www.fems-microbiology.org

FEMS Microbiology Letters 244 (2005) 173–180

Transcriptional regulation through RfaH contributes tointestinal colonization by Escherichia coli

Gabor Nagy a,*, Ulrich Dobrindt b, Lubomir Grozdanov b,Jorg Hacker b, Levente Em}ody a

a Department of Medical Microbiology and Immunology, University of Pecs, 7624 Pecs Szigeti ut 12, Hungaryb Institut fur Molekulare Infektionsbiologie, Universitat Wurzburg, Rontgenring 11., 97070 Wurzburg, Germany

Received 12 October 2004; received in revised form 31 December 2004; accepted 21 January 2005

First published online 1 February 2005

Edited by L.K. Hantke

Abstract

The Escherichia coli regulatory protein RfaH contributes to efficient colonization of the mouse gut. Extraintestinal pathogenic

(ExPEC) as well as non-pathogenic probiotic E. coli strains rapidly outcompeted their isogenic rfaH mutants following oral mixed

infections. LPS-core and O-antigen side-chain as well as capsular polysaccharide synthesis are among the E. coli virulence factors

affected by RfaH. In respect of colonization, deep-rough LPS mutants (waaG) but not capsular (kps) mutants were shown to behave

similarly to rfaH mutants. Furthermore, alteration in the length of O-antigen side-chains did not modify colonization ability either

indicating that it was the regulatory effect of RfaH on LPS-core synthesis, which affected intestinal colonization. Loss of RfaH did

not significantly influence adhesion of bacteria to cultured colon epithelial cells. Increased susceptibility of rfaHmutants to bile salts,

on the other hand, suggested that impaired in vivo survival could be responsible for the reduced colonization capacity.

� 2005 Federation of European Microbiological Societies. Published by Elsevier B.V. All rights reserved.

Keywords: Escherichia coli; RfaH; Colonization; Bile salt resistance; Deep-rough LPS; Group II capsules

1. Introduction

Escherichia coli is a prominent member of the human

intestinal microbial flora. Beside commensal variants,

however, this species includes strains capable of causing

various intestinal as well as extraintestinal infections [1].

Pathogenic strains have evolved upon acquisition of vir-

ulence traits that enable them to cause disease. Thecapability to colonize the intestinal tract by efficiently

competing with the normal microbiota has been consid-

0378-1097/$22.00 � 2005 Federation of European Microbiological Societies

doi:10.1016/j.femsle.2005.01.038

* Corresponding author. Present address: Institut fur Molekulare

Infektionsbiologie, Universitat Wurzburg, Rontgenring 11, 97070

Wurzburg, Germany. Tel.: +49 931 312635; fax: +49 931 312578.

E-mail address: gabor.nagy@aok.pte.hu (G. Nagy).

ered as a multifactorial virulence property. The correla-

tion between intestinal colonization and disease is

evident in case of diarrheagenic strains, and has been

shown to be a prerequisite for E. coli strains eliciting

extraintestinal infections (ExPEC) as well. More than

97% of all urinary tract infections (UTI) is elicited by

members of the patients� own gut flora (ascending

UTI) [2], whereas E. coli strains causing newborn septi-caemia originate from the bacterial flora of the mother

[3]. On the other hand, efficiently colonizing non-patho-

genic E. coli strains could be used as probiotics based on

their potential of outcompeting pathogenic variants [4].

Recent analysis of the genome structure of probiotic E.

coli strain Nissle1917 revealed several factors that may

contribute to the �fitness� of this strain required for

. Published by Elsevier B.V. All rights reserved.

174 G. Nagy et al. / FEMS Microbiology Letters 244 (2005) 173–180

colonization [5]. Lack of certain virulence traits (protein

toxins, serum resistance, P and S-fimbrial adhesins, etc.),

together with the observed ability to efficiently antago-

nize pathogens [6] renders this strain a safe and efficient

probiotic.

RfaH is a virulence regulator of enterobacteria thatfunctions as a transcriptional antiterminator [7,8]. Orig-

inally, RfaH was discovered as a regulator involved in

the synthesis of LPS-core in Salmonella enterica [9]

and E. coli [10]. Later it has been proven to be essential

for the expression of other cell components encoded on

long operons in E. coli. RfaH-affected operons include

those encoding the F-factor [11], O-antigens [12,13], dif-

ferent capsules [14–16], hemin uptake receptor [17], aswell as the toxins alpha-hemolysin [18,19] and CNF-1

[20]. Virulence of prototype uropathogenic E. coli strain

536 was recently shown to be abolished through inacti-

vation of gene rfaH [21]. The present study shows that

RfaH plays a role in the infectious process of E. coli

at an as early stage as the colonization of the intestinal

tract.

2. Materials and methods

Strains and plasmids used in this study as well as their

characteristics are shown in Table 1. Spontaneous strep-

Table 1

Strains and plasmids used in this study

Strain/plasmid Relevant characteristics

Strains

Nissle1917 Probiotic E. coli strain O6:K5:H1, commercially a

Nissle1917-S Spontaneous streptomycin-resistant (SmR) variant

Nissle1917-R1 Nissle1917-SDrfaH::cat; SmR, CmR

Nissle1917-R3 Nissle1917-SDrfaH::cat (pSMK1);trans-compleme

Nissle1917-WG1 Nissle1917-SDwaaG::kan; SmR, KmR

Nissle1917-WG3 Nissle1917-SDwaaG::kan (pWGN5);trans-complem

Nissle1917kps Nissle1917-SDkps::kan; SmR, KmR

Nissle1917-DM Nissle1917-SDkps::kan,DwaaG::cat; SmR, KmR, C

Nissle1917::wb*536 Smooth LPS phenotype obtained through integrat

gene from UPEC strain 536; SmR

Nissle1917::wb*536�A Nissle1917::wb*536,attB::bla; SmR, ApR

IHE3034 Wild-type E. coli strain causing newborn meningi

IHE3034-S Spontaneous streptomycin-resistant (SmR) variant

IHE3034-R1 IHE3034-SDrfaH::cat SmR, CmR

IHE3034-WG1 IHE3034-SDwaaG::kan; SmR, KmR

IHE3034kps IHE3034-SDkps::kan; SmR, KmR

IHE3034-DM IHE3034-SDkps::kan,DwaaG::cat; SmR, KmR, Cm

Plasmids

pKD3 Template plasmid for the amplification of the cat

pKD4 Template plasmid for the amplification of the kan

pKD46 Red recombinase expression vector, helper plasmi

pCVD442 Suicide plasmid, ApR

pSMK1 E. coli strain 536 rfaH gene cloned into pGEM-T

pWGN-5 waaGNissle1917 gene cloned into pUC18, ApR

pLDR9 Cloning plasmid for the integration in the attB sit

pSMK5 rfaH::cat cloned into suicide vector pCVD442, Ap

tomycin-resistant (SmR) variants were selected by plat-

ing overnight cultures on LB agar plates containing

50 lg ml�1 streptomycin. Gene rfaH was disrupted

through integration of a cat cassette by homologous

recombination of pSMK5 (rfaH ::cat cloned into a sui-

cide plasmid) as explained elsewhere [17,22]. IsogenicwaaG and kps (entire group II capsular determinant)

mutants were constructed from strains IHE3034-S and

Nissle1917-S using the method described by Datsenko

and Wanner [23]. Briefly, oligonucleotides WG-F

(TTTTGTTTATATAAATATTTTCCCTTTGGCGG-

TCTGCAGCGGTGTAGGCTGGAGCTGGCTTC) +

WG-R (GTATCAGCATAATGCCGCGCATTTTCC-

GCCCAGGCCATATGAATATCCTCCTTAGTTCC-TATTCC) or K15totpKD_fw + K15totpKD_rev [24]

were used to amplify cat or kan cassettes from pKD3

or pKD4, respectively. The resulting PCR products were

used to knock out the desired genes using the Red

recombinase system provided on the curable helper plas-

mid pKD46 [23]. Insertional mutations were confirmed

by PCR. Strain Nissle1917 exhibits a semi-rough (SR)

LPS phenotype due to a nonsense mutation in its wzy

gene encoding the O-antigen polymerase [25]. The wb*cluster of O6 E. coli strain 536 cloned into suicide plas-

mid pCVD442 was used to supplement the SR strain

with a functional O-antigen polymerase by allelic ex-

change performed as explained earlier [22]. The resulting

Reference

vailable under the trade name Mutaflor� [4], Ardeypharm GmbH,

(Herdecke, Germany)

This study

This study

nted mutant; SmR, CmR, ApR This study

This study

ented mutant; SmR, KmR, ApR This study

This study

mR This study

ion of a functional O-antigen polymerase This study

This study

tis, O18:K1:H7/9 [37]

This study

This study

This study

This studyR This study

cassette, CmR, ApR [23]

cassette, KmR, ApR [23]

d, temperature sensitive ori, ApR [23]

[22]

Easy, ApR [21]

This study

e, KmR, ApR [26]R [17]

G. Nagy et al. / FEMS Microbiology Letters 244 (2005) 173–180 175

strain (Nissle1917::wb*536) was supplied with the bla

gene through integration of theNotI fragment (attP::bla)

from plasmid pLDR9 into the attB site as described

by Diederich et al. [26]. Trans-complementation of

Nissle1917-R1 and Nissle1917-WG1 was achieved by

pSMK1 and pWGN5, respectively. pWGN5 carriesthe waaGNissle1917 gene together with its own promoter

region in pUC18. The promoter region of the wa* oper-

on was amplified by primer pair waaGpr-1 (TTATC-

TAGAGCTGACTTATGGATGTGCTGGGGA) and

waaGpr-2 (TTAGGATCCCTTCGAAATGGCTTAT-

CCACAAGTAAC), whereas waaG was produced using

waaG-1 (TTAGGATCCACTTCCCTCCTCCACGA-

CAGGTAC) and waaG-2 (TTAGAATTCGCGCCA-TAACGTGGCAAACGGCTC). Following digestion

with XbaI, EcoRI and BamHI the two products were li-

gated with each other and cloned into the corresponding

sites of pUC18.

2.1. Animal experiments

Groups of three 8-week-old female NMRI mice(Charles River, Hungary) were used in all cases and

experiments were repeated twice for each inoculum.

Normal intestinal flora was eliminated by the addition

of streptomycin (2 · 35 mg in 500 ll of saline on two

consecutive days) using a gavage. 6 h following the last

treatment, its effect was assessed by aerobic cultivation

of feces samples on LB agar plates. In case of effective

elimination of the normal aerobic flora (0–10 colonies/pellet feces after 24 h cultivation at 37 �C) mice were

co-infected with the parental wild-type strain and its iso-

genic mutant (109 CFU of each mixed in a final volume

of 200 ll saline) by gastric injection using a sterile ga-

vage. Cages were changed daily during the investigation

period. Feces samples were taken post-infection at 6 h

and daily afterwards for seven days. Pellets were homog-

enized and diluted in sterile saline. Bacterial numberswere determined by replica plating onto LB agar plates

containing streptomycin (50 lg ml�1) alone and in com-

bination with either chloramphenicol (25 lg ml�1) or

kanamycin (30 lg ml�1) or ampicillin (100 lg ml�1).

Dividing average CFU of mutant strains by average

CFU of parent strains (averages of six mice from two

independent experiments) set up competitive indices.

2.2. LPS silver staining

LPS samples were prepared from bacteria grown on

LB plates as described elsewhere [21]. Briefly, bacteria

were collected, washed in distilled water, incubated for

10 min at 100 �C, and then treated with lysozyme

(5 mg ml�1 for 30 min). Sample buffer containing 2-

mercaptoethanol (2%) was added and the mixture wasboiled for 10 min. Protein was digested by incubation

of the samples with proteinase K (0.5 mg ml�1) at

65 �C for 1 h. LPS was precipitated overnight by the

addition of 2 volumes of 0.375 M CaCl2 dissolved in eth-

anol. Following resuspension in Laemmli buffer samples

were separated on 12.5% SDS–PAGE gels and were sil-

ver stained as described earlier [21].

2.3. Adhesion assays

Human colon adenocarcinoma cell lines HCT-8 and

INT407 were cultured according to prescriptions by

ATCC. 3 · 105 epithelial cells were seeded into each well

of a 24-well plate, and cells were allowed to adhere over-

night. 107 CFU of washed bacteria were added, and the

plates were incubated at 37 �C in 5% CO2 for 2 h to al-low adhesion of the bacteria. The monolayers were

washed three times with phosphate-buffered saline

(PBS) to remove non-adherent bacteria. For measure-

ment of adhesion, cells were lysed by the addition of

200 ll of 1% Triton X-100 in PBS for 10 min. Viable

counts were determined by serial dilution of samples fol-

lowed by plating onto LB agar plates. The number of

adherent bacteria was formulated as percentage of thetotal bacterial number added at the beginning of the

incubation period (107 CFU). Averages ± standard

deviations were calculated from four independent

experiments.

2.4. Bile salt, SDS and novobiocin resistance tests

Susceptibility to bile salts, SDS, and novobiocin (allsupplied by Sigma–Aldrich, Hungary) were determined

principally as described earlier [27]. Briefly, 106 CFU

of washed bacteria were inoculated into 200 ll of LB

containing twofold serial dilutions of either bile salts

(24–0.02 mg ml�1) or SDS (100–0.1 mg ml�1) or novobi-

ocin (200–0.2 lg ml�1). Bacterial growth was deter-

mined photometrically following a 6-h incubation at

37 �C. Assays were repeated three times.

3. Results

3.1. RfaH plays a role in intestinal colonization

In order to assess a potential role of RfaH in the

intestinal colonization by E. coli, either probiotic E. colistrain Nissle1917 or prototype ExPEC strain IHE3034

was used together with its isogenic rfaH mutant for

mixed infection of mice. In fecal samples, the number

of the wild type-strains remained constant or was slowly

decreasing throughout the study period (between 108

and 107 CFU/fecal pellet), whereas number of their iso-

genic rfaH mutants dropped within a couple of days.

Competitive indices (CIs; CFU ratio of mutant/parentstrain) at different time points are indicated in Figs.

1(a) and (b). CIs reached 10�3 in case of both strains

Com

petit

ive

inde

x (C

FU m

utan

t / C

FU p

aren

t)

Com

petit

ive

inde

x (C

FU m

utan

t / C

FU p

aren

t)

day0.25 1 2 3 4 5 6 7

10-3

10-4

10-5

10-6

10-7

10-1

10-2

10

1

(b)

day0.25 1 2 3 4 5 6 7

10-3

10-4

10-5

10-6

10-7

10-1

10-2

10

1

(a) Nissle1917kps

Nissle1917-WG1

Nissle1917-WG3

Nissle1917-DM

Nissle1917 ::wb∗536-A

Nissle1917-R1

Nissle1917-R3

IHE3034kps

IHE3034-WG1

IHE3034-R1

IHE3034-DM

Fig. 1. Effect of different mutations on the colonization ability of E. coli strain Nissle1917 (a) and IHE3034 (b). Groups of six mice (3 mice each in

two independent experiments) were orally co-infected with wild-type strains and their isogenic rfaH mutants. The number of both strains was

determined by replica plating of feces samples on selective agar plates at different time points post-infection. Competitive indices were calculated

through dividing average CFU of mutant strains by average CFU of parent strains.

176 G. Nagy et al. / FEMS Microbiology Letters 244 (2005) 173–180

on day 4 post-infection indicating an important role of

RfaH in intestinal colonization.

3.2. RfaH acts through regulation of LPS-core

To determine which factor(s) known to be regu-lated by RfaH is responsible for altered ability to col-

onize the mouse gut, isogenic deep-rough LPS

mutants (waaG) and capsular mutants (kps) as well

as double mutants (waaG, kps) were constructed from

the wild-type strains. Mixed challenge experiments

were performed as described above. While the loss

of group II capsules alone (K5 and K1 in case of

strains Nissle1917 and IHE3034, respectively), didnot alter colonization, deep-rough mutants were very

rapidly outcompeted by their parental wild-type

strains in competition experiments (Figs. 1(a) and

(b)). Interestingly, the effect on colonization of the

waaG mutation was even more severe than that of

rfaH, although rfaH mutants exhibit a deep-rough

LPS phenotype as well (see below). Trans-complemen-

tation of the rfaH and waaG mutations in strains Nis-sle1917-R3 and Nissle1917-WG3, respectively, resulted

in restored colonization ability (Fig. 1(a)) indicating

that this characteristic was a specific result of the af-

fected genes. Complementation of the corresponding

mutants of IHE3034-S was, however, not possible this

way due to rapid loss of the plasmids in vivo (data

not shown).

The double (kps, waaG) mutants were shown to beslightly better colonizers than single waaG mutants,

however, were still more impaired in this respect than

rfaH mutants.

The LPS structure of wild-type strain Nissle1917 is

so-called �semi rough� (SR) meaning that the intact

LPS core is capped by a single O-antigen subunit due

to a point mutation in wzy encoding the O-antigen poly-

merase [25]. Supplementation of Nissle1917-S with an

intact O-antigen polymerase gene from another E. coli

O6 strain (UPEC 536) results in a smooth (S) LPS phe-

notype (Fig. 2(a)). The switch from SR to S phenotype

of LPS, however, did not affect colonization of the

mouse intestinal tract (Fig. 1(a)).

3.3. Truncation of LPS-core as a result of rfaH and waaG

deletions

LPS structures were visualized by silver staining of

samples separated on SDS–PAGE gels (Fig. 2). The

SR LPS-phenotype of Nissle1917-S was confirmed this

way, whereas IHE3034-S was shown to exhibit a smooth

LPS (Fig. 2(a), lanes 1 and 8). Deletions of gene rfaH or

waaG resulted in major truncation of the LPS-core in

case of both E. coli strains (Fig. 2, lanes 2, 4, 9, and

10). However, concision of LPS-core structures in caseof the rfaH mutants seemed to be only partial and less

‘‘deep’’ in comparison to that exhibited by the waaG

mutants. A better separation of LPS-core structures

(Fig. 2(b)) indicated multiple length of core oligosaccha-

rides in the rfaH mutants suggesting various termination

points during transcription of the wa* operon. Trans-

complementation of the mutants with the affected genes

restored wild-type LPS-core phenotype (Fig. 2, lanes 3and 5). Deletion of kps clusters encoding group II cap-

sules had no visible effect on LPS-core structures (Fig.

2(b), lanes 6 and 11). However, in case of strain

Fig. 2. Lipopolysaccharide structures of E. coli strain Nissle1917-S,

IHE3034-S and their derivatives (a). Purified LPS samples were

separated on 12.5% SDS–PAGE gels followed by silver staining as

described in Materials and Methods. Lesser quantities of the same LPS

samples were run on longer gels to get a better separation of LPS-core

oligosaccharides (b). Lane 1: Nissle1917-S; lane 2: Nissle1917-R1; lane

3: Nissle1917-R3; lane 4: Nissle1917-WG1; lane 5: Nissle1917-WG3;

lane 6: Nissle1917kps, lane 7: Nissle1917::wb*536-A; lane 8: IHE3034-S;

lane 9: IHE304-R1; lane 10: IHE3034-WG1; lane 11: IHE3034kps.

Table 2

Minimal inhibitory concentrations (MIC)a of bile salts, SDS and

novobiocin for Nissle1917-S, IHE3034-S and their derivatives

Strain Minimal inhibitory concentration

Bile salts

(mg ml�1)

SDS

(mg ml�1)

Novobiocin

(lg ml�1)

Nissle1917-S 6 100 100

Nissle1917-R1 3 1.56 50

Nissle1917-WG1 0.75 <0.1 12.5

Nissle1917kps 12 100 100

Nissle1917-DM 0.75 <0.1 12.5

IHE3034-S 3 100 25

IHE3034-R1 1.5 1.56 25

IHE3034-WG1 0.75 <0.1 12.5

IHE3034kps 12 100 50

IHE3034-DM 0.375 <0.1 12.5

a MIC values were determined as described in Section 2.

G. Nagy et al. / FEMS Microbiology Letters 244 (2005) 173–180 177

IHE3034-S total loss of O-antigen side chains was de-

tected in case of the kps mutant (Fig. 2(a), lane 11) sug-

gesting a role of certain proteins encoded within the kps

locus in the synthesis and/or secretion of O-antigen

subunits.

3.4. Adherence to epithelial cells is not affected by RfaH

In vitro adhesion assays were performed using colon

epithelial cell lines to find out whether altered coloniza-

tion ability of the rfaH mutants results from decreased

adhesion to cells of the intestinal mucosa. Adhesion of

IHE3034-R1 to HCT-8 cells (12.85 ± 3.32%) as well asto INT407 cells (43.17 ± 14.2%) did not significantly dif-

fer from that of its parental wild-type strain

(10.46 ± 2.55% and 44.83 ± 9.64%, respectively). Simi-

larly, loss of RfaH did not significantly alter adhesion

of Nissle1917-S to any of the two cell lines (adherence

was 11.78 ± 1.47% to HCT-8 cells and 76.17 ± 23.77%

to INT407 cells in case of the wild-type strain, while it

was 12.9 ± 2.15% and 82 ± 26.06%, respectively, in caseof the rfaH mutant strain Nissle1917-R1).

3.5. Susceptibility to bile salts, SDS and novobiocin is

increased in rfaH mutants

Bile salt resistance was tested in vitro to investigate

the possibility that it is the decreased survival of rfaH

mutants in the gastrointestinal tract, which hinders

intestinal colonization. Resistance to bile salts was sig-

nificantly decreased in waaG mutants and was elevated

in kps mutants in comparison to their parental wild-type

strains (Table 2). rfaH mutants were negatively affected

in their ability to survive/grow in the presence of bile

salts; however, this effect was more moderate than seen

in case of waaG mutants. Additionally, MIC values ofSDS and novobiocin were determined (Table 2). In

agreement with former reports [28], waaG mutants

showed extremely high susceptibility (>1000-fold de-

crease in MIC) to SDS, whereas only moderate change

in susceptibility to the hydrophobic antibiotic; novobio-

cin. Loss of RfaH results in similar, however, less pro-

nounced change in these respects. Deletion of kps

clusters encoding group II capsules did not significantlyalter susceptibility to SDS and novobiocin. Resistance

to all three substances of the double waaG, kps mutants

was shown to be similar to that of waaG mutants in case

of both E. coli strains.

4. Discussion

Colonization of the gastrointestinal tract is the first

stage in the infectious process of intestinal pathogenic

E. coli strains and, in most cases, it is a prerequisite

for those E. coli strains causing extraintestinal infections

(ExPEC) since the fecal flora is considered as a reservoir

for ExPEC. Upon colonization, pathogenic bacteria

have to compete with the commensal microbiota, which

consists of anaerobic as well as aerobic (mainly E. coli

and related species) members. Commensal bacteria hin-

der adhesion and subsequent colonization of the gut by

pathogenic variants. Under conditions resulting in a

reduction or shift of the normal flora components (in

case of antibiotic treatment or various diseases) the

gut is more vulnerable towards the settlement of patho-

gens. Efficiently colonizing probiotic bacteria (e.g.,E. coli

178 G. Nagy et al. / FEMS Microbiology Letters 244 (2005) 173–180

strain Nissle1917) have been widely used to change/

restore composition of the microbial flora in order to

be able to antagonize pathogens. The mechanism of pro-

tection elicited by probiotic strains is not yet fully under-

stood, however, competitive interactions, production of

specific antimicrobial substances as well as immunemodulation seem to be important mechanisms [29,30].

An understanding of the factors involved in intestinal

colonization as well as their regulation is fundamental

to our comprehension of intestinal infections as well as

to develop novel antimicrobial strategies.

RfaH has been shown as a global virulence regulator

in E. coli. Interestingly, this protein seems to be special-

ized for the transcriptional regulation of bacterial com-ponents that are either secreted (exotoxins, capsules) or

anchored in the outer membrane (lipopolysaccharide,

hemin receptor ChuA, F pilus). While located on the

surface of bacteria some of these factors are involved

in the initial adhesion to and/or colonization of the

intestinal mucosa. Intestinal colonization was proven

to be negatively affected in LPS mutants of highly differ-

ent Gram-negative bacteria such as Salmonella enterica

[31] and the opportunistic pathogen Aeromonas hydro-

phila [32]. Recently a deep-rough mutant of the com-

mensal E. coli K-12 strain MG1655 was shown to be

reduced in its ability to colonize the mouse intestinal

tract due to increased tendency to clump in the intestinal

mucus [27]. Similarly, capsular polysaccharides have

been proposed to contribute to intestinal colonization

by several Gram-negative pathogens including E. coli

[33,34]. In Vibrio cholerae O139 both LPS and capsular

polysaccharide play an important role in the coloniza-

tion process [35].

The competition (mixed) infection assay serves as a

powerful tool to assess impact of a certain mutation

by comparing virulence properties of mutants to their

parental wild-type strains in the same animal hosts. In

this study, we have shown that loss of regulatory proteinRfaH hinders intestinal colonization by pathogenic as

well as non-pathogenic probiotic E. coli strains (Fig.

1). To get more insight in the mechanism of the RfaH-

dependent effect on colonization, capsular or LPS

deep-rough mutants as well as double mutants were

used in additional mixed infections. In contrast to for-

mer observations [34], we could detect no positive role

of group II capsules (K5 in case of strain Nissle1917and K1 in strain IHE3034) in colonization. On the other

hand, deep-rough mutants (waaG) of the same strains

are highly impaired in their intestinal colonization com-

pared to their wild type strains (Fig. 1). Although rfaH

mutants exhibit a deep-rough LPS phenotype as well,

waaG mutants seem to be more severely affected regard-

ing their ability to colonize the gut. Difference in this

respect is justified by the different degree of LPS-core truncation as shown by silver staining (Fig. 2). Sup-

plementation of strain Nissle1917 with a smooth LPS

structure does not influence colonization in compari-

son to the semi-rough (SR) phenotype of the wild-type

strain suggesting that the proximal part of LPS itself is

essential for efficient colonization.

The altered colonization of the gut by rfaH mutants

may theoretically originate from either decreased adher-ence to the intestinal mucosa or altered ability of bacte-

ria to survive in vivo, or both. To differentiate between

these probabilities, adhesion tests were performed using

colon epithelial cell lines. Although adherence of bacte-

ria to the various cell lines greatly differs, no difference

between rfaH mutants and their parental wild-type

strains can be detected in this respect. Moreover, de-

creased survival of rfaH mutants does possibly not orig-inate from reduced growth rate either, since rfaH

mutations do not alter growth in vitro (data not shown).

Therefore, we hypothesized that increased vulnerability

rather than decreased replication can eventuate that

rfaH mutants are outcompeted in vivo by their wild-type

counterparts. Bacteria passing through the gastrointesti-

nal tract have to face several adverse environmental con-

ditions. Unspecific protective mechanisms like saliva,gastric acid, digestive enzymes, and detergents all con-

tribute to antagonize colonization by bacteria. Since

rfaH mutants could be detected at similar numbers as

wild-type strains 6 h post-infection in our model, pas-

sage through the gastrointestinal tract does not seem

to be a limiting factor in their colonization. In order

to mimic the intestinal milieu, survival of bacteria was

tested in the presence of bile salts in vitro (Table 2). Ithas become clear that wild-type strains are more resis-

tant to bile salts than their isogenic rfaH mutants. Sus-

ceptibility is increased even more in waaG mutants,

which is paralleled with their decreased colonization in

vivo. In comparison to wild type strains, kps mutants

of Nissle1917 (K5) as well as of IHE3034 (K1) exhibit

increased resistance to bile salts, suggesting that capsu-

lar polysaccharides may mediate binding of bile saltsto bacteria and hence strengthen their antibacterial ef-

fects. This phenomenon could serve as an alternative

explanation (beside the dissimilar LPS-core truncation)

for the discrepancy on the differences found between

rfaH and waaG mutants in respect of colonization and

bile salt susceptibility. Since RfaH regulates expression

of genes involved in both capsular (kps) and LPS core

(wa*) synthesis, susceptibility of a rfaH mutant to bilesalts and consequently intestinal colonization ability

are different (less pronouncedly decreased) from those

of a waaG mutant (and more similar to those of double

waaG, kps mutants), although both mutations result in

a deep-rough phenotype. Nevertheless, deletion of kps

in waaG mutants (double mutants) improved their colo-

nizing ability (Fig. 1) although no increased in vitro resis-

tance of the double mutants to bile salts could be shown(Table 2). This suggests yet unidentified alternative

mechanisms by which group II capsules may influence

G. Nagy et al. / FEMS Microbiology Letters 244 (2005) 173–180 179

colonization. On the other hand, enhanced resistance of

kps mutants to bile salts does not result in an even more

efficient colonization in comparison to wild-type E. coli

strains (Fig. 1).

In summary, the global virulence regulator RfaH has

been shown as an important regulatory factor in theintestinal colonization by E. coli. Its effect on coloniza-

tion is achieved by regulating the sysnthesis of LPS-core,

which is essential for the survival within the intestinal

environment. As RfaH influences not only colonization

but rather other virulence properties of pathogenic bac-

teria as well [21,36], it can be considered as a potential

target for prospective antimicrobial agents.

Acknowledgements

The excellent technical assistance of Rozsa Lajko

during the animal experiments is acknowledged. This

work was supported by Grants OTKA T037833 and

TeT D-24/2002 (to L.E.). The work of the Wurzburg

group was supported by the Deutsche Forschungsgeme-inschaft (SFB479, TP A1) and the �Fonds der Chemis-

chen Industrie�. G.N. was supported by Bolyai and

Humboldt Fellowships.

References

[1] Kaper, J.B., Nataro, J.P. and Mobley, H.L. (2004) Pathogenic

Escherichia coli. Nat. Rev. Microbiol. 2, 123–140.

[2] Em}ody, L., Kerenyi, M. and Nagy, G. (2003) Virulence factors of

uropathogenic Escherichia coli. Int. J. Antimicrob. Agents 22

(Suppl 2), 29–33.

[3] Obata-Yasuoka, M., Ba-Thein, W., Tsukamoto, T., Yoshikawa,

H. and Hayashi, H. (2002) Vaginal Escherichia coli share common

virulence factor profiles, serotypes and phylogeny with other

extraintestinal E. coli. Microbiology 148, 2745–2752.

[4] Blum, G., Marre, R. and Hacker, J. (1995) Properties of

Escherichia coli strains of serotype O6. Infection 23, 234–236.

[5] Grozdanov, L., Raasch, C., Schulze, J., Sonnenborn, U., Gotts-

chalk, G., Hacker, J. and Dobrindt, U. (2004) Analysis of the

genome structure of the nonpathogenic probiotic Escherichia coli

strain Nissle 1917. J. Bacteriol. 186, 5432–5441.

[6] Altenhoefer, A., Oswald, S., Sonnenborn, U., Enders, C., Schulze,

J., Hacker, J. and Oelschlaeger, T.A. (2004) The probiotic

Escherichia coli strain Nissle 1917 interferes with invasion of

human intestinal epithelial cells by different enteroinvasive bac-

terial pathogens. FEMS Immunol. Med. Microbiol. 40, 223–229.

[7] Bailey, M.J., Hughes, C. and Koronakis, V. (2000) In vitro

recruitment of the RfaH regulatory protein into a specialised

transcription complex, directed by the nucleic acid ops element.

Mol. Gen. Genet. 262, 1052–1059.

[8] Artsimovitch, I. and Landick, R. (2002) The transcriptional

regulator RfaH stimulates RNA chain synthesis after recruitment

to elongation complexes by the exposed nontemplate DNA

strand. Cell 109, 193–203.

[9] Lindberg, A.A. and Hellerqvist, C.G. (1980) Rough mutants of

Salmonella typhimurium: immunochemical and structural analysis

of lipopolysaccharides from rfaH mutants. J. Gen. Microbiol.

116, 25–32.

[10] Creeger, E.S., Schulte, T. and Rothfield, L.I. (1984) Regulation of

membrane glycosyltransferases by the sfrB and rfaH genes of

Escherichia coli and Salmonella typhimurium. J. Biol. Chem. 259,

3064–3069.

[11] Sanderson, K.E. and Stocker, B.A. (1981) Gene rfaH, which

affects lipopolysaccharide core structure in Salmonella typhimu-

rium, is required also for expression of F-factor functions. J.

Bacteriol. 146, 535–541.

[12] Wang, L., Jensen, S., Hallman, R. and Reeves, P.R. (1998)

Expression of the O antigen gene cluster is regulated by RfaH

through the JUMPstart sequence. FEMS Microbiol. Lett. 165,

201–206.

[13] Marolda, C.L. and Valvano, M.A. (1998) Promoter region of the

Escherichia coli O7-specific lipopolysaccharide gene cluster:

structural and functional characterization of an upstream

untranslated mRNA sequence. J. Bacteriol. 180, 3070–3079.

[14] Stevens, M.P., Hanfling, P., Jann, B., Jann, K. and Roberts, I.S.

(1994) Regulation of Escherichia coli K5 capsular polysaccharide

expression: evidence for involvement of RfaH in the expression of

group II capsules. FEMS Microbiol. Lett. 124, 93–98.

[15] Clarke, B.R., Pearce, R. and Roberts, I.S. (1999) Genetic

organization of the Escherichia coli K10 capsule gene cluster:

identification and characterization of two conserved regions in

group III capsule gene clusters encoding polysaccharide transport

functions. J. Bacteriol. 181, 2279–2285.

[16] Rahn, A. and Whitfield, C. (2003) Transcriptional organization

and regulation of the Escherichia coli K30 group 1 capsule

biosynthesis (cps) gene cluster. Mol. Microbiol. 47, 1045–1060.

[17] Nagy, G., Dobrindt, U., Kupfer, M., Em}ody, L., Karch, H. and

Hacker, J. (2001) Expression of hemin receptor molecule ChuA is

influenced by RfaH in uropathogenic Escherichia coli strain 536.

Infect. Immun. 69, 1924–1928.

[18] Leeds, J.A. and Welch, R.A. (1996) RfaH enhances elongation of

Escherichia coli hlyCABD mRNA. J. Bacteriol. 178, 1850–1857.

[19] Bailey, M.J., Koronakis, V., Schmoll, T. and Hughes, C. (1992)

Escherichia coli HlyT protein, a transcriptional activator of

haemolysin synthesis and secretion, is encoded by the rfaH (sfrB)

locus required for expression of sex factor and lipopolysaccharide

genes. Mol. Microbiol. 6, 1003–1012.

[20] Landraud, L., Gibert, M., Popoff, M.R., Boquet, P. and

Gauthier, M. (2003) Expression of cnf1 by Escherichia coli J96

involves a large upstream DNA region including the hlyCABD

operon, and is regulated by the RfaH protein. Mol. Microbiol. 47,

1653–1667.

[21] Nagy, G., Dobrindt, U., Schneider, G., Khan, A.S., Hacker, J.

and Em}ody, L. (2002) Loss of regulatory protein RfaH attenuates

virulence of uropathogenic Escherichia coli. Infect. Immun. 70,

4406–4413.

[22] Mobley, H.L., Jarvis, K.G., Elwood, J.P., Whittle, D.I., Locka-

tell, C.V., Russell, R.G., Johnson, D.E., Donnenberg, M.S. and

Warren, J.W. (1993) Isogenic P-fimbrial deletion mutants of

pyelonephritogenic Escherichia coli: the role of alpha Gal(1–4)

beta Gal binding in virulence of a wild-type strain. Mol.

Microbiol. 10, 143–155.

[23] Datsenko, K.A. and Wanner, B.L. (2000) One-step inactivation of

chromosomal genes in Escherichia coli K-12 using PCR products.

Proc. Natl. Acad. Sci. USA 97, 6640–6645.

[24] Schneider, G., Dobrindt, U., Bruggemann, H., Nagy, G., Janke,

B., Blum-Oehler, G., Buchrieser, C., Gottschalk, G., Em}ody, L.and Hacker, J. (2004) The pathogenicity island-associated K15

capsule determinant exhibits a novel genetic structure and

correlates with virulence in uropathogenic Escherichia coli strain

536. Infect. Immun. 72, 5993–6001.

[25] Grozdanov, L., Zahringer, U., Blum-Oehler, G., Brade, L.,

Henne, A., Knirel, Y.A., Schombel, U., Schulze, J., Sonnenborn,

U., Gottschalk, G., Hacker, J., Rietschel, E.T. and Dobrindt, U.

(2002) A single nucleotide exchange in the wzy gene is responsible

180 G. Nagy et al. / FEMS Microbiology Letters 244 (2005) 173–180

for the semirough O6 lipopolysaccharide phenotype and serum

sensitivity of Escherichia coli strain Nissle 1917. J. Bacteriol. 184,

5912–5925.

[26] Diederich, L., Rasmussen, L.J. and Messer, W. (1992) New

cloning vectors for integration in the lambda attachment site attB

of the Escherichia coli chromosome. Plasmid 28, 14–24.

[27] Moller, A.K., Leatham, M.P., Conway, T., Nuijten, P.J., de

Haan, L.A., Krogfelt, K.A. and Cohen, P.S. (2003) An

Escherichia coli MG1655 lipopolysaccharide deep-rough core

mutant grows and survives in mouse cecal mucus but fails to

colonize the mouse large intestine. Infect. Immun. 71, 2142–

2152.

[28] Yethon, J.A., Vinogradov, E., Perry, M.B. and Whitfield, C.

(2000) Mutation of the lipopolysaccharide core glycosyltransfer-

ase encoded by waaG destabilizes the outer membrane of

Escherichia coli by interfering with core phosphorylation. J.

Bacteriol. 182, 5620–5623.

[29] Shanahan, F. (2001) Probiotics in inflamatory bowel disease. Gut

48, 609.

[30] Wehkamp, J., Harder, J., Wehkamp, K., Meissner, B.W., Schlee,

M., Enders, C., Sonnenborn, U., Nuding, S., Bengmark, S.,

Fellermann, K., Schroder, J.M. and Stange, E.F. (2004) NF-

kappaB-and AP-1-mediated induction of human beta defensin-2

in intestinal epithelial cells by Escherichia coli Nissle 1917: a

novel effect of a probiotic bacterium. Infect. Immun. 72, 5750–

5758.

[31] Craven, S.E. (1994) Altered colonizing ability for the ceca of

broiler chicks by lipopolysaccharide-deficient mutants of Salmo-

nella typhimurium. Avian Dis. 38, 401–408.

[32] Merino, S., Rubires, X., Aguillar, A., Guillot, J.F. and Tomas,

J.M. (1996) The role of the O-antigen lipopolysaccharide on the

colonization in vivo of the germfree chicken gut by Aeromonas

hydrophila serogroup O:34. Microb. Pathog. 20, 325–333.

[33] Favre-Bonte, S., Licht, T.R., Forestier, C. and Krogfelt, K.A.

(1999) Klebsiella pneumoniae capsule expression is necessary for

colonization of large intestines of streptomycin-treated mice.

Infect. Immun. 67, 6152–6156.

[34] Herias, M.V., Midtvedt, T., Hanson, L.A. and Wold, A.E. (1997)

Escherichia coliK5 capsule expression enhances colonization of the

large intestine in the gnotobiotic rat. Infect. Immun. 65, 531–536.

[35] Nesper, J., Schild, S., Lauriano, C.M., Kraiss, A., Klose, K.E.

and Reidl, J. (2002) Role of Vibrio cholerae O139 surface

polysaccharides in intestinal colonization. Infect. Immun. 70,

5990–5996.

[36] Nagy, G., Dobrindt, U., Hacker, J. and Emody, L. (2004) Oral

immunization with an rfaH mutant elicits protection against

salmonellosis in mice. Infect. Immun. 72, 4297–4301.

[37] Korhonen, T.K., Valtonen, M.V., Parkkinen, J., Vaisanen-Rhen,

V., Finne, J., Orskov, F., Orskov, I., Svenson, S.B. and Makela,

P.H. (1985) Serotypes, hemolysin production, and receptor

recognition of Escherichia coli strains associated with neonatal

sepsis and meningitis. Infect. Immun. 48, 486–491.