In The Name of GOD

Tools of Molecular Genetics

M. Dianatpour PhD

One of the principal aims of modern medical genetics is:

-To characterize mutations that lead to genetic disease, -To understand how these mutations affect health, and-To use that information to improve diagnosis and management.

Molecular genetics have been aided considerably by the development of revolutionary new technologies that permit the detailed analysis of both normal and abnormal genes

Molecular Genetics toolsDiagnosis and clinical use

Research

CLASSIFICATION OF GENETIC DISORDERS

Three main types of disorders are recognized:

1- Single gene disorders :Caused by individual mutant genes. may be present on only one chromosome or on both chromosomes.

2- Chromosome disorders :an excess or a deficiency of the genes contained in whole chromosomes or chromosome segments.

3- Multifactorial disorders :Multifactorial inheritance is responsible for a number of developmental disorders resulting in congenital malformations and for many common disorders of adult life

ANALYSIS OF DNA AND RNA SEQUENCESTwo fundamental obstacles to carrying out the molecular basis of hereditary disease:

1- Obtaining a sufficient quantity of a DNA or RNA sequence of interest to allow it to be analyzed, because each cell generally has only two copies of a gene and some genes may be transcribed only in a subset of tissues or only at low levels, or both, providing only a small number of messenger RNA (mRNA) molecule.

2- Purifying the sequence of interest from all the other segments of DNA or mRNA molecules present in the cell.

Technological revolution solved both the problems

of quantity and of purification. These two complementary technologies are :

Molecular cloning and

polymerase chain reaction (PCR)

Molecular Cloning Aims1 -Amplification of the sequence of interest

2- Genetic engineering (production of a drug, hormone etc.)

Molecular Cloning

One of the key advances in the development of molecular cloning was the discovery in the early 1970s of bacterial restriction endonucleases (often referred to as restriction enzymes), enzymes that recognize specific double-stranded sequences in DNA and cleave both phosphodiester backbones of the DNA double helix at or near the recognition site

These cleavages can be immediately opposite each other, in which case they will leave blunt-ended DNA strands, or the nicks can be offset by a few bases in either direction, producing single-stranded overhangs on either the 5' or 3' end of the DNA strands (sticky ends).

The sequences are usually palindromes; that is, the sequence of bases in the recognition site, when read 5' to 3', is the same on both strands. For example, the restriction enzyme EcoRI recognizes the specific palindromic six-base pair sequence

5-'GAATTC-3 ‘ 3‘-CTTAAG-5’

ACCGTTAGGTCCGAATTCATGGCCATTGGCAATCCAGGCTTAAGTACCGGTA

ACCGTTAGGTCCG AATTCATGGCCAT

TGGCAATCCAGGCTTAA GTACCGGTA

VectorsA vector is a DNA molecule that can replicate

autono- mously in a host such as bacterial or yeast cells, from which it can be subsequently isolated in pure form for analysis.

The ligation of DNA molecules from different sources, such as a fragment of human DNA and a vector, is referred to as Recombinant DNA technology.

Plasmids

Plasmids used as vectors are circular double-stranded DNA molecules that exist separately from the bacterial or yeast chromosome and are replicated independently from the microorganism's own chromosomes.

Vector plasmids are derived from naturally occurring molecules that were first discovered in bacteria because they carried antibiotic resistance genes and could be passed easily from one bacterium to another, thereby spreading antibiotic resistance rapidly throughout the microbial population.

Libraries

A library is a collection of clones, each of which carries vector molecules into which a different fragment of DNA derived from the total DNA or RNA of a cell or tissue has been inserted.

Genomic librariescDNA libraries

cDNA

PCR (Polymerase Chain Reaction)

The polymerase chain reaction (PCR) is an alternative to cloning for generating essentially unlimited amounts of a sequence of interest.

PCR can selectively amplify a single molecule of DNA several billion- fold in a few hours and has revolutionized both molecular diagnosis and the molecular analysis of genetic disease.

PCRSmall Deletion, duplicationPoint mutation detection

ARMS (amplification refractory mutation system) SequencingPCR RFLP

Sickle cell anemiaRT-PCR

Gene expressionQ PCR (quantitative PCR) Real time PCR

Real time PCR

SequencingThe most widely used approach for DNA

sequence analysis is Sanger sequencing (named after Fred Sanger, who, with Walter Gilbert, received the Nobel Prize in 1980 for developing DNA sequencing).

The Sanger sequencing method takes advantage of certain chemical analogues of the four nucleotides known as dideoxy nucleotides (ddA, ddC, ddG and ddT) because they lack a 3'- hydroxyl group on their deoxyribose (in addition to the 2'-hydroxyl normally missing in DNA)

METHODS OF NUCLEIC ACID ANALYSIS Examination of the RNA or DNA from a particular gene

requires that we be able to distinguish the specific DNA segments or RNA molecules corresponding to that gene from among all the many other DNA segments or RNA molecules present in a sample of cells or tissue.

Southern blottingThe Southern blotting technique allows one to find and

examine, at a gross level, a number of DNA fragments of interest in a seemingly uninformative collection of a million or so restriction enzyme fragments.

Southern blotting, developed in the mid-1970s, is the standard method for examining particular fragments of DNA cleaved by restriction enzymes.

Northern or RNA BlottingFor the analysis of RNA, the counterpart of the Southern

blotting technique is called Northern or RNA blotting.

Northern blotting is a standard approach for determining the size and abundance of the mRNA from a specific gene in a sample of RNA.

Western blottingThe analysis of both normal and abnormal gene function

often requires an examination of the protein encoded by a normal or mutant gene of interest. In most instances, one wants to know not only the molecular defect in the DNA but also how that defect alters the encoded protein to produce the clinical phenotype. The most commonly used technique for examining one or more proteins in a sample of cells or tissues is Western blotting.

For Western blot analysis, proteins isolated from a cell extract are separated according to size or charge by polyacrylamide gel electrophoresis.

Allele-Specific Oligonucleotide Hybridization(ASOH)In certain genetic diseases, the mutation affecting one or a

small number of bases is known to be responsible for a significant fraction of cases of the disease.

Allele-Specific Oligonucleotide probe

Thank you