Title page

Growth defect and mutator phenotypes of RecQ-deficient Neurospora crassa mutants

separately result from homologous recombination and nonhomologous end joining

during repair of DNA double-strand breaks

Akihiro Kato and Hirokazu Inoue

Laboratory of Genetics, Department of Regulation Biology, Faculty of Science, Saitama

University, 338-8570 Saitama, Japan

Genetics: Published Articles Ahead of Print, published on October 11, 2005 as 10.1534/genetics.105.041756

Page 2

Short running head: RecQ mutants in Neurospora crassa

Key words: genome instability / homologous recombination / Neurospora crassa /

nonhomologous end joining / RecQ

Corresponding author: Hirokazu Inoue

Laboratory of Genetics, Department of Regulation Biology, Faculty of Science, Saitama

University, 338-8570 Saitama, Japan

e-mail: hinoue@post.saitama-u.ac.jp

TEL: +81-48-858-3414

FAX: +81-48-858-3413

Abstract

RecQ helicases function in the maintenance of genome stability in many organisms. The

filamentous fungus Neurospora crassa has two RecQ homologues, QDE3 and RECQ2.

We found that the qde-3 recQ2 double mutant showed a severe growth defect. The growth

defect was alleviated by mutation in mei-3, the homologue of yeast RAD51, which is

required for homologous recombination (HR), suggesting that HR is responsible for this

phenotype. We also found that the qde-3 recQ2 double mutant showed a mutator

phenotype, yielding mostly deletions. This phenotype was completely suppressed by

mutation of mus-52, a homologue of the human KU80 gene that is required for

nonhomologous end joining (NHEJ), but was unaffected by mutation of mei-3. The high

spontaneous mutation frequency in the double mutant is thus likely to be due to NHEJ

acting on an elevated frequency of double-strand breaks (DSBs) and we therefore suggest

that QDE3 and RECQ2 maintain chromosome stability by suppressing the formation of

spontaneous DSBs.

Text

INTRODUCTION

The RecQ family of DNA helicases has been highly conserved during evolution and is

present in organisms ranging from bacteria to humans. Members of the RecQ family have

been shown to be important for the maintenance of genomic stability. Mutation in three of

the five human RecQ homologues, BLM, WRN and RecQL4, results in Bloom syndrome

(BS), Werner syndrome (WS) and Rothmund-Thomson syndrome (RTS), respectively

(Ellis et al. 1995; Yu et al. 1996; Kitao et al. 1998; Kitao et al. 1999). BS is characterized

by growth retardation, a markedly increased incidence of several types of cancer and

genomic instability, including chromatid gaps, breaks, and rearrangements (German

1993). In addition, BS cells exhibit elevated sister chromatid exchange (Chaganti et al.

1974). WS is characterized by genomic instability and the premature appearance of

ageing phenotypes in young adults, including cancers (Epstein et al. 1966). Cells derived

from WS patients show an increased rate of somatic mutations, chromosome loss and

deletions (Salk et al. 1981; Fukuchi et al. 1989). RTS is also characterized by premature

ageing and cancer predisposition (Vennos and James 1995). These three diseases are

clinically distinct and the three causative genes are thought to play distinct roles. The

genomic instability found in these diseases correlates with cancer predisposition but there

is no direct evidence that the genome instability is responsible for the cancer

susceptibility. The remaining two human RecQ homologues, RecQL1 (Seki et al. 1994;

Puranam and Blackshear 1994) and RecQL5 (Kitao et al. 1998), have not been implicated

in any disease. However, in chicken DT40 cells, in which the BLM function is impaired,

RecQL1 and RecQL5 appear to be required for cell viability (Wang et al. 2003).

In Saccharomyces cerevisiae, there is only one RecQ homologue, Sgs1. sgs1 mutants

show an increase in various types of recombination (Watt et al. 1996; Yamagata et al.

1998; Onoda et al. 2000), accumulate gross chromosomal rearrangements (Myung et al.

2001), and show impaired sporulation (Watt et al. 1995) and premature ageing of mother

cells (Sinclair et al. 1997).

There is much evidence supporting the involvement of RecQ helicases in DNA

replication. The expression of Sgs1, BLM, WRN and RecQL4 is cell-cycle regulated and

peaks during S-phase (Kitao et al. 1998; Frei and Gasser 2000; Dutertre et al. 2000;

Kawabe et al. 2000). Correspondingly, WRN interacts physically with components

required for replication, including DNA polymerase δ, topoisomerase I, PCNA, FEN-1

and RPA (Kamath-Loeb et al. 2000; Lebel et al. 1999; Brosh et al. 2001; Brosh et al.

1999). In addition, BLM and WRN localize to stalled replication sites resulting from

cellular exposure to hydroxyurea (HU) (Jiao et al. 2004; Constantinou et al. 2000). In S.

cerevisiae, some Sgs1 foci also colocalize with replication foci (Frei and Gasser 2000).

Human cells lacking functional BLM or WRN accumulate aberrant replication

intermediates (Lonn et al. 1990; Poot et al. 1992). Recent studies indicate that RecQ

helicases are required for processing of DNA structures induced by stalled replication

forks. It is thought that lesions on the leading strand can cause replication forks to regress,

resulting in Holliday-junction-like 4-way structures. Holliday junctions are the preferred

substrate of BLM, WRN and Sgs1 (Mohaghegh et al. 2001; Bennett et al. 1999). BLM

and WRN can also catalyze branch migration of Holliday junctions (Karow et al. 2000;

Constantinou et al. 2000). Moreover, defects in Schizosaccharomyces pombe rqh1, the

only RecQ homologue in S. pombe, are suppressed by over-expression of a bacterial

Holliday junction resolvase, RusA (Doe et al. 2000). However, how replication

regression is promoted and how RecQ helicases maintain genomic stability remains to be

explained.

In Neurospora crassa, there are two RecQ homologues, QDE3 and RECQ2 (Cogoni and

Macino 1999; Kato et al. 2004; Pickford et al. 2003). QDE3 is a long-type RecQ

homologue, like BLM, WRN and RTS, while RECQ2 is a short-type homologue, like

RecQL1 and RecQL5α. It has been reported that QDE3 and RECQ2 are required for

DNA repair (Kato et al. 2004; Pickford et al. 2003) but it was not previously known

whether they are required for genome stability. In this report, we describe the effects of

mutations in QDE3 and RECQ2 and their interaction with mutations in HR and NHEJ.

MATERIALS AND METHODS

Strains: The N. crassa strains used in this study are listed in Table 1. C1-T10-37A and

C1-T10-28a (Tamaru and Inoue 1989) are wild-type strains closely related to the standard

Oak Ridge wild-type strain. Production of the recQ2 mutant strains KTO-Q2R-5A and

KTO-Q2-2A is described in the next section of Materials and Methods. The qde-3 recQ2

double mutant strains KTO-Qd-32a and KTO-Qd-35A were derived from a cross

between the qde-3 mutant strain KTO-r-20a (Kato et al. 2004) and KTO-Q2-2A. The

mus-38 recQ2 double mutant strain KTO-2m38-1a was derived from a cross between the

mus-38 mutant strain CZ272-5a (Ishii et al. 1998) and KTO-Q2-2A. The qde-3 recQ2

mus-38 triple mutant strain KTO-dm38-26A was derived from a cross between the qde-3

mus-38 double mutant strain QMU38-2A (Kato et al. 2004) and KTO-2m38-1a. The

recQ2 mei-3 double mutant strain KTO-2mi3-1a was derived from a cross between the

mei-3 mutant strain CY-10-9a (Ishii and Inoue 1994) and KTO-Q2-2A. The qde-3 recQ2

mei-3 triple mutant strain KTO-dmi3-1A was derived from a cross between

KTO-Qd-35A and KTO-2mi3-1a. The qde-3 recQ2 mus-52 triple mutant strain

KTO-dk8-33a was derived from a cross between KTO-Qd-32a and the mus-52 mutant

strain 54yo-828-3 (Ninomiya et al. 2004).

Construction of the recQ2 mutant: A 1908-bp fragment upstream of the recQ2 ORF,

beginning 5 bp upstream from the ORF, and a 1836-bp fragment downstream from the

recQ2 ORF, beginning 165 bp downstream from the ORF, were amplified by PCR using

the following primer sets:

Q2U-1: TTGGGATGATCGAAGAG and Q2U-2: GCAGCGTCGATAGCA

Q2D-1: TTCGGTGACAGGTAGGT and Q2D-2: GTCGTTCTCTGCCTTAG

These two fragments were inserted on each side of the hygromycin-resistance marker

gene (hygr) derived from the plasmid pCSN43 (Staben et al. 1989) to construct the

plasmid pQ2::HYG. This plasmid was used as a PCR template to produce the targeting

construct hygr flanked by sequences upstream and downstream of recQ2. The amplified

fragment was introduced into the C1-T10-37A wild-type strain by electroporation to

replace the endogenous recQ2 with the hygr gene. Hygromycin B-resistant transformants

were isolated and the replacement was confirmed by PCR using primers Q2I:

AACAACAGGCGCGACCAA, which is located in the upstream fragment, and Q2O:

AAGCCCGTAGAGTGCAGACAAA, which is located downstream of the downstream

fragment. In the wild-type case, a 4-kb fragment was amplified. Since 1.8 kb, including

the whole recQ2 ORF, is replaced by the 2.4 kb hygr gene in the recQ2-replaced mutant, a

4.5-kb fragment was amplified. Extra ectopic copies were ruled out and gene replacement

was confirmed by Southern analysis. This mutant strain, designated as KTO-Q2R-5A,

was backcrossed to the C1-T10-28a wild-type strain, and it was confirmed that the hygr

marker gene segregates normally through meiosis. Strain KTO-Q2-2A is one of the

progeny of this cross and was used as a standard recQ2 mutant strain.

Growth media and genetic methods: Growth media and genetic procedures for N.

crassa were as described by Davis and de Serres (1970). Transformation of Neurospora

by electroporation was performed as previously described (Ninomiya et al. 2004).

Qualitative assay of mutagen sensitivity by spot tests: Sensitivity to chemical

mutagens and other chemicals was analyzed by spot tests, as described by Watanabe et

al. (1997). Each conidial suspension was diluted and adjusted to densities of about

10000, 1000, 100, and 10 viable conidia per spot. Methyl methanesulfonate (MMS),

N-methyl-N’-nitro-N-nitrosoguanidine (MNNG), camptothecin (CPT), tert-butyl

hydroperoxide (TBHP), ethyl methanesulfonate (EMS), 4-nitroquinoline-1-oxide

(4NQO), and hydroxyurea (HU) were added to agar medium at final concentrations of

0.005% or 0.02%, 0.15 µg/ml or 0.45 µg/ml, 0.0025 µg/ml or 0.25 µg/ml, 0.0014% or

0.0028%, 0.1% or 0.2%, 0.0075 µg/ml or 0.045 µg/ml, and 0.38 mg/ml or 1.9 mg/ml,

respectively. Conidial suspensions were spotted onto these plates and grown at 30˚C for

2 days. UV-sensitivity was investigated by spotting a conidial suspension onto an agar

plate and irradiating at 150 J/m2 or 300 J/m2.

Assay of UV-sensitivity: The UV-dose dependency of the survival of N. crassa was

measured as described by Inoue and Ishii (1984). Conidial suspensions at a final

concentration of 1 x 106 cells/ml were irradiated at various doses of UV, and aliquots

were sampled and plated after appropriate dilution. The yeast on all the plates were

allowed to grow at 30˚C for 3 days and the number of colonies on each plate was

counted.

Measurement of apical growth and lifespan: Apical growth of hyphae was measured

in race tubes of approximately 30 cm length. So that the age of each strain would be

consistent, mutant strains were backcrossed to the wild-type strain and resultant

ascospores were randomly isolated and grown at 30˚C for 1 week. Conidia of each were

transferred to new media and grown at 30˚C for another week while the genotype of

each progeny was investigated by the spot test or PCR. A silica gel stock was made

from the conidia of each strain and stored at 4˚C. To start each experiment, a few grains

of the silica gel were placed on Vogel’s minimal agar medium and incubated at 30˚C for

1 week. The resulting conidia were inoculated at one end of the race tube and incubated

at 25˚C. The position of the growing front was marked once or twice a day. When the

mycelia reached the other end of the race tube, a piece of medium bearing mycelia was

cut from the growing front and transferred to a fresh tube.

Microscopy: Mycelia were grown on Vogel’s minimal agar medium containing 1.2%

sucrose and 2% agar at 30˚C for 1 day. A piece of mycelium was cut from the growing

front, fixed in 70% ethanol and transferred to a glass slide. SYBR Gold (Molecular

Probes) dye was used to stain nuclei. Mycelia were observed by fluorescence

microscopy (Nikon) and images were taken with a cooled CCD color camera

(KEYENCE).

Forward mutation assay: The direct method described by de Serres and Kølmark

(1958) was used for the detection of ad-3 mutations. To eliminate pre-existing ad-3

mutation, cultures started by single colony isolation were used for each experiment. A

conidial suspension from each isolate was inoculated into each 5-L Florence flask at a

concentration of 5 × 105 viable conidia per flask. The flask was cultured in the dark at

30ºC with low aeration. Under these conditions, each conidium makes a bead-like

colony after 1 week of culture. As ad-3 mutants accumulate purple pigments in mycelia,

purple-colored colonies were isolated and subcultured. To distinguish ad-3A from ad-3B

mutants, complementation tests were carried out using ad-3A and ad-3B tester strains

(Table 1). Spontaneous mutation rates per nucleus per division were calculated by the

method of the median (Lea and Coulson 1949) using the following formula: mutation

rate = m/N, where m is the calculated number of mutation events and N is the number of

nuclear divisions. To estimate the number of nuclear divisions, the number of nuclei in

50 conidia was counted and the average number of nuclei in a conidium was multiplied

by the estimated number of colonies in the culture. The formula r/m - ln(m) – 1.24 = 0

was solved for m. r is the median number of ad-3 mutants.

Analysis of mutations: To amplify the ad-3A gene from genomic DNA, PCR was

performed with two primers: Pst: AACTGCAGTTCTGATCCGTCCAGTTC and

M2: TTCGTTACAGTGCCGAGTCC

To amplify the ad-3B gene from genomic DNA, PCR was performed with two primers:

X1: TTGGGTCGTATGCTCTGTGA and

Y1: CTTGGGCCACTGTCCGT

To determine the nucleotide sequence of the ad-3A gene, six sequencing primers were

used (BigDye Terminator Cycle Sequencing Ready Reaction Kit v3.1, Applied

Biosystems):

2F: GTCCAGTTCCGTCCCGTCCA

3F: TTTACTACCGACCGC ATTTCGG

5F: CGAGCACCAAGGCAGAGCTG

4R: GCAGTAAGCTGTGTG AGGAT

6R: CAGTGGAGTAGACCTTGAGC

8R: CCAGCAAACTATCAG ATCAC

To amplify regions outside of the ad-3A ORF, six primers were used:

L1: CAAATGGAAGACGGTGGACT

R1: TCGCAGACTGTGAGGAATTG

L2: GATTGACGCCCTTTTGATGT

R2: GAACTGGAGGCTGGAGTGAG

L4: CGGCGGTCGTTGAGGTAG

R4: CAGCGAGTATTTGGTGGAAGG

Analysis of chromosome deletion around the ad-3A gene was performed by Southern

hybridization using cosmid G4:E3 as a probe.

RESULTS

The qde-3 recQ2 double mutant showed increased sensitivity to all tested mutagens:

The recQ2 mutant was generated by replacing the whole recQ2 ORF by hygr, as

described in Materials and Methods. The mutant did not show any defects during

vegetative growth and sporulation. The sensitivity of the recQ2 mutant to a variety of

mutagens and other chemicals was tested by spot tests (Figure 1). Conidial suspensions

adjusted to the same concentrations were spotted on plates containing MMS, MNNG,

EMS, TBHP, 4NQO, CPT, or HU, and plates were incubated at 30 ˚C. In the

UV-sensitivity test, conidia were irradiated after spotting.

While the qde-3 mutant showed high sensitivity to mutagens, as described previously

(Kato et al. 2004; Figure 1A), the recQ2 mutant was slightly more sensitive to MMS,

MNNG and CPT than the wild-type strain, the increased sensitivity being detectable

only at high concentrations of the DNA-damaging agents (Figure 1B). The qde-3 recQ2

double mutant showed higher sensitivity to the type I topoisomerase inhibitor CPT, the

replication inhibitor HU, and to all mutagens tested than the qde-3 single mutant (Figure

1B). Unlike the sgs1 mutant in S cerevisiae and the rqh1 mutant in S. pombe, which are

sensitive to UV, the UV-sensitivity of the qde-3 recQ2 double mutant was similar to that

of the wild-type strain (Figure 1 B and C).

To investigate whether QDE3 and RECQ2 function in the resistance to UV, a qde-3

mus-38 double mutant and a qde-3 recQ2 mus-38 triple mutant were made and their

UV-sensitivity was tested. mus-38 mutants are deficient in nucleotide excision repair

(NER) and sensitive to UV. The qde-3 mus-38 double mutant showed a higher

sensitivity to UV than the parental mus-38 mutant, and the qde-3 recQ2 mus-38 triple

mutant was still more sensitive (Figure 1D). These data indicate that the qde-3 and

recQ2 genes are required for resistance to UV in the case of dysfunction of MUS38.

The qde-3 recQ2 double mutant showed a growth defect: Growth of the qde-3 recQ2

double mutant was poor on glycerol complete medium as well as on minimal medium.

About one-fourth of the random progeny of a backcross of the double mutant to the

wild-type strain showed slow growth, and all were qde-3 recQ2 double mutants (data

not shown). Both qde-3 and recQ2 single mutants grew as fast as the wild-type strain

for several consecutive transfers (Figure 2A and data not shown). The double mutant

grew as fast as the wild-type strain in the first and second race tubes (Figure 2A) but its

growth slowed in the third tube and was dramatically reduced in the fourth tube (Figure

2A). The appearance of mycelia was also altered in the fourth tube, with the

accumulation of black and dense orange pigments and spherically formed mycelia

(Figure 2B).

Microscopic observation showed that the size and morphology of hyphal tips in the

wild-type strain, the qde-3 mutant, and the recQ2 mutant were in all cases similar

(Figure 2C). As N. crassa is a coenocytic organism, many nuclei were found in mycelia

of all those strains. Hyphal tips of the qde-3 recQ2 double mutant appeared similar

when the cells were young and growing vigorously, but in the aged double mutant,

whose growth was slow, mycelial tips were thin and the number of nuclei decreased

(Figure 2C). Along with the deterioration in linear growth, the colony morphology of

the double mutant became flat and spreading, whereas that of the wild-type strain was

thick and dense (Figure 2D).

Conidia in the wild-type, the qde-3 mutant, and the recQ2 mutant strains had similar

viability (77%, 71% and 74%, respectively) but viability was much reduced (to 33%) in

the double mutant.

The growth defect of the qde-3 recQ2 double mutant was suppressed by mutation of

a gene required for HR: In S. cerevisiae, the role of another DNA helicase, Srs2,

appears to overlap with that of Sgs1. Both Sgs1 and Srs2 have 3′-5′ DNA helicase

activity (Bennett et al. 1998; Rong and Klein 1993) and both sgs1 and srs2 mutants

have a hyper-recombination phenotype (Watt et al. 1996; Aguilera and Klein 1988).

Simultaneous deletion of SGS1 and SRS2 results in extremely poor growth or synthetic

lethality (Lee et al. 1999; Gangloff et al. 2000), with either phenotype alleviated by

mutations in the HR genes RAD51, RAD55 and RAD57 (Gangloff et al. 2000). A similar

result was reported in S. pombe (Maftahi et al. 2002). Moreover, over-expression of

Sgs1 partially suppresses the MMS- and HU- sensitivity of the srs2∆ mutant (Mankouri

et al. 2002).

Similarly, qde-3 and recQ2 are putative DNA helicases with redundant roles in DNA

repair in N. crassa. Therefore, the growth defect in the qde-3 recQ2 mutant might be

suppressed by mutations in HR genes, for example in the RAD51 homologue mei-3. The

qde-3 recQ2 mei-3 triple mutant grew as fast as the wild-type strain during the entire

course of the transfer experiment (Figure 2A). Unlike in the qde-3 recQ2 double mutant,

mycelial appearance and growth rate were normal, even after six transfers (data not

shown). Colony morphology of the triple mutant was similar to that of the mei-3 mutant

(Figure 2D). Conidial viability of the triple mutant and the mei-3 mutant was the same

(64% and 61%, respectively).

qde-3 and qde-3 recQ2 double mutants show increased mutability and extensive

deletion: To test the genomic instability of RecQ-homologue mutants of N. crassa,

spontaneous mutability was investigated. The spontaneous mutation rate at the ad-3

locus was 0.4 × 10-7 in the recQ2 mutant, which was similar to that in the wild-type

strain (Table 2). However, in the qde-3 mutant, the spontaneous mutation rate was 2.4 ×

10-7, 11 times higher than that in the wild-type strain. The spontaneous mutation rate of

the qde-3 recQ2 double mutant was 4.0 × 10-7, 18 times higher than that of the

wild-type strain.

The ad-3 locus consists of two genes, ad-3A and ad-3B, and which gene is mutated in a

particular ad-3 mutant can be determined by complementation tests. We wished to

examine the spectrum of mutations generated in qde-3, recQ2 and qde-3 recQ2 double

mutants. As the ad-3A gene is smaller than the ad-3B gene, we first determined the

sequence of the ad-3A gene.

To determine the sequence, the ad-3A ORF was amplified by PCR using primers Pst

and M2 (Figure 3A). The expected 1-kb fragments were amplified using genomic DNA

of the wild-type, the qde-3 mutant, and the qde-3 recQ2 double mutant as a template,

but no fragments were amplified from most of the ad-3A mutants obtained from the

qde-3 mutant and the qde-3 recQ2 double mutant (Table 3). Since the ad-3B gene was

successfully amplified using primers X1 and Y1 (Figure 3B) in all of these mutants, it

was thought that these mutants had experienced deletion in ad-3A. Primers L1 and R1

yield a 3-kb fragment that includes the ad-3A ORF and 1 kb of flanking sequence on

each side of the ORF, while primers L2 and R2 give a similar 5-kb fragment that

includes 2 kb of each flanking region, and primers L4 and R4 give a 7-kb fragment that

includes 3 kb of each flanking region (Figure 3A). Genomic DNA of the wild-type, the

qde-3 mutant or the qde-3 recQ2 mutant strains yielded the expected fragments with

each of these primer pairs (Table 3, controls). On the other hand, genomic DNAs of the

ad-3A mutants derived from the qde-3 or qde-3 recQ2 strains yielded no fragments in

these PCR analyses, suggesting that they have large deletions. In eight of 11 (72%)

ad-3A mutants obtained from the qde-3 mutant strain and 43 of 51 (84%) ad-3A mutants

obtained from the qde-3 recQ2 double mutant strain, no fragments were amplified even

using primers L4 and R4 (Table 3). Southern analysis revealed that these mutants all

have deletions at the ad-3A locus (data not shown). The resulting band patterns were the

same in all the ad-3A mutants obtained from the same subculture (Jug 9) in the qde-3

strain, but different band patterns appeared in the ad-3A mutants from the qde-3 recQ2

strain (data not shown). Then, the rest of the ad-3A mutations were analyzed by PCR

and sequencing. One of 11 ad-3A mutants from the qde-3 strain and two of 51 ad-3A

mutants from the qde-3 recQ2 strain gave a shorter fragment than expected using

primers L1 and R1. In two other mutants, shorter fragments were amplified only in the

PCR using primers L4 and R4 (Table 3). In the remaining two ad-3A mutants derived

from the qde-3 strain and four ad-3A mutants derived from the qde-3 recQ2 strain,

approximately 1-kb fragments were amplified by PCR using the primers Pst and M2

(Figure 3A). From the qde-3 strain, sequence analysis revealed that one ad-3A mutant

had a single base-substitution and the other a 10-bp deletion (Figure 4). From the qde-3

recQ2 strain, one ad-3A mutant had a single base insertion and the other three had

deletions of between 20 bp and 123 bp (Figure 4). No characteristic sequence was found

at the junctions.

PCR analysis was also done on the ad-3B mutants. In the PCR using the primers X1 and

Y1, more than half of the ad-3B mutants derived from the qde-3 strain or the qde-3

recQ2 strain didn’t yield any fragments (data not shown). In the ad-3B mutant from the

recQ2 strain, approximately 2-kb fragments were amplified in the PCR using the

primers X1 and Y1 (data not shown).

The mutator phenotype of the qde-3 recQ2 double mutant was suppressed by

mutation in NHEJ, but not in HR: Plasmid-rejoining experiments in BS cells and WS

cells showed that rejoining is error-prone, and mainly causes deletions (Rünger and

Kraemer 1989; Gaymes et al. 2002; Rünger et al. 1994; Oshima et al. 2002), suggesting

that error-prone NHEJ causes deletion in these RecQ homologue mutants and thus may

be responsible for the mutator phenotype of our qde-3 recQ2 double mutant.

In N. crassa, mus-51 and mus-52 genes, homologues of mammalian KU70 and KU80

respectively, are required for NHEJ (Ninomiya et al. 2004). The spontaneous mutation

rate of the mus-52 mutant at the ad-3 loci was 0.4 × 10-7, similar to that of the wild-type

strain (Table 2). The qde-3 recQ2 mus-52 triple mutant also showed a similar rate to the

wild-type strain, 0.2 × 10-7 (Table 2). The mutation rate of the qde-3 recQ2 mei-3 triple

mutant was 9.1 × 10-7, indicating that mutation in mei-3 did not suppress the high

spontaneous mutation rate and confirming that this suppression effect is due only to the

mutation in the NHEJ gene. In addition, analysis of the genomic DNA of the ad-3A

mutations derived in the qde-3 recQ2 mei-3 strain indicated that they carry large

deletions (data not shown).

Mutation in NHEJ increases the severity of the growth defect of the qde-3 recQ2

double mutant: Although the mus-52 mutation suppressed the rate of spontaneous

deletions, the growth defect of the qde-3 recQ2 double mutant was more extreme in the

qde-3 recQ2 mus-52 triple mutant. The colonies of the triple mutant were very thin and

the morphology of each colony was irregular. Conidial viability was also reduced, and

varied from 17% to 34%. Moreover, linear growth of the triple mutant slowed earlier

than that of the qde-3 recQ2 double mutant (Figure 2A). Though the triple mutant grew

faster than the double mutant in the fourth tube, the growth rate, once it slowed, was not

constant, alternating between a “slow” and “fast” growth pattern (data not shown). This

phenotype is like the “stop and start” phenotype reported for some DNA repair mutants

in N. crassa (Newmeyer 1984). Although the triple mutant showed a severe growth

defect, the abnormal appearance observed for the qde-3 recQ2 double mutant,

accumulation of orange and black pigments and spherically formed mycelia, was not

seen.

DISCUSSION

RecQ homologues in N. crassa have roles in the maintenance of genome stability as

well as DNA repair: In this report, we demonstrated that QDE3 and RECQ2 are

required for maintenance of genomic stability as well as repair of DNA damage induced

by mutagens. The qde-3 mutant and the qde-3 recQ2 double mutant show sensitivity to

several mutagens, as reported previously (Pickford et al. 2003; Kato et al 2004), but are

not sensitive to UV. However, the qde-3 mus-38 double mutant is more sensitive to UV

than is the mus-38 single mutant. Furthermore, the qde-3 recQ2 mus-38 triple mutant is

even more sensitive than either double mutant. As mus-38 is a homologue of S.

cerevisiae RAD1, which is required for NER, the role of the Neurospora RecQ

homologues in the repair of UV-damage must involve pathways separate from that of

NER, such as recombination repair, postreplication repair, and DNA damage checkpoint

response.

The qde-3 mutant exhibited an increased spontaneous mutation rate, indicating that it is

a mutator. The spontaneous mutation rate was much higher in the qde-3 recQ2 double

mutant, suggesting that the qde-3 and recQ2 genes are required for the maintenance of

genome stability. However, the spontaneous mutation rate in the recQ2 single mutant

was similar to that in the wild-type strain. Moreover, the recQ2 mutant did not show

significant mutagen sensitivity, though it had a slightly higher sensitivity to high

concentrations of MMS, MNNG and CPT than the wild-type strain. The qde-3 recQ2

double mutant was more mutagen sensitive than the qde-3 single mutant. Thus, it seems

that RECQ2 has a relatively minor role in cellular functions such as DNA repair and the

maintenance of genome stability, but the function only becomes conspicuous when the

qde-3 function is impaired. These two RecQ homologues have redundant functions in

the repair of damaged DNA and also in the maintenance of genome stability, since the

double mutant is more sensitive to mutagens and more mutable than each single mutant.

The growth defect of the qde-3 recQ2 mutant is caused by HR, not by NHEJ: The

qde-3 recQ2 double mutant shows low conidial viability, slow growth and a decreased

number of nuclei, indicating a decline of cellular proliferation. The growth defect of the

qde-3 recQ2 double mutant is suppressed by a mutation in mei-3, which is required for

HR, suggesting that the growth defect in the qde-3 recQ2 double mutant is a result of

the HR pathway. In contrast, the qde-3 recQ2 mus-52 triple mutant showed a greater

growth defect than the qde-3 recQ2 double mutant, showing that NHEJ was not

responsible for the defect.

HR and NHEJ are two major mechanisms of DSB repair. HR repair, which depends on

homologous sequences, rarely introduces mutations during DSB repair. NHEJ is an

error-prone pathway that involves exonucleolytic processing and subsequent rejoining

of the DNA ends without dependence on sequence homology. HR is initiated by

single-stranded invasion of a homologous DNA sequence and is mediated by Rad51.

Their suppression of the growth defect caused by the mei-3 mutation suggests that

QDE3 and RECQ2 function after strand invasion. RecQ homologues in human and

yeast can unwind Holliday junction-like DNA structures (Mohaghegh et al. 2001;

Bennett et al. 1999). BLM also can melt D-loops, which are formed during HR by

RAD51 (van Brabant et al. 2000). Because RecQ proteins are highly conserved, it is

likely that N. crassa QDE3 and RECQ2 behave in a similar manner. We speculate that

RecQ proteins are involved in the resolution of recombination intermediates and that a

lack of such resolution hinders the progress of DNA replication, resulting in the

observed growth defect.

The mutator phenotype of the qde-3 recQ2 mutant is caused by NHEJ-dependent

deletion formation and not by HR: Mutation spectrum analysis of the ad-3A locus

revealed that almost all the mutations that arose spontaneously in the qde-3 mutant and

the qde-3 recQ2 double mutant were deletions. PCR analysis of the ad-3B locus also

indicated that the ad-3B mutations obtained from the qde-3 and qde-3 recQ2 mutants

were predominantly deletions, especially large deletions. The mutator phenotype of the

double mutant was completely suppressed by mutation of mus-52, suggesting that

NHEJ is responsible for this phenotype. In contrast, the mutator phenotype was not

suppressed by mei-3 mutation, suggesting that HR is not involved. In addition, many

large deletions were formed at the ad-3A locus in the qde-3 recQ2 mei-3 triple mutant,

suggesting that HR is not required for the formation of deletions in the RecQ

homologue mutants.

BS cells and WS cells also show a mutator phenotype and an increased number of

deletion events (Warren et al. 1981; Tachibana et al. 1996; Fukuchi et al. 1989). There

are reports that joining of linear plasmid DNA is error-prone in these cells (Rünger and

Kraemer 1989; Rünger et al. 1994), and both of these findings offer indirect evidence

that NHEJ causes deletion in these cells. Our report provides direct evidence that

NHEJ-dependent deletion formation is responsible for the mutator phenotype in RecQ

homologue mutants. A number of studies also indicate a relationship between RecQ

helicases and NHEJ, which our findings support for the N. crassa RecQ homologues

QDE3 and RECQ2. However, the nature of this relationship is unknown. RecQ

homologues may control the rejoining efficiency of DSBs and/or the length of the

exonucleolytic processing of the DNA ends. The former possibility is supported by the

observation that over-expression of Ku70 in Drosophila melanogaster partially

suppresses defects conferred by mutations in the RecQ homologue Dmblm (Kusano et

al. 2001). The latter hypothesis is supported by the observation of error-prone joining of

linear plasmid DNA in human cells deficient in BLM or WRN (Rünger and Kraemer

1989; Rünger et al. 1994). The characteristic large deletions may result from

unregulated end-processing by NHEJ machinery.

Abnormal appearance of the qde-3 recQ2 double mutant is dependent on both HR

and NHEJ: The abnormal appearance of the qde-3 recQ2 double mutant is suppressed

by mutation in either mei-3 or mus-52, suggesting that this phenotype arises from a

pathway involving both HR and NHEJ. Accumulation of orange and black pigments

accompanied by the formation of spherical mycelia is a result of the uncontrolled

expression of genes involved in conidiation, carotenoid synthesis, hyphal formation, and

melanin production. As cancer cells proliferate in an uncontrolled manner, this

susceptibility to abnormal appearance is reminiscent of the predisposition to cancer in

BS patients. The mean age at which cancer is diagnosed in the BS-inherent population

is 24.4 years (German 1993) and cancer does not occur in children in this population.

The abnormal appearance of the qde-3 recQ2 double mutant is found only after growth

for several days. It might be true in all organisms that genomic dysregulation proceeds

at slow tempo, mediated by HR- and NHEJ- functions, when RecQ homologue genes

are mutated.

RecQ homologues may have a role in the suppression of spontaneous DSBs: The

characteristic deletions seen in RecQ mutants of N. crassa might be caused by

unregulated NHEJ, as discussed above. However, the increase in spontaneous mutation

rate may suggest an elevated frequency of DSBs in RecQ mutants. NHEJ is known to

function in DSB repair in the wild-type strain, so it cannot be that loss of QDE3 and

RECQ2 activates NHEJ to repair DSBs, resulting in the observed high mutation rate.

Since NHEJ is error-prone even in the wild-type strain, it is unlikely that loss of QDE3

and RECQ2 increases the tendency of NHEJ to be error-prone. We speculate that QDE3

and RECQ2 play roles in the suppression of DSBs. If this is the case, what mechanism

increases DSBs in the RecQ-deficient mutant?

The production of DSBs may be stimulated by HR dysfunction. If recombination

intermediates accumulate in the RecQ-deficient mutant, physical tension or processing

during mitosis may yield additional DSBs. However, since the HR-deficient qde-3

recQ2 mei-3 triple mutant retained the mutator phenotype, it is likely that DSBs arise by

another mechanism. DSBs are generated during endonuclease-mediated resolution of

Holliday junctions. BLM is thought to disrupt Holliday junctions formed at sites of

blocked replication forks by its potential reverse branch migration activity (Karow et al.

2000; Wang et al. 2000). Therefore, the increase in DSBs in the qde-3 recQ2 double

mutant may be due to a decrease in the unraveling of Holliday junctions formed at sites

of stalled replication forks and a resultant increase in endonuclease-mediated resolution

of these junctions.

The high sensitivity of the qde-3 recQ2 double mutant to HU and CPT supports the idea

that QDE3 and RECQ2 function in DNA replication, because replication is hindered by

these agents. We propose a model (Figure 5) to explain the mechanism of the growth

defect and genomic instability in the qde-3 recQ2 double mutant. If QDE3 and RECQ2

are non-functional, additional DSBs are formed by at the sites where replication forks

are stalled. Then, proteins involved in HR or NHEJ will be recruited to the DSB sites

for the repair of DSBs. HR events may not be completed normally without QDE3 and

RECQ2 and thus recombination intermediates accumulate, leading to the inhibition of

cell proliferation. In the absence of mei-3, proliferation-inhibiting DNA structures

derived from HR will not be made and cells can grow normally, but DSBs must then be

repaired by NHEJ and the extensive processing and subsequent ligation of the

nonhomologous ends yields deletions. Conversely, in the qde-3 recQ2 mus-52 triple

mutant, in which NHEJ is impaired, all DSBs will be repaired by HR, so deletions will

be less frequent but proliferation-inhibiting DNA structures made by HR will increase,

thus amplifying the growth defect. At present, there is no direct evidence that DSBs are

more frequent in the qde-3 recQ2 double mutant. Our current studies, focusing on DSB

formation during DNA replication, are expected to shed light on the important question

of how RecQ helicases function in the maintenance of genomic stability.

Acknowledgements

We thank Niji Ota for help in sequencing and Jane Yeadon for reviewing this

manuscript. This work was supported by Rational Evolutionary Design of Advanced

Biomolecules, Saitama Prefecture Collaboration of Regional Entities for the

Advancement of Technological Excellence, Japan Science and Technology Agency.

Literature Cited

AGUILERA, A., and H. L. KLEIN, 1988 Genetic control of intrachromosomal

recombination in Saccharomyces cerevisiae. I. Isolation and genetic

characterization of hyper-recombination mutations. Genetics 119: 779-790.

BENNETT, R. J., J. L. KECK and J. C. WANG, 1999 Binding specificity determines

polarity of DNA unwinding by the Sgs1 protein of S. cerevisiae. J. Mol. Biol.

289: 235-248.

BENNETT, R. J., J. A. SHARP and J. C. WANG, 1998 Purification and

characterization of the Sgs1 DNA helicase activity of Saccharomyces

cerevisiae. J. Biol. Chem. 273: 9644-9650.

BROSH, R. M., JR., D. K. ORREN, J. O. NEHLIN, P. H. RAVN, M. K. KENNY et al.,

1999 Functional and physical interaction between WRN helicase and human

replication protein A. J. Biol. Chem. 274: 18341-18350.

BROSH, R. M., JR., C. VON KOBBE, J. A. SOMMERS, P. KARMAKAR, P. L.

OPRESKO et al., 2001 Werner syndrome protein interacts with human flap

endonuclease 1 and stimulates its cleavage activity. Embo J 20: 5791-5801.

CHAGANTI, R. S., S. SCHONBERG and J. GERMAN, 1974 A manyfold increase in

sister chromatid exchanges in Bloom's syndrome lymphocytes. Proc. Natl.

Acad. Sci. USA 71: 4508-4512.

COGONI, C., and G. MACINO, 1999 Posttranscriptional gene silencing in Neurospora

by a RecQ DNA helicase. Science 286: 2342-2344.

CONSTANTINOU, A., M. TARSOUNAS, J. K. KAROW, R. M. BROSH, V. A.

BOHR et al., 2000 Werner's syndrome protein (WRN) migrates Holliday

junctions and co-localizes with RPA upon replication arrest. EMBO Rep. 1:

80-84.

DAVIS, R. H., and F. J. DE SERRES, 1970 Genetic and microbiological research

techniques for Neurospora crassa. Methods Enzymol. 17: 79-143.

DE SERRES, F. J., and H. G. KOLMARK, 1958 A direct method for determination of

forward-mutation rates in Neurospora crassa. Nature 182: 1249-1250.

DOE, C. L., J. DIXON, F. OSMAN and M. C. WHITBY, 2000 Partial suppression of

the fission yeast rqh1(-) phenotype by expression of a bacterial Holliday

junction resolvase. Embo J 19: 2751-2762.

DUTERTRE, S., M. ABABOU, R. ONCLERCQ, J. DELIC, B. CHATTON et al., 2000

Cell cycle regulation of the endogenous wild-type Bloom's syndrome DNA

helicase. Oncogene 19: 2731-2738.

ELLIS, N. A., J. GRODEN, T. Z. YE, J. STRAUGHEN, D. J. LENNON et al., 1995

The Bloom's syndrome gene product is homologous to RecQ helicases. Cell

83: 655-666.

EPSTEIN, C. J., G. M. MARTIN, A. L. SCHULTZ and A. G. MOTULSKY, 1966

Werner's syndrome a review of its symptomatology, natural history, pathologic

features, genetics and relationship to the natural aging process. Medicine

(Baltimore) 45: 177-221.

FREI, C., and S. M. GASSER, 2000 The yeast Sgs1p helicase acts upstream of Rad53p

in the DNA replication checkpoint and colocalizes with Rad53p in

S-phase-specific foci. Genes Dev. 14: 81-96.

FUKUCHI, K., G. M. MARTIN and R. J. MONNAT, JR., 1989 Mutator phenotype of

Werner syndrome is characterized by extensive deletions. Proc. Natl. Acad. Sci.

USA 86: 5893-5897.

GANGLOFF, S., C. SOUSTELLE and F. FABRE, 2000 Homologous recombination is

responsible for cell death in the absence of the Sgs1 and Srs2 helicases. Nat.

Genet. 25: 192-194.

GAYMES, T. J., P. S. NORTH, N. BRADY, I. D. HICKSON, G. J. MUFTI et al., 2002

Increased error-prone non homologous DNA end-joining--a proposed

mechanism of chromosomal instability in Bloom's syndrome. Oncogene 21:

2525-2533.

GERMAN, J., 1993 Bloom syndrome: a mendelian prototype of somatic mutational

disease. Medicine (Baltimore) 72: 393-406.

INOUE, H., and C. ISHII, 1984 Isolation and characterization of MMS-sensitive

mutants of Neurospora crassa. Mutat. Res. 125: 185-194.

ISHII, C., and H. INOUE, 1994 Mutagenesis and epistatic grouping of the Neurospora

meiotic mutants, mei-2 and mei-3, which are sensitive to mutagens. Mutat. Res.

315: 249-259.

ISHII, C., K. NAKAMURA and H. INOUE, 1998 A new UV-sensitive mutant that

suggests a second excision repair pathway in Neurospora crassa. Mutat. Res.

408: 171-182.

JIAO, R., C. Z. BACHRATI, G. PEDRAZZI, P. KUSTER, M. PETKOVIC et al., 2004

Physical and functional interaction between the Bloom's syndrome gene

product and the largest subunit of chromatin assembly factor 1. Mol. Cell. Biol.

24: 4710-4719.

KAMATH-LOEB, A. S., E. JOHANSSON, P. M. BURGERS and L. A. LOEB, 2000

Functional interaction between the Werner Syndrome protein and DNA

polymerase delta. Proc. Natl. Acad. Sci. USA 97: 4603-4608.

KAROW, J. K., A. CONSTANTINOU, J. L. LI, S. C. WEST and I. D. HICKSON,

2000 The Bloom's syndrome gene product promotes branch migration of

holliday junctions. Proc. Natl. Acad. Sci. USA 97: 6504-6508.

KATO, A., Y. AKAMATSU, Y. SAKURABA and H. INOUE, 2004 The Neurospora

crassa mus-19 gene is identical to the qde-3 gene, which encodes a RecQ

homologue and is involved in recombination repair and postreplication repair.

Curr. Genet. 45: 37-44.

KAWABE, T., N. TSUYAMA, S. KITAO, K. NISHIKAWA, A. SHIMAMOTO et al.,

2000 Differential regulation of human RecQ family helicases in cell

transformation and cell cycle. Oncogene 19: 4764-4772.

KITAO, S., I. OHSUGI, K. ICHIKAWA, M. GOTO, Y. FURUICHI et al., 1998

Cloning of two new human helicase genes of the RecQ family: biological

significance of multiple species in higher eukaryotes. Genomics 54: 443-452.

KITAO, S., A. SHIMAMOTO, M. GOTO, R. W. MILLER, W. A. SMITHSON et al.,

1999 Mutations in RECQL4 cause a subset of cases of Rothmund-Thomson

syndrome. Nat. Genet. 22: 82-84.

KUSANO, K., D. M. JOHNSON-SCHLITZ and W. R. ENGELS, 2001 Sterility of

Drosophila with mutations in the Bloom syndrome gene--complementation by

Ku70. Science 291: 2600-2602.

LEBEL, M., E. A. SPILLARE, C. C. HARRIS and P. LEDER, 1999 The Werner

syndrome gene product co-purifies with the DNA replication complex and

interacts with PCNA and topoisomerase I. J. Biol. Chem. 274: 37795-37799.

LEA, D. E., and C. A. COULSON, 1949 The distribution of the numbers of mutants in

bacterial populations. J. Genet. 49: 264-285.

LEE, S. K., R. E. JOHNSON, S. L. YU, L. PRAKASH and S. PRAKASH, 1999

Requirement of yeast SGS1 and SRS2 genes for replication and transcription.

Science 286: 2339-2342.

LONN, U., S. LONN, U. NYLEN, G. WINBLAD and J. GERMAN, 1990 An abnormal

profile of DNA replication intermediates in Bloom's syndrome. Cancer Res.

50: 3141-3145.

MAFTAHI, M., J. C. HOPE, L. DELGADO-CRUZATA, C. S. HAN and G. A.

FREYER, 2002 The severe slow growth of ∆srs2 ∆rqh1 in

Schizosaccharomyces pombe is suppressed by loss of recombination and

checkpoint genes. Nucleic Acids Res. 30: 4781-4792.

MANKOURI, H. W., T. J. CRAIG and A. MORGAN, 2002 SGS1 is a multicopy

suppressor of srs2: functional overlap between DNA helicases. Nucleic Acids

Res. 30: 1103-1113.

MOHAGHEGH, P., J. K. KAROW, R. M. BROSH JR, JR., V. A. BOHR and I. D.

HICKSON, 2001 The Bloom's and Werner's syndrome proteins are DNA

structure-specific helicases. Nucleic Acids Res. 29: 2843-2849.

MYUNG, K., A. DATTA, C. CHEN and R. D. KOLODNER, 2001 SGS1, the

Saccharomyces cerevisiae homologue of BLM and WRN, suppresses genome

instability and homeologous recombination. Nat. Genet. 27: 113-116.

NEWMEYER, D., 1984 Neurospora mutants sensitive both to mutagens and to

histidine. Curr. Genet. 9: 65-74.

NINOMIYA, Y., K. SUZUKI, C. ISHII and H. INOUE, 2004 Highly efficient gene

replacements in Neurospora strains deficient for nonhomologous end-joining.

Proc. Natl. Acad. Sci. USA 101: 12248-12253.

ONODA, F., M. SEKI, A. MIYAJIMA and T. ENOMOTO, 2000 Elevation of sister

chromatid exchange in Saccharomyces cerevisiae sgs1 disruptants and the

relevance of the disruptants as a system to evaluate mutations in Bloom's

syndrome gene. Mutat. Res. 459: 203-209.

OSHIMA, J., S. HUANG, C. PAE, J. CAMPISI and R. H. SCHIESTL, 2002 Lack of

WRN results in extensive deletion at nonhomologous joining ends. Cancer Res.

62: 547-551.

PICKFORD, A., L. BRACCINI, G. MACINO and C. COGONI, 2003 The QDE-3

homologue RecQ-2 co-operates with QDE-3 in DNA repair in Neurospora

crassa. Curr. Genet. 42: 220-227.

POOT, M., H. HOEHN, T. M. RUNGER and G. M. MARTIN, 1992 Impaired S-phase

transit of Werner syndrome cells expressed in lymphoblastoid cell lines. Exp.

Cell Res. 202: 267-273.

PURANAM, K. L., and P. J. BLACKSHEAR, 1994 Cloning and characterization of

RECQL, a potential human homologue of the Escherichia coli DNA helicase

RecQ. J. Biol. Chem. 269: 29838-29845.

RONG, L., and H. L. KLEIN, 1993 Purification and characterization of the SRS2 DNA

helicase of the yeast Saccharomyces cerevisiae. J. Biol. Chem. 268:

1252-1259.

RUNGER, T. M., C. BAUER, B. DEKANT, K. MOLLER, P. SOBOTTA et al., 1994

Hypermutable ligation of plasmid DNA ends in cells from patients with

Werner syndrome. J. Invest. Dermatol. 102: 45-48.

RUNGER, T. M., and K. H. KRAEMER, 1989 Joining of linear plasmid DNA is

reduced and error-prone in Bloom's syndrome cells. Embo J 8: 1419-1425.

SALK, D., K. AU, H. HOEHN and G. M. MARTIN, 1981 Cytogenetics of Werner's

syndrome cultured skin fibroblasts: variegated translocation mosaicism.

Cytogenet. Cell Genet. 30: 92-107.

SEKI, M., H. MIYAZAWA, S. TADA, J. YANAGISAWA, T. YAMAOKA et al.,

1994 Molecular cloning of cDNA encoding human DNA helicase Q1 which

has homology to Escherichia coli Rec Q helicase and localization of the gene

at chromosome 12p12. Nucleic Acids Res. 22: 4566-4573.

SINCLAIR, D. A., K. MILLS and L. GUARENTE, 1997 Accelerated aging and

nucleolar fragmentation in yeast sgs1 mutants. Science 277: 1313-1316.

STABEN, C., B. JENSEN, M. SINGER, J. POLLOCK, M. SCHECHTMAN et al.,

1989 Use of a bacterial Hygromycin B resistance gene as a dominant selectable

marker in Neurospora crassa transformation. Fungal Genet. Newsl. 36: 79-81.

TACHIBANA, A., K. TATSUMI, T. MASUI and T. KATO, 1996 Large deletions at

the HPRT locus associated with the mutator phenotype in a Bloom's syndrome

lymphoblastoid cell line. Mol. Carcinog. 17: 41-47.

TAMARU, H., and H. INOUE, 1989 Isolation and characterization of a

laccase-derepressed mutant of Neurospora crassa. J. Bacteriol. 171:

6288-6293.

VAN BRABANT, A. J., T. YE, M. SANZ, I. J. GERMAN, N. A. ELLIS et al., 2000

Binding and melting of D-loops by the Bloom syndrome helicase.

Biochemistry 39: 14617-14625.

VENNOS, E. M., and W. D. JAMES, 1995 Rothmund-Thomson syndrome. Dermatol.

Clin. 13: 143-150.

WANG, W., M. SEKI, Y. NARITA, T. NAKAGAWA, A. YOSHIMURA et al., 2003

Functional relation among RecQ family helicases RecQL1, RecQL5, and BLM

in cell growth and sister chromatid exchange formation. Mol. Cell. Biol. 23:

3527-3535.

WANG, W., M. SEKI, Y. NARITA, E. SONODA, S. TAKEDA et al., 2000 Possible

association of BLM in decreasing DNA double strand breaks during DNA

replication. Embo J 19: 3428-3435.

WARREN, S. T., R. A. SCHULTZ, C. C. CHANG, M. H. WADE and J. E. TROSKO,

1981 Elevated spontaneous mutation rate in Bloom syndrome fibroblasts. Proc.

Natl. Acad. Sci. USA 78: 3133-3137.

WATANABE, K., Y. SAKURABA and H. INOUE, 1997 Genetic and molecular

characterization of Neurospora crassa mus-23: a gene involved in

recombinational repair. Mol. Gen. Genet. 256: 436-445.

WATT, P. M., I. D. HICKSON, R. H. BORTS and E. J. LOUIS, 1996 SGS1, a

homologue of the Bloom's and Werner's syndrome genes, is required for

maintenance of genome stability in Saccharomyces cerevisiae. Genetics 144:

935-945.

WATT, P. M., E. J. LOUIS, R. H. BORTS and I. D. HICKSON, 1995 Sgs1: a

eukaryotic homolog of E. coli RecQ that interacts with topoisomerase II in vivo

and is required for faithful chromosome segregation. Cell 81: 253-260.

YAMAGATA, K., J. KATO, A. SHIMAMOTO, M. GOTO, Y. FURUICHI et al., 1998

Bloom's and Werner's syndrome genes suppress hyperrecombination in yeast

sgs1 mutant: implication for genomic instability in human diseases. Proc. Natl.

Acad. Sci. USA 95: 8733-8738.

YU, C. E., J. OSHIMA, Y. H. FU, E. M. WIJSMAN, F. HISAMA et al., 1996

Positional cloning of the Werner's syndrome gene. Science 272: 258-262.

Tables

Table 1. Strains of Neurospora crassa studied in this work.

Strain Genotype(allele) Source of reference

C1-T10-37A A Tamaru and Inoue (1989)

C1-T10-28a a Tamaru and Inoue (1989)

KTO-Q2R-5A A recQ2::hygr This study

KTO-Q2-2A A recQ2::hygr This study

KTO-r-17A A qde-3(RIP) Kato et al. (2004)

KTO-r-20a A qde-3(RIP) Kato et al. (2004)

KTO-Qd-32a a qde-3(RIP) recQ2::hygr This study

KTO-Qd-35A A qde-3(RIP) recQ2::hygr This study

CZ272-5a a mus-38 Ishii et al. (1998)

QMU38-2A A mus-38 qde-3(RIP) Kato et al. (2004)

KTO-2m38-1a a mus-38 recQ2::hygr This study

KTO-dm38-26A A mus-38 qde-3(RIP) recQ2::hygr This study

CY-10-9a a mei-3(SA10) Ishii and Inoue (1994)

KTO-2mi3-1a a mei-3(SA10) recQ2::hygr This study

KTO-dmi3-1A A mei-3(SA10) qde-3(RIP) recQ2::hygr This study

54yo-828-3 A mus-52::hygr Ninomiya et al. (2004)

KTO-dk8-33a A mus-52::hygr qde-3(RIP) recQ2::hygr This study

FGSC #3331 A ad-3A al-2 pan-2 cot-1 FGSC*

3331-b a ad-3A al-2 pan-2 cot-1 Laboratory stock

M80-C4-2A A ad-3B cyh-1 Laboratory stock

51-2-7 a ad-3B cyh-1 Laboratory stock

*: Fungal Genetics Stock Center

Table 2. Spontaneous mutation rates for the ad-3 loci

Median no. of

mutants m

Colony no.

(×105)

Wild type 0 0.3 56.4

qde-3 2 1.3 24.9

recQ2 0 0.3 33.3

qde-3 recQ2 2 1.3 15.0

qde-3 recQ2 mei-3 16 5.4 27.6

mus-52 0 0.3 35.9

qde-3 recQ2 mus-52

0 0.3 77.6

Average

no. of

nuclei

No. of nuclear

divisions

(×105)

Mutation

rate (×10-7)

Fold

increase

2.4 134.2 0.2 1.0

2.2 54.2 2.4 11.3

2.2 73.2 0.4 1.8

2.2 32.8 4.0 18.7

2.2 59.7 9.1 42.4

2.1 75.3 0.4 1.8

1.9 150.5 0.2 0.9

Table 3. PCR analysis of the ad-3A region

primers Strain Jug

No.

mutant

No. (Pst, M2) (L1, R1) (L2, R2) (L4, R4) (X1,Y1)

wild-type control + + + + +

qde-3 control + + + + +

7 1 + + + + +

2 - - - - +

3 - - - - +

8 1 + + + + +

9 1 - - - - +

2 - s s s +

3 - - - - +

4 - - - - +

5 - - - - +

6 - - - - +

7 - - - - +

qde-3 recQ2 control + + + + +

2 1 - - - - +

2 - - - - +

3 + + + + +

4 - - - - +

5 - - - s +

6 - - - - +

7 - - - - +

8 - - - - +

9 - - - - +

10 - - - - +

11 - - - - +

12 + + + + +

13 - - - - +

14 - - - - +

15 + + + + +

16 - - - - +

3 1 - - - - +

2 - - - s +

3 - - - - +

4 - s s s +

6 1 - s s s +

9 1 - - - - +

10 1 - - - - +

2 - - - - +

3 - - - - +

4 - - - - +

5 - - - - +

6 - - - - +

7 - - - - +

8 - - - - +

9 - - - - +

10 - - - - +

11 - - - - +

12 - - - - +

13 - - - - +

14 - - - - +

15 - - - - +

16 - - - - +

17 - - - - +

18 - - - - +

19 - - - - +

20 - - - - +

21 + + + + +

22 - - - - +

23 - - - - +

24 - - - - +

25 - - - - +

26 - - - - +

27 - - - - +

28 - - - - +

29 - - - - +

+: expected length fragments were amplified, s: shorter fragments were amplified,

-: no fragments were amplified.

Figure legends

Figure 1. Sensitivity of the qde-3, recQ2 and qde-3 recQ2 double mutants to mutagens

and other chemicals. (A, B, D) Approximately 105, 104, 103 or 102 viable conidia were

spotted from left to right onto the agar plates containing the indicated chemicals. The

final concentration of each chemical was as indicated. In the test of UV-sensitivity,

conidia were irradiated after spotting. (C) UV sensitivity of the wild-type (open circles),

the qde-3 mutant (filled squares), the recQ2 mutant (filled triangles), and the qde-3

recQ2 double mutant (filled diamonds) was measured quantitatively. Error bars indicate

the standard errors calculated from the data for three independent experiments.

Figure 2. Apical growth and morphology of the RecQ-homologue mutants. (A) Apical

growth of hyphae was measured by marking the growth front once or twice per day.

When growth reached the end of a tube, mycelia from the growth front were transferred

to a new tube. Crosses: the wild-type strain, open squares: qde-3 mutant, open triangles:

recQ2 mutant, filled circles: qde-3 recQ2 double mutant, filled diamonds: qde-3 recQ2

mei-3 triple mutant, filled triangles: qde-3 recQ2 mus-52 triple mutant. (B) Appearance

of the wild-type (top image in each panel) and the qde-3 recQ2 double mutant (lower

image in each panel). Photographs were taken from above (a) and beneath (b) the agar.

(C) Micrographs of the hyphal tips. Nuclei were stained with SYBR Gold and observed

by fluorescence microscopy (lower panels). Bars, 10 µm. (D) Colony morphology on

agar medium after incubation at 30 ˚C for 2 days. Bars are 1 cm long.

Figure 3. (A) PCR primers used to amplify the ad-3A ORF and flanking regions.

Arrows indicate the positions of PCR primers. The shaded box indicates the ad-3A ORF

and white boxes indicate DNA fragments amplified by PCR using these primers. (B)

PCR primers used to amplify the ad-3B ORF. Arrows indicate the positions of PCR

primers. The shaded box indicates the ad-3B ORF and the white box indicates the DNA

fragment amplified by PCR using these primers.

Figure 4. Sequence of spontaneous mutations within the ad-3A ORF. ad-3A mutants

arising in the qde-3 or the qde-3 recQ2 double mutant were subcultured and their ad-3A

genes were sequenced. The numbers above the sequences show the nucleotide position

from the first base of the start codon (ATG) of the ad-3A ORF.

Figure 5. A model to explain how the loss of function of RecQ helicases results in a

growth defect and mutator phenotype: In the wild-type, Holliday junctions formed by

regressed replication forks are mainly resolved by QDE3 and RECQ2, and few or no

DSBs result. If QDE3 and RECQ2 are not functional, Holliday junctions at stalled

replication forks are resolved by an endonuclease, creating DSBs. Repair of these DSBs

uses components of HR or NHEJ. However, HR is unsuccessful without QDE3 and

RECQ2 and proliferation-inhibiting DNA structures remain, causing the growth defect

in the qde-3 recQ2 double mutant. Without QDE3 and RECQ2, NHEJ repairs the DSBs,

causing large deletions, a characteristic of the qde-3 recQ2 double mutant. When QDE3

and RECQ2 are fully functional, the few DSBs that arise from endonuclease activity are

repaired normally by HR or NHEJ.

Figures