1

AN APPROACH TO EPIGENOME ANALYSIS OF SPACEFLIGHT MATERIAL

By

COLLIN LEFROIS

A THESIS PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT

OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE

UNIVERSITY OF FLORIDA

2017

2

© 2017 Collin LeFrois

3

To my mother who has always stood behind me and guided me in the right direction

4

ACKNOWLEDGMENTS

I would like to thank my family who helped support me throughout my graduate career. I

would also like to thank my advisers Dr. Ferl and Dr. Paul, as they have taught more than I could

have dreamed of. The life lessons I learned in their lab I will carry with me for the rest of my

days. I would like to thank Dr. Mingqi Zhou for producing the heatmap in Figure 3-4.

Additionally, I would like to thank my girlfriend and partner Lauren Scott who has been with me

through thick and thin, who moved to Gainesville with me and who offered me much comfort

and reassurance when needed. Also, a special thanks goes to Dr. Mark Schoenbeck who showed

me the wonderful world that goes on inside a plant cell and who inspired me to pursue a career in

plant sciences. His life will remain an inspiration for me in my professional life and will always

remind me to have fun in your career, avoid stress, and live a balanced life.

5

TABLE OF CONTENTS page

ACKNOWLEDGMENTS ...............................................................................................................4

LIST OF TABLES ...........................................................................................................................7

LIST OF FIGURES .........................................................................................................................8

ABSTRACT .....................................................................................................................................9

CHAPTER

1 BACKGROUND AND SIGNIFICANCE OF SPACEFLIGHT BIOLOGY .........................11

Why Plants are Essential to Spaceflight Exploration .............................................................11 What We Have Learned in the Transcriptomics Era ..............................................................12 Epigenomics ...........................................................................................................................13 Epigenomics in Spaceflight ....................................................................................................15

2 DNA ISOLATED FROM PLANT TISSUES PRESERVED IN RNALATER FOR BISULFITE PCR ASSAY OF GENOME METHYLATION ...............................................18

Background and Significance .................................................................................................18 Material and Methods .............................................................................................................19

Experimental Setup .........................................................................................................19 Genomic DNA Extraction ...............................................................................................20 Cytosine Methylation Analysis .......................................................................................21

Results.....................................................................................................................................22 Discussion ...............................................................................................................................24

3 ANALYSIS OF DNA METHYLATION IN A SPACEFLIGHT EXPERIMENT................34

Background and Significance .................................................................................................34 Materials and Methods ...........................................................................................................35

Experimental Design .......................................................................................................35 Plant Material and Plate Preparations ..............................................................................36 Plant Growth Conditions on ISS and Ground Controls ...................................................36 Dissection and DNA Extraction ......................................................................................37 Bisulfite Sequencing ........................................................................................................37 Read Alignment and Processing ......................................................................................38 DMR Analysis .................................................................................................................39

Results.....................................................................................................................................39 Discussion ...............................................................................................................................41

4 CONCLUSION.......................................................................................................................50

6

LIST OF REFERENCES ...............................................................................................................53

BIOGRAPHICAL SKETCH .........................................................................................................57

7

LIST OF TABLES

Table page 2-1 Quantification of gDNA extractions ..................................................................................32

2-2 PCR primer sequences .......................................................................................................33

3-1 Comparison of differentially expressed and differentially methylated genes ...................48

8

LIST OF FIGURES

Figure page 2-1 Varying plant mass between genotypes grown on petri plates.. ........................................26

2-2 Agarose gel electrophoresis of gDNA extractions.. ...........................................................27

2-3 TapeStation analysis of exemplary, typical DNA samples extracted from APEX04 EVT plant material.. ...........................................................................................................28

2-4 PCR amplification products from exonic regions of AT2G07698 and AT2G07687 shoots from Col-0, met1-7 or elp2-5. .................................................................................29

2-5 DNA methylation present in AT2G07698 from gDNA samples extracted for EVT ........30

2-6 DNA methylation present in AT2G07687 from gDNA samples extracted for the EVT ....................................................................................................................................31

3-1 Average genome-wide methylation level in spaceflight and ground control Arabidopsis plants.. ............................................................................................................44

3-2 DNA methylation profiles for each Leaf FT, Leaf GC, Root FT, and Root GC samples viewed in Integrative Genomics Viewer (IGV).. .................................................45

3-3 Proportions of both differentially methylated cytosines (DmCs) (A) and differentially methylated regions (DMRs) (B) in roots (left) and leaves (right). ....................................46

3-4 Genome-wide transcriptome analysis and preliminary investigations into biological function of differentially expressed genes spaceflight vs. ground control. .......................47

3-5 Example gene dicer-like 1 (DCL1).. ..................................................................................49

9

Abstract of Thesis Presented to the Graduate School of the University of Florida in Partial Fulfillment of the

Requirements for the Degree of Master of Science

AN APPROACH TO EPIGENOME ANALYSIS OF SPACEFLIGHT MATERIAL

By

Collin LeFrois

December 2017

Chair: Robert J. Ferl Major: Plant Molecular and Cell Biology

Plants have adapted to a diversity of conditions present on Earth throughout their

evolutionary history and have developed mechanisms that enable them to thrive in a variety of

terrestrial habitats. When plants are subjected to the novel environment of spaceflight aboard the

International Space Station (ISS), an environment that is completely alien to their evolutionary

history, they respond by making unique genome-wide alterations to their gene expression profile.

Precisely dissecting the biological processes and pathways engaged when a plant is grown on the

ISS has shed new light on several biological processes, and identified genes important to the

physiological adaptation to the spaceflight environment. The underlying regulatory mechanisms

responsible for these changes in gene expression patterns are just beginning to be explored.

The fundamental focus of the work presented here is the transcriptional regulation of

genes via epigenetic modifications – in particular DNA methylation. The nucleotide cytosine can

be methylated at the five position by DNA methyl transferase enzymes to form 5-

methylcyotosine (5mC) and the implications from this epigenetic modification at various levels

in living organisms have been studied for decades. DNA methylation has been shown to play a

role in gene regulation in many organism, and in response to many types of biotic and abiotic

stress. Spaceflight could be interpreted by plants as a unique abiotic stress, thus mapping

10

methylated cytosines across the genome is an important contribution to understanding how plants

tailor their gene expression profile in response to this novel environment.

The focus of this project was to develop a genomic DNA extraction method suitable for

spaceflight-preserved material, and conduct preliminary biochemical and molecular evaluations

in spaceflight and related material.

11

CHAPTER 1 BACKGROUND AND SIGNIFICANCE OF SPACEFLIGHT BIOLOGY

Why Plants are Essential to Spaceflight Exploration

Plants have a deep and intricate tie to humanity. Our primate ancestors existed as arboreal

apes, millions of years ago in the great arms of trees in the expansive tropical rainforests of

Africa. As our ancestors became hominid, and as we have advanced from unconscious fruit-

eating apes to conscious, spacefaring beings, plants remain essential to our lives and our

existence. Not only do plants provide food and oxygen, they also recycle our waste and give

significant psychological benefits in confined spaces like the ISS or a space shuttle. In this light,

NASA has made plants an important component in their aspirations and continually supports

plant science research since the Mercury era (1960s).

Plant science research in space took off during the Apollo era and has gained

considerable momentum due to NASA’s emphasis of embarking on long-term space missions

such as to Mars. The idea that plants could be used as life support systems in space was formally

proposed as early as 1971 (Walkinshaw 1971) where hybrid systems were described that could

feasibly grow under lunar conditions with the supplemental aid of lunar base personnel CO2

production. Efforts to construct greenhouses and large-scale vegetable production systems had

been undertaken and were intended to enable longer duration space missions. What was once the

subject of imaginative science fiction has taken a turn and become feasibly achievable with

modern technological advancements. In the early stages, plants were used to determine whether

or not lunar regolith samples, collected and brought back to the Lunar Receiving Laboratory

(LRL) on Earth by astronauts, was hazardous to life (Ferl and Paul 2010). They performed this

by dusting the plants with lunar regolith; no plants were grown in lunar regolith. The results were

that while the lunar soil caused the over accumulation of certain mineral and sterols it was by-in-

12

large biologically benign, but through these experiments, plant science had established a foothold

in NASA’s scientific research agenda. After that, many applied engineering problems have been

tackled to grow plants in space vehicles or in proposed extraterrestrial greenhouses, but

alongside this research basic biological questions have been asked using spaceflight as one of the

very few environments in which there has been no ancestral experience of throughout biological

time. It is in this kind of scientific environment in which the research reported here was

undertaken: this research addresses basic biological questions and resides in the basic science

offshoots from the applied engineering projects (Drysdale et al. 2003). Several topics of plant-

related research, such as molecular biology, genetics, and physiology (reviewed by Halstead and

Dutcher 1987 and Ferl et al. 2002) had emerged from the mission to generate the necessary

infrastructure for extraterrestrial food production and have thereby answered many basic

biological questions that would otherwise have been unascertainable without the novel

environment of spaceflight.

What We Have Learned in the Transcriptomics Era

Since entering the age of high-throughput sequencing, many genome-wide transcription

studies have been undertaken (Paul et al. 2005, 2012 and 2013, Correll et al. 2013, Kwon et al.

2014). From these studies, many genes and pathways have been identified that logically help

plants survive in spaceflight. But, amongst these logical pathways are genes that do not make

sense or that we have not uncovered their role yet. There are many unknown genes that are

significantly differentially expressed and some that are only observable with current technology

in the novel environment of spaceflight. At this point, the genes and pathways engaged to adapt

to the spaceflight environment have been roughly characterized, however, the mechanisms plants

engage in spaceflight to remodel their transcriptome and to engage genes that will help them

grow in spaceflight, remains to be investigated.

13

Epigenomics

Epigenetic modifications, or heritable chemical alterations to DNA or its associated

proteins, can play a key role in regulating gene expression by altering the availability of DNA to

transcriptional machinery. Methyl groups (CH3) are attached to cytosine bases at the 5 position

by methyltransferase enzymes, which are found in both prokaryotic and eukaryotic organisms. In

plants, DNA methylation occurs in the CG, CHG and CHH context (where H is A, C, or T), each

of which is maintained through cellular divisions by a distinct pathway and set of enzymes (Chan

et al. 2005, Kawashima and Berger 2014, Pikaard 2013) including DDM1, VIMs and MET1

(CG), SUVH4 deposited H3K9me2 and CMT3 (CHG), and CMT2 (CHH). If an organism deems

it necessary to establish DNA methylation where there has not been any in its ancestral cell (no

template), or encounters a situation that requires an alteration of gene expression such as

environmental stress or pathogen infection, DNA methylation is established de novo via the

RNA-directed DNA methylation (RdDM) pathway (Matzke & Mosher 2014).

Since its discovery, DNA methylation has been shown to be associated with many critical

aspects of molecular biology such as gene and transposon silencing, genomic imprinting as well

as X chromosome inactivation (Jaenisch and Bird 2003; Mohandus et al., 1981; Li et al., 1993;

Finnegan et al., 1996, Litt et al. 1996). DNA methylation occurs with great density at repetitive

sequences such as the pericentromeric regions, and occurs in light density in euchromatin (Lister

et al. 2008). The main reason why we are interested in DNA methylation is because it has been

shown to be a key regulator of gene expression.

Upon careful examination, the scientific community has generated many pieces of the

puzzle of the complex relationship between DNA methylation and gene transcription and has

demonstrated that this relationship is dependent upon many factors such as: sequence context,

genomic region, and the local architectural arrangement of chromatin (reviewed by Chan et al.

14

2005 and Jones 2012). There are also many interactions between DNA methylation and other

epigenetic modifications such as histone methylation (Soppe et al. 2002), and it is not always a

simple straightforward cause and effect. Methylation in the promoter of genes is typically

associated with transcriptional silencing, especially in mammals (Law and Jacobsen 2010) while

gene body methylation remains much more ambiguous and has been observed to be associated

with increased and decreased transcription depending on the sequence context (Teixeira and

Colot 2009) although other sources say that DNA methylation inhibits transcriptional elongation

and the degree to which transcription is affected is dependent upon the size of the gene

(Zillberman 2007). Given that epigenetic modifications have been demonstrated to play a key

role in gene regulation, DNA methylation presents a prime candidate for explaining how an

organism takes an environmental cue and tangibly alters its genetic blueprints to respond to that

cue, to remember it, and to potentially pass this information on to its progeny.

Epigenetic modifications have immense and growing importance in biology and it is

becoming clear that DNA methylation at certain loci are like notes in the margins of a

manuscript of how to survive a certain environmental situation. Given that epigenetic

modifications are engaged in response to environmental stimuli in both mammals (Jaenisch and

Bird 2003, Feil and Fraga 2012) and plants (Chinnusamy and Zhu 2009, Wang et al. 2010,

Bilichak et al. 2012, Labra et al. 2002), it is likely that Arabidopsis utilizes DNA methylation to

tailor its gene expression profile to the novel environment of spaceflight. Many aspects of this

response remain to be investigated, such as the pattern of signals transduced into the nucleus that

ultimately direct the addition of methyl groups to DNA bases, and the biological outcome of a

DNA methylation event at a certain genomic region and its effect on transcription.

15

Epigenomics in Spaceflight

This project aims to shed light and provide models for some of those unexplored

questions and will provide useful knowledge that could potentially be harnessed and placed in

the control of plant biotechnologists and bioengineers who wish to engineer the most fruitful and

successful plants for use in space travel. The biological significance of DNA methylation has

been put forth and accepted in the scientific community for decades now, however despite

several demonstrations that DNA methylation is sensitive to the environment and is one of the

few ways we know that organisms adapt to the environment on a molecular level, few DNA

methylation studies have been performed in the context of the spaceflight environment. The

current literature on spaceflight epigenetic/epigenomic studies of plants has been limited to a few

studies in Oryza sativa (rice) (Ou et al. 2009, 2010; Long et al. 2009; Shi et al. 2014).

Ou et al. examined the DNA methylation state of 11 genes and 6 transposable elements

(TEs) in rice plants grown on the grown from seeds flown on the “Long-March-2” spaceship for

18 days or ground controls (not flown), using methylation-sensitive Southern blot analysis and

found differential methylation in all TEs and all but 4 of the genes analyzed. When the

expression of these genes was analyzed via qRT-PCR, it was found that gene DNA methylation

and transcript abundance operated independently of each other (i.e. the hypermethylated genes

examined were not found to be downregulated in spaceflight vs. ground control). The authors

also demonstrated varying inheritance in a locus-specific manner of DNA methylation in the

progeny of the spaceflight plants.

In a different experiment, using the same seeds that were flown on the “LongMarch 2”

spacecraft, Ou et al. examined 460 genomic loci for genetic changes and 467 loci for epigenetic

changes using the amplified fragment length polymorphism (AFLP) and methylation sensitive

amplified polymorphism (MSAP) respectively and found much higher rates of (epi)genetic

16

mutagenesis compared to ground controls. Methylation sites across the genome were viewed as

“weak points” for potential mutation of methylated cytosines to uracils, which requires a simple

de-amination, as opposed to non-methylated cytosines, which would also require the addition of

a methyl group. Genome methylation was correlated to spaceflight-induce single nucleotide

polymorphisms (SNPs) and no significant correlation was found.

Most recently, an experiment carried out by Shi et al. compared genomic/epigenomic

mutations in rice exposed to the spaceflight environment and heavy ion radiation. The

spaceflight material was generated similarly: seeds were flown in an envelope aboard a satellite

(20th recoverable satellite of China) for 18 days and were subsequently grown in standard

laboratory conditions afterwards. Irradiated seeds were exposed to 12C 6+ ion beam. MASP and

AFLP methods were used to generate differential methylation and genetic polymorphisms in a

similar fashion to Ou et al. 2009 and 2010. Approximately 20% of mutations were observed in

both irradiated seeds and spaceflight seeds, indicating that spaceflight-induced epigenetic/genetic

mutations may involve factors beyond ion radiation. This is one study in plants that examined

DNA methylation in spaceflight and made comparisons to the expression of the genes in which

the differential DNA methylation was identified, however this study only examined a few loci

and the relationship between DNA methylation and differential gene expression in space remains

inconclusive.

In other biological systems such as mammals, yeast, bacteria, insects, and many others, it

has also been observed that exposure to spaceflight and simulated microgravity result in changes

in the expression of functionally important genes (Allen et al. 2009, Baqai et al. 2009, Herranz

2010, Wang et al. 2014, Li et al. 2015). Despite such examinations and the demonstration of

genome-wide transcriptional changes, few studies have investigated mechanisms that may

17

control these transcriptional alterations. Of the epigenetic studies performed, they have been

limited to human lymphocytes and lymphoblastoid cells in simulated microgravity (rotation)

(Singh et al. 2010, Chowdhury et al. 2016). The use of MEthylated DNA

ImmunoPrecipitation/5-Hydroxymethylated DNA ImmunoPrecipitation (MEDIP/hMEDIP)

sequencing by Chawdhury et al. represent the most comprehensive methylation analysis

techniques used in a spaceflight-related experiment to date. However, it is critical to note that

both of the studies mentioned here are using microgravity simulation, which is only a simulation

of one of the many factors that comprise the spaceflight environment (Mashinsky and Nechitailo

2000).

It is important to the “Twin Study” project with twin subjects Scott (astronaut) and Mark

Kelly (non-astronaut) is underway and will be an incredibly comprehensive –omics based

analysis, and the results will be of particular interest to my project as it will feature whole-

genome bisulfite sequencing and epigenetic analysis components between the twins

(https://ntrs.nasa.gov/search.jsp?R=20160012724). An overall examination of the state of

spaceflight epigenetic experiments reveals a largely uncharted territory with much to be learned

about basic molecular biology and if the scientific community can learn to harness

transcriptional regulation by DNA methylation through biotechnological methods, this will open

the door to potential ways to control genes that are important to spaceflight and indeed other

applications that are even stranger and more compelling than we can suppose.

18

CHAPTER 2 DNA ISOLATED FROM PLANT TISSUES PRESERVED IN RNALATER FOR BISULFITE

PCR ASSAY OF GENOME METHYLATION

Background and Significance

Spaceflight has a unique set of abiotic conditions, and it is likely that alteration to the

methylome of plants flown aboard the International Space Station (ISS) is one of the modalities

engaged to cope with this unfamiliar environment (Paul et al. unpublished observations). DNA

methylation on cytosine bases is utilized across the genome to withdraw the availability of DNA

from interactions with transcriptional machinery, generating alterations in the plants’ transcript

profile and resulting physiology. Cytosine methylation is involved in a variety of biological

processes in plants (Stroud et al., 2013) including development, pathogen response, temperature,

and salt stress. Given that the environment of spaceflight is essentially unknown within the

evolutionary history of plants, it is likely that a range of adaptation mechanisms, including DNA

methylation, will occur as plant adapt to this novel environment. Therefore the goal of this study

is to establish a method for genomic DNA isolation for the investigation of the DNA methylation

status of plants, one that is consistent with accepted practices for plants that have been grown

and harvested aboard the ISS.

APEX04-EPEX is an upcoming Arabidopsis plant growth experiment currently planned

for launch on SpaceX-10. The focus of EPEX, which is an acronym for Epigenetic Expression, is

to examine the spaceflight methylome of Arabidopsis. In preparation for that experiment, a

ground-based Experiment Verification Test (EVT) was performed at Kennedy Space Center

(KSC). In the design of this EVT, methylation mutants were included to give a base of evidence

from which we could make conclusions as to the quality of the methods and approach for

preserving the methylome and eventually for investigating the role of the methylome remodeling

process as a response to spaceflight. The Methyltransferase 1 (MET1) and Elongator complex

19

subunit 2 (ELP2) are key genes that encode regulators playing central roles in DNA methylation

of plants (Kankel et al., 2003; Saze et al., 2003; Wang et al., 2013) and the met1-7 and elp2-5

mutants have been previously described (Kanno et al., 2008;Wang et al., 2013). Compared to the

wild type control, the altered DNA methylation patterns in these mutants should reveal

methylome differences, provided that the method preserves cytosine methylation across the

genome. The following describes the process that generates an examination of methylation states

at the gene level in RNAlater-preserved Arabidopsis plants using a modified DNA extraction

method followed by bisulfite conversion, PCR amplification, TA cloning and Sanger sequencing

to determine methylation status..

Material and Methods

Experimental Setup

In the process of attaining the requirements for the EVT for spaceflight experiment

APEX04, nine 0.5x phytagel plates with dormant seeds of Col-0, met1-7, and elp2-5 were sent to

KSC for growth in the Veggie hardware (Massa et al. 2013; Ferl and Paul, 2016) for 11 days

before being harvested to 50 mL Falcon tubes containing RNAlater and sent to our lab for

processing. Samples were received from KSC and were stored at -80°C before processing for

DNA extraction. Each tube contained the harvested Arabidopsis samples from one media plate.

The Falcon tubes containing the samples were transferred to -20°C overnight and then defrosted

at 4°C overnight. Samples were warmed to room temperature to dissolve RNAlater precipitate,

and were subsequently photographed and dissected under a dissecting microscope, severing the

root from the rest of the plant (shoot). Each 50 mL Falcon tube sample was divided and allocated

to either RNA or DNA extraction. Consistent with previous reports (Finnegan et al., 1996; Jia et

al., 2015), retarded growth was observed in met1-7 and elp2-5 seedlings, displayed in Figure 1,

and had a large impact on the allocation of plant material for DNA extraction. We needed to get

20

DNA samples of at least 10 ng/µL of DNA with a total amount of 200 ng DNA for the

downstream bisulfite conversion step. In determining the amount of plants required to get that

concentration and amount of DNA, pilot experiments were run with an aim to conserve valuable

spaceflight materials and to determine how many samples were necessary.

Genomic DNA Extraction

Root and shoot samples were blotted with KimwipesTM, weighed, and rinsed twice in 3

mL of wash buffer (50 mM EDTA, 25 mM EGTA) for 10 minutes. Samples were blotted again

on kimwipes and transferred to mortar and pestle and ground in liquid nitrogen. 900 µL of lysis

buffer (10 mM EDTA, 50 mM EGTA, 50 mM Tris), 80 µL of proteinase K (80 mg/mL), and 100

µL of 10% SDS were added and further ground. Samples were incubated at 65°C overnight. 300

µL of 5M potassium acetate was added to each sample and put on ice for 30 minutes. Each

sample was then spun in a microcentrifuge at maximum speed for 5 minutes, supernatant was

transferred to a new 1.5 mL microcentrifuge tube and spun for an additional 5 minutes. The

supernatant was then split between two 1.5 mL microcentrifuge tubes and 800 µL isopropanol

was added and the tubes were incubated at RT for 1 hour. Tubes were then spun at maximum

speed for 10 minutes, the liquid was poured off and the resulting pellet was air dried for 15

minutes at RT. Pellets were suspended in 50 µL of TER buffer (10 mM Tris-HCl, 1 mM EDTA,

100 µg/µL RNase), split tubes were combined into one tube per sample and incubated at 60°C

for 20 minutes. 100 µL of 25:24:1 phenol/chloroform/isoamyl alcohol was added to each tube,

mixed, and spun at max speed for 10 minutes. The aqueous (upper) phase was transferred to a

new tube and 40 µL of 7.5 M ammonium acetate (AmOAc) and 300 µL of 95% ethanol (EtOH)

were added, the tubes were inverted to mix and placed at -20°C overnight. Tubes were then spun

at 4°C for 10 minutes, the EtOH and AmOAc solution was poured off and the pellets were rinsed

21

with 70% EtOH three times, dried for 15 minutes and suspended in 100 µL 0.25x TE buffer.

This protocol is based in part on a previously developed method (Dellaporta et al., 1983).

Molecular analysis was performed to assess both the quality and quantity of

gDNA produced from these extractions. As an initial look into the gDNA samples, 5 µL of each

sample was run out on a 1% agarose gel, which generated bands within the gDNA size, as

visualized in Figure 2. In addition to gel electrophoresis, the gDNA samples were also quantified

by Qubit, generating the values displayed in Table 1, and TapeStation. For an intensive

examination of gDNA quality, the 2200 TapeStation instrument designed by Agilent

Technologies was employed. Although there are no strict requirements upon DNA to have a

certain DNA integrity number (DIN), as displayed in the in silico gel electrophoresis image

displayed in Figure 3, for bisulfite conversion and DNA methylation analysis, the values

reported by this analysis could prove useful for other downstream applications..

Cytosine Methylation Analysis

Subsequently, PCR based DNA methylation analysis was performed to further

investigate the gDNA extracted from the above method and to clone exonic regions from genes

of interest for methylation analysis. Three genomic DNA samples from shoots of each genotype

with high concentrations were selected from four replicates. Approximately 500 ng of each DNA

sample were subjected to bisulfite conversion using the Zymo EZ DNA Methylation-

Lightning™ according to the manufacturer protocol. PCR products of exon regions from the

genes AT2G07698 (ATPase, F1 complex, alpha subunit protein) and AT2G07687 (Cytochrome

C oxidase, subunit III) were generated using the Zymotaq PCR system according to the

manufacturer protocol. Primers used are all listed in Table 2. PCR products amplified from

AT2G07698 and AT2G07687 exons in shoot DNA samples of Col-0, met1-7 and elp2-5 were

performed in triplicate and run out on a 1% agarose gel displayed in Figure 4, the bands were

22

excised according to their molecular weight and gel purified using the Thermo Fisher gel

purification kit according to the manufacturer’s protocol. To generate clean sequences and to

accurately quantify the percent of copies of DNA with cytosine methylation at a particular

nucleotide site, the three replicates of PCR products from each sample were combined to one

solution. The PCR products of these two genes were amplified from three biological replicates of

three genotypes and ligated to the pCR 2.1 vector and transformed into chemically competent

OneShot OmniMax Escherichia coli cells using the manufacturer’s protocol. Fifteen transformed

colonies were selected by growing on LB media with 50mg/L kanamycin, 100 mg/L X-Gal and

1mM IPTG for each plate. Ninety colonies in total were screened using PCR and the colonies

were submitted for Sanger sequencing. The final Sanger sequencing base calls were analyzed

using the BioEdit software (http://www.mbio.ncsu.edu/bioedit/bioedit.html).

Results

The Col-0 roots and shoots provided DNA samples with similar concentration, while

met1-7 and elp2-5 roots yielded lower DNA concentration compared with the corresponding

shoot samples (Figure 2-1; Table 2-1), indicating the difficulty in handling root tissues of small

mass. In all cases, no RNA or protein contamination or DNA degradation was observed in the

gel (Figure 2-1), which suggested DNA quality of adequate levels for bisulfite conversion.

Moreover, given the total DNA solution amount of 100 µL, most samples met the requirement

we had set for bisulfite conversion (200 ng with 10 ng/uL). The exceptions were one root sample

of met1-7 and two root samples of elp2-5 (Table 2-1). However, total DNA amounts of these

three samples were above 900 ng, which is much higher than the minimum suggestion for

bisulfite conversion and were suitable for bisulfite conversion after being subjected to standard

concentration analyses. Three biological replicates from Col-0 root and shoot samples were

analyzed by TapeStation and generated DIN values above 6.3 on a 10 point scale (Figure 2-3).

23

This analysis verified the DNA quality estimated by agarose gel electrophoresis (Figure 2-1) and

also generated valuable information for a variety of downstream applications such as sequencing.

Next, the genomic DNA samples were sent to the International Center for

Biotechnological Research (ICBR) at UF for bisulfite sequencing, and after acquisition and

bioinformatics processing was performed, manual observations of the distribution of methylated

cytosine bases were undertaken, generating the information displayed in Figures 2-5 and 2-6. No

mixed peaks were observed in the chromatogram peaks – a tribute to the uniformity of cloned

amplicons in the TA colonies. Two genes were chosen out of a list of genes that were previously

differentially expressed spaceflight vs. ground control in earlier experiments (APEX01). The two

genes chosen for analysis were highly downregulated and were therefore good candidates for

DNA methylation analysis. For the ATPase, F1 complex, alpha subunit protein (AT2G07698)

and Cytochrome c oxidase, subunit III (AT2G07687), the regions of +253 to + 507 and +19 to +

355 (the A of ATG start codon was designated +1) were analyzed, respectively. Methylation in

the ATPase subunit (AT2G07698) was much more bimodal and generally much lower than in

the Cytochrome C subunit (AT2G07687), typically having only 0 or 1 out of 15 colonies

methylated at a given locus in the CG, CHG, or CHH context in wild type (Figure 2-5). In met1-

7, no methylation was observed in most of the cytosine sites of AT2G07698 exon region (Figure

2-5), which is in line with the MET1 role of maintaining CG methylation (Cao and Jacobsen,

2002). It has been reported that loss-of-function mutation of ELP2 will lead to disorder in

genome-wide DNA methylation (Wang et al., 2013). Indeed, in two CG sites and most of

CHH/CHG sites of AT2G07698 region, elp2-5 showed higher methylation level than Col-0

(Figure 2-5). For AT2G07687, the methylation levels were somehow consistent among three

genotypes in most of CG and CHG sites (Figure 2-6). For CHH context, most of the cytosine

24

methylation was disrupted in both met1-7 and elp2-5 (Figure 2-6). Interestingly, unlike

AT2G07698, no elimination of methylation in CG context was observed in AT2G07687 exon

region in met1-7, suggesting the stability of CG methylation in this gene. Together, the Sanger

sequencing results indicated that these extracted DNA samples were suitable for PCR based

cytosine methylation analysis.

Discussion

In summary, we have generated a working method for characterizing the DNA

methylation status in RNAlater-preserved plants. These data illustrate that novel approaches can

be used to navigate some of the difficulties in working with RNAlater–preserved material. In

addition, examinations of genotypes revealed genotype-specific differences in the methylation

state of genes of interest. For DNA extraction, we deemed 10 of Col-0, 16 of met1-7, and the

maximum available elp2-5 (total minus 3 for RNA) plants to be necessary to get DNA solutions

of adequate concentration for bisulfite conversion. We also found that the PCR conditions used

to amplify bisulfite-converted DNA derived from RNAlater samples were highly sensitive, and

in our case it was necessary to use a polymerase kit designed specifically for amplifying bisulfite

converted DNA.

We expected the gDNA to be of lower concentration and amount in root samples, as

these tissues were of lower fresh mass and, in general, contain lower gDNA concentration per

gram of fresh mass. Given the small growth phenotype present in the elp2-5 genotype, we

expected gDNA extractions of elp2-5 roots to be of concern. Since the corresponding shoot

gDNA extractions had such a large fresh mass input, we expected the quality of shoot gDNA to

be qualitatively compromised. This also raised concern for elp2-5 shoot extractions due to the

comparatively large number of plants deemed necessary for adequate gDNA quantity for

25

bisulfite conversion. In general, four replicates of each material exhibited comparatively

consistent DNA quality and quantity.

Results produced from the methylation analysis revealed that the levels of methylation

varied widely between genotypes and the gene analyzed. This targeted approach adopted for the

EVT will have wide application in space-related genomic research, and also revealed interesting

gene-specific differences in methylation among genotypes. From the data that we collected

during this experiment, we are confident that in addition to its intended purpose of RNA

preservation, RNAlater-preserved plant material is suitable for high quality gDNA extraction and

methylation analysis. However, the integrity and completeness of DNA methylation preservation

by RNAlater fixation compared to DNA methylation analysis in fresh tissue remains to be

investigated.

26

Figure 2-1. Varying plant mass between genotypes grown on petri plates. 100 mm2 Petri plates

containing 11 day-old seedlings of Col-0, met1-7 or elp2-5 Arabidopsis plants grown on 0.5x phytagel media. These plants were grown under the VEGGIE growth system at Kennedy Space Center and were used in the EVT for APEX04.

Col-0 met1-7 elp2-5

27

Figure 2-2. Agarose gel electrophoresis of gDNA extractions. Genomic DNA extraction from

Col-0, met1-7 and elp2-5 root and shoot samples obtained from the EVT at KSC. Known genomic DNA purified using the CsCl method was diluted to gradient concentrations (50, 25, 12.5, 6.25, 3.125, 1.5625, 0.78, 0.39, 0.195 ng/µL) and used to generate a standard curve by which the DNA samples were quantified by band intensity. For each sample, 5 µL of DNA solution was loaded.

28

Figure 2-3. TapeStation analysis of exemplary, typical DNA samples extracted from APEX04 EVT plant material. Roots and shoots from the Col-0 ecotype EVT samples were analyzed on the Agilent 2200 TapeStation System using the Genomic DNA ScreenTape®, generating concentration values and DNA Integrity Number (DIN). L – molecular weight ladder, S – CsCl purified gDNA standard.

29

Figure 2-4. PCR amplification products from exonic regions of AT2G07698 and AT2G07687

shoots from Col-0, met1-7 or elp2-5. PCR generated samples were run out on 1% agarose gel, stained with ethidium bromide. The amplified region from AT2G07698 is expected to be 316 bases and from AT2G07687 is expected to be 398 bases (see Table 2-2).

30

Figure 2-5. DNA methylation present in AT2G07698 from gDNA samples extracted for EVT.

DNA methylation levels in the CG (A), CHG (B) and CHH (C) context in a window of ~200 b.p. in PCR detected exonic regions of AT2G07698 (+253 to + 507 from ATG) from shoot DNA samples of Col-0, met1-7 and elp2-5. Each column represents the percent of 15 TA colonies that had a methylated cytosine at a given nucleotide site

31

Figure 2-6. DNA methylation present in AT2G07687 from gDNA samples extracted for the

EVT. DNA methylation levels in the the CG (A), CHG (B) and CHH (C) context in a window of ~200 b.p. in PCR detected exonic regions of AT2G07687 (+19 to + 355 from ATG) from shoot DNA samples of Col-0, met1-7 and elp2-5. Each column represents the percent of 15 TA colonies that had a methylated cytosine at a given nucleotide site

32

Table 2-1. Quantification of gDNA extractions. Qubit quantification of DNA extraction samples corresponding to Figure 2. Standard DNA with known concentration was used as positive control. The amount of roots or shoots used for DNA extraction and concentration of each DNA sample were listed.

Sample # of plants

[DNA] (ng/µL)

Col-0 R1 10 30.8 Col-0 R2 10 14.9 Col-0 R3 10 26 Col-0 R4 10 23.6 Col-0 S1 10 27.2 Col-0 S2 10 25.6 Col-0 S3 10 27.2 Col-0 S4 10 29.4 met1-7 R1 16 19.8 met1-7 R2 16 15.2 met1-7 R3 16 20.6 met1-7 R4 16 9.06 met1-7 S1 16 37.2 met1-7 S2 16 31.8 met1-7 S3 16 30.8 met1-7 S4 16 22.4 elp2-5 R1 16 9.24 elp2-5 R2 25 9.24 elp2-5 R3 25 13 elp2-5 R4 17 12.3 elp2-5 S1 16 47.4 elp2-5 S2 25 49.2 elp2-5 S3 25 36.6 elp2-5 S4 17 45.4

33

Table 2-2. PCR primer sequences. The bisulfite primer seeker designed by Zymo Research was used select regions to amplify from the exons of AT2G07698 and AT2G07687.

Primer Sequence (5' to 3') Tm (°C)

Product Size (bp)

AT2G07698-F TAAATATTTTTTTTTTATTTGTTTTTGGAG 50.1 316 AT2G07698-R TAAAACRAAACTATAAAAAAAAAAAAAAAAAC 51.6

AT2G07687-F AGATAAAGTGGTTTATGATTGAATTTTAGAGG 55.6 398 AT2G07687-R ATCTAAAACCTCAATCCCTTTTAAAAACC 55.9

34

CHAPTER 3

ANALYSIS OF DNA METHYLATION IN A SPACEFLIGHT EXPERIMENT

Background and Significance

To elucidate the degree to which DNA methylation is altered and utilized in response to

the spaceflight environment, the DNA methylation profiles of FT and GC samples will be

generated by whole genome bisulfite sequencing (WGBS). Genomic DNA methylation has been

shown to be involved in a variety of biologically crucial processes such as the recruitment of

chromatin remodelers and methyl-CpG-binding domain (MBD) proteins, resulting regulation of

gene expression, X-chromosome inactivation and genomic imprinting, and has shown to be

important throughout embryonic development (Jaenisch and Bird 2003; Mohandus et al., 1981;

Li et al., 1993; Finnegan et al., 1996). The sites of methylation across the genome were

assembled into coherent maps that were then analyzed in more detail to discover genes that are

highly differentially methylated in spaceflight compared to ground, organizing this analysis into

both highly methylated genes (may have a few number of sites) and genes that have a large

number of differentially methylated sites (may have small average difference). In analyzing

genes that are found to be highly differentially methylated, a previously generated list of

hundreds of genes that have been shown to be significantly differentially expressed in previous

spaceflight experiments (Paul et al. 2005) and that have clear functional roles applicable to

spaceflight adaptation such as cell wall remodeling genes were used as a guide to isolate

important genes.

When plants are subjected to the novel environment of spaceflight aboard the

International Space Station (ISS), an environment that is completely alien to their evolutionary

history, they respond by making unique genome-wide alterations to their gene expression profile

(Paul et al. 2005 and 2013, Kwon et al. 2015). By precisely dissecting the biological processes

35

and pathways engaged when a plant is grown on the ISS, many important findings have been

made that have shed new light on several biological paradigms (Paul et al.

2012, 2016, Zupanska et al. 2013, Shi et al. 2017, Vandenbrink and Kiss 2016) and have

identified many key species and genes for developing food crops for trans-planetary exploration

(Sugimoto et al. 2014, Graham et al. 2015, Perchonock et al. 2012). Despite extensive studies

into both the genes expressed and the processes engaged in response to spaceflight, the

underlying regulatory mechanisms that may orchestrate these alterations are just beginning to be

explored.

The regulation of gene expression occurs at multiple levels; however, the fundamental

focus of the work here is the transcriptional regulation of genes via epigenetic modifications – in

particular DNA methylation. The nucleotide cytosine can be methylated at the five position by

DNA methyl transferase enzymes to form 5-methylcyotosine (5mC) and the implications from

this epigenetic modification at various levels in living organisms have been studied for decades.

An important discovery that is of particular interest to the work here is the participation of DNA

methylation in the regulation of gene expression (Goll and Bestor 2005, Zhang et al. 2006).

Given that genome-wide alterations of gene transcription is the basal response at the molecular

level to a variety of environments, stresses, and developmental cues, mapping methylated

cytosines across the genome has critical importance to understanding how an organism tailors its

gene expression profile to a novel environment such as spaceflight.

Materials and Methods

Experimental Design

The data presented here was taken from the NASA Advanced Plant Experiment 03-2

(APEX03-2) which was launched on SaceX mission CRS-5 on 10 January 2015 in a Dragon

Capsule carried by a Falcon 9 rocket launched from Complex 40. This experiment is also

36

identified by NASA operations nomenclature (OpNom) “TAGES-ISA” (Transgenic Arabidopsis

Gene Expression System-Intracellular Signaling Architecture:

http://www.nasa.gov/mission_pages/station/research/experiments/1059.html). The overarching

goal of this experiment was to characterize the molecular mechanisms plants use to guide the

distinct growth habits observed in spaceflight conditions.

Plant Material and Plate Preparations

Sterilized and dry Arabidopsis seeds of the Wassilewskija (WS) ecotype were placed in

sterile conditions onto the surface of 100 mm2 square petri dishes containing a solid medium of

0.5% Phytagel/0.5x MS media and then wrapped in black cloth (Duvetyne, SeattleFabrics.com) .

The wrapped plates were stored at 4°C until launch. The seeds remained dormant until removal

from cold stowage and exposure to light after installation of the plates into the Vegetable

Production System (VPS/Veggie) hardware on the Columbus Module of the ISS.

Plant Growth Conditions on ISS and Ground Controls

To initiate germination, plates were unwrapped and secured perpendicularly to the LED

light source of the VPS, which generated conditions of 100-135 µmoles/m2/s PAR. The plants

were grown for eleven days and individual plates were subsequently removed from the VPS and

harvested into Kennedy Space Center Fixation Tubes (KFTs) and fixed in RNAlater (Ambion,

Grand Island, NY, USA). KFTs provide three levels of liquid containment and are quintessential

ISS hardware for studying molecular biology. The KFTs were then stowed at -80°C in the

MELFI freezer aboard the ISS. The samples were kept frozen until delivery to the author’s

laboratory for analysis.

The corresponding ground controls were grown in the ISS Environmental Simulation

(ISSES) chamber at KSC. This chamber replicated the temperature, CO2 levels and lighting of

the ISS recorded for the previous 24h. The ground controls were unwrapped, placed into the

37

VPS, and grown for 11 days in an identical fashion to the spaceflight samples. The plants were

then harvested to KFTs and stored in a standard -80°C freezer. The samples were kept frozen

until delivery to the author’s laboratory.

Dissection and DNA Extraction

After arriving, the 50 mL Falcon tubes containing the plants from one plate preserved in

RNAlater were thawed and gradually brought to room temperature. Three individual plants were

removed from each tube and stored for other analyses and the rest (10-12 plants) was allocated to

DNA extraction. Leaves, hypocotyls and roots from each tube were dissected using an Olympus

microscope. DNA was extracted using a modified phenol/chloroform protocol as previously

described from three biological replicates of root and leaf samples from spaceflight and ground

controls. This DNA material was then submitted to the Interdisciplinary Center for

Biotechnology at the University of Florida for bisulfite conversion and Next-Generation

sequencing.

Bisulfite Sequencing

Genome-wide bisulfite sequencing was performed similarly to previous experiments.

Qualitative and quantitative measurements were performed on the genomic DNA using a

DNA1200 BioAnalyzer chip (Agilent Technologies, Santa Clara, CA, USA) and 700-1700 ng of

genomic DNA was processed for sequencing library construction. The DNA was transferred into

6x16 mm glass microtubes with AFA fiber and pre-slit snap caps and sheared into average

fragments of ~400 bp using the Covaris S2 ultrasonic disruptor, following the manufacturer

settings. Fragments of less than 100 bp in size were removed using AMPure magnetic beads

(Beckman Coulter, Brea, CA, USA) at a 100:100 bead to sample ratio and 300-750 ng of clean,

fragmented DNA was obtained. Between 100-250 ng of this material was used for Illumina

sequencing library construction using the NEBnext Ultra DNA Illumina construction kit (New

38

England Biolabs, Ipswich, MA, USA) in conjunction with Illumina-specific methylated and

barcoded adaptors (New England Biolabs). After end-repair, 3’-adenylation, and adaptor-ligation

steps 75-150 ng of clean, adaptor-ligated DNA fragments (Illumina library) were recovered in

Tris-HCl, pH 8.0 and were quantified using a QUBIT fluorimeter (Life Technologies, Carlsbad,

CA, USA).

Illumina libraries (including methylated adaptors) for each of the three replicates of roots

and leaves of spaceflight and ground control treatments were bisulfite converted using the EZ

DNA MethylationTM Kit (Zymo Research, Irvine, CA, USA) according to the manufacturer’s

instructions. The resulting bisulfite converted libraries were enriched by a 13-15 cycle

amplification using a uracil-insensitive polymerase (NEB) and then separated on a 2% agarose

gel with SYBR safe (Life Tecnologies) from which library fragments of 250-500 bp were

excised and purified (QIAquick gel extraction kit, QIAGEN, Hilden, Germany) and AMPure

purified (Beckman Coulter). The final processed libraries were quantified by the QUBIT

fluorometer and by qPCR with the Kapa SYBR Fast qPCR reagents (Kapa Biosystems) with

monitoring on an AB17900HT real-time PCR system (Life Technologies). Two barcoded

libraries were pooled equimolarly and diluted to 9 pM for cluster generation on the cBOT

(Illumina). Samples were sequenced on a single flowcell lane on the HiSeq2000 instrument using

a 2x101 cycle multiplex paired-end reads per lane.

Read Alignment and Processing

The input sequences were trimmed using trimmomatic and quality control was performed

before and after using FastQC. Reads were aligned to the WS reference genome using bsmap.

Methylation calling was performed with cscall v1.0 using the ws_0.v7.allPlusChlMito-CG index.

A site was included in the analysis if it reached at least 20 in at least 2 samples. Differential

methylation was determined using the mcomp program. Sites for which the P-value of the

39

difference between test and control methylation rates was below 0.01 were considered

significant. Sites of differential methylation were also categorized based on the characteristics of

their genomic location. Sites were categorized into gene body (coding regions), promoter (2kb

upstream), downstream (2 kb downstream), exons, introns and intergenic regions (more than 2

kb away from a TSS or TTS).

DMR Analysis

The DMRs were defined using similar criteria to Jacobsen et al. 2013. The genome was

tiled into 100 bp bins with an assigned level of methylation (sum of methylated Cs/total number

of Cs) was generated for each replicate of each organ and treatment. A 100 bp was included in

the analysis if it had at least 4 cytosines within it each covered with at least 4 reads. Bins with

methylation differences of 0.4, 0.2, and 0.1 for CG, CHG and CHH respectively and a Fisher’s

exact test FD<0.01 were selected. DMRs within 200 bp of each were merged to identify

methylation clusters.

Results

Based on preliminary studies, our initial expectation of the results of the whole genome

bisulfite sequencing (WGBS) project was to be a significant change in average level of genome

methylation in the spaceflight grown plants. However, we noticed that the level of methylation

did not change significantly between flight and ground (Fig. 3-1). In general, CG methylation

levels were the highest, while CHG levels were intermediate and CHH levels were the lowest.

Interestingly, the distribution of methylated cytosines between spaceflight leaves and the rest of

the samples did change. Spaceflight leaves had a much reduced representation of CHH sites

analyzed than the rest of the samples.

The methylation profiles of spaceflight-grown roots and leaves and ground control roots

and leaves look quite similar. There were peaks around the pericentromeric regions and isolated

40

peaks on the chromosomal arms. Overall, these profiles displayed that the methyltransferase

enzymes and DNA methylation pathways were working properly in space to ensure genome

integrity, although slight differences were observed that could possibly correlate with differential

gene regulation. (Fig 3-2)

Despite the similar appearance of the genome-wide methylation levels and the

methylation profiles of each of the samples to be similar, differential methylation was observed

in both roots and leaves when spaceflight samples were compared to ground control. There was a

much greater percentage of differentially methylated C in the CG context in roots compared to

leaves (Fig.3-3A). There was also an overall change in the distribution of differentially

methylated regions (DMRs) in leaves and roots. Roots had substantially more hypo-DMRs (de-

methylated regions) compared to leaves and leaves had substantially more hyper-DMRs

(methylated regions) compared to roots (Fig. 3-3). These regions could correspond with genes

(promoters or gene bodies) or other regulatory regions.

An overall examination of the transcriptome profile displayed 65 genes differentially

expressed in roots spaceflight vs. ground control and a whopping 608 genes differentially

expressed in leaves. This is in stark contrast to some of the other spaceflight experiments where

roots had the most differentially expressed genes. Some of the genes that were commonly up

regulated were ubiquitin ligases (protein degradation) and ethylene response factors. Some of the

genes that were commonly downregulated were ELIP1 and ELIP2 and DREB2A. Surprisingly, a

lot of heat shock factor proteins and transcription factors were down-regulated in this

experiment. Not surprisingly, however, was that ADH1 was upregulated, a gene observed to play

a role in spaceflight adaptation since some of the first spaceflight transcriptome profiles were

generated.

41

Despite there being so many genes differentially expressed and differentially methylated,

relatively few were observed to overlap. This could reflect on the fact that possibly only a few

genes are regulated by DNA methylation in the spaceflight environment and that possibly, DNA

methylation is a transcriptional regulation mechanism employed in more gradually stressful

situation such as salt or pathogen stress. One example of a differentially methylated gene that

was also differentially expressed was found and analyzed. The DCL1 (AT1G1040) possessed a

unique, small cluster of 5 CHH methylation events ~4kb upstream in leaves. When gene

expression values were examined, it was found that, in leaves, this gene is downregulated. In

roots, it is not differential expressed. This is an example of differential methylation correlating

with transcript levels revealing a potential role for DNA methylation in regulating a gene altered

in the spaceflight environment.

Discussion

The environment of spaceflight presents humans a new frontier on many levels, a

frontier of geographical discovery, of pushing the limits of mankind’s technology, diverting their

priorities from mundane survival, to something great. The environment of spaceflight has

afforded scientists a novel environment in which to conduct experiments in a wide range of

fields. The particular field that I am interested in is the novel abiotic environmental components

that comprise the spaceflight environment, and how plants grow and adapt to this novel

environment. To understand how a plant physiologically adapts to the spaceflight environment in

the most thorough way possible, one must investigate the occurrences at the biochemical level to

truly understand the molecular functions that ultimately lead to the intricate and fascinating

morphological phenotypes we observe when an organism is observed in a novel environment. By

studying DNA methylation, we may catch a glimpse at part of an intricate set of molecular

42

mechanisms that control which genes are expressed when, and these mechanisms may

potentially be inherited into future generations.

What we observe when we examine the methylome of plants that are subjected to the

novel environment of spaceflight is that much of the methylation that occurs in flight also occurs

on the ground (Fig. 3-1). At a very high level of resolution, it looks like the spaceflight and

ground methylomes of Arabidopsis are quite similar. This could be attributed to the fact that

DNA methylation is a highly conserved molecular mechanism that determines cell fate, silences

transposable elements, and alters the affinity of binding sites for methylation sensitive

transcription factors. However, there are genes that are under the control of DNA methylation

(see 3-5) and their expression values are regulated directly by the level of DNA methylation.

Also, when we begin to examine the genome at a higher resolution, we observed many

differentially methylated cytosines and 100-bp regions (Fig. 3-3). The number of genes that are

both significantly differentially expressed and significantly differentially methylated is low,

especially if we look at spaceflight through the paradigm of a stressful environment. Salt stress,

pathogen stress, nutrient availability all create genome-wide changes in the DNA methylation

levels and several to hundreds of genes involved in regulating those processes are differentially

expressed. Since spaceflight is not a particularly stressful environment, it could be argued that

indeed, only a handful of genes are going to be differentially expressed to become adapted to this

novel environment and only a handful of those will be regulated by DNA methylation. However,

the example gene (Fig. 3-5) I found and analyzed demonstrates a prime example of how just one

gene that was differentially expressed and differentially methylated could control a vast network

of post transcriptional gene silencing. DCL1 is involved in the RNAi pathway, in which micro-

RNAs are transcribed, bind complementarily to an mRNA transcript of a gene, and thereby

43

sentence it to dicing by the Dicer-RISC complex. It could be that these kinds of examples are

found all over the genome and perhaps a more intuitive and sensitive approach may reveal DNA

a key and powerful role for DNA methylation in subtly tailoring the spaceflight transcriptome.

44

Figure 3-1. Average genome-wide methylation level in spaceflight and ground control

Arabidopsis plants. The average genome-wide methylation levels for spaceflight and ground control leaves (A) and roots (B) were generated by averaging the methylation ratios for each C detected in the genomes of 3 biological replicate samples by WGBS. The total methylation levels in both roots and leaves grown on the ISS vs. ground controls were not significantly different.

45

Figure 3-2. DNA methylation profiles for each Leaf FT, Leaf GC, Root FT, and Root GC

samples viewed in Integrative Genomics Viewer (IGV). The vertical scale of each track is from 0 – 1.0 (0 reads methylated - all reads methylated) while the horizontal scale is the genomic location across each of the 5 Arabidopsis chromosomes (depicted below and described at the bottom of figure). Each column represents the average methylation level across a ~100 kb window.

46

Figure 3-3. Proportions of both differentially methylated cytosines (DmCs) (A) and differentially

methylated regions (DMRs) (B) in roots (left) and leaves (right). Each pie chart displays the proportion of a different amount of DmCs or DMRs (spaceflight vs. ground control) into certain categories. In this figure the for roots (A – left) 13165 DmCs were identified by sequence context (CG, CHG, or CHH) and proportionally displayed in a pie chart to show how roots and leaves utilize DNA methylation in distinct ways to adapt to the spaceflight environment.

47

Figure 3-4. Genome-wide transcriptome analysis and preliminary investigations into biological

function of differentially expressed genes spaceflight vs. ground control. Many genes of interest from previous spaceflight experiments were also differentially regulated in APEX03 WS plants, some of which are selectively highlighted.

48

Table 3-1. Comparison of differentially expressed and differentially methylated genes. Table of differentially expressed, differentially methylated genes and where those genes overlapped (were both differentially expressed and differentially methylated).

Comparison Diff. Exp. Diff. Met. Intersections

Roof FT vs. GC 65 5932 5

Leaf FT vs. GC 608 1479 26

49

Figure 3-5. Example gene dicer-like 1 (DCL1). Gene DCL1 is a dicer-like RNA helicase, found in the RNAi degradation pathway. This gene also had a small cluster of CHH methylations in leaves (circled in red), that was absent in roots.

50

CHAPTER 4 CONCLUSION

This study forges a way for biologists, interested in biology that takes place in a wide

array of novel environments, which have now become reliant upon RNAlater. One of the

hallmarks of this project is that I developed an extraction method that produces high quality

genomic DNA (Fig. 1-1) that is suitable for high throughput sequencing. This opens the door for

scientists who are interested in the molecular biology of plants that are harvested from

experiments that rely on RNAlater. Some examples of these are parabolic flight experiments –

where organisms are fixed into RNAlater at specific time points during a parabolic flight,

experiments in which using liquid nitrogen to fix samples is unfeasible, and of course spaceflight

experiments, where RNAlater is the gold-standard molecular fixation tool used to fix the samples

and have the transriptome and methylome static in such a manner that they were actually in

space at the time of nucleic acid extraction. By using this method, I extracted genomic DNA

from spaceflight material, fixed in RNAlater and stored at -80 °C for months after the experiment

was completed. I then analyzed two genes that were of particular interest to adapting to the

spaceflight environment. Both of these genes showed markedly different patterns of methylation

(Fig. 2-5 and 2-6): one gene was highly methylated while the other gene had barely any DNA

methylation that we could detect. This data showed primarily that we could detect differential

DNA methylation in RNAlater-preserved plants. We also observed that genes are methylated

differently and that the methylation applied to a gene could potentially have a meaningful impact

on the transcription of that methylation-sensitive gene, although that was not investigated in this

project. The next step was to see how methylation looked like in a real spaceflight experiment

across the entire genome using WGBS.

51

After establishing that DNA of sufficient quality could be extracted from RNAlater-

preserfed plants, and that we could detect differential methylation between two genes in three

different genotypes, we decided to investigate genome-wide methylation using high throughput

technology in a spaceflight experiment. In the results from these experiments, we did not find

any genome-wide changes in the average level of DNA methylation, and the methylation profiles

looked very similar to ground control plants (Fig. 3-1 and 3-2). We also found a great abundance

of differentially methylated cytosines when we compared the methylomes of spaceflight-grown

plants to ground control plants (Fig. 3-3). Some of these sites of differential methylation

corresponded to genes and some of those genes were also significantly differentially expressed.

Some of the other differential methylation may also be related to transposable elements (TEs),

enhancers, and possibly other important regulatory regions; however we did not specify the

regions in which we found other differential methylation sites. When we examined the genes that

were significantly differentially methylated we saw that few were also significantly differentially

expressed. The gene that we found to be differentially methylated and differentially expressed in

an organ and environment-specific manner (DCL1) was rare, but it was also particularly

interesting. DCL1 is involved in microRNA processing and microRNA are involved in the RNA

degradation pathway that creates double-stranded mRNAs which are cleaved and eliminated by

the DICER-RISK complex. When these mRNAs are cleaved, the gene is post-transcriptionally

silenced. Since this gene was methylated in leaves in the spaceflight environment, it could be

that post transcriptional gene silencing via RNA interference (RNAi) is a differentially regulated

process in spaceflight and that the transcriptional downregulation of DLC1 could lead to an

increase in the genes ordinarily silenced via the RNAi pathway. One of the main points gleaned

from this study was that only certain genes are regulated by DNA methylation while others are

52

not and that it is necessary to study how it is that a gene can be made sensitive to transcriptional

alteration by methylation, and how this knowledge can be best utilized to develop a technique to

control the expression of genes of interest in any field of work – be it spaceflight crop

generation, terrestrial crop improvement, or other such strategic goals.

53

LIST OF REFERENCES

Baqai FP, Gridley DS, Slater JM, Luo-Owen X, Stodieck LS, Ferguson V, Chapes SK, and Pecaut MJ. 2010. Effects of spaceflight on innate immune function and antioxidant gene expression. Journal of applied physiology 106(6): 1935-1942.

Bilichak A, Ilnystkyy Y, Hollunder J and Kovalchuk I. 2012. The progeny of Arabidopsis thaliana plants exposed to salt exhibit changes in DNA methylation, histone modifications and gene expression. PloS one 7(1): e30515.

Chan SWL, Henderson IR and Jacobsen SE. 2005. Gardening the genome: DNA methylation in Arabidopsis thaliana. Nature reviews. Genetics, 6(5): 351.

Chinnusamy V and Zhu JK. 2009. Epigenetic regulation of stress responses in plants. Current opinion in plant biology 12(2): 133-139.

David AL, Bandstra ER, Harrison BC, Thorng S, Stodieck LS, Kostenuik PJ, Morony S, Lacey DL, Hammond TG, Leinwand LL and Argraves WS. 2009. Effects of spaceflight on murine skeletal muscle gene expression. Journal of Applied Physiology 106(2): 582-595.

Drysdale AE, Ewert MK and Hanford AJ. 2003. Life support approaches for Mars missions. Advances in Space Research 31(1): 51-61.

En L, Beard C, and Jaenisch R. 1993. Role for DNA methylation in genomic imprinting. Nature 366.6453: 362-365.

Feil R and Fraga MF. 2012. Epigenetics and the environment: emerging patterns and implications. Nature reviews Genetics 13(2): 97.

Ferl RJ, and Paul A-L. 2016. The effect of spaceflight on the gravity-sensing auxin gradient of roots: GFP reporter gene microscopy on orbit. Npj Microgravity 2: 15023.

Ferl RJ, Paul A-L. 2010. Lunar Plant Biology – A Review the Apollo Era. Astrobiology 10: 261-74.

Ferl RJ, Wheeler R, Levine HG, Paul A-L. 2002. Plants in Space. Curr Opin Plant Biol 5:258-263.

Finnegan EJ, Peacock WJ, and Dennis E. 1996. Reduced DNA methylation in Arabidopsis thaliana results in abnormal plant development. Proceedings of the National Academy of Sciences 93: 8449-8454

Hume S, Greenberg MVC, Feng S, Bernatavichute YV, and Jacobsen SE. 2013. Comprehensive analysis of silencing mutants reveals complex regulation of the Arabidopsis methylome. Cell 152(1): 352-364.

Jaenisch R and Bird A. 2003. Epigenetic regulation of gene expression: how the genome integrates intrinsic and environmental signals. Nature genetics 33(3s): 245.

54

Jia Y, Tian H, Li H, Yu Q, Friml J, and Ding Z .2015. The Arabidopsis thaliana elongator complex subunit 2 epigenetically affects root development. Journal of Experimental Botany 66(15): 4631-4642

Jones PA. 2012. Functions of DNA methylation: islands, start sites, gene bodies and beyond. Nature Reviews Genetics 13(7): 484-492.

Kankel MW, Ramsey DE, Stokes TL, Flowers SK, Haag JR, Jeddeloh JA, Riddle NC, Verbsky ML, and Richards EJ. 2003. Arabidopsis MET1 cytosine methyltransferase mutants. Genetics 163(3): 1109-1122.

Kanno T, Bucher E, Daxinger L, Huettel B, Böhmdorfer G, Gregor W, Kreil DP, Matzke M and Matzke, AJ. 2008. A structural-maintenance-of-chromosomes hinge domain–containing protein is required for RNA-directed DNA methylation. Nature genetics 40(5): 670-675.

Kwon T, Sparks JA, Nakashima J, Allen SN, Tang Y and Blancaflor EB. 2015. Transcriptional response of Arabidopsis seedlings during spaceflight reveals peroxidase and cell wall remodeling genes associated with root hair development. American Journal of Botany, 102(1): 21-35.

Labra M, Ghiani A, Citterio S, Sgorbati S, Sala F, Vannini C, Ruffini-Castiglione M and Bracale M. 2002. Analysis of cytosine methylation pattern in response to water deficit in pea root tips. Plant Biology 4(06): 694-699.

Law JA and Jacobsen SE. 2010. Establishing, maintaining and modifying DNA methylation patterns in plants and animals. Nature reviews Genetics 11(3): 204.

LeFrois CE, Zhou M, Amador DM, Sng N, Paul A-L, Ferl RJ. 2016. Enabling the Spaceflight Methylome: DNA Isolated from Plant Tissues Preserved in RNAlater™ is Suitable for Bisulfite PCR Assay of Genome Methylation. Gravitational and Space Research 4(2): 28-37.

Li T, Chang D, Xu H, Chen J, Su L, Guo Y, Chen Z, Wang Y, Wang L, Wang J and Fang X. 2015. Impact of a short-term exposure to spaceflight on the phenotype, genome, transcriptome and proteome of Escherichia coli. International Journal of Astrobiology, 14(3): 435-444.

Lister R, O'Malley RC, Tonti-Filippini J, Gregory BD, Berry CC, Millar AH, and Ecker JR. 2008. Highly integrated single-base resolution maps of the epigenome in Arabidopsis. Cell 133(3): 523-536.

Long L, Ou X, Liu J, Lin X, Sheng L and Liu B. 2009. The spaceflight environment can induce transpositional activation of multiple endogenous transposable elements in a genotype-dependent manner in rice. Journal of plant physiology 166(18): 2035-2045.

Mashinsky AL, and Nechitailo GS. 2000. Results and prospects of studying the gravitationally sensitive systems of plants under conditions of space flight. Cosmic Research 39(4):317-327.

55

Massa G, Newsham G, Hummerick M, Caro J, Stutte G, Morrow R, and Wheeler R. 2013. Preilimary species and media selection for the veggie space hardware. Gravitational and Space Research 1: 95-106

Matzke MA and Mosher RA. 2014. RNA-directed DNA methylation: an epigenetic pathway of increasing complexity. Nature Reviews Genetics. 15(6): 394-408.

Melanie C, Tyler JP, Pyle K, Millar DL, Sun Y, Yao J, Edelmann RE, and Kiss JZ. 2013. Transcriptome analyses of Arabidopsis thaliana seedlings grown in space: implications for gravity-responsive genes. Planta: 519-533.

Mohandas T, Sparkes RS, and Shapiro LJ. 1993. Reactivation of an inactive human X chromosome: evidence for X inactivation by DNA methylation. Science 211.4480: 393-396.

Ou X, Long L, Wu Y, Yu Y, Lin X, Qi X, and Liu B. 2010. Spaceflight-induced genetic and epigenetic changes in the rice (Oryza sativa L.) genome are independent of each other." Genome 53(7): 524-532.

Ou X, Long L, Zhang Y, Xue Y, Liu J, Lin X and Liu B. 2009. Spaceflight induces both transient and heritable alterations in DNA methylation and gene expression in rice (Oryza sativa L.). Mutation Research/Fundamental and Molecular Mechanisms of Mutagenesis 662(1): 44-53.

Paul A‐L, Amalfitano CE, Ferl RJ. 2012. Plant growth strategies are remodeled by spaceflight. BMC Plant Biology. 12:232.

Paul A-L, Popp MP, Gurley WB, Guy C, Norwood KL and Ferl RJ. 2005. Arabidopsis gene expression patterns are altered during spaceflight. Advances in Space Research 36:1175–1181.

Paul A-L, Zupanska AK, Schultz ER, Ferl RJ. 2013. Organ-specific remodeling of the Arabidopsis transcriptome in response to spaceflight. BMC Plant Biology. 13:112.

Pikaard C. 2013. Methylating the DNA of the most repressed: special access required. Molecular cell 49.6: 1021-1022.

Raul H, Benguria A, Lavan DA, Lopez-Vidiero I, Gasset G, Javier Medina F, Loon Van J, and Marco R. 2010. Spaceflight‐related suboptimal conditions can accentuate the altered gravity response of Drosophila transcriptome. Molecular ecology 19(9): 4255-4264.

Saze H, Scheid OM, and Paszkowski J. 2003. Maintenance of CpG methylation is essential for epigenetic inheritance during plant gametogenesis. Nature genetics, 34(1): 65-69.

Shi J, Lu W, and Sun Y (2014) Comparison of space flight and heavy ion radiation induced genomic/epigenomic mutations in rice (Oryza sativa). Life Sci Space Res 1: 74-79

56

Soppe WJ, Jasencakova Z, Houben A, Kakutani T, Meister A, Huang MS, Jacobsen SE, Schubert I, and Fransz PF. 2002. DNA methylation controls histone H3 lysine 9 methylation and heterochromatin assembly in Arabidopsis. The EMBO Journal 21(23): 6549-6559.

Teixeira F K and Colot V. 2009. Gene body DNA methylation in plants: a means to an end or an end to a means? The EMBO journal 28(8): 997-998.

Tomokazu K, and Berger F. 2014 Epigenetic reprogramming in plant sexual reproduction. Nature Reviews Genetics 15.9: 613-624.

Walkinshaw CH. 1971 Lunar Horticulture. HortScience. 6(1): 518.

Wang WS, Pan YJ, Zhao XQ, Dwivedi D, Zhu LH, Ali J, Fu BY, Li ZK. 2010. Drought-induced site-specific DNA methylation and its association with drought tolerance in rice (Oryza sativa L.). Journal of experimental botany 62(6): 1951-1960.

Wang Y, Yuan Y, Liu J, Su L, Chang D, Guo Y, Chen Z, Fang X, Wang J, Li T and Zhou L. 2014. Transcriptomic and proteomic responses of Serratia marcescens to spaceflight conditions involve large-scale changes in metabolic pathways. Advances in Space Research 53(7): 1108-1117.

Wang, Y, An C, Zhang X, Yao J, Zhang Y, Sun Y, Yu F, Amador D.M. and Mou Z. 2013. The Arabidopsis Elongator complex subunit2 epigenetically regulates plant immune responses. Plant Cell 25: 762-776.

Zilberman D, Gehring M, Tran RK, Ballinger T and Henikoff S. 2007. Genome-wide analysis of Arabidopsis thaliana DNA methylation uncovers an interdependence between methylation and transcription. Nature genetics 39(1): 61.

57

BIOGRAPHICAL SKETCH

Ever since grade school he had an interest and fascination with the natural sciences –

although during that time, he was mostly interested in collecting insects and reading about

dinosaurs. As an undergraduate, his mother worked towards degrees in both biology and

chemistry, and though these pursuits were interrupted when she left school to raise a family, she

imparted to me her appreciation for scientific scholarship. He developed an appreciation for

nature and an impulse to apply reason for the purposes of discovery. After high school he

enrolled in a small private university near his hometown in California, majoring in English with

an emphasis on creative writing. Through his science coursework, required as part of the

curriculum, he discovered that he preferred practicing science rather than writing about it.

He switched majors and began to pursue a Bachelor of Science in biology, subsequently

transferring to the University of Nebraska at Omaha (UNO). He became interested in pursuing

plant research after taking an introductory biology class for majors taught by a plant biologist. It

became evident that he would need substantial additional coursework, research experience, and

ultimately a graduate level degree, if he were to achieve his goal of becoming a productive

research scientist.

He chose biology over other scientific disciplines because of the rapid pace of progress

and remaining potential for discovery; though other disciplines continue to advance, it seems that

the basic mechanisms or principles of physics, mathematics and chemistry are more settled than

those of biology. The recent explosion in technological developments brought about by the

human genome project created a forefront of discovery that he wished to be a part of. Among his

interests were the interconnectedness of enzyme-mediated reactions, the “logic” of metabolic

regulation and the wide variety and utility of plant natural products – especially in

pharmaceutical applications. Aside from reading books and articles, his interests were developed

58

particularly during the two years of research in the laboratory of Dr. Schoenbeck as well as a

wonderfully taught course in plant physiology.

His first research project was the characterization of a “virescent-like” mutant of

Glechoma hederacea, so named for its delayed chloroplast development, and of interest for its

altered morphology and biochemistry. This work was performed under the mentorship of Dr.

Mark Schoenbeck and supported by his first undergraduate research grant (2013-2014),

sponsored through UNO. The identity of the mutant as G. hederacea was demonstrated using

inter-simple sequence repeat (ISSR) PCR analysis. The mutant was compared to several

wildtype accessions, which were propagated in the lab, greenhouse, and in field plots with

differing levels of sunlight. The analysis entailed comparisons of dry matter, pigmentation,

protein distribution, and metabolic activities; inheritance studies were attempted but

unsuccessful. With assistance from Dr. Roxanne Kellar, plastomes of wild type and mutants

were compared to identify candidate nucleotide polymorphisms that might be the basis of the

virescent-like lesion. Several polymorphisms were identified, but the site of interest remains to

be determined. A continuation of this work formed the basis for his second UNO undergraduate

grant (2014-2015), focusing on the carbon and nitrogen metabolism in the “virescent-like”

mutant and altered source-sink relationships between young and mature tissues.

Additionally, during the Fall semester of 2014 he did an independent study with Dr.

Schoenbeck for course credit studying the phenomenon of light-dependent suppression of nitrate

reductase in Ipomoea hederacea (morning glory). While light is most often reported as

enhancing nitrate-dependent nitrate reductase activity in plants, findings in the lab of Dr.

Schoenbeck report that light actually suppresses nitrate reductase activity in I. hederacea

seedling tissues and those of other non-model plants. Previous investigations into the suppression

59

of nitrate reductase activity in I. hederacea seedlings were performed on young seedlings three

to five days old. His project’s main goal was to investigate to what degree the light-dependent

regulation of nitrate reductase matures and changes as the season progresses in both cultivated

and wild grown I. hederacea plants. The impact of other factors – for example the metabolites

sucrose and glutamine – on nitrate reductase activity were also examined.

During his time conducting research he learned a number of technical skills such as PCR,

DNA sequencing, enzyme assays, gel electrophoresis, protein quantification, and tissue culture.

Apart from these technical skills he also learned how to work independently in a laboratory, i.e.

the proper ethics, behavior and safety protocol expected from those who work in a laboratory

environment. Perhaps most importantly, he learned how to construct a good experiment. Asking

reasonable biological questions and constructing a method by which the question may be

answered had been imparted to him since the beginnings of his training as a research scientist.