blem s re-c weh uta-t re-s hi-b ts.A ulds d.

4

bero n,c ionsa s re-s 0;

revious data showed both Cd and Pb to induceombination and mutation in plants[23]. The probablifference is due to the higher concentration of the mls we used in this experiment. A significant resu

his work is the strong correlation we observed betwhe concentration of Cd in medium and plants, thef the plants and roots and the increase in homoloecombination. In contrast, there was no such storrelation for Pb.

Interestingly, Hengstler et al. showed a correlaetween the concentration of Cd but not of Pb inir and DNA single strand breaks in human lympytes[40]. Also, Dally and Hartwig showed Cd to cauNA strand breaks in concentration as little as 10�M

4]. We observed Cd to induce recombination at 50�M,lthough our previous data showed recombination

nduced at much lower concentrations[23]. Direct ex-osure of human lymphocytes to 1–100�M of Pb re-

ibose)polymerase (PARP)[9]. This data creates aitional levels of complexity regarding the possiechanisms responsible for increasing homologou

ombination in plants exposed to Cd. Importantly,ave previously shown that Cd induced point m

ions in plants[23]. This also could have been theult of inactivation of 8-oxoguanin glycosylase, inition of Fpg, XPA, PARP as well MMR componenll the mentioned above Cd effects undoubtedly woeverely affect appearance of plants exposed to C

.3. Global genome expression

Plants respond to heavy metal toxicity in a numf different ways including immobilization, exclusiohelation and compartmentalization of the metals well as the expression of more general stresponse mechanisms[6,45](reviewed in Cobbett, 200

158 I. Kovalchuk et al. / Mutation Research 570 (2005) 149–161

Clements, 2001). Analysis of hyperaccumulators suchasThlaspi caerulescens, Arabidopsis halleriandSac-charomyces cerevisiae, revealed that increased metaluptake is primarily caused by the high activity of var-ious transporters[8,13,46]. In our current experimentwe also observed a significant percent of transport re-lated genes to be up-regulated by Cd and Pb, 13 and11%, respectively (Fig. 5). However, similar regula-tion of transport related genes would not explain thedifference in metal uptake as observed here. Anotherinteresting phenomenon observed previously was theinfluence of heavy metals on protein and amino acidmetabolism, especially on cysteine, glutamate, aspar-tate, methionine, serine, arginine and histidine biosyn-thesis[29,33,34,37,42]. The genes that belonged tothe group of “protein and amino acid metabolism” ac-counted for 10–20% of the genes that changed theiractivity under the influence of Cd and Pb (Fig. 5).

Another group of genes regulated by Cd and Pb be-longed to the oxidative stress related genes (Table 2).Data presented by Dixit et al. shows the up-regulationof antioxidative enzymes superoxide dismutase (SOD),catalase (CAT), ascorbate peroxidase (APX) and glu-tathioneS-transferase (GST) by 7 days exposure of peato 4 and 40�M of cadmium[47]. Interestingly, data ofSchutzendubel et al. showed that the expression pat-tern of the aforementioned antioxidative enzymes hasa great variation within the first 48 h after plant (Scottpine) exposure to cadmium[7]. Six hours after expo-sure the activity of the SOD was increased, whereas theat sed.A eda -t ctlyi ida-t

eat-m ca essc vary(c tra-t SHa

ex-p icer eins

(MT1 and MT2), kinases (MAPK 14), proton pump AT-Pase as well as a broad groups of various SODs, CATs,peroxidases and GSTs[51]. Similarly, the data of Tsan-garis et al. showed that lymphocytes treated with Cd inconcentrations of 10 and 20�M for 6–24 h changed theexpression of a number of kinases, including ERK5,MAPK3, MAPKK7, JAK3 [52]. The exposure of ratastrocytes to 10�M of Pb for 24 h also showed a num-ber of genes changed their expression: tyrosine pro-tein kinase FRK, G-protein coupled receptor kinase,VEGF, several GSTs, HSP70, serine hydroxymethyl-transferase etc.[34].

The literature indicates that up-regulation of var-ious kinases and receptors, seems to be an early re-sponse to cadmium and lead stress. Curiously, in ourexperiment we did not observe significant changes inthe regulation of protein kinases. The “signal trans-duction” genes must have been “on” very early in theplant response and after 21 days of exposure, most ofthem would be back to normal expression or even per-haps down-regulated. It also seemed that the early cellresponse to stress involves a significantly larger num-ber of up-regulated genes than down-regulated genes[34,51,52]. In contrast, this is not true for long-termexposure; in both cases (Cd or Pb), we observed moredown-regulated than up-regulated genes.

From the genes that were differentially regulated byCd and Pb following genes were found to be stress-exposure regulated: germin-like, cytochrome P450,major latex protein (MLP) (Supplementary Table 1).G d byvI o-t eseg s at-t ero Pb.S hu-m ea re toC nget thy-l ino tressp s,g s andP eralle

ctivity of the systems involved in H2O2 removal (glu-athione/glutathione reductase, CAT, APX) decreaPX and CAT activity was significantly up-regulatt 24 h and decreased at 48 h[7]. Despite such varia

ion, the data suggests that Cd, although not direnvolved in the Fenton type reaction, causes the oxive stress.

Lead also showed oxidative potential. The pretrent with antioxidants such asN-acetylcysteine, lipoicid or taurine significantly reduced oxidative straused by lead exposure of Chinese hamster oCHO) cells or Fisher rat cells[48,49]. Similarly toadmium, exposure of CHO cells to Pb in concenion of 0.5 mM for 20 h, resulted in a decrease of Gnd increase of CAT activity[50].

Microarray analysis of changes in bone cell generession early after cadmium gavage (2–4 h), in mevealed a number of genes, including metallothion

ermin-like protein genes were shown to be inducearious stresses including heavy metal stress[53,54].nterestingly, we found two different germin-like prein genes were up-regulated by Cd only. Role of thenes in the Cd response/detoxification deserve

ention in the future. Similarly, we found the numbf P450 phytochromes to be down-regulated byimilar effect of lead was previously reported inan ovarian granulosa cells[55]. MLP genes wermong the genes down-regulated by the exposud only. MLP genes were shown before to cha

heir activity upon the pathogen and hormone (eene) stresses[56]. Overall, exposure to Cd resultedverexpression of a number of genes involved in srotection. Among those were glucosyltransferase�-lucosidase, peroxidases, stress-related proteaseR1 precursor (Supplementary Table 1). The ovffect of Pb was less pronounced.

I. Kovalchuk et al. / Mutation Research 570 (2005) 149–161 159

Although it is important to understand what is hap-pening within a cell upon initial exposure to a high con-centration of heavy metal, chronic exposure is morerelevant for plants. It is not surprising that the typeof the changes observed during periods of short-termexposure would be significantly different from thosein long-term exposure. Ideally, a direct comparisonof “acute” short-term exposure versus “chronic” long-term exposure performed on the same organism is re-quired. Significant similarities observed upon the ex-posure to lead or cadmium suggest that plants possess acommon response mechanism to non-essential metals.It would also be interesting in the future to comparethe plant response to essential (Cu, Zn) versus non-essential metals (Cd, Pb) presented in different physi-ological (for essential metals) or life threatening con-centrations.

Acknowledgements

We want to thank Edward Oakeley for his help inanalysis of microchip data and Chris Picken for crit-ical reading of the manuscript. We acknowledge theNSERC Operating grants to IK and OK as well as fi-nancial support of Novartis Research Foundation.

Appendix A. Supplementary data

ar-t at1

R

of984,

leic

en-

a-ian

vy. 420

[6] S. Clemens, Molecular mechanisms of plant metal toleranceand homeostasis, Planta 212 (2001) 475–486.

[7] A. Schutzendubel, P. Schwanz, T. Teichmann, K. Gross, R.Langenfeld-Heyser, D. Godbold, A. Polle, Cadmium-inducedchanges in antioxidative systems, hydrogen peroxide content,and differentiation in Scots pine roots, Plant Phys. 127 (2001)887–898.

[8] S. Clemens, M. Palmgren, U. Kramer, A long way ahead: un-derstanding and engineering plant metal accumulation, TrendsPlant Sci. 7 (2002) 309–315.

[9] A. Hartwig, M. Asmuss, I. Ehleben, U. Herzer, D. Kostelac, A.Pelczer, T. Schwedtle, A. Burkle, Interference by toxic metalions with DNA repair processes and cell cycle control: molec-ular mechanisms, Environ. Health Perspect. 110 (2002) 797–809.

[10] K. Wozniak, J. Blasiak, In vitro genotoxicity of lead acetate:induction of single and double DNA strand breaks and DNA-protein cross-links, Mutat. Res. 535 (2003) 127–139.

[11] D. Zharkov, T. Rosenquist, Inactivation of mammalian 8-oxoguanin-DNA glycosylase by cadmium(II): implicationsfor cadmium genotoxicity, DNA Repair 1 (2002) 661–670.

[12] J. Palus, K. Rydzynski, E. Dziubaltowska, K. Wyszynska, A.Natarajan, R. Nilsson, Genotoxic effects of occupational expo-sure to lead and cadmium, Mutat. Res. 540 (2003) 19–28.

[13] W.-Y. Song, et al., Engineering tolerance and accumulation oflead and cadmium in transgenic plants, Nat. Biotechnol. 21(2003) 914–919.

[14] A. Hartwig, Current aspects in metal genotoxicity, Bio. Metals8 (1995) 3–11.

[15] C. Gisbert, R. Ros, A. De Haro, D. Walker, P. Bernal, R. Serrano,J. Navarro-Avino, A plant genetically modified that accumulatesPb is especially promising for phytoremediation, Biochem. Bio-phys. Res. Commun. 303 (2003) 440–445.

[16] D. Lloyd, P. Carmichael, D. Phillips, Comparison of the forma-′ ble-

hem.

[ r andlogy

[ in

[ iron.

[ n-197

[ om-u-

[ nicused54–

[ si-om-

Supplementary data associated with thisicle can be found, in the online version,0.1016/j.mrfmmm.2004.10.004.

eferences

[1] N. Horn, in: O.M. Rennert, W.-Y. Chan (Eds.), MetabolismTrace Metals in Man, vol. 2, CRC Press, Boca Raton, FL, 1pp. 26–52.

[2] D. Thiele, Metal-regulated transcription in eukaryotes, NucAcids Res. 20 (1992) 1183–1191.

[3] B.J. Alloway, D.C. Ayres, Chemical Principles of Environmtal Pollution, Chapman and Hall, London, 1993.

[4] H. Dally, A. Hartwig, Induction and repair inhibition of oxidtive DNA damage by nickel(II) and cadmium(II) in mammalcells, Carcinogenesis 18 (1997) 1021–1026.

[5] S. Knasm̈uller, et al., Detection of genotoxic effects of heametal contaminated soils with plant bioassays, Mutat. Res(1998) 37–48.

tion of 8-hydroxy-2-deoxyguanosine and single- and doustrand breaks in DNA mediated by Fenton reactions, CRes. Toxicol. 11 (1998) 420–427.

17] M. Waisberg, P. Joseph, B. Hale, D. Beyersmann, Moleculacellular mechanisms of cadmium carcinogenesis, Toxico192 (2003) 95–117.

18] L. Sanita di Toppi, R. Gabbrielli, Response to cadmiumhigher plants, Environ. Exp. Bot. 41 (1999) 105–130.

19] H. Kahle, Response of roots of trees to heavy metals, EnvExp. Bot. 33 (1993) 99–119.

20] G. Fiskesj̈o, The Allium test—an alternative in environmetal studies: the relative toxicity of metal ions, Mutat. Res.(1988) 243–260.

21] H. Steinkellner, et al., Genotoxic effects of heavy metals: cparative investigation with plant bioassays, Environ. Mol. Mtagen. 31 (1998) 183–191.

22] I. Kovalchuk, O. Kovalchuk, A. Arkhipov, B. Hohn, Transgeplants are sensitive bioindicators of nuclear pollution caby the Chernobyl accident, Nat. Biotechnol. 16 (1998) 101059.

23] O. Kovalchuk, V. Titov, B. Hohn, I. Kovalchuk, A sentive transgenic plant system to detect toxic inorganic c

160 I. Kovalchuk et al. / Mutation Research 570 (2005) 149–161

pounds in the environment, Nat. Biotechnol. 19 (2001) 568–572.

[24] P. Swoboda, S. Gal, B. Hohn, H. Puchta, Intrachromosomalhomologous recombination in whole plants, EMBO J. 13 (1994)484–489.

[25] H. Puchta, P. Swoboda, B. Hohn, Induction of homologousDNA recombination in whole plants, Plant J. 7 (1995) 203–210.

[26] I. Kovalchuk, J. Filkowski, K. Smith, O. Kovalchuk, The dual-istic nature of radicals: the high–low phenomenon, Plant CellEnviron. 26 (2003) 1531–1539.

[27] E. Giachetti, P. Vanni, Effect of Mg2+ and Mn2+ on isocitratelyase, a non-essentially metal-ion-activated enzyme. A graphi-cal approach for the discrimination of the model for activation,Biochem. J. 276 (1991) 223–230.

[28] F. Ranaldi, P. Vanni, E. Giachetti, Multisite inhibition of Pinuspinea isocitrate lyase by phosphate, Plant Physiol. 124 (2000)1131–1138.

[29] Y.S. Noh, R.M. Amasino, Identification of a promoter regionresponsible for the senescence-specific expression of SAG12,Plant Mol. Biol. 41 (1999) 181–194.

[30] M. Koizumi, K. Yamaguchi-Shinozaki, H. Tsuji, K. Shinozaki,Structure and expression of two genes that encode distinctdrought-inducible cysteine proteinases inArabidopsis thaliana,Gene 129 (1993) 175–182.

[31] R. Boominathan, P.M. Doran, Organic acid complexation,heavy metal distribution and the effect of ATPase inhibitionin hairy roots of hyperaccumulator plant species, J. Biotechnol.101 (2003) 131–146.

[32] E. Lombi, K.L. Tearall, J.R. Howarth, F.J. Zhao, M.J.Hawkesford, S.P. McGrath, Influence of iron status on cad-mium and zinc uptake by different ecotypes of the hyperaccu-mulatorThlaspi caerulescens, Plant Physiol. 128 (2002) 1359–1367.

[33] A. Katayama, A. Tsujii, A. Wada, T. Nishino, A. Ishihama,Systematic search for zinc-binding proteins inEscherichia coli,

[ vs-in

001)

[ m-002)

[ ito,in-t

[ ett-pu-986)

[ et-hree. 44

[ Cad-orter

family in Arabidopsiswith homology to Nramp genes, Proc.Natl. Acad. Sci. U.S.A. 9 (2000) 4991–4996.

[40] J. Hengstler, et al., Occupational exposure to heavy metals:DNA damage induction and DNA repair inhibition prove co-exposures to cadmium, cobalt and lead as more dangerous thanhitherto expected, Carcinogenesis 24 (2003) 63–73.

[41] M. Ariza, M. Williams, Lead and mercury mutagenesis: typeof mutation dependent upon metal concentration, J. Biochem.Mol. Toxicol. 13 (1999) 107–112.

[42] J.M. Castagnetto, S.W. Hennessy, V.A. Roberts, E.D. Getzoff,J.A. Tainer, M.E. Pique, MDB: the metalloprotein database andbrowser at The Scripps Research Institute, Nucleic Acids Res.30 (2002) 379–382.

[43] K. Hopfner, J. Tainer, Rad50/SMC proteins and ABC trans-porters: unifying concepts from high-resolution structures,Curr. Opin. Struct. Biol. 13 (2003) 249–255.

[44] Y. Jin, et al., Cadmium is a mutagen that acts by inhibitingmismatch repair, Nat. Genet. 34 (2003) 239–241.

[45] C. Cobbett, Phytochelatins and their roles in heavy metal detox-ification, Plant Physiol. 123 (2000) 825–832.

[46] Pence, et al., The molecular physiology of heavy metal trans-port in the Zn/Cd hyperaccumulatorThlaspi caerulescens, Proc.Natl. Acad. Sci. U.S.A. 97 (2000) 4956–4960.

[47] V. Dixit, V. Pandey, R. Shyam, Differential antioxidative re-sponses to cadmium in roots and leaves of pea (Pisum sativumL. cv. Azad), J. Exp. Bot. 52 (2001) 1101–1109.

[48] N. Ercal, P. Treeratphan, T.C. Hammond, R.H. Matthews, N.H.Granneman, D.R. Spitz, In vivo indices of oxidative stress inlead-exposed C57BL/6 mice are reduced by treatment withmeso-2,3-dimercaptosuccinic acid orN-acetylcysteine, FreeRadic. Biol. Med. 21 (1996) 157–161.

[49] H. Gurer, H. Ozgunes, S. Oztezcan, N. Ercal, Antioxidant roleof alpha-lipoic acid in lead toxicity, Free Radic. Biol. Med. 27(1999) 75–81.

[50] H. Gurer, H. Ozgunes, E. Saygin, N. Ercal, Antioxidant effectiron.

[ ico-of

mium73–

[ ou-e al-s on

[ : an

[ ucedDun-

[ ard,lev-

r beta03)

Eur. J. Biochem. 269 (2002) 2403–2413.34] C.M. Bouton, M.A. Hossain, L.P. Frelin, J. Laterra, J. Pe

ner, Microarray analysis of differential gene expressionlead-exposed astrocytes, Toxicol. Appl. Pharmacol. 176 (234–53.

35] F.F. Nocito, L. Pirovano, M. Cocucci, G.A. Sacchi, Cadmiuinduced sulfate uptake in maize roots, Plant Physiol. 129 (21872–1879.

36] N. Yoshimoto, H. Takahashi, F.W. Smith, T. Yamaya, K. SaTwo distinct high-affinity sulfate transporters with differentducibilities mediate uptake of sulfate inArabidopsisroots, PlanJ. 29 (2002) 465–473.

37] L.H. Weinstein, R. Kaur-Sawhney, M.V. Rajam, S.H. Wlaufer, A.W. Galston, Cadmium-induced accumulation oftrescine in oat and bean leaves, Plant Physiol. 82 (1641–645.

38] M.D. Vazquez, J. Lopez, A. Carballeira, Uptake of heavy mals to the extracellular and intracellular compartments in tspecies of aquatic bryophyte, Ecotoxicol. Environ. Saf(1999) 12–24.

39] S. Thomine, R. Wang, J. Ward, N. Crawford, J. Schroeder,mium and iron transport by members of a plant metal transp

of taurine against lead-induced oxidative stress, Arch. EnvContam. Toxicol. 41 (2001) 397–402.

51] A. Regunathan, D.A. Glesne, A.K. Wilson, J. Song, D. Nlae, T. Flores, M.H. Bhattacharyya, Microarray analysischanges in bone cell gene expression early after cadgavage in mice, Toxicol. Appl. Pharmacol. 191 (2003) 2293.

52] G.T. Tsangaris, A. Botsonis, I. Politis, F. TzortzatStathopolou, Evaluation of cadmium-induced transcriptomterations by three color cDNA labeling microarray analysia T-cell line, Toxicology 178 (2002) 135–160.

53] D. Patnaik, P. Khurana, Germins and germin like proteinsoverview, Indian J. Exp. Biol. 39 (2001) 191–200.

54] M. Nakata, T. Shiono, Y. Watanabe, T. Satoh, Salt stress-inddissociation from cells of a germin-like protein with Mn-SOactivity and an increase in its mRNA in a moss, Barbulaguiculata, Plant Cell Physiol. 43 (2002) 1568–1574.

55] C. Taupeau, J. Poupon, D. Treton, A. Brosse, Y. RichV. Machelon, Lead reduces messenger RNA and proteinels of cytochrome p450 aromatase and estrogen receptoin human ovarian granulosa cells, Biol. Reprod. 68 (201982–1988.

I. Kovalchuk et al. / Mutation Research 570 (2005) 149–161 161

[56] B. Ruperti, et al., Characterization of a major latex protein(MLP) gene down-regulated by ethylene during reach fruitletabscission, Plant Sci. 163 (2002) 265–272.

[57] R.A. Jefferson, M. Bevan, T. Kavanagh, The use of theEs-cherichia colibeta-glucuronidase as a gene fusion marker for

studies of gene expression in higher plants, Biochem. Soc.Trans. 15 (1987) 17–28.

[58] T.V. Nedelkoska, P.M. Doran, Hyperaccumulation of cadmiumby hairy roots ofThlaspi caerulescens, Biotechnol. Bioeng. 67(2000) 607–615.