Transcriptome analysis identifies a zinc finger protein ...Integrative Biology, 15. Zhejiang...

- 1 -

Short title: Dof regulates kiwifruit starch degradation 1

Corresponding author details: 2

Xueren Yin 3

Zhejiang Provincial Key Laboratory of Horticultural Plant Integrative Biology, 4

Zhejiang University, Zijingang Campus, 310058 Hangzhou, PR China 5

E-mail, [email protected] 6

7

Transcriptome analysis identifies a zinc finger protein regulating 8

starch degradation in kiwifruit 9

10

Ai-di Zhang1,2, Wen-qiu Wang1,2, Yang Tong1, Ming-jun Li3, Donald Grierson1,4, Ian 11

Ferguson1,5, Kun-song Chen1,2, Xue-ren Yin1,2* 12

13

1 Zhejiang Provincial Key Laboratory of Horticultural Plant Integrative Biology, 14

Zhejiang University, Zijingang Campus, Hangzhou, PR China 15

2 The State Agriculture Ministry Laboratory of Horticultural Plant Growth, 16

Development and Quality Improvement, Zhejiang University, Zijingang Campus, 17

Hangzhou, PR China 18

3 State Key Laboratory of Crop Stress Biology in Arid Areas/College of Horticulture, 19

Northwest A&F University, Yangling, PR China 20

4 Plant & Crop Sciences Division, School of Biosciences, University of Nottingham, 21

Sutton Bonington Campus, Loughborough, UK 22

5 New Zealand Institute for Plant & Food Research Limited, Private Bag 92169, 23

Auckland, New Zealand 24

25

One sentence summary: 26

An ethylene responsive C2H2-type zinc finger transcription factor, AdDof3, regulates 27

starch degradation in kiwifruit via trans-activation of the AdBAM3L promoter. 28

Plant Physiology Preview. Published on August 22, 2018, as DOI:10.1104/pp.18.00427

Copyright 2018 by the American Society of Plant Biologists

www.plantphysiol.orgon January 30, 2020 - Published by Downloaded from Copyright © 2018 American Society of Plant Biologists. All rights reserved.

mailto:[email protected]

http://www.plantphysiol.org

- 2 -

29

Author contributions: 30

X.Y. and K.C. designed the study; A.Z., W.W. and Y.T. performed the experiments and 31

analyses, with input from all other authors; M.L. contributed to the stable 32

transformation and analyses; A.Z., D.G., I.F. and X.Y. wrote the manuscript. All 33

authors read and approved the final manuscript. 34

35

Funding: 36

This research was supported by the National Key Research and Development Program 37

(2016YFD0400102), the National Natural Science Foundation of China (31722042), 38

the Natural Science Foundation of Zhejiang Province, China (LR16C150001), the Fok 39

Ying Tung Education Foundation, China (161028, 20170101210004) and the 111 40

Project (B17039). 41

42

Address correspondence to [email protected] 43

44

Abstract 45

Ripening, including softening, is a critical factor in determining postharvest shelf-life 46

of fruit and is controlled by enzymes involved in cell wall metabolism, starch 47

degradation and hormone metabolism. Here, we used a transcriptomics-based 48

approach to identify transcriptional regulatory components associated with texture, 49

ethylene and starch degradation in ripening kiwifruit (Actinidia deliciosa). Twelve 50

differentially expressed structural genes— including seven involved in cell wall 51

metabolism, four in ethylene biosynthesis and one in starch degradation— and 14 52

transcription factors (TFs) induced by exogenous ethylene treatment and inhibited by 53

the ethylene signalling inhibitor 1-methylcyclopropene were identified as changing in 54

transcript levels during ripening. Moreover, analysis of the regulatory effects of 55

differentially expressed genes (DEGs) identified a zinc finger TF, DNA BINDING 56

WITH ONE FINGER (AdDof3), which showed significant trans-activation on the 57


mailto:[email protected]


- 3 -

AdBAM3L (β-amylase) promoter. AdDof3 physically interacted with the AdBAM3L 58

promoter, and stable overexpression of AdBAM3L resulted in lower starch content in 59

transgenic kiwifruit leaves, suggesting that AdBAM3L is a key gene for starch 60

degradation. Moreover, transient overexpression analysis showed that AdDof3 61

upregulated AdBAM3L expression in kiwifruit. Thus, transcriptomics analysis not 62

only allowed prediction of some ripening regulating genes but also facilitated 63

characterization of a TF, AdDof3, and a key structural gene, AdBAM3L, in starch 64

degradation. 65

Key words: Fruit ripening, cell wall, Dof transcription factor, ethylene, kiwifruit, 66

starch degradation, stable transformation 67

68

Introduction 69

Ripening is a programmed process involving substantial changes in fruit quality 70

properties, such as color, aroma, flavor and texture (Prasanna et al., 2007; Klee and 71

Giovannoni, 2011). The overall process of fruit ripening, however, is that of 72

senescence, accompanied by fruit quality deterioration and postharvest loss (Seymour 73

et al., 2013). Thus, the postharvest control of ripening is critical for the fruit industry. 74

In tomato (Solanum lycopersicum), multiple regulators of fruit ripening have been 75

identified, such as Ripening-inhibitor (Rin, Vrebalov et al., 2002), Colorless 76

non-ripening (CNR, Manning et al., 2006), Never-ripe (Nr, Wilkinson et al., 1995), 77

APETALA2a (AP2a, Karlova et al., 2011), etc. Transgenic studies of such genes in 78

tomato fruit, or use of mutants, has shown the impacts of these genes on fruit ripening. 79

However, such studies have been less frequent in other fruit crops, especially 80

perennial fruit where transgenic studies and the availability of mutants is limited. 81

Moreover, the function of these ripening regulators may differ in various crops, e.g. 82

tomato rin mutant (Vrebalov et al., 2002) and FaMADS9 83

(MCM1/AGAMOUS/DEFICIENS/SRF(MADS)-box) antisense transgenic strawberry 84

(Fragaria x ananassa Duch.) fruit (Seymour et al., 2011) inhibit or retard ripening, 85

while MdMADS8/9-suppressed apples (Malus x domestica) have a phenotype of small 86



- 4 -

fruit with reduced flesh (Ireland et al., 2013). These findings highlight the need for 87

investigations on ripening regulation in different fruit types and species. 88

Kiwifruit (Actinidia), one of the most recently domesticated fruit crops, now has 89

global distribution (Huang et al., 2001). Its rise as an important economic crop has led 90

to extensive research on regulation of kiwifruit ripening. It is a typical climacteric 91

fruit exhibiting an ethylene burst and also is particularly sensitive to ethylene 92

(McDonald and Harman, 1982). Postharvest ripening indices for kiwifruit are similar 93

to those in other fruit, including starch degradation/soluble solids accumulation, 94

ethylene biosynthesis, cell wall metabolism, and volatile emission (Atkinson et al., 95

2011). A number of structural genes related with these physiological changes have 96

been characterized, but most are associated with multiple gene families involved with 97

regulation of fruit softening (CkPGA/B/C, polygalacturonase, Wang et al., 2000; 98

AdXTH4/5/6/7/8/10/13, xyloglucan endotransglucosylase/hydrolase, Atkinson et al., 99

2009; AdBAM3L/3.1/9, AdAMY1 α-amylase, AdAGL3 α-glucosidase, Hu et al., 2016), 100

and prove difficult to manipulate in relation to genetic improvement. Other genes 101

have been identified with multiple quality traits, e.g. knock-down of AdACO1 102

(1-aminocyclopropane-1-carboxylic acid oxidase) resulted in less ethylene production 103

and firm fruit but lower levels of the quality attributes of aroma and flavor (Atkinson 104

et al., 2011). 105

In terms of regulating fruit ripening, targeting transcription factors (TFs) is an 106

alternative option. In tomato, the above-mentioned CNR and RIN genes encode SBP 107

(SQUAMOSA promoter binding protein) and MADS TFs (Dong et al., 2013). Other 108

TFs have also been shown to be involved in fruit ripening, mostly characterized in 109

tomato, including AP2/Ethylene Response Factor (eg. SlERF6, Lee et al., 2012; 110

SlERF.B3-SRDX, Liu et al., 2014), NAC (eg. SlNAC1/4, Ma et al., 2014; Zhu et al., 111

2014; Meng et al., 2016), and Homeobox (eg. LeHB1, Lin et al., 2008). In other fruit 112

species, potential roles of TFs in fruit ripening have been identified (Xie et al., 2016), 113

but few have full or partial functional characterization. Citrus CitERF13 is a regulator 114

of ethylene-driven fruit postharvest degreening via binding and regulation of the 115

CitPPH (pheophorbide hydrolase) promoter (Yin et al., 2016); a jasmonate (JA) 116



- 5 -

responsive MdMYC2 transcription factor mediates JA regulation of ethylene 117

biosynthesis and apple fruit ripening (Li et al., 2017). 118

In the present research, we analyzed three major ripening traits in kiwifruit, 119

including texture (firmness and cell wall components), ethylene production, and 120

starch degradation (as well as total soluble solids (TSS)). We performed 121

transcriptomic analysis on ethylene- and 1-methylcyclopropene (1-MCP)-treated fruit 122

with the aim of identifying the most responsive TFs and structural genes during fruit 123

ripening. Using the dual-luciferase assay, multiple TFs showed regulatory effects on 124

different promoters, including trans-activation by AdDof3 on a starch degradation 125

gene (AdBAM3L). Furthermore, electrophoretic mobility shift assays (EMSAs) 126

indicated specific cis-elements of the AdBAM3L promoter for AdDof3 binding. We 127

investigated the functions of AdDof3 and AdBAM3L, as well as their in vivo regulation 128

in fruit, with stable transformation (analysis using leaves) or transient overexpression 129

in kiwifruit (analysis with the core tissues at two sites within a single fruit). This 130

strategy provided insights into the molecular basis of starch degradation during 131

kiwifruit ripening. 132

133

Results 134

Analyses of kiwifruit ripening 135

Ethylene treatment significantly accelerated fruit ripening, with treated fruit 136

reaching the ethylene climacteric peak of 81.4 nl g-1 h-1 at 8 days in storage (DIS), 137

which was higher and occurred earlier than that of control fruit, which peaked at 17 d 138

with 30.2 nl g-1 h-1 production. Ethylene production was inhibited in 1-MCP-treated 139

fruit and was therefore undetectable over the whole experimental period (Fig. 1a). 140

Starch degradation is considered the first sign of kiwifruit postharvest ripening 141

and also contributes to the TSS. Starch content decreased from 61.5 mg/g at 0 DIS to 142

1.5 mg/g at 18 DIS in control fruit. In ethylene-treated fruit, starch content rapidly 143

decreased to 1.9 mg/g by 8 DIS. 1-MCP-treated fruit exhibited a significantly slower 144

rate of decrease with 24.3 mg/g starch remaining at 18 DIS (Fig. 1b). TSS showed the 145



- 6 -

opposite trends to starch content, increasing from 6.2% at 0 DIS to 15.6% at 18 DIS 146

for the control fruit. In ethylene- and 1-MCP-treated fruit, TSS reached 15.2% at 8 147

DIS and 11.7% at 18 DIS, respectively (Fig. 1b). 148

Changes in fruit firmness were similar to those of starch content. 149

Ethylene-treated fruit reached an ‘eating-ripe’ stage (firmness of 7.9 N) at 6 DIS 150

whereas control fruit reached a similar firmness (7.4 N) at 18 DIS (Fig. 1c). In parallel 151

with fruit softening, extractable cell wall materials (CWM) also decreased, with the 152

decrease accelerated by ethylene and inhibited by 1-MCP (Fig. 1c). With regard to 153

main cell wall components, in general only cellulose and covalent binding pectin 154

(CBP) showed similar patterns to that of fruit firmness. Both cellulose and CBP 155

contents were relatively lower in ethylene-treated and higher in 1-MCP-treated fruit. 156

Water soluble pectin (WSP) content showed an increasing trend during ripening (Fig. 157

1c). Both hemicellulose and ionic soluble pectin (ISP) decreased during fruit ripening, 158

but their decreasing rate and contents were similar among the three treatments (Fig. 159

1c). 160

161

Expression of TF and structural genes during ripening 162

RNA-seq provided an overview of genes differentially expressed during ripening 163

and in response to exogenous ethylene and 1-MCP treatments. The transcript 164

abundances of genes were estimated by fragments per kilobase of exon per million 165

fragments mapped (FPKM). The boxplot distribution of the log10FPKM values in 166

Supplemental Fig. S1a showed that the median and quartile values of the expression 167

values across the libraries compared for differential expression were comparable. De 168

novo assembly also predicted a total of 4542 genes which have not appeared in the 169

‘Hong Yang’ genome database annotated by COG, GO, KEGG, KOG, Pfam, eggnog, 170

Swiss-Prot and nr databases (Supplemental Fig. S1b). At 1 and 4 DIS, 6326 and 3994 171

DEGs were found between the control and ethylene treatments, while only 25 and 34 172

DEGs were found between the control (CK) and 1-MCP treatments (Supplemental Fig. 173

S1c, d). KEGG pathway analysis revealed that the DEGs between control and 174

ethylene treatments were mainly enriched in carbon metabolism, biosynthesis of 175



- 7 -

amino acids and starch and sucrose metabolism at both 1 and 4 DIS (Supplemental 176

Fig. S1e, f). 177

The selective thresholds were set using a false discovery rate (FDR) ≤0.01, 178

estimated absolute log2fold change >2, FPKM ratio of CK/ETH >40 or 179

ETH/1-MCP >100 and the highest FPKM values >9. Thirteen target genes, including 180

four ethylene biosynthesis genes, eight cell wall-related genes, one starch degradation 181

gene (Fig. 2a) and 14 transcription factors (Fig. 2b) emerged from all DEGs 182

(Supplemental Table S1). Expression of the 13 structural genes positively associated 183

with kiwifruit postharvest ripening and softening, as all genes were induced by 184

ethylene treatment and suppressed by 1-MCP (Fig. 2). This was verified by reverse 185

transcription quantitative PCR (RT-qPCR) for all genes (Fig. 3) except AdAFC1 (acid 186

β-fructofuranosidase, Supplemental Fig. S2). However, these structural genes also 187

showed different responses to exogenous and internal ethylene. AdXTH5, AdXTH6, 188

AdACO5 and AdACO7 were responsive to ethylene treatment and peaked at 1 or 2 189

DIS, then declined to similar basal levels of the control and 1-MCP-treated fruit. 190

AdPME1 (pectin methyl esterase), AdPL2 (pectin lyase), AdMAN1 191

(endo-β-mannanase), AdBAM3L and AdACO1 were rapidly up-regulated by ethylene 192

treatment and then showed a significantly higher expression peak at the ethylene 193

climacteric peak (17 DIS for control and 4-8 DIS for ethylene-treated fruit). 194

Expression of AdPG1, AdPL1 and AdACS1 (1-aminocyclopropane-1-carboxylate 195

synthase) followed the pattern of the ethylene climacteric peak (Fig. 3). In contrast to 196

the expression patterns of structural genes, 11 transcription factors were putative 197

activators and were up-regulated by ethylene (Fig. 4a), while AdbZIP1 (basic leucine 198

zipper protein), AdDof3 and AdHB1 were putative repressors down-regulated by 199

ethylene treatment (Fig. 4b). In general, all of these structural genes and transcription 200

factors could be potential candidates involved in programming kiwifruit ripening. It 201

should be noted that we only looked at three key ripening processes in the present 202

study, and other structural genes involved in fruit ripening could also be targets for 203

these transcription factors. 204

205



- 8 -

In vivo regulation of ripening-associated TFs and structural genes 206

The regulatory effects of ripening-associated TFs on structural genes were tested 207

using the dual-luciferase assay. Although these TFs and structural genes had very 208

obvious associations at the transcript level, limited in vivo interactions were found 209

between them (Fig. 5). AdDof4 acted as a repressor on promoters of AdPL1 and 210

AdACS1 where luciferase activity (LUC/REN value) was reduced to approx. 0.5. 211

AdNAC5 and AdWRKY1 both targeted the AdACS1 promoter, with 3.7- and 2.3-fold 212

induction, respectively. The AdBAM3L promoter was only up-regulated by AdDof3, 213

with an approx. 3-fold induction. Except for these regulatory effects, relations of the 214

other ripening-associated TFs and structural genes remained unclear. 215

216

Investigation of AdDof3 binding elements on the AdBAM3L promoter 217

Based on the dual-luciferase assays (Fig. 5) and RNA-seq results (Supplemental 218

Fig. S1), the mechanism of AdDof3 regulation on the AdBAM3L promoter was 219

selected for further investigation. Firstly, subcellular localization results indicated that 220

AdDof3 located at the nucleus (Fig. 6a), which is similar to most TFs. The core 221

binding sequence for the Dof family is AAAG/CTTT (Yanagisawa et al., 1999). In the 222

region of the AdBAM3L promoter (-1790 to -1 bp), six motifs were found (Fig. 6c). 223

EMSA results indicated that the region (-160 to -200 bp) that contains the other three 224

motifs showed the binding band in the presence of AdDof3 (Fig. 6b and d). 225

In order to determine the exact binding site between -160 to -200 bp, eight 226

different probes were designed with deletion or mutagenesis (Fig. 6b). EMSA showed 227

that AdDof3 could bind to the probes of P-abc (probe with three motifs), P-a, P-bc and 228

P-ab, but not the probe P-c (Fig. 6d). These results suggested that AdDof3 physically 229

binds to the AdBAM3L promoter (sites ‘a’ and ‘b’), which was further confirmed by 230

mutated probes. In the presence of AdDof3, P-Δabc (probe with b and c motifs and 231

mutated a motif) and P-aΔbc showed binding signals with different intensity, while 232

the P-ΔaΔbc failed to generate any visible binding signal (Fig. 6d). Moreover, the 233

shifted band disappeared with the addition of an unlabeled competitor with the same 234

sequence P-abc. 235



- 9 -

236

Stable transformation suggests AdBAM3L is an important gene for starch 237

degradation in kiwifruit 238

For most perennial fruits, it is difficult to perform stable transformation due to 239

low efficiency and long periods required for growth and development. Here, 240

AdBAM3L was overexpressed in ‘Qinmei’ (Actinidia deliciosa) tissue cultured 241

plantlets. Although the aim of the present research is fruit ripening, only leaves from 5 242

month plantlets on Murashige and Skoog (MS) medium were used for transgenic 243

verification and phenotype analyses (Fig. 7a), due to the very slow growth rate of 244

kiwifruit plantlets (Supplemental Fig. S3). Firstly, the integration of AdBAM3L into 245

the genome was confirmed by conventional PCR analyses (Fig. 7b). Further analysis 246

by RT-qPCR (Fig. 7c) and GUS staining (Fig. 7d) confirmed the overexpression of 247

AdBAM3L in the two transgenic lines. The expression of AdBAM3L in transgenic 248

plants (lines 4 and 6) was more than 10-fold higher than in the WT (Fig. 7c). Starch 249

analyses indicated that both transgenic lines had lower starch contents in leaves than 250

the WT plants (Fig. 7e, f). At the same period (about 5 months), leaves of WT plants 251

contained 60 mg/g fresh weight (FW) starch, while the transgenic lines (line-4 and 252

line-6) only contained 6.20 and 9.98 mg/g FW starch, respectively (Fig. 7f). 253

254

Transient overexpression analyses suggest regulation of AdBAM3L by AdDof3 255

during kiwifruit ripening 256

The results from the dual-luciferase assay, EMSA and stable transformation 257

analyses suggest a regulatory pathway between AdDof3 and AdBAM3L. AdDof3 258

could contribute to kiwifruit ripening via physical binding and activation on the 259

promoter of AdBAM3L, a key gene of starch degradation. Further experiments were 260

designed to test the proposed regulatory model in kiwifruit. Transient overexpression 261

experiments were carried out in ‘Hayward’ fruit core tissue because this tissue has 262

high permeability and provides the ideal single fruit control with two ends (Fig. 8a). 263

RT-qPCR analyses indicated that the expression of AdDof3 and AdBAM3L was similar 264

in the two different fruit ends (Supplemental Fig. S4). Thus, one end of the core tissue 265



- 10 -

was infiltrated with Agrobacterium tumefaciens strain EHA105 as control, and the 266

other injected with AdDof3-pCAMBIA1301-EHA105 (Fig. 8b). GUS staining showed 267

that the strain with the vector carrying AdDof3 not only infiltrated into the kiwifruit 268

core tissue but was also translated and functioned normally, while the control tissue 269

had no visible GUS staining (Fig. 8b). 270

Fruit at two different stages of maturity were selected for transient expression 271

experiments, including immature fruit (80 days after full bloom, DAFB) and 272

commercially mature fruit (170 DAFB). Both AdDof3 and AdBAM3L expression 273

levels were much higher in the mature fruit core tissue than in immature fruit (Fig. 8c, 274

d). The abundances of AdDof3 and AdBAM3L transcripts increased at 1 d and 2 d after 275

AdDof3 infiltration in both stages. Injecting with AdDof3 resulted in 16.1% (1 d after 276

injection) and 25.2% (2 d after injection) reductions in 80 DAFB samples, and 12.5% 277

(1 d after injection) and 9.0% (2 d after injection) reductions in 170 DAFB samples 278

(Supplemental Fig. S5). However, these reductions were not significant at p<0.05 279

level. 280

281

Discussion 282

Characterization of genes associated with postharvest ripening of kiwifruit by 283

transcriptomics analysis 284

Kiwifruit is an ideal species for studying fruit ripening and softening and 285

contains four distinct softening phases (Atkinson et al., 2011). Here, the measurement 286

of three characteristic indices (ethylene production, firmness, starch content) indicated 287

that ripening and softening of ‘Hayward’ kiwifruit was, as expected, accelerated by 288

ethylene and retarded by 1-MCP, as previously reported in kiwifruit (Koukounaras et 289

al., 2007; Atkinson et al., 2011; Mworia et al., 2012). 290

Transcriptomic analysis indicated there were more than 5000 DEGs between 291

ethylene-treated and control fruit at 1 d, which is consistent with general ideas on the 292

multigenic traits of fruit ripening. Our selective analysis identified 12 structural genes 293

related to ethylene biosynthesis, cell wall and starch degradation. As only three 294



- 11 -

characteristic traits were selected in this research, it is likely that additional DEGs will 295

exist for the other ripening-related traits, such as aroma, sugar and acid degradation 296

(Nieuwenhuizen et al., 2015; Tang et al., 2016). In addition, 14 TFs reached the 297

selective threshold set for DEGs, with 11 putative activators and 3 putative repressors, 298

based on their sequence similarity with previously published sequences. Unlike the 299

structural genes, these 14 TFs could be potential regulators of any aspect of kiwifruit 300

ripening, including other ripening traits in addition to softening, starch and ethylene. 301

Most of these structural genes have been previously reported from gene expression or 302

activity analyses (AdXTH5/6, Atkinson et al., 2009; AdBAM3L, Hu et al., 2016; 303

AdACO1, Xu et al., 1998) or functional analysis (AdACS1, Atkinson et al., 2011). 304

However, some new genes, such as a PG gene (AdPG1) and two PLs (AdPL1/2), were 305

identified in the present work and may contribute to kiwifruit pectin solubilization and 306

softening. For hemicellulose degradation, isolation of another new gene, AdMAN1, 307

suggests a potential metabolic pathway for hemicellulose degradation in addition to 308

the role of the XTHs (Cutillasiturralde et al., 1994; Atkinson et al., 2009). It is 309

particularly interesting that AdPG1 could not be found in the current version of the 310

kiwifruit genome database. Of the TFs identified, only AdERF10 and AdERF64 have 311

been previously reported from gene expression analysis (Yin et al., 2010; Zhang et al., 312

2016), and all others were newly identified regulator genes potentially implicated in 313

controlling kiwifruit ripening and quality. 314

315

Characterization of multiple links between TFs and ripening-related genes 316

Ripening-associated TFs have been widely reported in various fruit; however, 317

most (especially from perennial fruit) have only been characterized through 318

correlations between gene transcripts and fruit ripening. Few TFs have reported 319

regulatory effects on target genes, e.g. a number of tomato fruit ripening regulators 320

(Rin, Vrebalov et al., 2002; CNR, Manning et al., 2006; Nr, Wilkinson et al., 1995; 321

AP2a, Karlova et al., 2011), a few banana (Musa acuminata) ripening related genes 322

(MabHLH6, basic Helix-Loop-Helix, Xiao et al., 2017; MaDREB1-MaDREB4, 323

dehydration responsive element binding protein, Kuang et al., 2017; MaERF9, 324



- 12 -

MaDof23, Feng et al., 2016), apple ERF genes (MdCBF, Tacken et al., 2010; 325

MdERF2, Li et al., 2016), and papaya (Carica papaya) CpERF9 (Fu et al., 2016). 326

Here, among 14 TFs, at least four (AdDof3, AdDof4, AdNAC5 and AdWRKY1) 327

showed significant regulatory activity on different target kiwifruit ripening genes, 328

suggesting potential roles in ripening and softening. AdDof3 was an activator on the 329

AdBAM3L promoter, AdNAC5 and AdWRKY1 were activators for the AdACS1 330

promoter, and AdDof4 was a repressor on both AdPL1 and AdACS1 promoters. In 331

kiwifruit, AdERF9 has been characterized as a regulator of the AdXTH5 promoter 332

(designated AdXET5, Yin et al., 2010). Thus, the roles of these TFs on fruit 333

ripening-related genes may provide new information on kiwifruit ripening regulation. 334

Compared to the model fruit tomato and perennial fruit banana and apple, our 335

results appear to show previously uncharacterized links between TFs and 336

ripening-related genes. In tomato, PL was recently characterized as an important 337

regulator for fruit softening (Yang et al., 2017) and long shelf-life (Uluisik et al., 338

2016), but its transcriptional regulation remains unclear. In tomato, high-resolution 339

mapping showed that a QTL contained an ERF and three PME genes (Chapman et al., 340

2012). In apple, an ERF gene (MdCBF) was also characterized as an activator of the 341

apple MdPG (Tacken et al., 2010). In kiwifruit, the physiology analysis also 342

confirmed that pectin degradation is important for postharvest softening. Thus, the 343

regulation of AdDof4 on AdPL1 suggests a regulatory link between TFs and pectin 344

modification. 345

In general, the interactions between the four TFs (AdDof3, AdDof4, AdNAC5 and 346

AdWRKY1) and ripening-related genes were not only benefit to understand kiwifruit 347

ripening, but also provided new examples for other fruit species. The differences 348

between the present results in kiwifruit and previous findings from other fruit, while 349

probably reflecting species differences, could also be due to the selective threshold 350

setting. Thus, homologs of the ripening-related TFs from other fruit may also exist in 351

kiwifruit. Moreover, the structural genes were only limited to ethylene response and 352

cell wall and starch degradation, thus the 10 other TFs still retain the potential for fruit 353

ripening regulation via other ripening-related genes. 354



- 13 -

355

Functional verification of the role of AdBAM3L as a key gene in starch 356

degradation 357

The two AdBAM3L overexpressed transgenic lines of kiwifruit showed obvious 358

phenotypes. The transgenic lines had low gene expression levels and lower starch 359

contents. In addition, sucrose content was higher in transgenic lines, but fructose and 360

glucose contents were similar (Supplemental Fig. S6). Thus, the transformation and 361

expression analysis (both postharvest ripening and on-tree development) suggests that 362

AdBAM3L is a key gene for kiwifruit starch degradation (Fig. 3; Supplemental Fig. 363

S7). For perennial fruit, stable transformation is extremely difficult and has only been 364

used in a few species (e.g. papaya, apple). Thus, most fruit-related genes (except for 365

tomato) have been characterized with in vitro molecular biology platforms. Among 366

the three structural genes (AdPL1, AdBAM3L and AdACS1) that could be regulated by 367

differentially expressed TFs, AdBAM3L was one of the predicted starch degradation 368

related genes from our previous research, using various postharvest treatments and 369

RT-qPCR (Hu et al., 2016). Thus, the functional verification of AdBAM3L with 370

overexpression analysis in kiwifruit is an extension of previous results, with the 371

approach providing a shortcut to overcoming long-term transformation in kiwifruit 372

(Supplemental Fig. S3) and also the basis for selections of AdDof3-AdBAM3L 373

interactions for further analysis. The associations between expression of BAM, as well 374

as some other structural genes, and ripening have been previously reported in fruit, 375

such as kiwifruit (Tang et al., 2016; Hu et al., 2016), banana (Xiao et al., 2017), and 376

Poncirus trifoliate (Peng et al., 2014). However, none of these genes had been 377

functionally characterized with stable transformation. 378

379

In vitro and in vivo regulation of AdBAM3L by AdDof3 380

The dual-luciferase assay showed that AdDof3 trans-activated the promoter of 381

AdBAM3L, which is further supported by the associations between AdDof3 and 382

AdBAM3L expression in both developing kiwifruit (Supplemental Fig. S7) and fruit 383

undergoing postharvest ripening (Fig. 2). EMSA analyses further indicated that 384



- 14 -

AdDof3 physically bound to AAAG/CTTT elements within the AdBAM3L promoter, 385

which is similar to Dof homologs from other plants. For instance, a maize (Zea mays) 386

Dof class protein, PBF (prolamin-box binding factor), can trans-activate the γ-zein 387

gene promoter by binding to the AAAG motif (Marzabal et al., 2008). Moreover, 388

ZmDof3 recognized and bound to the AAAG core sequence in promoters of the starch 389

biosynthesis genes Du1 and Su2 in maize and functioned as a positive regulator (Qi et 390

al., 2017). Similar to these plants, AdDof3 is a direct activator on the AdBAM3L 391

promoter and may contribute to starch degradation in kiwifruit. Banana MabHLH6 is 392

also an activator of starch degradation genes via physical binding to target promoters 393

(Xiao et al., 2017). Here, AdDof3 provided another type of regulator on fruit starch 394

degradation. 395

Moreover, while MabHLH6 showed regulatory function on starch degradation 396

genes based on EMSA and dual-luciferase assays, its regulatory function in banana 397

fruit remains unclear. Transient expression experiments have been widely used for 398

gene function analysis in various fruit species (Akagi et al., 2009; Li et al., 2017), but 399

the precision of such analyses is largely influenced by bias that is generated between 400

different fruit tissues (discs or slices) and also different fruits. Our results indicate that 401

kiwifruit core tissue had very high water permeability and the two ends of the fruit 402

had similar gene expression levels (Fig. 8), thus providing an ideal system for 403

transient overexpression analysis. With the benefit of this system, as well as GUS 404

staining (Fig. 8), AdDof3 was shown to regulate AdBAM3L in vivo in ‘Hayward’ 405

kiwifruit, in both immature (80 DAFB) and mature fruit (170 DAFB). However, 406

analysis of the starch contents in transient overexpressed tissues indicated that 407

AdDof3 could reduce starch contents compared to the empty control (SK), which is 408

consistent with its regulation of starch degradation genes. However, the reduction was 409

not statistically significant (Supplemental Fig. S5). To find out whether such an effect 410

is significant requires more extended transient overexpression experiments or stable 411

transformation. 412

413

Conclusions 414



- 15 -

Transcriptomic analysis predicted 12 structural genes (for ethylene biosynthesis, 415

cell wall degradation, and starch degradation) and 14 TFs that showed high potential 416

for fruit ripening regulation. Moreover, analysis of relationships between these TFs 417

and structural genes indicated previously uncharacterized novel potential 418

transcriptional regulation links, including four TFs (AdDof3, AdDof4, AdNAC5 and 419

AdWRKY1) and three structural genes (AdBAM3L, AdACS1 and AdPL1). Most 420

significantly, using stable transformation, EMSA, and transient analysis, AdBAM3L 421

was confirmed as a key regulator of kiwifruit starch degradation, which could be 422

trans-activated by AdDof3 via binding on AAAG/CTTT elements. Thus, the present 423

findings advance our understanding of the regulation of fruit starch degradation, a 424

critical step for both fruit initial ripening and the ultimate fruit flavor contributed by 425

soluble sugars. 426

427

Materials and Methods 428

Plant material and treatments 429

Mature kiwifruit (Actinidia deliciosa [A. Chev.] C.F. Liang et A.R. Ferguson var. 430

deliciosa cv. Hayward) were harvested from a commercial orchard, Shanxi, China in 431

2015, with mean TSS of 6.19%. Fruits of uniform size free from visible defects were 432

selected and divided into three batches for three treatments. Each treatment contained 433

three biological replicates of approximately 200 fruit. The fruit were treated with 434

ethylene (100 μl l-1, 24 h, 20 oC), 1-MCP (1 μl l-1, 24 h, 20 oC) or air as the control (24 435

h, 20 oC) in 20 L air-tight containers, respectively. After treatment, the fruit were 436

transferred to normal air at 20 oC. At each sampling point, 3 replicates of 4 fruit were 437

collected from each batch. The outer pericarp (without skin or seeds) of the fruit was 438

cut into small pieces and rapidly frozen in liquid nitrogen and then stored at -80 oC for 439

further experiments. 440

441

Fruit physiological properties 442

A number of kiwifruit postharvest quality properties were measured, including 443



- 16 -

ethylene production, TSS and starch content, firmness, and CWM. Ethylene was 444

measured by gas chromatography (Agilent Technologies 7890A GC System) and 445

firmness using a TA-XT2i texture analyzer (Stable Micro systems, UK), with the 446

same parameters as described in our previous report (Zhang et al., 2016). TSS were 447

measured using an Atago digital hand-held refractometer (Tokyo, Japan). Two ends of 448

each fruit were sliced and then three drops of juice squeezed from each slice onto the 449

refractometer. Ethylene was measured with three replicates (4 fruit in each replicate) 450

for each treatment. Firmness and TSS were measured with ten single fruit replicates. 451

Total starch was measured on three replicates of 0.1 g frozen samples using a 452

total starch assay kit (Megazyme International Ireland Ltd., Wicklow, Ireland), 453

following a method described previously (Stevenson et al., 2006; Hu et al., 2016). 454

Starch contents were measured from frozen fruit flesh with three biological replicates. 455

CWM extraction and isolation was performed as described previously with slight 456

modifications (Vicente et al., 2013; Minas et al., 2014). The CWM extractions were 457

performed on three biological replicates. For each extraction, approximately 3.0 g of 458

frozen fruit flesh was placed in 20 mL of 80% (V/V) ethanol and boiled for 20 min. 459

After centrifuging at room temperature, the low molecular weight solutes and 460

insoluble materials were separated. The supernatant was discarded and sediments 461

were sequentially washed with 80% (V/V) ethanol, chloroform: methanol (1:1) and 462

acetone and dried at 40 oC for 24 h. The dried residue was collected and weighed. 463

Approximately 50 mg CWM from each sample was used to determine the contents of 464

different cell wall components. Firstly, they were suspended in 6 mL of 50 mM acetic 465

acid-sodium acetic buffer (pH 6.5) and stirred at 20 oC for 6 h, then centrifuged and 466

vacuum filtered. The filtrate were designated as WSP. Secondly, the residue was 467

suspended in 6 mL of 50 mM acetic acid-sodium acetic buffer (pH 6.5) with 50 mM 468

ethylene diamine tetraacetic acid (EDTA), for 6 h continuous shaking. After 469

centrifugation, the supernatant was filtered and measured as ISP. Thirdly, the 470

EDTA-insoluble pellet was extracted with 6 mL of 50 mM Na2CO3 at 4 oC for 18 h, 471

then turned to 20 oC shaking for 2 h. The slurry was centrifuged and the supernatant 472

was filtered as CBP. Subsequently, the residue was extracted with 3 mL of 4 M KOH 473



- 17 -

at 20 oC for 5 h continuous shaking, and the supernatant was designated as 474

hemicellulose content. Finally, the insoluble residue was washed with 3 mL of 0.3 M 475

acetic acid and 6 mL of 80% (V/V) ethanol and then centrifuged. The pellet was dried 476

at 40 oC and weighted as α-cellulose. Pectin and hemicellulose were measured 477

according to reported protocols (Blumenkrantz and Asboe-Hansen, 1973; Yemm and 478

Wills, 1954). For pectin, 3 mL H2SO4 was added to 0.5 mL extracting solution and 479

boiled for 20 minutes. The mixture was cooled down to room temperature and 0.2 mL 480

carbazole-anhydrous ethanol (1.5 g/L) added. After 30 min standing, absorbance was 481

measured at 530 nm. Hemicellulose content was determined by the anthrone-sulfuric 482

acid method. The hemicellulose extracting solution comprised 5 mL anthrone reagent 483

(2 g anthrone dissolved in 80% H2SO4, and diluted with 80% H2SO4 to 1000 mL). The 484

mixture was heated in a 100 oC water bath for 10 min. After cooling to room 485

temperature, absorbance measurements were made at 625 nm. The results were 486

expressed as mg GalA (galacturonic acid) /g FW and mg Glu (glucose) /g FW, 487

respectively. 488

489

RNA extraction and RNA-seq 490

Total RNA was extracted from frozen kiwifruit flesh following our previous 491

protocol (Yin et al., 2008). For RNA-seq, at least 1.0 µg RNA from each sampling 492

point (1 d and 4 d) and each treatment (control, 1-MCP, ethylene) were sent for 493

sequencing. Three replicates were used for RNA-seq. 494

RNA-seq and bioinformatics analyses were conducted by Biomarker (Beijing, 495

China). The library constructions were carried out following the manufacturer’s 496

instruction of NEBNext Ultra RNA Library Prep Kit for Illumina (NEB, E7530) and 497

NEBNext Multiplex Oligos for Illumina (NEB, E7500), and were sequenced with 498

Illumina HiSeqTM 4000 sequencing platform. Transcriptome analysis used reference 499

genome-based reads mapping. The clean reads filtered from raw data were mapped to 500

the Hong Yang (Actinidia chinensis) genome database using Tophat2 software (Kim et 501

al., 2013). Low quality reads were removed by perl script (unknown nucleotides >5%, 502



- 18 -

or low Q-value≤20%). FPKM were used to estimate gene expression levels by the 503

Cufflinks software (Trapnell et al., 2010). FDR was used to identify the p-value 504

threshold in multiple texts. Sequences were compared against various protein 505

databases, including NCBI (the National Center for Biotechnology Information), Nr 506

(non-redundant protein) and Swiss-Prot (a manually annotated and reviewed protein 507

sequence database) by a cut-off E-value of 10-5. Gene function was annotated with 508

GO (gene ontology), KO (KEGG ortholog database), Swiss-Prot and Nr annotation. 509

GO enrichment analysis of the DEGs was carried out using Wallenius non-central 510

hyper-geometric distribution based on GOseq R packages (Young et al., 2010), which 511

can adjust for gene length bias in DEGs. KEGG is a database resource for 512

understanding high-level functions and utilities of the biological system (Kanehisa et 513

al., 2008). KOBAS software was used to test the statistical enrichment of DEGs in 514

KEGG pathways (Mao et al., 2005). 515

516

cDNA synthesis and RT-qPCR 517

For cDNA synthesis, TURBO Dnase (Ambion) was used for removing 518

contaminating genomic DNA. Reverse Transcription System (Promega) was used as 519

cDNA synthesis. Three biological replicates with three independent RNA extractions 520

and cDNA synthesis were performed for each sampling point and each treatment. 521

RT-qPCR was carried out using a LightCycler® 480 instrument (Roche), with 522

LightCycler® 480 SYBR Green I Master (Roche). The specificity of primers was 523

double checked by melting curves and product resequencing (Yin et al., 2010). 524

Primers for RT-qPCR analysis are listed in Supplemental Table S2. Kiwifruit actin 525

(Genbank no. EF063572) was employed as the housekeeping gene (Zhang et al., 526

2006). 527

528

Genomic DNA extraction 529

Kiwifruit genomic DNA was extracted from leaves. Approximately 0.1 g of 530

tissue was put into 900 μL TPS buffer (100 mM Tris-HCL, 10 mM EDTA and 1 M 531

KCL) for 1 h in a water bath at 75 oC, then centrifuged at 12000 rpm for 10 min and 532



- 19 -

added with equal volume of isopropyl alcohol to the supernatant to subside genomic 533

DNA. After 5 min, the tube was centrifuged again and supernatant was discarded. The 534

pellet (genomic DNA) was dissolved in sterile water. Three individual plants (five 535

months old) from each line were used as three replicates. The PCR template using a 536

plasmid containing the target sequence acted as the positive control and water was the 537

negative control. 538

539

Gene isolation, promoter cloning and promoter motif analysis 540

Based on the RNA-seq results, differentially expressed sequences (DES) 541

associated with ethylene biosynthesis, starch degradation and cell wall metabolism 542

were selected. Genes induced by ethylene and repressed by 1-MCP relative to the 543

control were assigned as candidates, and the threshold of DES was set as 50-fold 544

based on FPKM values between control, ethylene and 1-MCP treatments on 1 d and 4 545

d, separately. The full-length coding sequences for these DES were obtained from the 546

kiwifruit genome database (Huang et al., 2013) and the sequences were verified by 547

PCR using gene specific primers (Supplemental Table S3), with cDNA from the 548

‘Hayward’ cultivar. 549

Promoters of postharvest ripening related genes (the structural genes) were 550

isolated according to the genome database, except for AdPG1 (not present in the 551

genome database). With the promoter sequences from the genome database, the 552

forward primers (FP) were located in promoter regions and reverse primers (RP) were 553

from coding sequences. For AdPG1, genome walking was carried out to obtain its 554

promoter, with the GenomeWalker kit (Clontech), using primary RP 555

(5’-TGCATGGCCCGCTAAACATAGTC-3’) and secondary RP 556

(5’-GCCGCAAGCTGAATCCCATGCG-3’). The analysis of cis-elements within 557

promoter regions was conducted using the online website http://jaspar.genereg.net. All 558

promoter sequences used in the following experiments are listed in Supplemental 559

Table S4. 560

561

Dual luciferase assays 562



- 20 -

The dual luciferase assay was used to investigate the regulatory roles of different 563

transcription factors on target promoters, according to our previous protocols (Min et 564

al., 2012). Full length sequences of eleven transcription factors were inserted into 565

pGreen II 0029 62-SK vector (SK), while the promoters of eight softening-related 566

genes were recombined to the pGreen II 0800-LUC vector. Primers used for vector 567

constructions are listed in Supplemental Table S5. All the constructs were transferred 568

into Agrobacterium tumefaciens (GV3101), and the cultures were adjusted to an 569

OD600 of 0.75 with infiltration buffer (150 mM acetosyringone, 10 mM MES, 10mM 570

MgCl2, pH 5.6). The ratio of A. tumefaciens mixtures of transcription factors and 571

promoters was 10:1, which were then infiltrated into the leaves of Nicotiana 572

benthamiana. The N. benthamiana plants were cultivated in a glasshouse for 3 d. 573

Firefly luciferase and Renilla luciferase were assayed with the Dual-Luciferase 574

Reporter Assay System (Promega). For each TF-promoter interaction, triplicate 575

transient assay measurements were performed. Those with significant regulatory 576

effects were confirmed by at least three independent experiments. 577

578

Recombinant protein and EMSA analysis 579

According to the results of the dual luciferase assay, the regulatory action of 580

AdDof3 on the AdBAM3L promoter was further analyzed by an electrophoretic 581

mobility shift assay (EMSA). 582

In order to obtain the recombinant protein, the full-length AdDof3 was amplified 583

with FP (5’-GCTGATATCGGATCCGAATTCATGCCTCCGGAAACTTCCG-3’) and 584

RP (5’-GCAAGCTTGTCGACGGAGCTCGACTTGAGACCTTTGCCTG-3’) and 585

inserted into the pET-32a (Novagen) vector with double digestions of EcoRI and SacI. 586

The construct was purified and transformed into Escherichia coli strain BL21 (DE3). 587

The recombinant protein was induced by 0.5 mM isopropyl 588

β-D-1-thiogalactopyranoside (IPTG) at 20 oC for 18 h and purified as follows. The E. 589

coli cells were lysed with the buffer (20 mM Tris-HCl pH=8.0, 0.5 M NaCl, 10 mM 590

β-mercaptoethanol and 10% glycerol) and then subjected to sonication on ice at 200W 591

with 3s/2s on/off cycle for 30 minutes and centrifuged at 9000g for 20 minutes at 4 oC. 592



- 21 -

Following this, the Ni-NTA resin (TRAN) was added to the supernatant to combine 593

His-tagged proteins and the His-tagged proteins were eluted with gradient imidazole 594

containing buffers (75, 100, 125, 150, 175, 250 and 500 mM). The portions eluted by 595

500 mM imidazole were further used in the following EMSA experiment 596

(Supplemental Fig. S8). 597

The probes were 3’biotin end-labeled by HuaGene (Shanghai, China) and 598

converted to double-stranded DNA probes by annealing complementary 599

oligonucleotides. EMSA was performed using the LightShift Chemiluminescent 600

EMSA kit (Thermo Fisher Scientific, 20148). The binding specificity was examined 601

by mutant probes and competition probe (1000 folds unlabeled oligonucleotides). 602

603

Stable transformation and analysis in kiwifruit 604

To obtain transgenic kiwifruit, the 1641-bp AdBAM3L coding sequence was 605

amplified with primers (FP, 5’- 606

AGAGAACACGCCCGGGGATCCATGGCTTTAACATTACATTG -3’; RP, 5’- 607

CTTGCATGCCTGCAGGTCGACTTACACAAAAGCAGCCTCCT -3’) and inserted 608

downstream of the CaMV 35S promoter into the modified pCAMBIA1301 vector via 609

the BamHI/SalI restriction sites. The pCAMBIA1301 vector also contained a GUS 610

reporter gene following one CaMV 35S promoter (Fig. 7b). The construct was then 611

introduced into A. tumefaciens strain EHA105. 612

Leaves of plantlet ‘Qinmei’ (Actinidia deliciosa) in tissue culture were used for 613

transformation. Firstly, the leaves were cut into pieces (1 cm * 1 cm) and cultured in 614

co-culture medium for 24 h in dark. They were then co-incubated for 10 min with A. 615

tumefaciens cultures containing 1 mL/L acetosyringone solution (AS, 100 mM), and 616

put back into co-culture medium with sterilized filter paper for 48 h in the dark. Then 617

the explants were transferred and screened on shoot induction medium under long day 618

conditions (16 h light/8 h dark) until the regenerated shoots reached ~2 cm and then 619

were transferred to rooting medium. All the processes were performed at 25 oC and 620

the representative status of transformed plant at different stages are shown in 621

Supplemental Fig. S3. The co-culture medium components were MS+1 mL/L Nitsch 622



- 22 -

& Nitsch vitamin solution (NV) +4 mg/L 6-benzylaminopurine (6-BA) +1 mg/L 623

Naphthaleneacetic acid solution (NAA); the shoot induction medium was MS+1 mL/L 624

NV+4 mg/L 6-BA+1 mg/L NAA+5 mg/L hygromycin+50 mg/L meropenem; the 625

rooting medium contained MS+1 mL/L NV+5 mg/L hygromycin+50 mg/L 626

meropenem. 627

Transgenic plants overexpressing AdBAM3L were identified by DNA detection, 628

RT-qPCR, GUS staining and starch content analysis. Verification of DNA level used 629

genomic DNA from the transgene plants as template with primers across the 35S 630

promoter region (-424 bp) and CDS region (Supplemental Table S6). The methods of 631

RT-qPCR and starch content have been described above, with reduced amounts of 632

materials (0.25 g for RNA and 0.05 for starch). Three biological replicates were 633

carried out for each line. 634

635

GUS (β-glucuronidase) Staining 636

Histochemical staining was conducted to confirm the expression of the GUS 637

reporter co-transformed with AdBAM3L. The staining buffer was 0.1 M sodium 638

phosphate buffer (pH 7.0), 10 mM EDTA, 1 mM ferricyanide, 1 mM ferrocyanide, 0.5% 639

Triton X-100, and 1 mM 5-bromo-4-chloro-3-indolyl-β-D-glucur-onide (X-Gluc). The 640

leaves of transgenic kiwifruit plantlets were immersed in the staining buffer under 641

vacuum for 30 mins and then incubated overnight at 37 oC. 75% ethanol was used for 642

degradation of the chlorophyll of stained leaves. 643

644

Subcellular localization of AdDof3 645

The AdDof3 full-length CDS without the stop codon was amplified using 646

specific primers (FP: 647

5’-GGACGAGCTCGGTACCATGCCTCCGGAAACTTCCG-3’; RP: 648

5’-TGCTCACCATGTCGACCTTGAGACCTTTGCCTGGAG-3’) and then was 649

fused to the pCAMBIA1300-sGFP vector (KpnI/SalI). The construct 650

(35S-AdDof3-GFP) was transformed into A. tumefaciens strain (GV3101) and then 651

transiently expressed in transgenic N. benthamiana (expressed with nucleus located 652



- 23 -

mCherry) leaves. The green fluorescent protein (GFP) and red fluorescent protein 653

(RFP) fluorescence was imaged by fluorescence microscope (Zeiss). 654

655

Transient overexpression in ‘Hayward’ fruit 656

The in vivo regulation of AdDof3 on AdBAM3L was investigated by transient 657

overexpression in ‘Hayward’ fruit with core tissue. In order to eliminate the variation 658

across different fruit, the controls (empty SK vector) and AdDof3 (same as dual 659

luciferase assays) were separately infiltrated into two different ends of core tissue 660

within intact fruit (Fig. 8a). The infiltrated materials analyzed by GUS staining were 661

injected EHA105 strain as control and EHA105 strain with the pCAMBIA1301 vector 662

with AdDof3 and the GUS reporter gene (Fig. 8b). The primers for AdDof3 for GUS 663

staining were forward primer 664

5’-AGAGAACACGCCCGGGGATCCATGCCTCCGGAAACTTCCG-3’ and reverse 665

primer 5’-ACGACGGCCAGTGCCAAGCTTCTACTTGAGACCTTTGCCTG-3’. 666

The fruit at 80 and 170 days after full bloom (DAFB) were harvested from 667

Shaanxi in 2017. The buffers together with A. tumefaciens carrying constructs were 668

the same as for the dual luciferase assay. Either 0.2 ml of AdDof3 or empty vector 669

were infiltrated into the core from the two ends, and then fruits were stored in an 670

incubator at 25 oC for 2 d. The material was collected at 1 d and 2 d, with three 671

biological replicates. 672

673

Statistical analysis 674

Least significant difference (LSD) analysis and Student’s t test were conducted 675

by DPS7.05 (Zhejiang University, Hangzhou, China). Figures were drawn with Origin 676

8.0 (Microcal Software Inc., Northampton, MA, USA). The heatmaps were conducted 677

with the log10FPKM values using online software 678

(https://console.biocloud.net/static/index.html#/drawtools/intoDrawTool). 679

680

Accession numbers 681



- 24 -

All sequence reads are available at GenBank SRR6885590-SRR6885601. 682

683

Acknowledgments 684

The authors would like to thank Prof. Zhenghe Li (Zhejiang University) for providing 685

the transgenic N. benthamiana that expressed with nucleus located mCherry. 686

687

Supplemental Data 688

Supplemental Figure S1. RNA-seq analysis of differentially-expressed genes 689

between control, ethylene-treated, and 1-MCP-treated kiwifruit. 690

Supplemental Figure S2. AdAFC1 gene expression. 691

Supplemental Figure S3. Transgenic plants overexpressing AdBAM3L regenerated 692

and cultured on MS medium for up to 22 weeks. 693

Supplemental Figure S4. RT-qPCR analyses of AdDof3 and AdBAM3L expression at 694

apical and basal ends of kiwifruit core tissue. 695

Supplemental Figure S5. Starch contents in transient overexpressed core tissue with 696

AdDof3 or empty vector (SK). 697

Supplemental Figure S6. Sugar content in transgenic AdBAM3L kiwifruit. 698

Supplemental Figure S7. Expression of AdDof3 and AdBAM3L during the 699

development of ‘Hayward’ kiwifruit. 700

Supplemental Figure S8. AdDof3 protein purification. 701

Supplemental Table S1. Ethylene-responsive structural genes and transcription 702

factors. 703

Supplemental Table S2. Primers for RT-qPCR. 704

Supplemental Table S3. Primers for full-length amplification. 705

Supplemental Table S4. Sequences (5’ to 3’) for promoter isolation. 706

Supplemental Table S5. Primers for vector construction in dual-luciferase assays. 707

Supplemental Table S6. PCR primers for DNA detection in transgenic kiwifruit 708

plants. 709

710



- 25 -

Figure legends 711

Figure 1. Effects of ethylene and 1-MCP treatment on kiwifruit ripening and 712

softening. Fruits were treated with either 100 μL/L ethylene (ETH), 1 μL/L 1-MCP, or 713

air (control; CK) for 24 h at 20oC. (a) Ethylene production of ‘Hayward’ kiwifruit 714

during storage. Error bars represent ±SE from three replicates. (b) Total soluble solids 715

(TSS) and starch content in ‘Hayward’ fruit. For TSS and starch content, error bars 716

represent ±SE from ten and three replicates, respectively. (c) Firmness, cell wall 717

material (CWM) content, cellulose content, hemicellulose content and pectin content 718

(covalent binding pectin (CBP), water soluble pectin (WSP) and ionic soluble pectin 719

(ISP)) of fruit in storage. Error bars of firmness represent ±SE based on twelve 720

replicates. All others were from three replicates. FW, fresh weight. LSDs represent 721

least significant difference at p=0.05. 722

Figure 2. Comparison of differentially-expressed genes (DEGs) between control, 723

ethylene-treated and 1-MCP treated kiwifruit. Fruits were treated with either 100 μL/L 724

ethylene (ETH), 1 μL/L 1-MCP, or air (control; CK) for 24 h at 20oC, and 725

comparisons were made at 1 and 4 days. (a) DEGs of 13 structural genes with 726

putative function in kiwifruit ethylene biosynthesis, cell wall modification and starch 727

degradation. (b) DEGs of 14 transcriptional factors. There were three replicates at 728

each point. Transcript abundance is indicated by color. The names in black represent 729

new genes, which were not included in ‘Hongyang’ genome database, those in blue 730

and red are published structural and transcription factor genes, respectively. 731

Figure 3. Expression of structural genes in response to ethylene or 1-MCP treatment 732

during kiwifruit ripening. Fruits were treated with either 100 μL/L ethylene (ETH), 1 733

μL/L 1-MCP, or air (control; CK) for 24 h at 20oC. Gene expression was analyzed by 734

RT-qPCR. ACO, 1-aminocyclopropane-1-carboxylate oxidase; ACS, 735

1-aminocyclopropane-1-carboxylate synthase; BAM, β-amylase; MAN, 736

endo-β-mannanase; PG, polygalacturonase; PL, pectin lyase; PME, pectin methyl 737

esterase; XTH, xyloglucan endotransglucosylase/hydrolase. Error bars represent ±SE 738

based on three replications. LSDs represent least significant difference at p=0.05. 739



- 26 -

Figure 4. Expression of transcription factors in response to ethylene or 1-MCP 740

treatment during kiwifruit ripening. Fruits were treated with either 100 μL/L ethylene 741

(ETH), 1 μL/L 1-MCP, or air (control; CK) for 24 h at 20oC. Gene expression was 742

analyzed by RT-qPCR. (a) Expression of putative activators. (b) Expression of 743

putative repressors. BEE, brassinosteroid enhanced expression; bHLH, basic 744

helix-loop-helix protein; bZIP: basic leucine zipper protein; CBF, cold binding factor; 745

Dof, Dof zinc finger protein; ERF, ethylene response factor; GT, Trihelix transcription 746

factor; HB, Homeobox-leucine zipper protein. Error bars represent ±SE based on 747

three replications. LSDs represent least significant difference at p=0.05. 748

Figure 5. Regulatory effects of TFs on promoters of ethylene biosynthesis, cell wall 749

modifying and starch degradation genes as determined by dual-luciferase assays. The 750

ratio of LUC/REN of the empty vector plus promoter was set as 1. SK represents the 751

empty pGreen II 0029 62-SK vector. Error bars indicate ±SE from three replicates 752

(**P<0.01 and *** P<0.001). 753

Figure 6. Subcellular localization of AdDof3 and electrophoretic mobility shift assays 754

(EMSA). (a) Subcellular localization of AdDof3-GFP in transgenic Nicotiana 755

benthamiana leaves (expressed with nucleus located mCherry). AdDof3 was inserted 756

into the pCAMBIA1300-sGFP vector. GFP fluorescence of AdDof3-GFP is indicated. 757

Bars=25 μm. (b) Oligonucleotides used for the EMSA with the Dof core sequences in 758

red. The mutated bases are indicated in green. (c) The core sequences (AAAG/CTTT) 759

of Dof protein binding sites in the AdBAM3L promoter. (d) EMSA of 3’-biotin-labeled 760

double-stranded DNA probes with the AdDof3 DNA binding domain proteins. 761

Recombinant AdDof3 was purified from E. coli cells and used for DNA binding 762

assays with P-abc, P-a, P-bc, P-c, P-ab, and mutated P-ΔaΔbc, P-Δabc, P-aΔbc 763

together with cold unlabeled competitor as the probes. Water was added in place of 764

AdDof3 protein as control. 765

Figure 7. Overexpression of AdBAM3L in kiwifruit plants. (a) Five-month-old plants 766

on MS medium. (b) Schematic map of the AdBAM3L-pCAMBIA1301 construct and 767

PCR analysis of wild type (WT) and two independently regenerated transgenic lines. 768

The positive control used a plasmid containing the AdBAM3L-pCAMBIA1301 769



- 27 -

construct as a template. (c) Expression of AdBAM3L in WT and transgenic lines. (d) 770

GUS staining of WT and AdBAM3L transgenic plants. (e) Starch content reflected by 771

quinoneimine dye. The color intensity represents starch concentration. Positive 772

control: D-glucose standard (Megazyme International Ireland Ltd., Wicklow, Ireland); 773

negative control: water. (f) Starch content in WT and transgenic plant leaves. Error 774

bars in (c) and (f) indicate ±SE from three replicates (*P<0.05, **P<0.01 and *** 775

P<0.001). 776

Figure 8. Transient overexpression of AdDof3 and its upregulation of AdBAM3L in 777

the core tissue of ‘Hayward’ fruit. (a) Schematic diagram for injection with 778

differential color inks. The arrows show injection sites. (b) GUS staining of kiwifruit 779

core tissue segments injected with AdDof3-pCAMBIA1301-EHA105 or EHA105 at 1 780

day after injection. The segments were photographed separately. Bars = 100 μm. (c) 781

Gene expression of endogenous AdDof3 and AdBAM3L in immature kiwifruit at 80 782

days after full bloom. Injection of Agrobacterium tumefaciens strain (GV3101) with 783

the empty SK vector was the control and the AdDof3 recombined SK vector was the 784

treatment. (d) Gene expression of endogenous AdDof3 and AdBAM3L in mature 785

kiwifruit harvested 170 days after full bloom. Error bars in (c) and (d) indicate ±SE 786

from three replicates (*P<0.05, **P<0.01). 787

788

Literature Cited 789

Akagi T, Ikegami A, Tsujimoto T, Kobayashi S, Sato A, Kono A, Yonemori K 790

(2009) DkMyb4 is a Myb transcription factor involved in proanthocyanidin 791

biosynthesis in persimmon fruit. Plant Physiol 151: 2028-2045 792

Atkinson RG, Johnston SL, Yauk YK, Sharma NN, Schröder R (2009) Analysis of 793

xyloglucan endotransglucosylase/hydrolase (XTH) gene families in kiwifruit and 794

apple. Postharvest Biol Tec 51: 149-157 795

Atkinson RG, Gunaseelan K, Wang MY, Luo L, Wang TC, Norling CL, Johnston 796

SL, Maddumage R, Schröder R, Schaffer RJ (2011) Dissecting the role of 797

climacteric ethylene in kiwifruit (Actinidia chinensis) ripening using 798



- 28 -

a1-aminocyclopropane-1-carboxylic acid oxidase knockdown line. J Exp Bot 62: 799

3821-3835 800

Blumenkrantz N, Asboehansen G (1973) New method for quantitative 801

determination of uronic acids. Anal Biochem 54: 484-489 802

Chapman NH, Bonnet J, Grivet L, Lynn J, Graham N, Smith R, Sun G P, Walley 803

PG, Poole M, Causse M, King GJ, Baxter C, Seymour GB (2012) 804

High-resolution mapping of a fruit firmness-related quantitative trait locus in 805

tomato reveals epistatic interactions associated with a complex combinatorial 806

locus. Plant Physiol 159: 1644-1657 807

Cutillasiturralde A, Zarra I, Fry SC, Lorences EP (1994) Implication of 808

persimmon fruit hemicellulose metabolism in the softening process-importance of 809

xyloglucan endotransglycosylase. Physiol Plantarum 91: 169-176 810

Dong TT, Hu ZL, Deng L, Wang Y, Zhu MK, Zhang JL, Chen GP (2013) A 811

Tomato MADS-Box transcription factor, SlMADS1, acts as a negative regulator 812

of fruit ripening. Plant Physiol 163: 1026-1036 813

Feng BH, Han YC, Xiao YY, Kuang JF, Fan ZQ, Chen JY, Lu WJ (2016) The 814

banana fruit Dof transcription factor MaDof23 acts as a repressor and interacts 815

with MaERF9 in regulating ripening-related genes. J Exp Bot 67: 2263-2275 816

Fu CC, Han YC, Qi XY, Qi XY, Shan W, Chen JY, Lu WJ, Kuang JF (2016) 817

Papaya CpERF9 acts as a transcriptional repressor of cell-wall-modifying genes 818

CpPME1/2, and CpPG5, involved in fruit ripening. Plant Cell Rep 35: 2341-2352 819

Hu X, Kuang S, Zhang AD, Zhang WS, Chen MJ, Yin XR, Chen KS (2016) 820

Characterization of starch degradation related genes in postharvest kiwifruit. Int J 821

Mol Sci 17: 2112 822

Huang H, Ferguson AR (2001) Kiwifruit in China. New Zeal J Crop Hort 29: 1-14. 823

Huang SX, Ding J, Deng DJ, Tang W, Sun HH, Liu DY, Zhang L, Niu XL, Meng 824

M, Yu JD, Liu J, Han Y, Shi W, Zhang DF, Cao SQ, Wei ZJ, Cui YL, Xia YH, 825

Zeng HP, Bao K, Lin L, Min Y, Zhang H, Miao M, Tang XF, Zhu YY, Sui Y, 826

Li GW, Sun HJ, Yue JY, Sun JQ, Liu FF, Zhou LQ, Lei L, Zheng XQ, Liu M, 827

Huang L, Song J, Xu CH, Li JW, Ye KY, Zhong SL, Lu BR, He GH, Xiao FM, 828



- 29 -

Wang HL, Zheng HK, Fei ZJ, Liu YS (2013) Draft genome of the kiwifruit 829

Actinida chinensis. Nat Commun 4: 2640 830

Ireland HS, Yao JL, Tomes S, Sutherland PW, Nieuwenhuizen N, Gunaseelan K, 831

Winz RA, David KM, Schaffer RJ (2013) Apple SEPALLATA1/2-like genes 832

control fruit flesh development and ripening. Plant J 73: 1044-1056 833

Kanehisa M, Araki M, Goto S, Hattori M, Hirakawa M, Itoh M, Katayama T, 834

Kawashima S, Okuda S, Tokimatsu T, Yamanishi Y (2008) KEGG for linking 835

genomes to life and the environment. Nucleic Acids Res 36: 480-484 836

Karlova R, Rosin FM, Busscher-Lange J, Parapunova V, Do PT, Fernie AR, 837

Fraser PD, Baxter C, Angenent GC, De Maagd RA (2011) Transcriptome and 838

metabolite profiling show that APETALA2a is a major regulator of tomato fruit 839

ripening. Plant Cell 23: 923-941 840

Kim D, Pertea G, Trapnell C, Pimentel H, Kelley R, Salzberg SL (2013) TopHat2: 841

accurate alignment of transcriptomes in the presence of insertion, deletions and 842

gene fusions. Genome Biol 14: R36 843

Klee HJ, Giovannoni JJ (2011) Genetics and control of tomato fruit ripening and 844

quality attributes. Annu Rev Genet 45: 41-59 845

Koukounaras A, Sfakiotakis E (2007) Effect of 1-MCP prestorage treatment on 846

ethylene and CO2 production and quality of ‘Hayward’ kiwifruit during shelf-life 847

after short, medium and long term cold storage. Postharvest Biol Tec 46: 174-180 848

Kuang JF, Chen JY, Liu XC, Han YC, Xiao YY, Shan W, Yang T, Wu KQ, He JX, 849

Lu WJ (2017) The transcriptional regulatory network mediated by banana (Musa 850

acuminata) dehydration-responsive element binding (MaDREB) transcription 851

factors in fruit ripening. New Phytol 214: 762-781 852

Lee JM, Joung JG, McQuinn R, Chung MY, Fei ZJ, Tieman D, Klee H, 853

Giovannoni J (2012) Combined transcriptome, genetic diversity and metabolite 854

profiling in tomato fruit reveals that the ethylene response factor SlERF6 plays an 855

important role in ripening and carotenoid accumulation. Plant J 70: 191-204 856

Li T, Jiang ZY, Zhang LC, Tan DM, Wei Y, Yuan H, Li TL, Wang AD (2016) 857

Apple (Malus Domestica) MdERF2 negatively affects ethylene biosynthesis 858



- 30 -

during fruit ripening by suppressing MdACS1 transcription. Plant J 88: 735-748 859

Li T, Xu YX, Zhang LC, Ji YL, Tan DM, Yuan H, Wang AD (2017) The 860

jasmonate-activated transcription factor MdMYC2 regulates ETHYLENE 861

RESPONSE FACTOR and ethylene biosynthetic genes to promote ethylene 862

biosynthesis during apple fruit ripening. Plant Cell 29: 1316-1334 863

Lin ZF, Hong YG, Yin MG, Li CY, Zhang K, Grierson D (2008) A tomato HD-Zip 864

homeobox protein, LeHB-1, plays an important role in floral organogenesis and 865

ripening. Plant J 55: 301-310 866

Liu MC, Diretto G, Pirrello J, Roustan JP, Li ZG, Giuliano G, Regad F, 867

Bouzayen M (2014) The chimeric repressor version of an Ethylene Response 868

Factor (ERF) family member, Sl-ERF. B3, shows contrasting effects on tomato 869

fruit ripening. New Phytol 203: 206-218 870

Lv QD, Zhong YJ, Wang YG, Wang ZY, Zhang L, Shi J, Wu ZC, Liu Y, Mao CZ, 871

Yi KK, Wu P (2014) SPX4 Negatively Regulates Phosphate Signaling and 872

Homeostasis through Its Interaction with PHR2 in Rice. Plant Cell 26: 1586-1597 873

Ma NN, Feng HL, Meng X, Li D, Yang DY, Wu CG, Meng QW (2014) 874

Overexpression of tomato SlNAC1 transcription factor alters fruit pigmentation 875

and softening. BMC Plant Biol 14: 351 876

Manning K, Tör M, Poole M, Hong Y, Thompson AJ, King GJ, Giovannoni JJ, 877

Seymour GB (2006) A naturally occurring epigenetic mutation in a gene encoding 878

an SBP-box transcription factor inhibits tomato fruit ripening. Nat Genet 38: 879

948-952 880

Mao XZ, Cai T, Olyarchuk JG, Wei LP (2005) Automated genome annotation and 881

pathway identification using the KEGG Orthology (KO) as a controlled vocabulary. 882

Bioinformatics 21: 3787-3793 883

Marzabal P, Gas E, Fontanet P, Vicente-Carbajosa J, Torrent M, Ludevid MD 884

(2008) The maize Dof protein PBF activates transcription of γ-zein during 885

maize seed development. Plant Mol Biol 67: 441-454 886

Mcdonald B, Harman JE (1982) Controlled-atmosphere storage of kiwifruit. 1. 887

Effect on fruit firmness and storage life. Sci Hortic 17: 113-123 888



- 31 -

Meng C, Yang DY, Ma XC, Zhao WY, Liang XQ, Ma NN, Meng QW (2016) 889

Suppression of tomato SlNAC1 transcription factor delays fruit ripening. J Plant 890

Physiol 193: 88-96 891

Min T, Yin XR, Shi YN, Luo ZR, Yao YC, Grierson D, Ferguson IB, Chen KS 892

(2012) Ethylene-responsive transcription factors interact with promoters of ADH 893

and PDC involved in persimmon (Diospyros kaki) fruit de-astringency. J Exp Bot 894

63: 6393-6405 895

Minas IS, Vicente AR, Dhanapal AP, Manganaris GA, Goulas V, Vasilakakis M, 896

Crisosto CH, Molassiotis A (2014) Ozone-induced kiwifruit ripening delay is 897

mediated by ethylene biosynthesis inhibition and cell wall dismantling regulation. 898

Plant Sci 229: 76-85 899

Mworia EG, Yoshikawa T, Salikon N, Oda C, Asiche WO, Yokotani N, Abe D, 900

Ushijima K, Nakano R, Kubo Y (2012) Low-temperature-modulated fruit 901

ripening is independent of ethylene in ‘Sanuki Gold’ kiwifruit. J Exp Bot 63: 902

963-971 903

Nardozza S, Boldingh HL, Osorio S, Höhne M, Wohlers M, Gleave AP, MacRae 904

EA, Richardson AC, Atkinson RG, Sulpice R, Fernie AR, Clearwater MJ 905

(2013) Metabolic analysis of kiwifruit (Actinidia deliciosa) berries from extreme 906

genotypes reveals hallmarks for fruit starch metabolism. J Exp Bot 64: 5049-5063 907

Nieuwenhuizen NJ, Chen X, Wang MY, Matich AJ, Perez RL, Allan AC, Green 908

SA, Atkinson RG (2015) Natural variation in monoterpene synthesis in kiwifruit: 909

transcriptional regulation of terpene synthases by NAC and 910

ETHYLENE-INSENSITIVE3-like transcription factors. Plant Physiol 167: 911

1243-1258 912

Peng T, Zhu XF, Duan N, Liu JH (2014) PtrBAM1, a β-amylase-coding gene of 913

Poncirus trifoliata, is a CBF regulon member with function in cold tolerance by 914

modulating soluble sugar levels. Plant Cell Environ 37: 2754-2767 915

Prasanna V, Prabha TN, Tharanathan RN (2007) Fruit ripening phenomena-an 916

overview. Crit Rev Food Sci 47: 1-19 917

Qi X, Li SX, Zhu YX, Zhao Q, Zhu DY, Yu JJ (2017) ZmDof3, a maize 918



- 32 -

endosperm-specific Dof protein gene, regulates starch accumulation and aleurone 919

development in maize endosperm. Plant Mol Biol 93: 7-20 920

Seymour GB, Ryder CD, Cevik V, Hammond JP, Popovich A, King GJ, Vrebalov 921

J, Giovannoni JJ, Manning K (2011) A SEPALLATA gene is involved in the 922

development and ripening of strawberry (Fragaria×ananassa Duch.) fruit, a 923

non-climacteric tissue. J Exp Bot 62: 1179-1188 924

Seymour GB, Chapman NH, Chew BL, Rose JKC (2013) Regulation of ripening 925

and opportunities for control in tomato and other fruits. Plant Biotechnol J 11: 926

269-278 927

Stevenson DG, Johnson SR, Jane J, Inglett GE (2010) Chemical and Physical 928

Properties of Kiwifruit (Actinidia deliciosa) Starch. Starch-Stärke 58: 323-329 929

Tacken E, Ireland H, Gunaseelan K, Karunairetnam S, Wang D, Schultz K, 930

Bowen J, Atkinson RG, Johnston JW, Putterill J, Hellens RP, Schaffer RJ 931

(2010) The role of ethylene and cold temperature in the regulation of the apple 932

POLYGALACTURONASE1 gene and fruit softening. Plant Physiol 153: 294-305 933

Tang W, Zheng Y, Dong J, Yu J, Yue JY, Liu FF, Guo XH, Huang SX, Wisniewski 934

M, Sun JQ, Niu XL, Ding J, Liu J, Fei ZJ, Liu YS (2016) Comprehensive 935

transcriptome profiling reveals long noncoding RNA expression and alternative 936

splicing regulation during fruit development and ripening in kiwifruit (Actinidia 937

chinensis). Front Plant Sci 7: 335 938

Trapnell C, Williams BA, Pertea G, Mortazavi A, Kwan G, van Baren MJ, 939

Salzberg SL, Wold BJ, Pachter L (2010) Transcript assembly and quantification 940

by RNA-Seq reveals unannotated transcripts and isoform switching during cell 941

differentiation. Nature Biotechnology 28: 511-515 942

Uluisik S, Chapan NH, Smith R, Poole M, Adams G, Gillis RB, Besong TMD, 943

Sheldon J, Stiegelmeyer S, Perez L, Samsulrizal N, Wang D, Fisk ID, Yang N, 944

Baxter C, Rickett D, Fray R, Blanco-Ulate B, Powell ALT, Harding SE, 945

Craigon J, Rose JKC, Fich EA, Sun L, Domozych DS, Fraser PD, Tucker GA, 946

Grierson D, Seymour GB (2016) Genetic improvement of tomato by targeted 947

control of fruit softening. Nat Biotechnol 39: 950-952 948



- 33 -

Vicente AR, Manganaris GA, Minas IS,Goulas V, Lafuente M (2013) Cell wall 949

modifications and ethylene-induced tolerance to non-chilling peel pitting in citrus 950

fruit. Plant Sci 210: 46-52 951

Vrebalov J, Ruezinsky D, Padmanabhan V, White R, Medrano D, Drake R, 952

Schuch W, Giovannoni J (2002) A MADS-box gene necessary for fruit ripening at 953

the tomato ripening-inhibitor (Rin) locus. Science 296: 343-346 954

Wang ZY, MacRae EA, Wright MA, Bolitho KM, Ross GS, Atkinson RG (2000) 955

Polygalacturonase gene expression in kiwifruit: relationship to fruit softening and 956

ethylene production. Plant Mol Biol 42: 317-328 957

Wilkinson JQ, Lanahan MB, Yen HC, Giovannoni JJ, Klee HJ (1995) An 958

ethylene-inducible component of signal transduction encoded by Never-ripe. 959

Science 270: 1807-1809 960

Xiao YY, Kuang JF, Qi XN, Ye YJ, Wu ZX, Chen JY, Lu WJ (2018) A 961

comprehensive investigation of starch degradation process and identification of a 962

transcriptional activator MabHLH6 during banana fruit ripening. Plant Biotechnol 963

J 16: 151-164 964

Xie XL, Yin XR, Chen KS (2016) Roles of APETALA2/Ethylene Responsive 965

Factors in regulation of fruit quality. Crit Rev Plant Sci 35: 120-130 966

Xu ZC, Hyodo H, Ikoma Y, Yano M, Ogawa K (1998) Biochemical characterization 967

and expression of recombinant ACC oxidase in Escherichia coli, and endogenous 968

ACC oxidase from kiwifruit. Postharvest Biol Tec 14: 41-50 969

Yanagisawa S, Schmidt RJ (1999) Diversity and similarity among recognition 970

sequence of Dof transcription factors. Plant J 17: 209-214 971

Yang L, Huang W, Xiong FJ, Xian ZQ, Su DD, Ren MZ, Li ZG (2017) Silencing 972

of SlPL, which encodes a pectate lyase in tomato, confers enhanced fruit firmness, 973

prolonged shelf-life, and reduced susceptibility to gray mold. Plant Biotechnol J 974

15: 1544-1555 975

Yemm EW, Willis AJ (1954) The estimation of carbohydrates in plant extracts by 976

anthrone. Biochem J 57: 508-514 977

Yin XR, Chen KS, Allan AC, Wu RM, Zhang B, Lallu N, Ferguson I (2008) 978



- 34 -

Ethylene-induced modulation of genes associated with the ethylene signaling 979

pathway in ripening kiwifruit. J Exp Bot 59: 2097-2108 980

Yin XR, Allan AC, Chen KS, Ferguson I (2010) Kiwifruit EIL and ERF genes 981

involved in regulating fruit ripening. Plant Physiol 153: 1280-1292 982

Yin XR, Xie XL, Xia XJ, Yu JQ, Ferguson IB, Giovannoni JJ, Chen KS (2016) 983

Involvement of an ethylene response factor in chlorophyll degradation during 984

citrus fruit degreening. Plant J 86: 403-412 985

Young MD, Wakefield MJ, Smyth GK, Oshlack A (2010) Gene ontology analysis 986

for RNAseq: accounting for selection bias. Genome Biol 11: 14 987

Zhang AD, Hu X, Kuang S, Ge H, Yin XR, Chen KS (2016) Isolation, 988

classification and transcription profiles of the Ethylene Response Factors (ERFs) 989

in ripening kiwifruit. Sci Hortic 199: 209-215 990

Zhang B, Chen KS, Bowen J, Allan A, Espley R, Karunairetnam S, Ferguson I 991

(2006) Differential expression within the LOX gene family in ripening kiwifruit. J 992

Exp Bot 57: 3825-3836 993

Zhu MK, Chen GP, Zhou S, Tu Y, Wang Y, Dong TT, Hu ZL (2014) A new tomato 994

NAC (NAM/ATAF1/2/CUC2) transcription factor, SlNAC4, function as a positive 995

regulator of fruit ripening and carotenoid accumulation. Plant Cell Physiol 55: 996

119-135 997

998



Parsed CitationsAkagi T, Ikegami A, Tsujimoto T, Kobayashi S, Sato A, Kono A, Yonemori K (2009) DkMyb4 is a Myb transcription factor involved inproanthocyanidin biosynthesis in persimmon fruit. Plant Physiol 151: 2028-2045

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Atkinson RG, Johnston SL, Yauk YK, Sharma NN, Schröder R (2009) Analysis of xyloglucan endotransglucosylase/hydrolase (XTH)gene families in kiwifruit and apple. Postharvest Biol Tec 51: 149-157


Atkinson RG, Gunaseelan K, Wang MY, Luo L, Wang TC, Norling CL, Johnston SL, Maddumage R, Schröder R, Schaffer RJ (2011)Dissecting the role of climacteric ethylene in kiwifruit (Actinidia chinensis) ripening using a1-aminocyclopropane-1-carboxylic acidoxidase knockdown line. J Exp Bot 62: 3821-3835


Blumenkrantz N, Asboehansen G (1973) New method for quantitative determination of uronic acids. Anal Biochem 54: 484-489Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Chapman NH, Bonnet J, Grivet L, Lynn J, Graham N, Smith R, Sun G P, Walley PG, Poole M, Causse M, King GJ, Baxter C, Seymour GB(2012) High-resolution mapping of a fruit firmness-related quantitative trait locus in tomato reveals epistatic interactions associatedwith a complex combinatorial locus. Plant Physiol 159: 1644-1657


Cutillasiturralde A, Zarra I, Fry SC, Lorences EP (1994) Implication of persimmon fruit hemicellulose metabolism in the softeningprocess-importance of xyloglucan endotransglycosylase. Physiol Plantarum 91: 169-176


Dong TT, Hu ZL, Deng L, Wang Y, Zhu MK, Zhang JL, Chen GP (2013) A Tomato MADS-Box transcription factor, SlMADS1, acts as anegative regulator of fruit ripening. Plant Physiol 163: 1026-1036


Feng BH, Han YC, Xiao YY, Kuang JF, Fan ZQ, Chen JY, Lu WJ (2016) The banana fruit Dof transcription factor MaDof23 acts as arepressor and interacts with MaERF9 in regulating ripening-related genes. J Exp Bot 67: 2263-2275


Fu CC, Han YC, Qi XY, Qi XY, Shan W, Chen JY, Lu WJ, Kuang JF (2016) Papaya CpERF9 acts as a transcriptional repressor of cell-wall-modifying genes CpPME1/2, and CpPG5, involved in fruit ripening. Plant Cell Rep 35: 2341-2352


Hu X, Kuang S, Zhang AD, Zhang WS, Chen MJ, Yin XR, Chen KS (2016) Characterization of starch degradation related genes inpostharvest kiwifruit. Int J Mol Sci 17: 2112


Huang H, Ferguson AR (2001) Kiwifruit in China. New Zeal J Crop Hort 29: 1-14.Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Huang SX, Ding J, Deng DJ, Tang W, Sun HH, Liu DY, Zhang L, Niu XL, Meng M, Yu JD, Liu J, Han Y, Shi W, Zhang DF, Cao SQ, Wei ZJ,Cui YL, Xia YH, Zeng HP, Bao K, Lin L, Min Y, Zhang H, Miao M, Tang XF, Zhu YY, Sui Y, Li GW, Sun HJ, Yue JY, Sun JQ, Liu FF, ZhouLQ, Lei L, Zheng XQ, Liu M, Huang L, Song J, Xu CH, Li JW, Ye KY, Zhong SL, Lu BR, He GH, Xiao FM, Wang HL, Zheng HK, Fei ZJ, LiuYS (2013) Draft genome of the kiwifruit Actinida chinensis. Nat Commun 4: 2640


Ireland HS, Yao JL, Tomes S, Sutherland PW, Nieuwenhuizen N, Gunaseelan K, Winz RA, David KM, Schaffer RJ (2013) AppleSEPALLATA1/2-like genes control fruit flesh development and ripening. Plant J 73: 1044-1056


Kanehisa M, Araki M, Goto S, Hattori M, Hirakawa M, Itoh M, Katayama T, Kawashima S, Okuda S, Tokimatsu T, Yamanishi Y (2008)KEGG for linking genomes to life and the environment. Nucleic Acids Res 36: 480-484



http://www.ncbi.nlm.nih.gov/pubmed?term=Akagi T%2C Ikegami A%2C Tsujimoto T%2C Kobayashi S%2C Sato A%2C Kono A%2C Yonemori K %282009%29 DkMyb4 is a Myb transcription factor involved in proanthocyanidin biosynthesis in persimmon fruit%2E Plant Physiol 151%3A 2028%2D2045&dopt=abstract

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Akagi&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=DkMyb4 is a Myb transcription factor involved in proanthocyanidin biosynthesis in persimmon fruit&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=DkMyb4 is a Myb transcription factor involved in proanthocyanidin biosynthesis in persimmon fruit&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Akagi&as_ylo=2009&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Atkinson RG%2C Johnston SL%2C Yauk YK%2C Sharma NN%2C Schr�der R %282009%29 Analysis of xyloglucan endotransglucosylase%2Fhydrolase %28XTH%29 gene families in kiwifruit and apple%2E Postharvest Biol Tec 51%3A 149%2D157&dopt=abstract

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Atkinson&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Analysis of xyloglucan endotransglucosylase/hydrolase (XTH) gene families in kiwifruit and apple&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Analysis of xyloglucan endotransglucosylase/hydrolase (XTH) gene families in kiwifruit and apple&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Atkinson&as_ylo=2009&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Atkinson RG%2C Gunaseelan K%2C Wang MY%2C Luo L%2C Wang TC%2C Norling CL%2C Johnston SL%2C Maddumage R%2C Schr�der R%2C Schaffer RJ %282011%29 Dissecting the role of climacteric ethylene in kiwifruit %28Actinidia chinensis%29 ripening using a1%2Daminocyclopropane%2D1%2Dcarboxylic acid oxidase knockdown line%2E J Exp Bot 62%3A 3821%2D3835&dopt=abstract

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Atkinson&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Dissecting the role of climacteric ethylene in kiwifruit (Actinidia chinensis) ripening using a1-aminocyclopropane-1-carboxylic acid oxidase knockdown line&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Dissecting the role of climacteric ethylene in kiwifruit (Actinidia chinensis) ripening using a1-aminocyclopropane-1-carboxylic acid oxidase knockdown line&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Atkinson&as_ylo=2011&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Blumenkrantz N%2C Asboehansen G %281973%29 New method for quantitative determination of uronic acids%2E Anal Biochem 54%3A 484%2D489&dopt=abstract

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Blumenkrantz&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=New method for quantitative determination of uronic acids&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=New method for quantitative determination of uronic acids&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Blumenkrantz&as_ylo=1973&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Chapman NH%2C Bonnet J%2C Grivet L%2C Lynn J%2C Graham N%2C Smith R%2C Sun G P%2C Walley PG%2C Poole M%2C Causse M%2C King GJ%2C Baxter C%2C Seymour GB %282012%29 High%2Dresolution mapping of a fruit firmness%2Drelated quantitative trait locus in tomato reveals epistatic interactions associated with a complex combinatorial locus%2E Plant Physiol 159%3A 1644%2D1657&dopt=abstract

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Chapman&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=High-resolution mapping of a fruit firmness-related quantitative trait locus in tomato reveals epistatic interactions associated with a complex combinatorial locus&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=High-resolution mapping of a fruit firmness-related quantitative trait locus in tomato reveals epistatic interactions associated with a complex combinatorial locus&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Chapman&as_ylo=2012&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Cutillasiturralde A%2C Zarra I%2C Fry SC%2C Lorences EP %281994%29 Implication of persimmon fruit hemicellulose metabolism in the softening process%2Dimportance of xyloglucan endotransglycosylase%2E Physiol Plantarum 91%3A 169%2D176&dopt=abstract

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Cutillasiturralde&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Implication of persimmon fruit hemicellulose metabolism in the softening process-importance of xyloglucan endotransglycosylase&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Implication of persimmon fruit hemicellulose metabolism in the softening process-importance of xyloglucan endotransglycosylase&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Cutillasiturralde&as_ylo=1994&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Dong TT%2C Hu ZL%2C Deng L%2C Wang Y%2C Zhu MK%2C Zhang JL%2C Chen GP %282013%29 A Tomato MADS%2DBox transcription factor%2C SlMADS1%2C acts as a negative regulator of fruit ripening%2E Plant Physiol 163%3A 1026%2D1036&dopt=abstract

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Dong&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Dong&as_ylo=2013&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Feng BH%2C Han YC%2C Xiao YY%2C Kuang JF%2C Fan ZQ%2C Chen JY%2C Lu WJ %282016%29 The banana fruit Dof transcription factor MaDof23 acts as a repressor and interacts with MaERF9 in regulating ripening%2Drelated genes%2E J Exp Bot 67%3A 2263%2D2275&dopt=abstract

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Feng&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=The banana fruit Dof transcription factor MaDof23 acts as a repressor and interacts with MaERF9 in regulating ripening-related genes&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=The banana fruit Dof transcription factor MaDof23 acts as a repressor and interacts with MaERF9 in regulating ripening-related genes&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Feng&as_ylo=2016&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Fu CC%2C Han YC%2C Qi XY%2C Qi XY%2C Shan W%2C Chen JY%2C Lu WJ%2C Kuang JF %282016%29 Papaya CpERF9 acts as a transcriptional repressor of cell%2Dwall%2Dmodifying genes CpPME1%2F2%2C and CpPG5%2C involved in fruit ripening%2E Plant Cell Rep 35%3A 2341%2D2352&dopt=abstract

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Fu&hl=en&c2coff=1


http://scholar.google.com/scholar?as_q=&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Fu&as_ylo=2016&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Hu X%2C Kuang S%2C Zhang AD%2C Zhang WS%2C Chen MJ%2C Yin XR%2C Chen KS %282016%29 Characterization of starch degradation related genes in postharvest kiwifruit%2E Int J Mol Sci 17%3A 2112&dopt=abstract

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Hu&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Characterization of starch degradation related genes in postharvest kiwifruit.&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Characterization of starch degradation related genes in postharvest kiwifruit.&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Hu&as_ylo=2016&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Huang H%2C Ferguson AR %282001%29 Kiwifruit in China%2E New Zeal J Crop Hort 29%3A 1%2D14%2E&dopt=abstract

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Huang&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Kiwifruit in China&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Kiwifruit in China&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Huang&as_ylo=2001&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Huang SX%2C Ding J%2C Deng DJ%2C Tang W%2C Sun HH%2C Liu DY%2C Zhang L%2C Niu XL%2C Meng M%2C Yu JD%2C Liu J%2C Han Y%2C Shi W%2C Zhang DF%2C Cao SQ%2C Wei ZJ%2C Cui YL%2C Xia YH%2C Zeng HP%2C Bao K%2C Lin L%2C Min Y%2C Zhang H%2C Miao M%2C Tang XF%2C Zhu YY%2C Sui Y%2C Li GW%2C Sun HJ%2C Yue JY%2C Sun JQ%2C Liu FF%2C Zhou LQ%2C Lei L%2C Zheng XQ%2C Liu M%2C Huang L%2C Song J%2C Xu CH%2C Li JW%2C Ye KY%2C Zhong SL%2C Lu BR%2C He GH%2C Xiao FM%2C Wang HL%2C Zheng HK%2C Fei ZJ%2C Liu YS %282013%29 Draft genome of the kiwifruit Actinida chinensis%2E Nat Commun 4%3A 2640&dopt=abstract

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Huang&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Draft genome of the kiwifruit Actinida chinensis.&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Draft genome of the kiwifruit Actinida chinensis.&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Huang&as_ylo=2013&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Ireland HS%2C Yao JL%2C Tomes S%2C Sutherland PW%2C Nieuwenhuizen N%2C Gunaseelan K%2C Winz RA%2C David KM%2C Schaffer RJ %282013%29 Apple SEPALLATA1%2F2%2Dlike genes control fruit flesh development and ripening%2E Plant J 73%3A 1044%2D1056&dopt=abstract

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Ireland&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Apple SEPALLATA1/2-like genes control fruit flesh development and ripening&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Apple SEPALLATA1/2-like genes control fruit flesh development and ripening&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Ireland&as_ylo=2013&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Kanehisa M%2C Araki M%2C Goto S%2C Hattori M%2C Hirakawa M%2C Itoh M%2C Katayama T%2C Kawashima S%2C Okuda S%2C Tokimatsu T%2C Yamanishi Y %282008%29 KEGG for linking genomes to life and the environment%2E Nucleic Acids Res 36%3A 480%2D484&dopt=abstract

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Kanehisa&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=KEGG for linking genomes to life and the environment&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=KEGG for linking genomes to life and the environment&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Kanehisa&as_ylo=2008&as_allsubj=all&hl=en&c2coff=1


Karlova R, Rosin FM, Busscher-Lange J, Parapunova V, Do PT, Fernie AR, Fraser PD, Baxter C, Angenent GC, De Maagd RA (2011)Transcriptome and metabolite profiling show that APETALA2a is a major regulator of tomato fruit ripening. Plant Cell 23: 923-941


Kim D, Pertea G, Trapnell C, Pimentel H, Kelley R, Salzberg SL (2013) TopHat2: accurate alignment of transcriptomes in the presenceof insertion, deletions and gene fusions. Genome Biol 14: R36


Klee HJ, Giovannoni JJ (2011) Genetics and control of tomato fruit ripening and quality attributes. Annu Rev Genet 45: 41-59Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Koukounaras A, Sfakiotakis E (2007) Effect of 1-MCP prestorage treatment on ethylene and CO2 production and quality of 'Hayward'kiwifruit during shelf-life after short, medium and long term cold storage. Postharvest Biol Tec 46: 174-180


Kuang JF, Chen JY, Liu XC, Han YC, Xiao YY, Shan W, Yang T, Wu KQ, He JX, Lu WJ (2017) The transcriptional regulatory networkmediated by banana (Musa acuminata) dehydration-responsive element binding (MaDREB) transcription factors in fruit ripening. NewPhytol 214: 762-781


Lee JM, Joung JG, McQuinn R, Chung MY, Fei ZJ, Tieman D, Klee H, Giovannoni J (2012) Combined transcriptome, genetic diversityand metabolite profiling in tomato fruit reveals that the ethylene response factor SlERF6 plays an important role in ripening andcarotenoid accumulation. Plant J 70: 191-204


Li T, Jiang ZY, Zhang LC, Tan DM, Wei Y, Yuan H, Li TL, Wang AD (2016) Apple (Malus Domestica) MdERF2 negatively affects ethylenebiosynthesis during fruit ripening by suppressing MdACS1 transcription. Plant J 88: 735-748


Li T, Xu YX, Zhang LC, Ji YL, Tan DM, Yuan H, Wang AD (2017) The jasmonate-activated transcription factor MdMYC2 regulatesETHYLENE RESPONSE FACTOR and ethylene biosynthetic genes to promote ethylene biosynthesis during apple fruit ripening. PlantCell 29: 1316-1334


Lin ZF, Hong YG, Yin MG, Li CY, Zhang K, Grierson D (2008) A tomato HD-Zip homeobox protein, LeHB-1, plays an important role infloral organogenesis and ripening. Plant J 55: 301-310


Liu MC, Diretto G, Pirrello J, Roustan JP, Li ZG, Giuliano G, Regad F, Bouzayen M (2014) The chimeric repressor version of anEthylene Response Factor (ERF) family member, Sl-ERF. B3, shows contrasting effects on tomato fruit ripening. New Phytol 203: 206-218


Lv QD, Zhong YJ, Wang YG, Wang ZY, Zhang L, Shi J, Wu ZC, Liu Y, Mao CZ, Yi KK, Wu P (2014) SPX4 Negatively Regulates PhosphateSignaling and Homeostasis through Its Interaction with PHR2 in Rice. Plant Cell 26: 1586-1597


Ma NN, Feng HL, Meng X, Li D, Yang DY, Wu CG, Meng QW (2014) Overexpression of tomato SlNAC1 transcription factor alters fruitpigmentation and softening. BMC Plant Biol 14: 351


Manning K, Tör M, Poole M, Hong Y, Thompson AJ, King GJ, Giovannoni JJ, Seymour GB (2006) A naturally occurring epigeneticmutation in a gene encoding an SBP-box transcription factor inhibits tomato fruit ripening. Nat Genet 38: 948-952


Mao XZ, Cai T, Olyarchuk JG, Wei LP (2005) Automated genome annotation and pathway identification using the KEGG Orthology (KO)as a controlled vocabulary. Bioinformatics 21: 3787-3793


Marzabal P, Gas E, Fontanet P, Vicente-Carbajosa J, Torrent M, Ludevid MD (2008) The maize Dof protein PBF activates transcription www.plantphysiol.orgon January 30, 2020 - Published by Downloaded from

Copyright © 2018 American Society of Plant Biologists. All rights reserved.

http://www.ncbi.nlm.nih.gov/pubmed?term=Karlova R%2C Rosin FM%2C Busscher%2DLange J%2C Parapunova V%2C Do PT%2C Fernie AR%2C Fraser PD%2C Baxter C%2C Angenent GC%2C De Maagd RA %282011%29 Transcriptome and metabolite profiling show that APETALA2a is a major regulator of tomato fruit ripening%2E Plant Cell 23%3A 923%2D941&dopt=abstract

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Karlova&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Transcriptome and metabolite profiling show that APETALA2a is a major regulator of tomato fruit ripening&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Transcriptome and metabolite profiling show that APETALA2a is a major regulator of tomato fruit ripening&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Karlova&as_ylo=2011&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Kim D%2C Pertea G%2C Trapnell C%2C Pimentel H%2C Kelley R%2C Salzberg SL %282013%29 TopHat2%3A accurate alignment of transcriptomes in the presence of insertion%2C deletions and gene fusions%2E Genome Biol 14%3A R36&dopt=abstract

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Kim&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=TopHat2: accurate alignment of transcriptomes in the presence of insertion, deletions and gene fusions.&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=TopHat2: accurate alignment of transcriptomes in the presence of insertion, deletions and gene fusions.&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Kim&as_ylo=2013&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Klee HJ%2C Giovannoni JJ %282011%29 Genetics and control of tomato fruit ripening and quality attributes%2E Annu Rev Genet 45%3A 41%2D59&dopt=abstract

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Klee&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Genetics and control of tomato fruit ripening and quality attributes&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Genetics and control of tomato fruit ripening and quality attributes&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Klee&as_ylo=2011&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Koukounaras A%2C Sfakiotakis E %282007%29 Effect of 1%2DMCP prestorage treatment on ethylene and CO2 production and quality of %27Hayward%27 kiwifruit during shelf%2Dlife after short%2C medium and long term cold storage%2E Postharvest Biol Tec 46%3A 174%2D180&dopt=abstract

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Koukounaras&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Effect of 1-MCP prestorage treatment on ethylene and CO2 production and quality of 'Hayward' kiwifruit during shelf-life after short, medium and long term cold storage&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Effect of 1-MCP prestorage treatment on ethylene and CO2 production and quality of 'Hayward' kiwifruit during shelf-life after short, medium and long term cold storage&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Koukounaras&as_ylo=2007&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Kuang JF%2C Chen JY%2C Liu XC%2C Han YC%2C Xiao YY%2C Shan W%2C Yang T%2C Wu KQ%2C He JX%2C Lu WJ %282017%29 The transcriptional regulatory network mediated by banana %28Musa acuminata%29 dehydration%2Dresponsive element binding %28MaDREB%29 transcription factors in fruit ripening%2E New Phytol 214%3A 762%2D781&dopt=abstract

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Kuang&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=The transcriptional regulatory network mediated by banana (Musa acuminata) dehydration-responsive element binding (MaDREB) transcription factors in fruit ripening&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=The transcriptional regulatory network mediated by banana (Musa acuminata) dehydration-responsive element binding (MaDREB) transcription factors in fruit ripening&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Kuang&as_ylo=2017&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Lee JM%2C Joung JG%2C McQuinn R%2C Chung MY%2C Fei ZJ%2C Tieman D%2C Klee H%2C Giovannoni J %282012%29 Combined transcriptome%2C genetic diversity and metabolite profiling in tomato fruit reveals that the ethylene response factor SlERF6 plays an important role in ripening and carotenoid accumulation%2E Plant J 70%3A 191%2D204&dopt=abstract

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Lee&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Combined transcriptome, genetic diversity and metabolite profiling in tomato fruit reveals that the ethylene response factor SlERF6 plays an important role in ripening and carotenoid accumulation&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Combined transcriptome, genetic diversity and metabolite profiling in tomato fruit reveals that the ethylene response factor SlERF6 plays an important role in ripening and carotenoid accumulation&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Lee&as_ylo=2012&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Li T%2C Jiang ZY%2C Zhang LC%2C Tan DM%2C Wei Y%2C Yuan H%2C Li TL%2C Wang AD %282016%29 Apple %28Malus Domestica%29 MdERF2 negatively affects ethylene biosynthesis during fruit ripening by suppressing MdACS1 transcription%2E Plant J 88%3A 735%2D748&dopt=abstract

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Li&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Apple (Malus Domestica) MdERF2 negatively affects ethylene biosynthesis during fruit ripening by suppressing MdACS1 transcription&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Apple (Malus Domestica) MdERF2 negatively affects ethylene biosynthesis during fruit ripening by suppressing MdACS1 transcription&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Li&as_ylo=2016&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Li T%2C Xu YX%2C Zhang LC%2C Ji YL%2C Tan DM%2C Yuan H%2C Wang AD %282017%29 The jasmonate%2Dactivated transcription factor MdMYC2 regulates ETHYLENE RESPONSE FACTOR and ethylene biosynthetic genes to promote ethylene biosynthesis during apple fruit ripening%2E Plant Cell 29%3A 1316%2D1334&dopt=abstract

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Li&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=The jasmonate-activated transcription factor MdMYC2 regulates ETHYLENE RESPONSE FACTOR and ethylene biosynthetic genes to promote ethylene biosynthesis during apple fruit ripening&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=The jasmonate-activated transcription factor MdMYC2 regulates ETHYLENE RESPONSE FACTOR and ethylene biosynthetic genes to promote ethylene biosynthesis during apple fruit ripening&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Li&as_ylo=2017&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Lin ZF%2C Hong YG%2C Yin MG%2C Li CY%2C Zhang K%2C Grierson D %282008%29 A tomato HD%2DZip homeobox protein%2C LeHB%2D1%2C plays an important role in floral organogenesis and ripening%2E Plant J 55%3A 301%2D310&dopt=abstract

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Lin&hl=en&c2coff=1


http://scholar.google.com/scholar?as_q=&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Lin&as_ylo=2008&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Liu MC%2C Diretto G%2C Pirrello J%2C Roustan JP%2C Li ZG%2C Giuliano G%2C Regad F%2C Bouzayen M %282014%29 The chimeric repressor version of an Ethylene Response Factor %28ERF%29 family member%2C Sl%2DERF%2E B3%2C shows contrasting effects on tomato fruit ripening%2E New Phytol 203%3A 206%2D218&dopt=abstract

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Liu&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=The chimeric repressor version of an Ethylene Response Factor (ERF) family member, Sl-ERF&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=The chimeric repressor version of an Ethylene Response Factor (ERF) family member, Sl-ERF&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Liu&as_ylo=2014&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Lv QD%2C Zhong YJ%2C Wang YG%2C Wang ZY%2C Zhang L%2C Shi J%2C Wu ZC%2C Liu Y%2C Mao CZ%2C Yi KK%2C Wu P %282014%29 SPX4 Negatively Regulates Phosphate Signaling and Homeostasis through Its Interaction with PHR2 in Rice%2E Plant Cell 26%3A 1586%2D1597&dopt=abstract

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Lv&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=SPX4 Negatively Regulates Phosphate Signaling and Homeostasis through Its Interaction with PHR2 in Rice&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=SPX4 Negatively Regulates Phosphate Signaling and Homeostasis through Its Interaction with PHR2 in Rice&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Lv&as_ylo=2014&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Ma NN%2C Feng HL%2C Meng X%2C Li D%2C Yang DY%2C Wu CG%2C Meng QW %282014%29 Overexpression of tomato SlNAC1 transcription factor alters fruit pigmentation and softening%2E BMC Plant Biol 14%3A 351&dopt=abstract

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Ma&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Overexpression of tomato SlNAC1 transcription factor alters fruit pigmentation and softening.&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Overexpression of tomato SlNAC1 transcription factor alters fruit pigmentation and softening.&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Ma&as_ylo=2014&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Manning K%2C T�r M%2C Poole M%2C Hong Y%2C Thompson AJ%2C King GJ%2C Giovannoni JJ%2C Seymour GB %282006%29 A naturally occurring epigenetic mutation in a gene encoding an SBP%2Dbox transcription factor inhibits tomato fruit ripening%2E Nat Genet 38%3A 948%2D952&dopt=abstract

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Manning&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=A naturally occurring epigenetic mutation in a gene encoding an SBP-box transcription factor inhibits tomato fruit ripening&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=A naturally occurring epigenetic mutation in a gene encoding an SBP-box transcription factor inhibits tomato fruit ripening&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Manning&as_ylo=2006&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Mao XZ%2C Cai T%2C Olyarchuk JG%2C Wei LP %282005%29 Automated genome annotation and pathway identification using the KEGG Orthology %28KO%29 as a controlled vocabulary%2E Bioinformatics 21%3A 3787%2D3793&dopt=abstract

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Mao&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Automated genome annotation and pathway identification using the KEGG Orthology (KO) as a controlled vocabulary&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Automated genome annotation and pathway identification using the KEGG Orthology (KO) as a controlled vocabulary&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Mao&as_ylo=2005&as_allsubj=all&hl=en&c2coff=1


of γ-zein during maize seed development. Plant Mol Biol 67: 441-454Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Mcdonald B, Harman JE (1982) Controlled-atmosphere storage of kiwifruit. 1. Effect on fruit firmness and storage life. Sci Hortic 17:113-123


Meng C, Yang DY, Ma XC, Zhao WY, Liang XQ, Ma NN, Meng QW (2016) Suppression of tomato SlNAC1 transcription factor delays fruitripening. J Plant Physiol 193: 88-96


Min T, Yin XR, Shi YN, Luo ZR, Yao YC, Grierson D, Ferguson IB, Chen KS (2012) Ethylene-responsive transcription factors interactwith promoters of ADH and PDC involved in persimmon (Diospyros kaki) fruit de-astringency. J Exp Bot 63: 6393-6405


Minas IS, Vicente AR, Dhanapal AP, Manganaris GA, Goulas V, Vasilakakis M, Crisosto CH, Molassiotis A (2014) Ozone-induced kiwifruitripening delay is mediated by ethylene biosynthesis inhibition and cell wall dismantling regulation. Plant Sci 229: 76-85


Mworia EG, Yoshikawa T, Salikon N, Oda C, Asiche WO, Yokotani N, Abe D, Ushijima K, Nakano R, Kubo Y (2012) Low-temperature-modulated fruit ripening is independent of ethylene in 'Sanuki Gold' kiwifruit. J Exp Bot 63: 963-971


Nardozza S, Boldingh HL, Osorio S, Höhne M, Wohlers M, Gleave AP, MacRae EA, Richardson AC, Atkinson RG, Sulpice R, Fernie AR,Clearwater MJ (2013) Metabolic analysis of kiwifruit (Actinidia deliciosa) berries from extreme genotypes reveals hallmarks for fruitstarch metabolism. J Exp Bot 64: 5049-5063


Nieuwenhuizen NJ, Chen X, Wang MY, Matich AJ, Perez RL, Allan AC, Green SA, Atkinson RG (2015) Natural variation in monoterpenesynthesis in kiwifruit: transcriptional regulation of terpene synthases by NAC and ETHYLENE-INSENSITIVE3-like transcription factors.Plant Physiol 167: 1243-1258


Peng T, Zhu XF, Duan N, Liu JH (2014) PtrBAM1, a β-amylase-coding gene of Poncirus trifoliata, is a CBF regulon member with functionin cold tolerance by modulating soluble sugar levels. Plant Cell Environ 37: 2754-2767


Prasanna V, Prabha TN, Tharanathan RN (2007) Fruit ripening phenomena-an overview. Crit Rev Food Sci 47: 1-19Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Qi X, Li SX, Zhu YX, Zhao Q, Zhu DY, Yu JJ (2017) ZmDof3, a maize endosperm-specific Dof protein gene, regulates starchaccumulation and aleurone development in maize endosperm. Plant Mol Biol 93: 7-20


Seymour GB, Ryder CD, Cevik V, Hammond JP, Popovich A, King GJ, Vrebalov J, Giovannoni JJ, Manning K (2011) A SEPALLATA geneis involved in the development and ripening of strawberry (Fragaria×ananassa Duch.) fruit, a non-climacteric tissue. J Exp Bot 62:1179-1188


Seymour GB, Chapman NH, Chew BL, Rose JKC (2013) Regulation of ripening and opportunities for control in tomato and other fruits.Plant Biotechnol J 11: 269-278


Stevenson DG, Johnson SR, Jane J, Inglett GE (2010) Chemical and Physical Properties of Kiwifruit (Actinidia deliciosa) Starch. Starch-Stärke 58: 323-329


Tacken E, Ireland H, Gunaseelan K, Karunairetnam S, Wang D, Schultz K, Bowen J, Atkinson RG, Johnston JW, Putterill J, Hellens RP,Schaffer RJ (2010) The role of ethylene and cold temperature in the regulation of the apple POLYGALACTURONASE1 gene and fruitsoftening. Plant Physiol 153: 294-305


http://www.ncbi.nlm.nih.gov/pubmed?term=Marzabal P%2C Gas E%2C Fontanet P%2C Vicente%2DCarbajosa J%2C Torrent M%2C Ludevid MD %282008%29 The maize Dof protein PBF activates transcription of γ%2Dzein during maize seed development%2E Plant Mol Biol 67%3A 441%2D454&dopt=abstract

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Marzabal&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=The maize Dof protein PBF activates transcription of �?³-zein during maize seed development&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=The maize Dof protein PBF activates transcription of �?³-zein during maize seed development&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Marzabal&as_ylo=2008&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Mcdonald B%2C Harman JE %281982%29 Controlled%2Datmosphere storage of kiwifruit%2E 1%2E Effect on fruit firmness and storage life%2E Sci Hortic 17%3A 113%2D123&dopt=abstract

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Mcdonald&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Controlled-atmosphere storage of kiwifruit&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Controlled-atmosphere storage of kiwifruit&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Mcdonald&as_ylo=1982&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Meng C%2C Yang DY%2C Ma XC%2C Zhao WY%2C Liang XQ%2C Ma NN%2C Meng QW %282016%29 Suppression of tomato SlNAC1 transcription factor delays fruit ripening%2E J Plant Physiol 193%3A 88%2D96&dopt=abstract

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Meng&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Suppression of tomato SlNAC1 transcription factor delays fruit ripening&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Suppression of tomato SlNAC1 transcription factor delays fruit ripening&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Meng&as_ylo=2016&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Min T%2C Yin XR%2C Shi YN%2C Luo ZR%2C Yao YC%2C Grierson D%2C Ferguson IB%2C Chen KS %282012%29 Ethylene%2Dresponsive transcription factors interact with promoters of ADH and PDC involved in persimmon %28Diospyros kaki%29 fruit de%2Dastringency%2E J Exp Bot 63%3A 6393%2D6405&dopt=abstract

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Min&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Ethylene-responsive transcription factors interact with promoters of ADH and PDC involved in persimmon (Diospyros kaki) fruit de-astringency&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Ethylene-responsive transcription factors interact with promoters of ADH and PDC involved in persimmon (Diospyros kaki) fruit de-astringency&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Min&as_ylo=2012&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Minas IS%2C Vicente AR%2C Dhanapal AP%2C Manganaris GA%2C Goulas V%2C Vasilakakis M%2C Crisosto CH%2C Molassiotis A %282014%29 Ozone%2Dinduced kiwifruit ripening delay is mediated by ethylene biosynthesis inhibition and cell wall dismantling regulation%2E Plant Sci 229%3A 76%2D85&dopt=abstract

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Minas&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Ozone-induced kiwifruit ripening delay is mediated by ethylene biosynthesis inhibition and cell wall dismantling regulation&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Ozone-induced kiwifruit ripening delay is mediated by ethylene biosynthesis inhibition and cell wall dismantling regulation&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Minas&as_ylo=2014&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Mworia EG%2C Yoshikawa T%2C Salikon N%2C Oda C%2C Asiche WO%2C Yokotani N%2C Abe D%2C Ushijima K%2C Nakano R%2C Kubo Y %282012%29 Low%2Dtemperature%2Dmodulated fruit ripening is independent of ethylene in %27Sanuki Gold%27 kiwifruit%2E J Exp Bot 63%3A 963%2D971&dopt=abstract

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Mworia&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Low-temperature-modulated fruit ripening is independent of ethylene in 'Sanuki Gold' kiwifruit&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Low-temperature-modulated fruit ripening is independent of ethylene in 'Sanuki Gold' kiwifruit&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Mworia&as_ylo=2012&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Nardozza S%2C Boldingh HL%2C Osorio S%2C H�hne M%2C Wohlers M%2C Gleave AP%2C MacRae EA%2C Richardson AC%2C Atkinson RG%2C Sulpice R%2C Fernie AR%2C Clearwater MJ %282013%29 Metabolic analysis of kiwifruit %28Actinidia deliciosa%29 berries from extreme genotypes reveals hallmarks for fruit starch metabolism%2E J Exp Bot 64%3A 5049%2D5063&dopt=abstract

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Nardozza&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Metabolic analysis of kiwifruit (Actinidia deliciosa) berries from extreme genotypes reveals hallmarks for fruit starch metabolism&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Metabolic analysis of kiwifruit (Actinidia deliciosa) berries from extreme genotypes reveals hallmarks for fruit starch metabolism&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Nardozza&as_ylo=2013&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Nieuwenhuizen NJ%2C Chen X%2C Wang MY%2C Matich AJ%2C Perez RL%2C Allan AC%2C Green SA%2C Atkinson RG %282015%29 Natural variation in monoterpene synthesis in kiwifruit%3A transcriptional regulation of terpene synthases by NAC and ETHYLENE%2DINSENSITIVE3%2Dlike transcription factors%2E Plant Physiol 167%3A 1243%2D1258&dopt=abstract

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Nieuwenhuizen&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Natural variation in monoterpene synthesis in kiwifruit: transcriptional regulation of terpene synthases by NAC and ETHYLENE-INSENSITIVE3-like transcription factors&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Natural variation in monoterpene synthesis in kiwifruit: transcriptional regulation of terpene synthases by NAC and ETHYLENE-INSENSITIVE3-like transcription factors&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Nieuwenhuizen&as_ylo=2015&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Peng T%2C Zhu XF%2C Duan N%2C Liu JH %282014%29 PtrBAM1%2C a β%2Damylase%2Dcoding gene of Poncirus trifoliata%2C is a CBF regulon member with function in cold tolerance by modulating soluble sugar levels%2E Plant Cell Environ 37%3A 2754%2D2767&dopt=abstract

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Peng&hl=en&c2coff=1


http://scholar.google.com/scholar?as_q=&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Peng&as_ylo=2014&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Prasanna V%2C Prabha TN%2C Tharanathan RN %282007%29 Fruit ripening phenomena%2Dan overview%2E Crit Rev Food Sci 47%3A 1%2D19&dopt=abstract

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Prasanna&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Fruit ripening phenomena-an overview&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Fruit ripening phenomena-an overview&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Prasanna&as_ylo=2007&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Qi X%2C Li SX%2C Zhu YX%2C Zhao Q%2C Zhu DY%2C Yu JJ %282017%29 ZmDof3%2C a maize endosperm%2Dspecific Dof protein gene%2C regulates starch accumulation and aleurone development in maize endosperm%2E Plant Mol Biol 93%3A 7%2D20&dopt=abstract

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Qi&hl=en&c2coff=1


http://scholar.google.com/scholar?as_q=&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Qi&as_ylo=2017&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Seymour GB%2C Ryder CD%2C Cevik V%2C Hammond JP%2C Popovich A%2C King GJ%2C Vrebalov J%2C Giovannoni JJ%2C Manning K %282011%29 A SEPALLATA gene is involved in the development and ripening of strawberry %28Fragaria�ananassa Duch%2E%29 fruit%2C a non%2Dclimacteric tissue%2E J Exp Bot 62%3A 1179%2D1188&dopt=abstract

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Seymour&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=A SEPALLATA gene is involved in the development and ripening of strawberry (Fragaria�?ananassa Duch&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=A SEPALLATA gene is involved in the development and ripening of strawberry (Fragaria�?ananassa Duch&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Seymour&as_ylo=2011&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Seymour GB%2C Chapman NH%2C Chew BL%2C Rose JKC %282013%29 Regulation of ripening and opportunities for control in tomato and other fruits%2E Plant Biotechnol J 11%3A 269%2D278&dopt=abstract

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Seymour&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Regulation of ripening and opportunities for control in tomato and other fruits&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Regulation of ripening and opportunities for control in tomato and other fruits&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Seymour&as_ylo=2013&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Stevenson DG%2C Johnson SR%2C Jane J%2C Inglett GE %282010%29 Chemical and Physical Properties of Kiwifruit %28Actinidia deliciosa%29 Starch%2E Starch%2DSt�rke 58%3A 323%2D329&dopt=abstract

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Stevenson&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Chemical and Physical Properties of Kiwifruit (Actinidia deliciosa) Starch&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Chemical and Physical Properties of Kiwifruit (Actinidia deliciosa) Starch&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Stevenson&as_ylo=2010&as_allsubj=all&hl=en&c2coff=1



Tang W, Zheng Y, Dong J, Yu J, Yue JY, Liu FF, Guo XH, Huang SX, Wisniewski M, Sun JQ, Niu XL, Ding J, Liu J, Fei ZJ, Liu YS (2016)Comprehensive transcriptome profiling reveals long noncoding RNA expression and alternative splicing regulation during fruitdevelopment and ripening in kiwifruit (Actinidia chinensis). Front Plant Sci 7: 335


Trapnell C, Williams BA, Pertea G, Mortazavi A, Kwan G, van Baren MJ, Salzberg SL, Wold BJ, Pachter L (2010) Transcript assemblyand quantification by RNA-Seq reveals unannotated transcripts and isoform switching during cell differentiation. Nature Biotechnology28: 511-515


Uluisik S, Chapan NH, Smith R, Poole M, Adams G, Gillis RB, Besong TMD, Sheldon J, Stiegelmeyer S, Perez L, Samsulrizal N, Wang D,Fisk ID, Yang N, Baxter C, Rickett D, Fray R, Blanco-Ulate B, Powell ALT, Harding SE, Craigon J, Rose JKC, Fich EA, Sun L, DomozychDS, Fraser PD, Tucker GA, Grierson D, Seymour GB (2016) Genetic improvement of tomato by targeted control of fruit softening. NatBiotechnol 39: 950-952


Vicente AR, Manganaris GA, Minas IS,Goulas V, Lafuente M (2013) Cell wall modifications and ethylene-induced tolerance to non-chilling peel pitting in citrus fruit. Plant Sci 210: 46-52


Vrebalov J, Ruezinsky D, Padmanabhan V, White R, Medrano D, Drake R, Schuch W, Giovannoni J (2002) A MADS-box gene necessaryfor fruit ripening at the tomato ripening-inhibitor (Rin) locus. Science 296: 343-346


Wang ZY, MacRae EA, Wright MA, Bolitho KM, Ross GS, Atkinson RG (2000) Polygalacturonase gene expression in kiwifruit:relationship to fruit softening and ethylene production. Plant Mol Biol 42: 317-328


Wilkinson JQ, Lanahan MB, Yen HC, Giovannoni JJ, Klee HJ (1995) An ethylene-inducible component of signal transduction encodedby Never-ripe. Science 270: 1807-1809


Xiao YY, Kuang JF, Qi XN, Ye YJ, Wu ZX, Chen JY, Lu WJ (2018) A comprehensive investigation of starch degradation process andidentification of a transcriptional activator MabHLH6 during banana fruit ripening. Plant Biotechnol J 16: 151-164


Xie XL, Yin XR, Chen KS (2016) Roles of APETALA2/Ethylene Responsive Factors in regulation of fruit quality. Crit Rev Plant Sci 35:120-130


Xu ZC, Hyodo H, Ikoma Y, Yano M, Ogawa K (1998) Biochemical characterization and expression of recombinant ACC oxidase inEscherichia coli, and endogenous ACC oxidase from kiwifruit. Postharvest Biol Tec 14: 41-50


Yanagisawa S, Schmidt RJ (1999) Diversity and similarity among recognition sequence of Dof transcription factors. Plant J 17: 209-214Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Yang L, Huang W, Xiong FJ, Xian ZQ, Su DD, Ren MZ, Li ZG (2017) Silencing of SlPL, which encodes a pectate lyase in tomato, confersenhanced fruit firmness, prolonged shelf-life, and reduced susceptibility to gray mold. Plant Biotechnol J 15: 1544-1555


Yemm EW, Willis AJ (1954) The estimation of carbohydrates in plant extracts by anthrone. Biochem J 57: 508-514Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Yin XR, Chen KS, Allan AC, Wu RM, Zhang B, Lallu N, Ferguson I (2008) Ethylene-induced modulation of genes associated with theethylene signaling pathway in ripening kiwifruit. J Exp Bot 59: 2097-2108



http://www.ncbi.nlm.nih.gov/pubmed?term=Tacken E%2C Ireland H%2C Gunaseelan K%2C Karunairetnam S%2C Wang D%2C Schultz K%2C Bowen J%2C Atkinson RG%2C Johnston JW%2C Putterill J%2C Hellens RP%2C Schaffer RJ %282010%29 The role of ethylene and cold temperature in the regulation of the apple POLYGALACTURONASE1 gene and fruit softening%2E Plant Physiol 153%3A 294%2D305&dopt=abstract

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Tacken&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=The role of ethylene and cold temperature in the regulation of the apple POLYGALACTURONASE1 gene and fruit softening&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=The role of ethylene and cold temperature in the regulation of the apple POLYGALACTURONASE1 gene and fruit softening&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Tacken&as_ylo=2010&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Tang W%2C Zheng Y%2C Dong J%2C Yu J%2C Yue JY%2C Liu FF%2C Guo XH%2C Huang SX%2C Wisniewski M%2C Sun JQ%2C Niu XL%2C Ding J%2C Liu J%2C Fei ZJ%2C Liu YS %282016%29 Comprehensive transcriptome profiling reveals long noncoding RNA expression and alternative splicing regulation during fruit development and ripening in kiwifruit %28Actinidia chinensis%29%2E Front Plant Sci 7%3A 335&dopt=abstract

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Tang&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Comprehensive transcriptome profiling reveals long noncoding RNA expression and alternative splicing regulation during fruit development and ripening in kiwifruit (Actinidia chinensis).&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Comprehensive transcriptome profiling reveals long noncoding RNA expression and alternative splicing regulation during fruit development and ripening in kiwifruit (Actinidia chinensis).&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Tang&as_ylo=2016&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Trapnell C%2C Williams BA%2C Pertea G%2C Mortazavi A%2C Kwan G%2C van Baren MJ%2C Salzberg SL%2C Wold BJ%2C Pachter L %282010%29 Transcript assembly and quantification by RNA%2DSeq reveals unannotated transcripts and isoform switching during cell differentiation%2E Nature Biotechnology 28%3A 511%2D515&dopt=abstract

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Trapnell&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Transcript assembly and quantification by RNA-Seq reveals unannotated transcripts and isoform switching during cell differentiation&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Transcript assembly and quantification by RNA-Seq reveals unannotated transcripts and isoform switching during cell differentiation&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Trapnell&as_ylo=2010&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Uluisik S%2C Chapan NH%2C Smith R%2C Poole M%2C Adams G%2C Gillis RB%2C Besong TMD%2C Sheldon J%2C Stiegelmeyer S%2C Perez L%2C Samsulrizal N%2C Wang D%2C Fisk ID%2C Yang N%2C Baxter C%2C Rickett D%2C Fray R%2C Blanco%2DUlate B%2C Powell ALT%2C Harding SE%2C Craigon J%2C Rose JKC%2C Fich EA%2C Sun L%2C Domozych DS%2C Fraser PD%2C Tucker GA%2C Grierson D%2C Seymour GB %282016%29 Genetic improvement of tomato by targeted control of fruit softening%2E Nat Biotechnol 39%3A 950%2D952&dopt=abstract

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Uluisik&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Genetic improvement of tomato by targeted control of fruit softening&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Genetic improvement of tomato by targeted control of fruit softening&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Uluisik&as_ylo=2016&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Vicente AR%2C Manganaris GA%2C Minas IS%2CGoulas V%2C Lafuente M %282013%29 Cell wall modifications and ethylene%2Dinduced tolerance to non%2Dchilling peel pitting in citrus fruit%2E Plant Sci 210%3A 46%2D52&dopt=abstract

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Vicente&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Cell wall modifications and ethylene-induced tolerance to non-chilling peel pitting in citrus fruit&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Cell wall modifications and ethylene-induced tolerance to non-chilling peel pitting in citrus fruit&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Vicente&as_ylo=2013&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Vrebalov J%2C Ruezinsky D%2C Padmanabhan V%2C White R%2C Medrano D%2C Drake R%2C Schuch W%2C Giovannoni J %282002%29 A MADS%2Dbox gene necessary for fruit ripening at the tomato ripening%2Dinhibitor %28Rin%29 locus%2E Science 296%3A 343%2D346&dopt=abstract

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Vrebalov&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=A MADS-box gene necessary for fruit ripening at the tomato ripening-inhibitor (Rin) locus&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=A MADS-box gene necessary for fruit ripening at the tomato ripening-inhibitor (Rin) locus&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Vrebalov&as_ylo=2002&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Wang ZY%2C MacRae EA%2C Wright MA%2C Bolitho KM%2C Ross GS%2C Atkinson RG %282000%29 Polygalacturonase gene expression in kiwifruit%3A relationship to fruit softening and ethylene production%2E Plant Mol Biol 42%3A 317%2D328&dopt=abstract

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Wang&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Polygalacturonase gene expression in kiwifruit: relationship to fruit softening and ethylene production&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Polygalacturonase gene expression in kiwifruit: relationship to fruit softening and ethylene production&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Wang&as_ylo=2000&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Wilkinson JQ%2C Lanahan MB%2C Yen HC%2C Giovannoni JJ%2C Klee HJ %281995%29 An ethylene%2Dinducible component of signal transduction encoded by Never%2Dripe%2E Science 270%3A 1807%2D1809&dopt=abstract

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Wilkinson&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=An ethylene-inducible component of signal transduction encoded by Never-ripe&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=An ethylene-inducible component of signal transduction encoded by Never-ripe&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Wilkinson&as_ylo=1995&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Xiao YY%2C Kuang JF%2C Qi XN%2C Ye YJ%2C Wu ZX%2C Chen JY%2C Lu WJ %282018%29 A comprehensive investigation of starch degradation process and identification of a transcriptional activator MabHLH6 during banana fruit ripening%2E Plant Biotechnol J 16%3A 151%2D164&dopt=abstract

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Xiao&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=A comprehensive investigation of starch degradation process and identification of a transcriptional activator MabHLH6 during banana fruit ripening&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=A comprehensive investigation of starch degradation process and identification of a transcriptional activator MabHLH6 during banana fruit ripening&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Xiao&as_ylo=2018&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Xie XL%2C Yin XR%2C Chen KS %282016%29 Roles of APETALA2%2FEthylene Responsive Factors in regulation of fruit quality%2E Crit Rev Plant Sci 35%3A 120%2D130&dopt=abstract

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Xie&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Roles of APETALA2/Ethylene Responsive Factors in regulation of fruit quality&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Roles of APETALA2/Ethylene Responsive Factors in regulation of fruit quality&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Xie&as_ylo=2016&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Xu ZC%2C Hyodo H%2C Ikoma Y%2C Yano M%2C Ogawa K %281998%29 Biochemical characterization and expression of recombinant ACC oxidase in Escherichia coli%2C and endogenous ACC oxidase from kiwifruit%2E Postharvest Biol Tec 14%3A 41%2D50&dopt=abstract

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Xu&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Biochemical characterization and expression of recombinant ACC oxidase in Escherichia coli, and endogenous ACC oxidase from kiwifruit&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Biochemical characterization and expression of recombinant ACC oxidase in Escherichia coli, and endogenous ACC oxidase from kiwifruit&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Xu&as_ylo=1998&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Yanagisawa S%2C Schmidt RJ %281999%29 Diversity and similarity among recognition sequence of Dof transcription factors%2E Plant J 17%3A 209%2D214&dopt=abstract

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Yanagisawa&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Diversity and similarity among recognition sequence of Dof transcription factors&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Diversity and similarity among recognition sequence of Dof transcription factors&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Yanagisawa&as_ylo=1999&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Yang L%2C Huang W%2C Xiong FJ%2C Xian ZQ%2C Su DD%2C Ren MZ%2C Li ZG %282017%29 Silencing of SlPL%2C which encodes a pectate lyase in tomato%2C confers enhanced fruit firmness%2C prolonged shelf%2Dlife%2C and reduced susceptibility to gray mold%2E Plant Biotechnol J 15%3A 1544%2D1555&dopt=abstract

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Yang&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Silencing of SlPL, which encodes a pectate lyase in tomato, confers enhanced fruit firmness, prolonged shelf-life, and reduced susceptibility to gray mold&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Silencing of SlPL, which encodes a pectate lyase in tomato, confers enhanced fruit firmness, prolonged shelf-life, and reduced susceptibility to gray mold&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Yang&as_ylo=2017&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Yemm EW%2C Willis AJ %281954%29 The estimation of carbohydrates in plant extracts by anthrone%2E Biochem J 57%3A 508%2D514&dopt=abstract

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Yemm&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=The estimation of carbohydrates in plant extracts by anthrone&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=The estimation of carbohydrates in plant extracts by anthrone&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Yemm&as_ylo=1954&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Yin XR%2C Chen KS%2C Allan AC%2C Wu RM%2C Zhang B%2C Lallu N%2C Ferguson I %282008%29 Ethylene%2Dinduced modulation of genes associated with the ethylene signaling pathway in ripening kiwifruit%2E J Exp Bot 59%3A 2097%2D2108&dopt=abstract

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Yin&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Ethylene-induced modulation of genes associated with the ethylene signaling pathway in ripening kiwifruit&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Ethylene-induced modulation of genes associated with the ethylene signaling pathway in ripening kiwifruit&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Yin&as_ylo=2008&as_allsubj=all&hl=en&c2coff=1


Yin XR, Allan AC, Chen KS, Ferguson I (2010) Kiwifruit EIL and ERF genes involved in regulating fruit ripening. Plant Physiol 153: 1280-1292


Yin XR, Xie XL, Xia XJ, Yu JQ, Ferguson IB, Giovannoni JJ, Chen KS (2016) Involvement of an ethylene response factor in chlorophylldegradation during citrus fruit degreening. Plant J 86: 403-412


Young MD, Wakefield MJ, Smyth GK, Oshlack A (2010) Gene ontology analysis for RNAseq: accounting for selection bias. Genome Biol11: 14


Zhang AD, Hu X, Kuang S, Ge H, Yin XR, Chen KS (2016) Isolation, classification and transcription profiles of the Ethylene ResponseFactors (ERFs) in ripening kiwifruit. Sci Hortic 199: 209-215


Zhang B, Chen KS, Bowen J, Allan A, Espley R, Karunairetnam S, Ferguson I (2006) Differential expression within the LOX gene familyin ripening kiwifruit. J Exp Bot 57: 3825-3836


Zhu MK, Chen GP, Zhou S, Tu Y, Wang Y, Dong TT, Hu ZL (2014) A new tomato NAC (NAM/ATAF1/2/CUC2) transcription factor, SlNAC4,function as a positive regulator of fruit ripening and carotenoid accumulation. Plant Cell Physiol 55: 119-135



http://www.ncbi.nlm.nih.gov/pubmed?term=Yin XR%2C Allan AC%2C Chen KS%2C Ferguson I %282010%29 Kiwifruit EIL and ERF genes involved in regulating fruit ripening%2E Plant Physiol 153%3A 1280%2D1292&dopt=abstract


http://scholar.google.com/scholar?as_q=Kiwifruit EIL and ERF genes involved in regulating fruit ripening&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Kiwifruit EIL and ERF genes involved in regulating fruit ripening&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Yin&as_ylo=2010&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Yin XR%2C Xie XL%2C Xia XJ%2C Yu JQ%2C Ferguson IB%2C Giovannoni JJ%2C Chen KS %282016%29 Involvement of an ethylene response factor in chlorophyll degradation during citrus fruit degreening%2E Plant J 86%3A 403%2D412&dopt=abstract


http://scholar.google.com/scholar?as_q=Involvement of an ethylene response factor in chlorophyll degradation during citrus fruit degreening&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Involvement of an ethylene response factor in chlorophyll degradation during citrus fruit degreening&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Yin&as_ylo=2016&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Young MD%2C Wakefield MJ%2C Smyth GK%2C Oshlack A %282010%29 Gene ontology analysis for RNAseq%3A accounting for selection bias%2E Genome Biol 11%3A 14&dopt=abstract

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Young&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Gene ontology analysis for RNAseq: accounting for selection bias.&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Gene ontology analysis for RNAseq: accounting for selection bias.&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Young&as_ylo=2010&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Zhang AD%2C Hu X%2C Kuang S%2C Ge H%2C Yin XR%2C Chen KS %282016%29 Isolation%2C classification and transcription profiles of the Ethylene Response Factors %28ERFs%29 in ripening kiwifruit%2E Sci Hortic 199%3A 209%2D215&dopt=abstract

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Zhang&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Isolation, classification and transcription profiles of the Ethylene Response Factors (ERFs) in ripening kiwifruit&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Isolation, classification and transcription profiles of the Ethylene Response Factors (ERFs) in ripening kiwifruit&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Zhang&as_ylo=2016&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Zhang B%2C Chen KS%2C Bowen J%2C Allan A%2C Espley R%2C Karunairetnam S%2C Ferguson I %282006%29 Differential expression within the LOX gene family in ripening kiwifruit%2E J Exp Bot 57%3A 3825%2D3836&dopt=abstract

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Zhang&hl=en&c2coff=1

http://scholar.google.com/scholar?as_q=Differential expression within the LOX gene family in ripening kiwifruit&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

http://scholar.google.com/scholar?as_q=Differential expression within the LOX gene family in ripening kiwifruit&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Zhang&as_ylo=2006&as_allsubj=all&hl=en&c2coff=1

http://www.ncbi.nlm.nih.gov/pubmed?term=Zhu MK%2C Chen GP%2C Zhou S%2C Tu Y%2C Wang Y%2C Dong TT%2C Hu ZL %282014%29 A new tomato NAC %28NAM%2FATAF1%2F2%2FCUC2%29 transcription factor%2C SlNAC4%2C function as a positive regulator of fruit ripening and carotenoid accumulation%2E Plant Cell Physiol 55%3A 119%2D135&dopt=abstract

http://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Zhu&hl=en&c2coff=1


http://scholar.google.com/scholar?as_q=&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Zhu&as_ylo=2014&as_allsubj=all&hl=en&c2coff=1


Transcriptome analysis identifies a zinc finger protein ...Integrative Biology, 15. Zhejiang...

Documents

Transcript of Transcriptome analysis identifies a zinc finger protein ...Integrative Biology, 15. Zhejiang...