Title: SsaA, a novel class of transcriptional regulator, controls ...

1 / 34

Title: SsaA, a novel class of transcriptional regulator, controls sansanmycin 1

production in Streptomyces sp. SS involving a feedback mechanism 2

3

Running title: SsaA autoregulates sansanmycin biosynthesis 4

5

Qinglian Li*, Lifei Wang*, Yunying Xie, Songmei Wang, Ruxian Chen, Bin Hong# 6

7

Key Laboratory of Biotechnology of Antibiotics of Ministry of Health, Institute of 8

Medicinal Biotechnology, Chinese Academy of Medical Sciences and Peking Union 9

Medical College, Beijing, China 10

11

*These authors equally contributed to this study. 12

#To whom correspondence should be addressed. 13

Prof. & Dr. Bin Hong, Institute of Medicinal Biotechnology, Chinese Academy of 14

Medical Sciences & Peking Union Medical College, No.1 Tiantan Xili, Beijing 100050, 15

China 16

Tel: +86 10 63028003 17

Fax: +86 10 63017302 18

Email: [email protected], [email protected] 19

20

21

22

Copyright © 2013, American Society for Microbiology. All Rights Reserved.J. Bacteriol. doi:10.1128/JB.00054-13 JB Accepts, published online ahead of print on 8 March 2013

on February 12, 2018 by guest

http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

2 / 34

Abstract 23

Sansanmycins, produced by Streptomyces sp. SS, are uridyl peptide antibiotics with 24

activities against Pseudomonas aeruginosa and multidrug-resistant Mycobacterium 25

tuberculosis. In this work, the biosynthetic gene cluster of sansanmycins was identified, 26

comprised of 25 ORFs showing considerable amino acid sequence identity to those of the 27

pacidamycin and napsamycin gene cluster. SsaA, the archetype of a novel class of 28

transcriptional regulators, was characterized in the sansanmycin gene cluster, with an 29

N-terminal fork-head-associated (FHA) domain and a C-terminal LuxR-type 30

helix-turn-helix (HTH) motif. The disruption of ssaA abolished sansanmycin production 31

as well as the expression of the structural genes for sansanmycin biosynthesis, indicating 32

that SsaA is a pivotal activator for sansanmycin biosynthesis. SsaA was proved to directly 33

bind several putative promoter regions of biosynthetic genes, and comparison of 34

sequences of the binding sites allowed the identification of a consensus SsaA-binding 35

sequence, GTMCTGACAN2TGTCAGKAC. SsaA-DNA binding activities were inhibited 36

by sansanmycin A and H in a concentration-dependent manner. Furthermore, 37

sansanmycin A and H were found to directly interact with SsaA. These results indicated 38

that SsaA may strictly control the production of sansanmycins at transcriptional level in a 39

feedback regulatory mechanism by sensing the accumulation of the end-products. As the 40

first characterized regulator of uridyl peptide antibiotic biosynthesis, the understanding of 41

this autoregulatory process involved in sansanmycin biosynthesis will likely provide an 42

effective strategy for rational improvements in the yields of these uridyl peptide 43

antibiotics. 44

45


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

3 / 34

Introduction 46

Sansanmycins, isolated from Streptomyces sp. SS (1, 2), are members of a uridyl peptide 47

antibiotic family including closely related pacidamycins (3), napsamycins (4) and 48

mureidomycins (5). These antibiotics share a common structure with a 3’-deoxyuridine 49

nucleoside attached to an Nβ-methyl 2,3-diaminobutyric acid (DABA) residue of a 50

pseudo tetra/pentapeptide backbone via an exocyclic enamide. In addition to DABA, the 51

pseudo peptides comprise of other non-proteinogenic amino acids such as meta-Tyr 52

(m-Tyr) and derivatives of tetradehydro-3-isoquinoline carboxylic acid (TIC), and 53

proteinogenic amino acids Gly, Ala, Met, Trp and Phe. Particularly, the tetrapeptides of 54

some sansanmycins incorporate Leu to the α-amino group of DABA which is absent in 55

other known uridyl peptide antibiotics (Fig. 1). Sansanmycins were reported to exert 56

antibacterial activity against the highly refractory pathogen Pseudomonas aeruginosa, 57

and more interesting, Mycobacterium tuberculosis H37Rv and multidrug-resistant M. 58

tuberculosis strains (2). As the increasing emergence of multidrug resistant tuberculosis 59

has become one of the biggest challenges to human health worldwide, there is an urgent 60

need to develop novel anti-infective drugs with no cross-resistance to current clinically 61

used antibiotics. Sansanmycins and other uridyl peptide antibiotics are of interest as they 62

are inhibitors of translocase MraY (also known as translocase I), the critical enzyme 63

involved in bacterial cell wall biosynthesis, which is a clinically unexploited target of 64

antibiotics (6). Elucidation of the biosynthetic and regulatory mechanism for these uridyl 65

peptide antibiotics in their producing strains will therefore facilitate the enhancement of 66

production level and the generation of new bioactive uridyl peptide derivatives by genetic 67

engineering and combinatorial biosynthesis. 68


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

4 / 34

Recently, the biosynthetic gene clusters for pacidamycins (7, 8) and napsamycins (9) 69

were identified and characterized, suggesting a general biosynthetic pathway to the uridyl 70

peptide antibiotics. Based on the bioinformatic analysis and in vivo and in vitro 71

experiments, the assembly of pacidamycin is catalysed by nonribosomal peptide 72

synthetases (NRPSs) with highly dissociated modules (7, 10). The clusters also contain 73

genes responsible for the biosynthesis of the DABA non-proteinogenic amino acid, the 74

modification of uridine nucleoside, the export of the antibiotic and other tailoring 75

reactions (7-9). Generally, at least one transcriptional regulatory gene lies within an 76

antibiotic biosynthetic gene cluster, controlling the respective antibiotic biosynthesis. 77

However, early bioinformatic analysis did not propose a candidate of regulator for 78

pacidamycin biosynthesis (7, 8). In napsamycin gene cluster, npsA was deduced to 79

encode a putative regulator homologous to ArsR-type transcriptional repressors (9), but 80

no biological experiments were conducted to verify its involvement in the production of 81

napsamycins. 82

Streptomycetes are well known for their ability to produce various secondary 83

metabolites, including clinically used antibiotics, antitumor agents, immunosuppressants, 84

etc. The control of secondary metabolite production is quite complicated, involving 85

multiple levels of intertwined regulation in response to physiological and environmental 86

condition alterations (11, 12). Typically the ultimate regulator of antibiotic production is 87

a pathway-specific transcriptional regulator situated in the respective biosynthetic cluster, 88

controlling the transcription level of the corresponding biosynthetic genes. Most 89

pathway-specific regulators belong to the Streptomyces antibiotic regulatory protein 90

(SARP) family, containing a DNA binding domain (DBD) close to the N-terminus and a 91


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

5 / 34

bacterial transcriptional activation domain (BTAD) (13). The well studied regulators, e.g., 92

ActII-ORF4, CdaR and RedD in S. coelicolor controlling actinorhodin, the 93

calcium-dependent-antibiotic (CDA) and undecylprodigiosin production, respectively, 94

belong to this family. Streptomyces LAL (large ATP-binding members of the LuxR 95

family) regulators are also frequent in some antibiotic gene clusters, including PikD from 96

the pikromycin cluster of S. venezuelae (14) and multiple LAL homologues from the 97

nystatin cluster of S. noursei (15). Other classes of transcriptional regulators have also 98

been reported recently. PimM in S. natalensis, which is highly conserved among all 99

known polyene biosynthesis gene clusters (16), contains an N-terminal PAS sensor 100

domain and a C-terminal LuxR-type helix-turn-helix (HTH) domain for DNA binding 101

(17). Atypical response regulators (ARRs), with N-terminal REC domain and a winged 102

HTH motif in the C-terminal domain, are involved in the pathway-specific regulation of 103

secondary metabolite production (18). The diversity of the pathway-specific regulators 104

may reflect the variety of regulatory mechanism in the biosynthesis of different 105

secondary metabolites. JadR1, an ARR, was recently characterized to control jadomycin 106

biosynthetic gene expression in an autoregulatory feedback mechanism by binding of the 107

end product, which is the first example of the autoregulation of antibiotic biosynthesis by 108

an end product(s) (19). RedZ for undecylprodigiosin (19) and Aur1P for auricin (20) 109

were found to be modulated in a similar way, implying that end-product-mediated control 110

of antibiotic pathway-specific ARRs may be widespread. However, whether other class 111

of pathway-specific regulators adopt a similar mechanism remains to be elucidated. 112

In this work, we report the biosynthetic gene cluster of uridyl peptide antibiotic 113

sansanmycins. The structure homology search of SsaA, the orthologue of PacA and 114


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

6 / 34

NpsM, revealed that it contained HTH DNA-binding motif at its C-terminus. We further 115

provide genetic and biochemical evidence confirming that SsaA is a novel class of 116

pathway-specific transcriptional activator of sansanmycin biosynthesis, and that the end 117

products can bind to and change the activity of SsaA to autoregulate the antibiotic 118

production. 119

120

Materials and Methods 121

Strains, media and growth conditions 122

Streptomyces sp. SS (wild-type strain) and its derivatives were grown at 28 oC on S5 agar 123

(21) for sporulation, on mannitol soya flour (MS) agar (22) for conjugation, in the liquid 124

fermentation medium (1) with addition of 0.1% tyrosine for sansanmycins production, in 125

liquid phage medium (23) for isolation of genomic DNA. Escherichia coli DH5α (24) 126

was used as host for cloning purposes. E. coli ET12567 (pUZ8002) (25) was used to 127

transfer DNA into Streptomyces from E. coli by conjugation. E. coli XL1-Blue MR 128

(Stratagene, CA, USA) was used as the host strain for the construction of Streptomyces sp. 129

SS genomic DNA library. E. coli BW25113/pIJ790 was used as the host for 130

Red/ET-mediated recombination (26). E. coli BL21(DE3) (Novagen, Madison, USA) 131

was used as the host strain to express SsaA protein. They were grown at 37 oC in 132

Luria-Bertani medium (LB). For protein expression in E. coli, the strain was grown in 133

liquid ZYM-5052 medium (27). P. aeruginosa 11, the test organism for the antibacterial 134

bioassay of sansanmycins (2), was grown on F403 agar (21). When antibiotic selection of 135

bacteria was needed, strains were incubated with 50 μg ml-1 apramycin (Am), 100 μg ml-1 136

ampicillin (Ap), 50 μg ml-1 kanamycin (Km) and 25 μg ml-1 chloramphenicol (Cm), 50 137


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

7 / 34

μg ml-1 streptomycin (Strep). Strains used and constructed in this study are listed in Table 138

1. 139

140

DNA manipulation 141

Routine DNA manipulations with E. coli were carried out as described by Sambrook and 142

Russell (24). Recombinant DNA techniques in Streptomyces species were performed as 143

described by Kieser et al. (22). The plasmids used and constructed in this study are listed 144

in Table 1. The primers for PCR amplification are shown in Table S1. 145

146

Construction and screening of the genomic library 147

Chromosomal DNA isolated from Streptomyces sp. SS was partially digested with 148

Sau3AI to give 40 to 50 kb DNA fragments. These fragments were dephosphorylated by 149

calf intestinal alkaline phosphatase (Takara, Tokyo, Japan) and then ligated into BamHI 150

and HpaI digested pOJ446. The ligation products were packaged with Gigapack III XL 151

Gold packaging extract (Stratagene) following the manufacture’s instructions, and the 152

resulting recombinant phages were used to transfect E. coli XL1-Blue MR. 153

Approximately 6,000 colonies were screened by colony hybridization with alkaline 154

phosphatase-labeled ssaQ and ssaF probes which were amplified from Streptomyces sp. 155

SS genomic DNA and labeled using Gene Images AlkPhos Direct Labelling and 156

Detection System Kit (GE Healthcare, Sweden) according to the manufacture's 157

instructions. Cosmid 13R-1 was isolated from a positive colony for subsequent complete 158

sequencing using the shotgun method performed by Majorbio (Shanghai, China). 159

160


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

8 / 34

Construction and complementation of Streptomyces sp. SS ssaA mutant 161

Gene disruptions were carried out by PCR targeting method (26). Detailed methods for 162

construction of Streptomyces sp. SS ssaA mutant are provided in the supplemental 163

material. The resulted mutant strain was designated SS/AKO. A 747 bp DNA fragment 164

containing the complete ssaA coding region was amplified using ssaA-pET16b-F and 165

ssaA-pICL-R (Table S1) as primers, then cloned into the NdeI and BamHI sites of pL646 166

(28), under the control of a strong constitutive promoter ermE*p. The resulting 167

expression vector pL-ssaA was introduced into SS/AKO by conjugation to give the 168

complemented strain. 169

170

Analysis of sansanmycin production 171

Fermentation, isolation and high-pressure liquid chromatography (HPLC) analysis of 172

sansanmycins were performed mostly following Xie et al (1). Detailed methods are 173

provided in the supplemental material. 174

175

Gene expression analysis by quantitative RT-PCR 176

Total RNAs were isolated from different strains after incubation in fermentation medium 177

for 48 h using PureYieldTM RNA Midiprep System (Promega) according to the 178

manufacture's instructions. Samples were treated with DNase I (Promega) to eliminate 179

the chromosomal DNA. The quantity and quality of RNA samples was assessed by 180

measuring the A260 and A280 of the samples (22). The first-strand cDNA synthesis was 181

performed with Turbo Script 1st-strand cDNA Synthesis Kit (Yuanpinghao, Beijng, 182

China) using random primers following the manufacture's instructions. Oligonucleotides 183


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

9 / 34

were designed to amplify fragments of about 80-150 bp, and the primers used are listed in 184

Table S1. Quantitative real-time PCR was performed as described previously (21). Three 185

PCR replicates were performed for each transcript and the relative mRNA level of target 186

genes was normalized to the level of hrdB according to Pfaffl's method (29). 187

188

Expression and purification of His10-tagged SsaA 189

Expression and purification of His10-tagged SsaA were performed mostly following 190

Wang et al (21), with detailed protocols provided in the supplemental material. Protein 191

purity was determined by coomassie brilliant blue staining after SDS-PAGE on 12% 192

polyacrylamide gel. The concentration of the purified SsaA was determined by the 193

bicinchoninic acid (BCA) assay (Applygen, Beijing, China) using bovine serum albumin 194

(BSA) as a standard. 195

196

Electrophoretic mobility shift assays (EMSAs) 197

EMSAs were performed mostly following Wang et al (21), with detailed protocols 198

provided in the supplemental material. 199

200

DNase I footprinting 201

DNA fragments used in DNase I footprinting were generated by PCR using the primers 202

listed in Table S1. All these DNA fragments were cloned into pGEM-T (Promega) and 203

then authenticated by sequencing. Probes were generated by PCR with the universal T7 204

and SP6 promoter primers, one of them labeled with 5’-Alexa-647 (Invitrogen, CA, 205

USA). The PCR products were purified by agarose gel electrophoresis and quantified 206


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

10 / 34

with a NanoDrop 2000 spectrophotometer (Thermo Scientific). His10-SsaA (2.67 μM) 207

was incubated with labeled DNA fragment (50 ng) in a total volume of 90 μl at 25 oC for 208

20 min. Following several optimization experiments, DNase I digestions was performed 209

with 0.1 U DNase I (grade I, Roche, Mannheim, Germany) at 30 oC for 60 s. The 210

reactions were stopped by adding of 10 μl of 500 mM EDTA (pH 8.0) and then heating at 211

75 oC for 10 min. After phenol-chloroform extraction and ethanol precipitation, digested 212

DNA was redissolved in 20 μl of Sample Loading Solution (containing 0.3 μl of DNA 213

size standard marker 600, Beckman Coulter, CA, USA) and loaded in a GenomeLab 214

GeXP Genetic Analysis System (Beckman Coulter). The results were analyzed with 215

GenomeLab eXpress Profiler program (Beckman Coulter). 216

217

Surface plasmon resonance (SPR) analysis 218

For SsaA-sansanmycins binding experiments, SPR measurements were performed on a 219

BIAcore T100 System (GE Healthcare) in PBS buffer (pH 7.4, 0.05% (V/V) surfactant 220

P20) with a flow rate of 30 μl min-1 at 25 oC. The His10-tagged SsaA was diluted to 50 μg 221

ml-1 in 10 mM sodium acetate (pH 5.5) and immobilized on a CM5 sensor chip by amino 222

coupling kit (GE Healthcare) at densities of 8,500 response units (RU). SS-A and SS-H 223

were diluted in the running buffer and injected over the sensor chip for 3 min. 224

Regeneration of the surface was performed with 5 mM NaOH for 28 s for SS-A and 0.5 225

mM NaOH for 16 s for SS-H, followed by washes for 5 min. The data fitting for the 226

binding model was analyzed using BiaEvaluation software (GE Healthcare). 227

In case of SsaA-promoter binding experiments, SPR measurements were performed in 228

HBS buffer (10 mM Hepes, 150 mM NaCl, 3 mM EDTA, 0.05% surfactant P20, pH 7.4) 229


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

11 / 34

with a flow rate of 50 μl min-1 at 25 oC. The biotinylated ssaC-Dp-3 fragment was diluted 230

to 4 nM and immobilized on SA sensor surface at densities of 200 response units (RU). A 231

series of samples containing a fixed amount of SsaA in the presence of an increasing 232

concentrations of SS-A was injected over the surface for 150 s. Regeneration of the SA 233

sensor surface was performed with 2 M NaCl for 120 s, followed by washes for 180 s. 234

235

Bioinformatic analysis 236

The sequence data of the ssa cluster have been submitted to the GenBank databases under 237

accession number KC188778. Putative protein-coding sequences were predicted using 238

the Glimmer version 3.0 (30), and gene functional annotation was based on BLASTP 239

results determined with the KEGG, COG, Swiss-Port, NT and NR databases. The 240

program HHpred was used for structural homology search for unknown proteins 241

(Homology detection & structure prediction by HMM-HMM comparison, 242

http://toolkit.tuebingen.mpg.de/hhpred/). The program WebLogo was used for the 243

identification of the consensus binding site (http://weblogo.berkeley.edu/logo.cgi). 244

DNA-pattern of RSA-tools (31) (http://rsat.ulb.ac.be/rsat/) was used to search a pattern 245

(string description) within a DNA sequence. 246

247

Results 248

Identification and analysis of the sansanmycin gene cluster (ssa) 249

Sansanmycins share a common structural scaffold with pacidamycins and napsamycins 250

(Fig. 1), therefore we initially attempted to locate the sansanmycin gene cluster from the 251

producer Streptomyces sp. SS through genome mining by using pacidamycin biosynthetic 252


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

12 / 34

genes as probes. Nucleotide sequencing of the Streptomyces sp. SS genome was 253

undertaken by using an illumina/Hiseq 2000 sequencer (32). The size of Streptomyces sp. 254

SS draft genome was predicted to be approximately 8.1 Mb, distributing over 69 255

scaffolds containing 87 contigs (GenBank accession no. AKXV00000000). For the local 256

BLASTP, each of the ORFs of the pacidamycin gene culster was used as a probe to query 257

against the database consisting of all the scaffolds. The bioinformatic search identified 14 258

ORFs (designated as SsaH-N, SsaP-T and SsaX-Y) on scaffold 7 and 10 ORFs 259

(designated as SsaA-G, SsaO, SsaV) on scaffold 36 putatively responsible for 260

sansanmycin biosynthesis (Fig. S1). In order to obtain the complete ssa cluster, we 261

subsequently constructed a cosmid library of genomic DNA from Streptomyces sp. SS. 262

The alkaline phosphatase-labeled fragments of coding sequence of ssaQ on scaffold 7 263

and that of ssaF on scaffold 36 were used as probes to screen the library. Of ~ 6,000 264

cosmids, five gave positive signals (Fig. S1). Three cosmids were positive for both 265

probes and cosmid 13R-1 was selected for complete sequencing via the shotgun approach. 266

Assembly of the sequences of scaffold 7, scaffold 36 and cosmid 13R-1 resulted in about 267

440 kb contiguous sequence, of which a 33.1 kb segment encoding 25 ORFs is assigned 268

to the ssa cluster (Fig. 2). ssaH and ssaW are predicted to be the left and right boundary 269

of the ssa cluster respectively based on the BLASTP analysis. The deduced function of 270

the ORFs within the ssa cluster and five ORFs upstream or downstream of the ssa cluster 271

was presented in Table S2. Interestingly, the upstream and coding sequence of ssaW is 272

almost identical to that of ssaU (99% identity between 23677~25320 bp and 273

36823~38465 bp in the ssa cluster). 274


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

13 / 34

Determined by BLASTP analysis, the ORFs of the ssa cluster show high amino acid 275

sequence similarity to those of the pacidamycin (7, 8) and napsamycin gene cluster (9), 276

and a gene cluster found in S. roseosporus NRRL 15998, a known daptomycin producer 277

(7). The genetic organization of ssa cluster resembles that of napsamycin gene cluster and 278

the similar cluster in S. roseosporus NRRL 15998, while in pacidamycin gene cluster the 279

pacA-G is located in the upstream of pacI-U. The function of most of the genes of the 280

pacidamycin gene cluster has been well studied, especially those responsible for the 281

peptide scaffold assembly, and the biosynthetic pathway has been proposed based on the 282

in vivo and in vitro experiments (7, 10). All the defined pacidamycin biosynthetic genes 283

including uninterrupted 22 genes (pacA-V) and a digene cassette (pacW and pacX) 284

identified elsewhere have a homologue in the proposed ssa cluster, with only one ORF 285

(ssaY) showing homology to hypothetical genes with no known function in the 286

biosynthesis of a uridyl peptide compound. 287

288

SsaA is a putative pathway-specific transcriptional regulator 289

For the several ORFs with no information on the putative functions in sansanmycin 290

biosynthesis, structural homology search was performed using the online program 291

HHpred (33). Similar to PacA (10), SsaA was predicted to contain an N-terminal 292

fork-head-associated (FHA) domain and a C-terminal helix-turn-helix (HTH) DNA 293

binding domain (DBD) (Fig. 3A). The FHA domain of SsaA displays the 11-stranded 294

β-sandwich seen in other eukaryotic or prokaryotic FHA domains (Fig. 3B), which 295

mediates the protein-protein interaction with threonine-phosphorylated peptides in a 296

sequence-specific manner (34, 35). The alignment of FHA domains of orthologues of 297


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

14 / 34

SsaA and the other 4 closest FHA structural neighbors shows overall homology, but the 298

well-known amino acids important for the binding of phosphothreonine are not conserved 299

in SsaA orthologues. The DBD domain of SsaA displays the domain architechture of the 300

tetra-helical version of HTH, with the α3 as the recognition helix (Fig. 3C). The closest 301

DBD structural neighbors defined in HHpred were LuxR-family of transcription factors, 302

whereas the orthologues of SsaA have longer coils between the helices. 303

To investigate the contribution of ssaA to the regulation of sansanmycin biosynthesis, 304

the coding region of ssaA was cloned into a pSET152-derived expression plasmid pL646 305

(28), under the control of a strong constitutive promoter ermE*p, to give pL-ssaA. The 306

plasmid was introduced into the wild-type strain by conjugation and the resulted ssaA 307

overexpression strain was designated SS/pL-ssaA. The antibacterial bioassay against P. 308

aeruginosa showed that the overexpression of ssaA increased sansanmycin production in 309

SS/pL-ssaA (Fig. 4A), which was further confirmed by HPLC analysis (Fig. 4B). The 310

presence of an extra copy of ssaA under ermE*p in the chromosome led to an about 100% 311

increase in the production of sansanmycin A (SS-A) and sansanmycin H (SS-H) in 312

comparison to that in the wild-type strain containing pSET152. The results suggested that 313

ssaA is a positive regulator of sansanmycin biosynthesis. 314

315

Disruption of ssaA completely abolished sansanmycin production 316

To confirm the role of ssaA in sansanmycin biosynthesis, a part of coding region of ssaA 317

(547 bp) was replaced with a streptomycin-resistant gene aadA to create the ssaA 318

disrupted strain SS/AKO (Fig. S2A) according to standard methods (26). The disruption 319

of the intended target was confirmed by PCR with primers priming about 100 bp outside 320


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

15 / 34

the region affected by homologous recombination (Fig. S2B), and further confirmed by 321

Southern blotting using the streptomycin-resistant gene aadA as the probe (Fig. S2C). 322

Antibacterial activity results (Fig. 5A) and HPLC analysis (Fig. 5B) showed that 323

disruption of ssaA totally blocked sansanmycin production. When pL-ssaA was 324

introduced into the SS/AKO mutant, the complemented transconjugant was found to 325

resume sansanmycin production (Fig. 5A) at an early stage and at a higher level than the 326

wild-type strain, which might be ascribed to the usage of the constitutive and strong 327

promoter. These results demonstrated that the gene cluster identified is indeed 328

responsible for sansanmycin biosynthesis, and that ssaA is a pivotal positive regulator of 329

sansanmycin biosynthesis. 330

331

Disruption of ssaA decreased the transcription of biosynthetic genes 332

To examine further the involvement of ssaA gene in transcription regulation of ssa cluster, 333

the gene expression analysis was conducted using quantitative RT-PCR. The relative 334

level of the transcripts of five structural genes, ssaH, ssaN, ssaP, ssaX and ssaC, located 335

on the possible cluster boundary or as one of the two divergent ORFs, were analyzed 336

together with ssaA. Total RNAs from the wild-type strain, ssaA knockout mutant 337

SS/AKO and the complemented strain SS/AKO/pL-ssaA were isolated under which 338

condition the wild-type strain commenced sansanmycin production at about 48 h (Fig. 339

5A). As expected, the transcripts of ssaA were completely undetectable in the knockout 340

mutant while readily detectable in the wild-type strain and the complemented strain. The 341

results showed that the transcripts of the structural genes tested were almost undetectable 342

in the knockout strain. In addition, the transcripts in the complemented strain were 343


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

16 / 34

restored to a higher level than that in the wild-type strain (Fig. 5C), consistent to the 344

sansanmycin production level (Fig. 5A). These results indicated that ssaA could 345

positively regulate the sansanmycin biosynthesis by controlling the expression of the 346

structural genes of ssa cluster. 347

348

SsaA bound to the promoter regions of the ssa cluster 349

To be a positive regulator of sansanmycin biosynthesis, SsaA was speculated to promote 350

the sansanmycin production by binding at the promoter regions of biosynthetic genes and 351

thereby activating their transcription. Therefore, a series of EMSAs were performed to 352

verify whether SsaA indeed interacts with the promoter regions. SsaA was overexpressed 353

in E. coli BL21 (DE3) as His10-tagged protein with a predicted molecular mass of 28,380 354

Da, and was purified to a purity of >90% by nickel affinity chromatography (Fig. S3A). 355

Twelve DNA fragments of intergenic regions containing possible promoters of interest 356

were chosen as probes (Fig. 2), including ssaHp, ssaKp, ssaN-Pp, ssaQp, ssaX-Yp, 357

ssaU-A-1p, ssaU-A-2p, ssaU-A-3p, ssaBp, ssaC-Dp, ssaVp and ssaWp (long intergenic 358

region between the divergent ssaU and ssaA was separated into three overlapped 359

fragments). The EMSA results showed that the purified His10-tagged SsaA bound to the 360

divergent intergenic region fragments ssaN-Pp, ssaU-A-1p, ssaU-A-2p and ssaC-Dp, and 361

upstream region fragments of two designated boundary genes, ssaH and ssaW (Fig. 6), 362

but did not bind to the other six fragments detected (Fig. S3B), suggesting that most of 363

the sansanmycin biosynthetic genes were transcribed as an operon. The bindings were 364

enhanced by increasing the amount of SsaA (up to 1.75 μM). Shifting of the probes was 365

decreased when the unlabeled specific competitor DNA fragments were added in excess 366


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

17 / 34

to binding reactions. Notably, only a single retarded band was observed for ssaHp, 367

ssaU-A-1p, ssaU-A-2p and ssaC-Dp probes with all the concentrations of SsaA tested, 368

whereas a second retarded band was observed for ssaN-Pp probe with higher 369

concentrations of SsaA (0.7, 1.4 and 1.75 μM), suggesting the presence of two binding 370

sites for SsaA in this region. To restrict the binding regions to shorter segments, several 371

subfragments were generated by PCR for ssaN-Pp, ssaC-Dp, ssaU-A-1p and ssaU-A-2p. 372

The results showed that two subfragments within ssaN-Pp, subfragment 3 within 373

ssaC-Dp and subfragment B, C and E within ssaU-Ap were shifted by SsaA respectively 374

(Fig. S3C). Specific binding of SsaA to several promoter regions of the ssa cluster in 375

vitro, together with the results of overexpression and disruption of ssaA, indicated that 376

SsaA controlled sansanmycin biosynthesis by directly binding to the promoter regions of 377

biosynthetic genes. 378

379

Identification of SsaA binding sites in ssa promoter regions 380

To identify the specific binding sites of SsaA in ssa promoter regions, the promoter 381

region fragments shown to be retarded in EMSAs (ssaHp, ssaC-Dp, ssaN-Pp, ssaU-Ap-E) 382

were studied by DNase I footprinting analysis. Footprinting experiments were performed 383

on both the coding strand and the complementary strand of the DNA fragments (Fig. 7A 384

and S4). 385

Footprinting analysis of the ssaHp region revealed a 31-nucleotide protection in the 386

coding strand (positions -135 to -105 bp relative to the translation start site of ssaH). In 387

the complementary strand, the protected sequence was 13-nucleotide long, at positions 388

-118 to -106 bp. These two protected regions overlapped by 12 nucleotides (Fig. S4A). 389


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

18 / 34

Results of the analysis of the ssaC-Dp region revealed that SsaA protected a region of 390

28 nucleotides from -238 to -211 bp relative to the ssaD translation start site in the coding 391

strand. In the complementary strand, SsaA protected a 21-bp sequence, located at 392

nucleotide positions -228 to -208 bp relative to the ssaD translation start site (Fig. S4B). 393

In the case of ssaU-Ap-E fragment, the footprint on the coding strand covered a region 394

of 25 nucleotides from -411 to -387 bp relative to the ssaU translation start site. A 395

16-nucleotide footprint of SsaA binding at the complementary strand was obtained, 396

spanning from positions -385 to -370 bp relative to the ssaU translation start site. The two 397

protected regions were not overlapped at all (Fig. S4C). 398

Footprinting analysis with the ssaN-Pp region revealed two protected areas in each 399

strand, in accordance with the appearance of two retarded bands in EMSA experiments. 400

In the coding strand, SsaA protected two regions stretching from positions -320 to -295 401

bp and from -193 to -173 bp with respective to the ssaP translation start site. In the 402

complementary strand, two protected regions stretching from positions -286 to -271 bp 403

and from -175 to -156 bp relative to the ssaP translation start site were observed (Fig. 404

7A). 405

It is interesting to note that the SsaA footprints on the coding strand are not 406

accompanied by totally equivalent footprints on the complementary strand for all the four 407

promoter regions detected, but by aligning the five sequences within the protected 408

regions of both strands and the homologous sequence in ssaWp, an SsaA consensus 409

binding sequence of GTMCTGACAN2TGTCAGKAC (where M represents A or C, and 410

K is G or T) was identified (Fig. 7B), which consisted of two 9-bp inverted repeats (IRs) 411


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

19 / 34

separated by a 2-bp linker. A sequence logo (36) that depicts the binding sites is shown in 412

Fig. 7B. 413

To validate the identified SsaA consensus binding site, we designed three duplexes: 414

one containing the canonical binding site (GTCCTGACAGCTGTCAGGAC, D1), a 415

second one in which CTGAC of one of IRs was replaced by ATTCA 416

(GTCATTCAAGCTGTCAGGAC, D2), and the third one with GTCAG of one of the IRs 417

deleted (GTCCTGACAGCT-----GAC, D3). We examined the binding of the SsaA to 418

these three duplexes in EMSA experiments. The results showed that SsaA only interacts 419

with the D1 duplex (Fig. 7C). These results validated the identified SsaA consensus 420

binding site, and implied that two IRs are both important for the binding activity of SsaA. 421

422

Sansanmycins modulate the DNA binding activity of SsaA by interacting with SsaA 423

To test whether the sansanmycin end products have effect on the DNA binding activity of 424

SsaA, EMSAs were performed using the promoter probes ssaC-Dp and ssaU-A-1p, 425

respectively, in the presence of different amounts of SS-A or SS-H (Fig. 8). The results 426

showed that SS-A inhibited the band-shifting of ssaC-Dp and ssaU-A-1p caused by SsaA 427

in a concentration-dependent manner (Fig. 8A), while SS-H did it in a similar manner 428

(Fig. 8B). These results were further confirmed by SPR analysis, as shown in Fig. 8C, a 429

concentration-dependent inhibition of SsaA binding to ssaC-Dp-3 fragment immobilized 430

on an SA sensor chip was readily observed when the amount of SS-A was increased. All 431

these results suggested that sansanmycins could modulate the binding activity of SsaA for 432

its target DNA. 433


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

20 / 34

To determine whether sansanmycins modulate the DNA binding activity of SsaA 434

through direct interaction with SsaA, SPR experiments were conducted using a CM5 435

sensor chip. Over a concentration range of 3.125 to 200 μM SS-A, SPR sensorgrams 436

showed an increasing binding of SS-A to the immobilized SsaA (Fig. 8D). A similar 437

result was obtained for the SPR analysis of the interaction of SS-H with immobilized 438

SsaA (Fig. 8E). The best fittings for both SS-A and SS-H were obtained with the 439

two-stage reaction model yielding a KD value of 318.1 μM and 781.7 μM for SS-A and 440

SS-H, respectively, suggesting that the binding of a first molecule allows, by inducing a 441

conformational change, the binding of a second molecule. 442

443

Discussion 444

The sansanmycin biosynthetic gene cluster was identified in Streptomyces sp. SS by a 445

combination of genome mining approach and conventional probing and cosmid 446

sequencing. Consistent with the high similarity of the structures of sansanmycins with 447

that of pacidamycins and napsamycins, the three clusters share the vast majority of 448

homologues (ssaA-V). The ssa and nps cluster present an almost same genetic 449

organization, except for several unidentified small ORFs. They both contain the 450

homologue of pacX responsible for the synthesis of m-Tyr in the pseudopeptide, which 451

was identified elsewhere in a pacWX digene cassette in S. coeruleorubidus NRRL 18370 452

(10). However, the homologue of NpsU, responsible for the reduced uracil moiety in 453

napsamycin (9), was not found in ssa and pac clusters. Interestingly, ssa cluster contains 454

an extra ORF (SsaW) at the right boundary of the cluster. SsaW is predicted to encode a 455

freestanding A domain of NRPS, showing 74% identity to PacU and 77% identity to 456


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

21 / 34

PacW from S. coeruleorubidus NRRL 18370. PacU was demonstrated to specifically 457

activate the N-terminal Ala found in pacidamycin D/S (7) and PacW to activate the 458

N-terminal m-Tyr found in pacidamycin 4/5/5T (10). But the SsaW matches almost 459

perfectly with the amino acid sequence of SsaU (only one substitution of Lys to Arg), 460

suggesting that SsaW is the early duplicate of SsaU in the cluster, viable for the evolution 461

to incorporate a new kind of amino acid. Different from the nps cluster which has an 462

ArsR-type regulator around the cluster boundary, there is no homologues to any kind of 463

transcriptional regulators in the near upstream or downstream of the defined ssa cluster. 464

Our studies have identified a new class of transcriptional factor, SsaA, which functions 465

as a pivotal activator of the sansanmycin production in Streptomyces sp. SS. This was 466

established by targeted ssaA gene disruption and complementation together with 467

transcript analysis. It was confirmed when the overexpression of SsaA in the wild-type 468

strain and complementation of SsaA in the ssaA disruption strain under a strong promoter 469

both significantly increased the sansanmycin production level. This indicates that the 470

endogenous SsaA is not present in saturating amounts, and to elevate the expression level 471

of ssaA could be a practical strategy to improve the uridyl peptide antibiotic production. 472

To the best of our knowledge, SsaA is the first-described example of a regulator that 473

combines an N-terminal fork-head-associated (FHA) domain with a C-terminal 474

helix-turn-helix (HTH) motif of the LuxR type for DNA binding. SsaA bears no 475

significant homology to any characterized gene products in the NCBI database using 476

BLASTP. In addition to orthologues in reported uridyl peptide antibiotic clusters 477

with >80% identity, there are some hypothetic proteins from actinomycetes, mainly 478

streptomycetes, showing considerable similarity (>30% overall identity), suggesting that 479


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

22 / 34

this class of regulators might be generally involved in cellular physiology including 480

secondary metabolite biosynthesis in actinomycetes. 481

EMSAs were used here to prove the direct binding of SsaA to certain promoters of the 482

ssa genes. Binding of the SsaA protein was demonstrated at six out of twelve postulated 483

intergenic fragments. More than one shift bands were obtained with the ssaN-Pp at 484

increasing protein concentrations, indicating that more than one binding site is present in 485

this region, a result that was confirmed by EMSA of subfragments of this region. The 486

lack of binding to the upstream region of ssaKp, ssaQp, ssaBp and ssaVp, which is in the 487

same direction of its upstream gene with relatively long intergenic region, suggests that 488

most, if not all, blocks of codirectional genes are controlled as operons. So it appears 489

plausible that transcription from most of sansanmycin biosynthetic genes can be 490

controlled by SsaA. This is a notable feature of some pathway specific regulators of 491

antibiotic biosynthesis, minimising the number of promoters by extensive usage of 492

operon control, as exemplified by control of streptomycin production by StrR in S. 493

griseus (37). 494

DNase I footprinting experiments revealed protected areas of approximate 20 to 30 495

nucleotides in the target promoters. Typically, the protected region in the sense strand of 496

the activated gene is accompanied by a slightly displaced protection in the 497

complementary strand, suggesting one monomer of the protein binds one face of the 498

DNA helix. A comparison of the protected sequences led to the identification of a 499

conserved palindromic sequence spanning 20 nucleotides. The relevance of the IRs as the 500

cis regulatory element of SsaA was demonstrated by mutation or deletion of the most 501

conserved CTGAC sequence in the IRs. The dyad symmetry of the binding site of SsaA 502


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

23 / 34

is in agreement with the binding sites of regulators of the LuxR type, such as LuxR (38) 503

and TraR (39). The presence of highly conserved SsaA orthologues in all the reported 504

uridyl peptide antibiotic biosynthetic clusters suggests the relevance of this new class of 505

transcriptional regulators in the regulation of their production. Interestingly, the other 506

reported uridyl peptide antibiotic clusters also contain the highly conserved SsaA binding 507

sites in the divergent intergenic regions or the upstream region of genes on the cluster 508

boundary (Table S3), proving the general applicability of the consensus binding site of 509

these transcriptional regulators. 510

Gene expression analysis in the wild-type strain and SS/AKO mutant by quantitative 511

RT-PCR revealed that the transcription of ssaX was dependent on SsaA. However, 512

EMSAs results showed that SsaA can not bind to the intergenic region between ssaX and 513

ssaY. Sequence search of this region and further upstream region till the end of ssaU did 514

not find the conserved SsaA binding site either. One possible explanation for these results 515

is that the transcription of ssaX is controlled by another hierarchical regulator which 516

would be activated by SsaA. Another possibility is that ssaX may be cotranscribed with 517

ssaU which is located in the far upstream of ssaX. All these hypotheses required further 518

experimental tests. 519

In more detailed EMSA analyses, the major end products of sansanmycins were found 520

to markedly inhibit the DNA binding activity of SsaA to the two promoter regions tested. 521

This result, further confirmed by an SPR analysis, raised the possibility that the end 522

products of sansanmycins might modulate SsaA activity. However, sansanmycins 523

overproduced in a pL-ssaA overexpression strain did not reduce the transcription of 524

sansanmycin biosynthesis genes. It is possible that the elevated SsaA protein levels in the 525


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

24 / 34

pL-ssaA-bearing strain might be much higher than the concentration required for the 526

titration of the sansanmycin end products. The direct interaction of SS-A and SS-H with 527

SsaA was then demonstrated by SPR analysis, indicating that the DNA binding activity 528

of SsaA could be directly modulated by the end products of sansanmycins. It is well 529

known that FHA domain is responsible for the interaction of phosphoprotein containing a 530

phosphothreonine (pThr), which is involved in diverse biological pathways (34). The 531

typical FHA domain comprises approximately 75 amino acids for pThr peptide 532

recognition involving the highly conserved residues Arg, Ser and Asn. However, SsaA 533

resembles some FHA domains functioning as a non-pThr-binding module (40), with the 534

only invariant residue Gly following strand β3. As each uridyl peptide antibiotic consists 535

of a pseudo peptide, it seems reasonable to speculate that the end products can bind to the 536

FHA domain to change the conformation of SsaA, which influence its DNA binding 537

activity. 538

Low molecular weight compounds, including intermediates or end products of the 539

respective biosynthetic pathways, were previously reported to influence antibiotic 540

production and export. For example, in tylosin biosynthesis, glycosylated macrolides 541

were proposed to exert a pronounced positive effect on polyketide metabolism in S. 542

fradiae (41). Rhodomycin D, the first glycosylated intermediate in donorubicin 543

biosynthetic pathways, can interact with the TetR-like pathway-specific regulator DnrO 544

to relieve its self-repression, thus positively enhancing the end production (42). A 545

feed-forward mechanism has been proposed by Tahlan et al. (43) that antibiotically 546

inactive precursor may relieve repression by TetR-like regulator ActR, ensuring the 547

expression of the efflux pump ActA to couple the antibiotic biosynthesis and export. A 548


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

25 / 34

similar regulation of efflux of simocyclinone was reported by Le et al. (44). Here we 549

demonstrated that the novel class of FHA-LuxR type regulator SsaA adopted the negative 550

autoregulation strategy to strictly control the production of uridyl peptide antibiotics, 551

regulating the biosynthetic genes at the transcriptional level by sensing the concentration 552

of the end products of the biosynthetic pathway. This strategy might ensure that the 553

producer organism does not inhibit its own growth. A similar autoregulatory mechanism 554

was recently reported that end products and some intermediates in jadomycin 555

biosynthesis can bind to its pathway-specific regulator, an atypical response regulator 556

(ARR), and affect its binding activity (19). This mechanism has been also found in 557

auricin (20) or simocyclinone (45) production. The negative autoregulation by end 558

products may be a widespread regulatory mechanism for antibiotic biosynthesis in 559

streptomycetes. 560

In summary, we have identified and characterized a member of a novel class of 561

transcriptional regulators with FHA domain in global regulation of the sansanmycin 562

biosynthesis. Knowledge of this regulator may set the stage for an understanding of the 563

genetic control of uridyl peptide antibiotic biosynthesis and its regulation, and provide an 564

effective strategy to rational improvements in the yields of these antibiotics. 565

566

Acknowledgments 567

The authors gratefully acknowledge Dr. K. McDowall for the plasmid pL646, and Entai 568

Yao and Ning He for their helps in the fermentation of the SS strains. This work was 569

supported by the National Natural Science Foundation of China (31170042, 30973668 570

and 81273415), Ministry of Science and Technology of China 571


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

26 / 34

(2012ZX09301002-001-016, 2009ZX09501-008 and 2010ZX09401-403), Beijing 572

Natural Science Foundation (5102032) and the Fundamental Research Funds for the 573

Central Universities (2012N09). 574

575

References 576

1. Xie Y, Chen R, Si S, Sun C, Xu H. 2007. A new nucleosidyl-peptide antibiotic, sansanmycin. J. 577

Antibiot. (Tokyo) 60:158-161. 578

2. Xie Y, Xu H, Si S, Sun C, Chen R. 2008. Sansanmycins B and C, new components of 579

sansanmycins. J. Antibiot. (Tokyo) 61:237-240. 580

3. Chen RH, Buko AM, Whittern DN, McAlpine JB. 1989. Pacidamycins, a novel series of 581

antibiotics with anti-Pseudomonas aeruginosa activity. II. Isolation and structural elucidation. J. 582

Antibiot. (Tokyo) 42:512-520. 583

4. Chatterjee S, Nadkarni SR, Vijayakumar EK, Patel MV, Ganguli BN, Fehlhaber HW, 584

Vertesy L. 1994. Napsamycins, new Pseudomonas active antibiotics of the mureidomycin family 585

from Streptomyces sp. HIL Y-82,11372. J. Antibiot. (Tokyo) 47:595-598. 586

5. Isono F, Inukai M, Takahashi S, Haneishi T, Kinoshita T, Kuwano H. 1989. Mureidomycins 587

A-D, novel peptidylnucleoside antibiotics with spheroplast forming activity. II. Structural 588

elucidation. J. Antibiot. (Tokyo) 42:667-673. 589

6. Winn M, Goss RJ, Kimura K, Bugg TD. 2010. Antimicrobial nucleoside antibiotics targeting 590

cell wall assembly: recent advances in structure-function studies and nucleoside biosynthesis. Nat. 591

Prod. Rep. 27:279-304. 592

7. Zhang W, Ostash B, Walsh CT. 2010. Identification of the biosynthetic gene cluster for the 593

pacidamycin group of peptidyl nucleoside antibiotics. Proc. Natl. Acad. Sci. U. S. A 594

107:16828-16833. 595

8. Rackham EJ, Gruschow S, Ragab AE, Dickens S, Goss RJ. 2010. Pacidamycin biosynthesis: 596

identification and heterologous expression of the first uridyl peptide antibiotic gene cluster. 597

Chembiochem. 11:1700-1709. 598

9. Kaysser L, Tang X, Wemakor E, Sedding K, Hennig S, Siebenberg S, Gust B. 2011. 599

Identification of a napsamycin biosynthesis gene cluster by genome mining. Chembiochem. 600

12:477-487. 601

10. Zhang W, Ntai I, Bolla ML, Malcolmson SJ, Kahne D, Kelleher NL, Walsh CT. 2011. Nine 602

enzymes are required for assembly of the pacidamycin group of peptidyl nucleoside antibiotics. J. 603

Am. Chem. Soc. 133:5240-5243. 604

11. Martin JF, Liras P. 2010. Engineering of regulatory cascades and networks controlling antibiotic 605

biosynthesis in Streptomyces. Curr. Opin. Microbiol. 13:263-273. 606

12. van Wezel GP, McDowall KJ. 2011. The regulation of the secondary metabolism of 607

Streptomyces: new links and experimental advances. Nat. Prod. Rep. 28:1311-1333. 608


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

27 / 34

13. Wietzorrek A, Bibb M. 1997. A novel family of proteins that regulates antibiotic production in 609

streptomycetes appears to contain an OmpR-like DNA-binding fold. Mol. Microbiol. 610

25:1181-1184. 611

14. Wilson DJ, Xue Y, Reynolds KA, Sherman DH. 2001. Characterization and analysis of the PikD 612

regulatory factor in the pikromycin biosynthetic pathway of Streptomyces venezuelae. J. Bacteriol. 613

183:3468-3475. 614

15. Sekurova ON, Brautaset T, Sletta H, Borgos SE, Jakobsen MO, Ellingsen TE, Strom AR, 615

Valla S, Zotchev SB. 2004. In vivo analysis of the regulatory genes in the nystatin biosynthetic 616

gene cluster of Streptomyces noursei ATCC 11455 reveals their differential control over antibiotic 617

biosynthesis. J. Bacteriol. 186:1345-1354. 618

16. Santos-Aberturas J, Payero TD, Vicente CM, Guerra SM, Canibano C, Martin JF, Aparicio 619

JF. 2011. Functional conservation of PAS-LuxR transcriptional regulators in polyene macrolide 620

biosynthesis. Metab Eng 13:756-767. 621

17. Santos-Aberturas J, Vicente CM, Guerra SM, Payero TD, Martin JF, Aparicio JF. 2011. 622

Molecular control of polyene macrolide biosynthesis: direct binding of the regulator PimM to 623

eight promoters of pimaricin genes and identification of binding boxes. J. Biol. Chem. 624

286:9150-9161. 625

18. Guthrie EP, Flaxman CS, White J, Hodgson DA, Bibb MJ, Chater KF. 1998. A 626

response-regulator-like activator of antibiotic synthesis from Streptomyces coelicolor A3(2) with 627

an amino-terminal domain that lacks a phosphorylation pocket. Microbiology 144 ( Pt 3):727-738. 628

19. Wang L, Tian X, Wang J, Yang H, Fan K, Xu G, Yang K, Tan H. 2009. Autoregulation of 629

antibiotic biosynthesis by binding of the end product to an atypical response regulator. Proc. Natl. 630

Acad. Sci. U. S. A 106:8617-8622. 631

20. Kutas P, Feckova L, Rehakova A, Novakova R, Homerova D, Mingyar E, Rezuchova B, 632

Sevcikova B, Kormanec J. 2012. Strict control of auricin production in Streptomyces 633

aureofaciens CCM 3239 involves a feedback mechanism. Appl. Microbiol. Biotechnol. 634

21. Wang L, Hu Y, Zhang Y, Wang S, Cui Z, Bao Y, Jiang W, Hong B. 2009. Role of sgcR3 in 635

positive regulation of enediyne antibiotic C-1027 production of Streptomyces globisporus C-1027. 636

BMC. Microbiol. 9:14. 637

22. Kieser T, Bibb MJ, Buttner MJ, Chater KF, Hopwood DA. 2000. Pratical Streptomyces 638

Gnetics. Norwich: The John Innes Foundation. 639

23. Korn F, Weingartner B, Kutzner HJ. 1978. A study of twenty actinophages: morphology, 640

serological relationship and host range, p. 251-270. In E. Freerksen, I. Tarnok, and H. Thumin 641

(ed.), Genetics of the Actinomycetales. Stuttgart & New York: G. Fisher. 642

24. Sambrook J, Russell DW. 2001. Molecular Cloning: a Laboratory Manual. Cold Spring Harbor, 643

NY: Cold Spring Harbor Laboratory. 644

25. Paget MS, Chamberlin L, Atrih A, Foster SJ, Buttner MJ. 1999. Evidence that the 645

extracytoplasmic function sigma factor sigmaE is required for normal cell wall structure in 646

Streptomyces coelicolor A3(2). J. Bacteriol. 181:204-211. 647

26. Gust B, Challis GL, Fowler K, Kieser T, Chater KF. 2003. PCR-targeted Streptomyces gene 648

replacement identifies a protein domain needed for biosynthesis of the sesquiterpene soil odor 649


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

28 / 34

geosmin. Proc. Natl. Acad. Sci. U. S. A 100:1541-1546. 650

27. Studier FW. 2005. Protein production by auto-induction in high density shaking cultures. Protein 651

Expr. Purif. 41:207-234. 652

28. Hong B, Phornphisutthimas S, Tilley E, Baumberg S, McDowall KJ. 2007. Streptomycin 653

production by Streptomyces griseus can be modulated by a mechanism not associated with change 654

in the adpA component of the A-factor cascade. Biotechnol. Lett. 29:57-64. 655

29. Pfaffl MW. 2001. A new mathematical model for relative quantification in real-time RT-PCR. 656

Nucleic Acids Res. 29:e45. 657

30. Delcher AL, Bratke KA, Powers EC, Salzberg SL. 2007. Identifying bacterial genes and 658

endosymbiont DNA with Glimmer. Bioinformatics. 23:673-679. 659

31. van Helden J. 2003. Regulatory sequence analysis tools. Nucleic Acids Res. 31:3593-3596. 660

32. Wang L, Xie Y, Li Q, He N, Yao E, Xu H, Yu Y, Chen R, Hong B. 2012. Draft genome 661

sequence of Streptomyces sp. SS, which produces a series of uridyl peptide antibiotic 662

sansanmycins. J. Bacteriol. 194:6988-6989. 663

33. Soding J, Biegert A, Lupas AN. 2005. The HHpred interactive server for protein homology 664

detection and structure prediction. Nucleic Acids Res. 33:W244-W248. 665

34. Liang X, van Doren SR. 2008. Mechanistic insights into phosphoprotein-binding FHA domains. 666

Acc. Chem. Res. 41:991-999. 667

35. Hammet A, Pike BL, McNees CJ, Conlan LA, Tenis N, Heierhorst J. 2003. FHA domains as 668

phospho-threonine binding modules in cell signaling. IUBMB. Life 55:23-27. 669

36. Crooks GE, Hon G, Chandonia JM, Brenner SE. 2004. WebLogo: a sequence logo generator. 670

Genome Res. 14:1188-1190. 671

37. Retzlaff L, Distler J. 1995. The regulator of streptomycin gene expression, StrR, of Streptomyces 672

griseus is a DNA binding activator protein with multiple recognition sites. Mol. Microbiol. 673

18:151-162. 674

38. Pompeani AJ, Irgon JJ, Berger MF, Bulyk ML, Wingreen NS, Bassler BL. 2008. The Vibrio 675

harveyi master quorum-sensing regulator, LuxR, a TetR-type protein is both an activator and a 676

repressor: DNA recognition and binding specificity at target promoters. Mol. Microbiol. 70:76-88. 677

39. Zhu J, Winans SC. 1999. Autoinducer binding by the quorum-sensing regulator TraR increases 678

affinity for target promoters in vitro and decreases TraR turnover rates in whole cells. Proc. Natl. 679

Acad. Sci. U. S. A 96:4832-4837. 680

40. Tong Y, Tempel W, Wang H, Yamada K, Shen L, Senisterra GA, MacKenzie F, Chishti AH, 681

Park HW. 2010. Phosphorylation-independent dual-site binding of the FHA domain of KIF13 682

mediates phosphoinositide transport via centaurin alpha1. Proc. Natl. Acad. Sci. U. S. A 683

107:20346-20351. 684

41. Fish SA, Cundliffe E. 1997. Stimulation of polyketide metabolism in Streptomyces fradiae by 685

tylosin and its glycosylated precursors. Microbiology 143 ( Pt 12):3871-3876. 686

42. Jiang H, Hutchinson CR. 2006. Feedback regulation of doxorubicin biosynthesis in Streptomyces 687

peucetius. Res. Microbiol. 157:666-674. 688

43. Tahlan K, Ahn SK, Sing A, Bodnaruk TD, Willems AR, Davidson AR, Nodwell JR. 2007. 689

Initiation of actinorhodin export in Streptomyces coelicolor. Mol. Microbiol. 63:951-961. 690


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

29 / 34

44. Le TB, Fiedler HP, den Hengst CD, Ahn SK, Maxwell A, Buttner MJ. 2009. Coupling of the 691

biosynthesis and export of the DNA gyrase inhibitor simocyclinone in Streptomyces antibioticus. 692

Mol. Microbiol. 72:1462-1474. 693

45. Horbal L, Rebets Y, Rabyk M, Makitrynskyy R, Luzhetskyy A, Fedorenko V, Bechthold A. 694

2012. SimReg1 is a master switch for biosynthesis and export of simocyclinone D8 and its 695

precursors. AMB. Express 2:1. 696

46. Bierman M, Logan R, O'Brien K, Seno ET, Rao RN, Schoner BE. 1992. Plasmid cloning 697

vectors for the conjugal transfer of DNA from Escherichia coli to Streptomyces spp. Gene 698

116:43-49. 699

700

701


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

30 / 34

Table 1. Strains or plasmids used in this study. 702

703

704

Strains or plasmids Description Reference

Strains

Streptomyces sp. SS Wild-type strain (sansanmycin producing strain) 1

SS/AKO Streptomyces sp. SS with disruption of ssaA This study

SS/AKO/pL-ssaA SS/AKO with the expression vector pL-ssaA, Amr This study

SS/pL-ssaA Streptomyces sp. SS with the expression vector pL-ssaA, Amr

This study

Escherichia coli DH5α General cloning host 24

E. coli ET12567/pUZ8002 Strain used for E. coli/Streptomyces conjugation 25

E. coli XL1-Blue MR Host strain for genomic library construction Stratagene

E. coli BW25113/pIJ790 Strain used for Red/ET-mediated recombination 26

E. coli BL21(DE3) Strain used for the expression of SsaA protein Novagen

Pseudomonas aeruginosa 11 Strain used for sansanmycin bioassays 2

Plasmids

pOJ446 Cosmid vector used for the construction of genomic library

46

13R-1 Cosmid selected for complete sequencing viashotgun approach

This study

10R-1 Cosmid introduced into E. coli BW25113/pIJ790 for disruption of the minimal replicon of SCP2* and then ssaA

This study

10R-1-SCP2KO Cosmid 10R-1 with the minimal replicon of SCP2* replaced by ampicillin resistance marker bla, Apr and Amr

This study

10R-1-SCP2KO-AKO 10R-1-SCP2KO with ssaA replaced by streptomycin resistance gene addA, Apr, Amr and Strepr

This study

pIJ779 Vector used as the template for amplifying aadA cassette

26

pSET152 Streptomyces integrative vector, Amr 46

pL646 pSET152 derivative containing ermE*p, Amr 28

pL-ssaA pL646 derivative plasmid containing 747 bp complete coding region of ssaA

This study

pET-16b E. coli expression vector, Apr Novagen

pET-16b-A pET-16b containing the conding region of ssaA This study


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

31 / 34

Figure legends 705

706

Fig. 1. Structures of sansanmycins and some of pacidamycins and napsamycins. 707

m-Tyr, meta-Tyr; TIC, tetradehydro-3-isoquinoline carboxylic acid; MetSO, methionine 708

sulfoxide. 709

710

Fig. 2. Genetic organization of the ssa cluster. Genetic organization of 25 ORFs of the 711

ssa cluster plus 5 ORFs upstream and downstream respectively. Black lines above the 712

ORFs are DNA fragments retarded in the EMSA experiments, and gray lines are DNA 713

fragments which were not retarded in the EMSA experiments. 714

715

Fig. 3. Domain structure of SsaA and structure-based alignment of SsaA with its 716

structurally homologous proteins. (A) Predicted domain structure of SsaA. (B) 717

Structure-based alignment of the FHA domain of SsaA with its structurally homologous 718

proteins. Three orthologues of SsaA, PacA (GenBank: ADN26237.1), NpsM (GenBank: 719

ADY76675.1) and SrosN15 (GenBank: ZP_04694256.1) and 4 closest FHA structural 720

neighbors of SsaA, EmbR (PDB: 2FF4), Yeast Rad53 FHA1 (PDB: 1QU5), Yeast Rad53 721

FHA2 (PDB: 1QU5) and Human Ki67 (PDB: 1R21), were aligned. The known conserved 722

amino acid residues important for the binding of phosphopeptide are gray-shadowed. 723

Numbers inserted in the sequences count residues omitted from the non-conserved regions. 724

(C) Structure-based alignment of the DNA binding domain (DBD) of SsaA with its 725

structurally homologous proteins. Three orthologues of SsaA, PacA (GenBank: 726

ADN26237.1), NpsM (GenBank: ADY76675.1) and SrosN15 (GenBank: 727


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

32 / 34

ZP_04694256.1) and 5 closest DBD structural neighbors of SsaA, TraR (PDB: 1L3L), 728

QcsR (PDB: 1P4W), CviR (PDB: 3QP6), RcsB (PDB: 3SZT) and ComA (PDB: 3ULQ), 729

were aligned. 730

731

Fig. 4. Effects of overexpression of ssaA on sansanmycin production in Streptomyces 732

sp. SS. (A) Antibacterial activities of SS/pL-ssaA and SS/pSET152 at indicated time 733

points. (B) HPLC analysis of sansanmycins produced by SS/pL-ssaA and SS/pSET152 at 734

144 h. 735

736

Fig. 5. Disruption of ssaA and its effects on sansanmycin production and 737

biosynthetic gene expression. (A) Antibacterial activities of the wild-type strain (1), 738

SS/AKO (2) and SS/AKO/pL-ssaA (3) at indicated time points. (B) HPLC analysis of 739

sansanmycins produced by the wild-type strain, SS/AKO and SS/AKO/pL-ssaA at 144 h. 740

(C) Transcriptional analysis of different genes in wide-type strain, SS/AKO mutant and 741

its complemented strain SS/AKO/pL-ssaA. The relative abundance of ssaH, ssaN, ssaP, 742

ssaA, ssaX, ssaC transcripts in 48-h mycelia of wide-type strain, SS/AKO and 743

SS/AKO/pL-ssaA was determined by quantitative RT-PCR. Data are from three 744

biological samples with one or two PCR determinations of each. The values were 745

normalized to that of hrdB and were represented as mean±SD. The amounts of each 746

particular transcript in the wild-type strain were arbitrarily assigned as 1. 747

748

Fig. 6. EMSA analysis of SsaA with the postulated promoter regions of the ssa 749

cluster. EMSA analysis of 3’ Biotin-11-ddUTP labeled fragments ssaHp, ssaN-Pp, 750


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

33 / 34

ssaC-Dp, ssaU-A-1p, ssaU-A-2p and ssaWp with His10-SsaA. For ssaHp, ssaN-Pp, 751

ssaU-A-1p, ssaU-A-2p, ssaC-Dp, lane -, probe only; lanes under the triangle, increasing 752

concentrations of SsaA (0, 0.175, 0.35, 0.7, 1.4, 1.75 μM) incubated with the probe; lane 753

C, 0.7 μM His10-SsaA incubated with 200 fold excess unlabeled specific competitor DNA 754

fragment. In the case of ssaWp, lane -, probe only; lane +, probe incubated with 0.175 μM 755

His10-SsaA. 756

757

Fig. 7. Identification of SsaA binding sites. (A) Identification of SsaA binding site in 758

ssaN-Pp promoter region by DNase I footprinting. The upper electropherogram shows 759

the control reaction, and the lower one shows DNase I footprints of the His10-SsaA (2.67 760

μM) bound to the labeled DNA fragments (50 ng). The protected nucleotide sequences 761

are gray-shadowed. The nucleotide positions of the protected sequences respective to the 762

ssaP translation start point are shown below the gray shadow. (B) Identification of the 763

SsaA consensus binding site by WebLogo. Six sequences were aligned, including 5 764

sequences detected by the DNase I footprinting experiments and one sequence upstream 765

of ssaW which is identical to that of ssaU. The base-pairing nucleotides within the 766

binding site are underlined. (C) Validation of the identified SsaA consensus binding site. 767

The binding of SsaA to the three synthetic duplexes, D1, D2 and D3 (the dashed lines in 768

D3 indicated the deletion of 5 nucleotides), was detected by EMSA analysis. Lane -, 769

probe only; lane +, probe incubated with 1.75 μM His10-SsaA. 770

771

Fig. 8. Effect of sansanmycins on the DNA binding activity of SsaA. (A) Effect of 772

different amounts of SS-A on the binding of His10-SsaA (0.175 μM) to ssaC-Dp or 773


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

34 / 34

ssaU-A-1p. Lane 1, probe only; lane 2, probe incubated with 0.175 μM His10-SsaA; lane 774

3-10, probe incubated with 0.175 μM His10-SsaA in the presence of increasing 775

concentrations of SS-A (50, 100, 200, 300, 450, 600, 800, 1,000 μM). (B) Effect of 776

different amounts of SS-H on the binding of His10-SsaA (0.175 μM) to ssaC-Dp or 777

ssaU-A-1p. Lane 1, probe only; lane 2, probe incubated with 0.175 μM His10-SsaA; lane 778

3-10, probe incubated with 0.175 μM His10-SsaA in the presence of increasing 779

concentrations of SS-H (50, 100, 200, 300, 450, 600, 800, 1,000 μM). (C) SPR analysis 780

of the effect of SS-A on the DNA binding activity of SsaA. The binding of His10-SsaA 781

(100 nM) to ssaC-Dp-3 fragment immobilized on an SA chip was inhibited by the 782

increasing concentrations of SS-A (50, 100, 200, 300 μM). (D) SPR analysis of SS-A 783

interaction with immobilized His10-SsaA. Sensorgrams for the increasing concentrations 784

of SS-A (3.125, 6.25 12.5, 25, 50 μM) shows its binding to the immobilized His10-SsaA 785

on a CM5 chip. (E) SPR analysis of SS-H interaction with immobilized His10-SsaA. 786

Sensorgrams for the increasing concentrations of SS-H (12.5, 25, 50, 100, 200 μM) 787

shows its binding to the immobilized His10-SsaA on a CM5 chip. 788


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/


http://jb.asm.org/

Dow

nloaded from

http://jb.asm.org/

Title: SsaA, a novel class of transcriptional regulator, controls ...

Documents

Transcript of Title: SsaA, a novel class of transcriptional regulator, controls ...