Towards Personal Genomics
description
Transcript of Towards Personal Genomics
![Page 1: Towards Personal Genomics](https://reader035.fdocuments.in/reader035/viewer/2022062314/568145ca550346895db2d1fc/html5/thumbnails/1.jpg)
Towards Personal GenomicsTools for Navigating the Genome of an Individual
Saul A. KravitzJ. Craig Venter Institute
Rockville, MD
Bio-IT World 2008
![Page 2: Towards Personal Genomics](https://reader035.fdocuments.in/reader035/viewer/2022062314/568145ca550346895db2d1fc/html5/thumbnails/2.jpg)
Personal Genomics: The future is now
![Page 3: Towards Personal Genomics](https://reader035.fdocuments.in/reader035/viewer/2022062314/568145ca550346895db2d1fc/html5/thumbnails/3.jpg)
Outline
• HuRef Project: Genome of an Individual• HuRef Research Highlights• The HuRef Browser – http://huref.jcvi.org• Towards Personal Genomics Browsers• Conclusions and Credits
![Page 4: Towards Personal Genomics](https://reader035.fdocuments.in/reader035/viewer/2022062314/568145ca550346895db2d1fc/html5/thumbnails/4.jpg)
Genome of a Single Individual: Goals
• Provide a diploid genome that could serve as a reference for future individualized genomics
• Characterize the individual’s genetic variation– HuRef vs NCBI– HuRef haplotypes
• Understand the individual’s risk profile based on their genomic data
![Page 5: Towards Personal Genomics](https://reader035.fdocuments.in/reader035/viewer/2022062314/568145ca550346895db2d1fc/html5/thumbnails/5.jpg)
How does HuRef Differ?• NCBI Genome
– Multiple individuals– Collapsed Haploid Sequence of a Diploid Genome– No haplotype phasing or inference possible
• HuRef– Single individual– Can reconstruct haplotypes of diploid genome
• Haplotype Blocks– Segment of DNA inherited from one parent
![Page 6: Towards Personal Genomics](https://reader035.fdocuments.in/reader035/viewer/2022062314/568145ca550346895db2d1fc/html5/thumbnails/6.jpg)
The HuRef Genome
PLoS Biology 2007 5:e254September 4, 2007
![Page 7: Towards Personal Genomics](https://reader035.fdocuments.in/reader035/viewer/2022062314/568145ca550346895db2d1fc/html5/thumbnails/7.jpg)
• DNA from a single individual• De Novo Assembly
– 7.5x Coverage Sanger Reads
• Diploid Reconstruction– Half of genome is in haplotype blocks of >200kb
• HuRef Data Released– NCBI: Genome Project 19621– JCVI: http://huref.jcvi.org
The HuRef Genome
![Page 8: Towards Personal Genomics](https://reader035.fdocuments.in/reader035/viewer/2022062314/568145ca550346895db2d1fc/html5/thumbnails/8.jpg)
Variants: NCBI-36 vs HuRef
• NCBI-36 vs HuRef yields Homozygous Variants
SNP MNP
Insertion DeletionNCBI
HuRef
variant: G/A variant: TA/AT
variant: variant:
![Page 9: Towards Personal Genomics](https://reader035.fdocuments.in/reader035/viewer/2022062314/568145ca550346895db2d1fc/html5/thumbnails/9.jpg)
Reads
ACCTTTGTAATTCCCACCTTTGTAATTCCCACCTTTGTAATTCCCACCTTTACAATTCCCACCTTTACAATTCCCACCTTTACAATTCCC
Computing Allelic Contributions• Consensus generation conflates alleles
Haploid Consensus
ACCTTTGCAATTCCC
![Page 10: Towards Personal Genomics](https://reader035.fdocuments.in/reader035/viewer/2022062314/568145ca550346895db2d1fc/html5/thumbnails/10.jpg)
Computing Allelic Contributions
• Consensus generation conflates alleles• Consensus generation modified to separate alleles• Bioinformatics. 2008 Apr 15;24(8):1035-40
![Page 11: Towards Personal Genomics](https://reader035.fdocuments.in/reader035/viewer/2022062314/568145ca550346895db2d1fc/html5/thumbnails/11.jpg)
Reads
ACCTTTGTAATTCCCACCTTTGTAATTCCCACCTTTGTAATTCCCACCTTTACAATTCCCACCTTTACAATTCCCACCTTTACAATTCCC
Computing Allelic Contributions• Modified Consensus generation separates allele• Compare HuRef alleles to identify SNP, MNP, Indel Variants
True Diploid Alleles
ACCTTTGTAATTCCC
ACCTTTACAATTCCC
Haploid Consensus
ACCTTTGCAATTCCC
AC / GT
MNP Variant
![Page 12: Towards Personal Genomics](https://reader035.fdocuments.in/reader035/viewer/2022062314/568145ca550346895db2d1fc/html5/thumbnails/12.jpg)
HuRef Variations
• 4.1 Million Variations (12.3 Mbp)• 1.2 Million Novel
• Many non-synonymous changes• ~700 indels and ~10,000 total SNPs
• Indels and non-SNP Sequence Variation• 22% of all variant events, 74% of all variant bases
• 0.5-1.0% difference between haploid genomes• 5-10x higher than previous estimates
![Page 13: Towards Personal Genomics](https://reader035.fdocuments.in/reader035/viewer/2022062314/568145ca550346895db2d1fc/html5/thumbnails/13.jpg)
HuRef Browser• Why do this?
• Research tool focused on variation• Verify assembly and variants• Show ALL the evidence• High Perfomance
• Features• Use HuRef or NCBI as reference• Genome vs Genome Comparison• Drill down from chromosome to reads and alignments• Overlay of Ensembl and NCBI Annotation• Links from HuRef features in NCBI (e.g., dbSNP)• Export of data for further analysis
![Page 14: Towards Personal Genomics](https://reader035.fdocuments.in/reader035/viewer/2022062314/568145ca550346895db2d1fc/html5/thumbnails/14.jpg)
http://huref.jcvi.org
Search by Feature ID or coordinatesSearch by Feature ID or coordinates
Navigate by Chromosome BandNavigate by Chromosome Band
![Page 15: Towards Personal Genomics](https://reader035.fdocuments.in/reader035/viewer/2022062314/568145ca550346895db2d1fc/html5/thumbnails/15.jpg)
Zinc Finger ProteinChr19:57564487-57581356
Assembly StructureAssembly Structure
VariationsVariations
TranscriptTranscript GeneGene
Haplotype BlocksHaplotype Blocks
NCBI-36NCBI-36
HuRefHuRefAssembly-Assembly MappingAssembly-Assembly Mapping
![Page 16: Towards Personal Genomics](https://reader035.fdocuments.in/reader035/viewer/2022062314/568145ca550346895db2d1fc/html5/thumbnails/16.jpg)
chr19:57578700-57581000
Protein Truncated by 476 bp Insertion
Homozygous SNPHomozygous SNPHeterozygous SNPHeterozygous SNP
![Page 17: Towards Personal Genomics](https://reader035.fdocuments.in/reader035/viewer/2022062314/568145ca550346895db2d1fc/html5/thumbnails/17.jpg)
Assembly Structure
![Page 18: Towards Personal Genomics](https://reader035.fdocuments.in/reader035/viewer/2022062314/568145ca550346895db2d1fc/html5/thumbnails/18.jpg)
Drill Down toMulti-sequence Alignment
Validation of Phased A/C Heterozygous SNPs in HuRef
![Page 19: Towards Personal Genomics](https://reader035.fdocuments.in/reader035/viewer/2022062314/568145ca550346895db2d1fc/html5/thumbnails/19.jpg)
14kbp Inversion Spanning TNFRSF14chr1:2469149-2496613
![Page 20: Towards Personal Genomics](https://reader035.fdocuments.in/reader035/viewer/2022062314/568145ca550346895db2d1fc/html5/thumbnails/20.jpg)
Browser for Multiple Genomes
• Expand on existing features– Variants and haplotype blocks in individuals– Structural variation among individuals– Genetic traits of variants related to diseases
• Required Features– Which genome/haplotype is the reference?– Correlation with phenotypic, medical, and
population data– Correlation within families
![Page 21: Towards Personal Genomics](https://reader035.fdocuments.in/reader035/viewer/2022062314/568145ca550346895db2d1fc/html5/thumbnails/21.jpg)
Future Challenges
• Data volumes– read data included from new technologies– Multiplication of genomes
• Enormous number of potential comparisons– Populations, individuals, variants
• Dynamic generation of views in web time• Use cases are evolving
![Page 22: Towards Personal Genomics](https://reader035.fdocuments.in/reader035/viewer/2022062314/568145ca550346895db2d1fc/html5/thumbnails/22.jpg)
Conclusion
• A high performance visualization tool for an individual genome– Validation of variants– Comparison with NCBI-36
• Planned extensions for multi-genome era
• Website: http://huref.jcvi.org• Contact: [email protected]
![Page 23: Towards Personal Genomics](https://reader035.fdocuments.in/reader035/viewer/2022062314/568145ca550346895db2d1fc/html5/thumbnails/23.jpg)
HuRef Browser: Nelson Axelrod, Yuan Lin, and Jonathan Crabtree
Scientific Leadership: Sam Levy, Craig Venter, Robert Strausberg, Marvin Frazier
Sequence Data Generation and Indel Validation: Yu-Hui Rogers, John Gill, Jon Borman, JTC Production, Tina McIntosh, Karen Beeson, Dana Busam, Alexia Tsiamouri, Celera Genomics. Data Analysis: Sam Levy, Granger Sutton, Pauline Ng, Aaron Halpern, Brian Walenz, Nelson Axelrod, Yuan Lin, Jiaqi Huang, Ewen Kirkness, Gennady Denisov, Tim Stockwell, Vikas Basal, Vineet Bafna, Karin Remington, and Josep Abril
CNV, Genotyping, FISH mapping: Steve Scherer, Lars Feuk, Andy Wing Chun Pang, Jeff MacDonald
Funding: J. Craig Venter Foundation DNA: J. Craig Venter
Acknowledgements