Plant Physiol. (1 996) 11 2: 51 3-524

Tissue-Specific Expression and Promoter Analysis of the Tobacco ltpl Gene’

Stefano Canevascini, Doina Caderas, Therese Mandel, Andrew J. Fleming, lsabelle Dupuis, and Cris Kuhlemeier*

lnstitute of Plant Physiology, University of Berne, Altenbergrain 21, CH-3013 Berne, Switzerland

The Nicofiana fabacum lfpl gene (Nflfpl) encodes a small basic protein that belongs to a class of putative lipid transfer proteins. These proteins transfer lipids between membranes in vitro, but their in vivo function remains hotly debated. This gene also serves as an important early marker for epidermis differentiation. We report here, the analysis of the spatial and developmental activity of the Nfltpl promoter, and we define a sequence element required for epidermis-specific expression. Transgenic plants were created con- taining 1346 bp of the Nflfpl promoter fused upstream of the P-glucuronidase (CUS) gene. In the mature aerial tissues, CUS activity was detected predominantly in the epidermis, whereas in younger aerial tissues, such as the shoot apical meristem and floral meristem, GUS expression was not restricted to the tunica layer. Unexpectedly, CUS activity was also detected in young roots, par- ticularly in the root epidermis. Furthermore, the Nflfpl promoter displayed a tissue and developmental specific pattern of activity during germination. These results suggest that the Nflfpl gene is highly expressed in regions of the plant that are vulnerable to pathogen attack and are thus consistent with the proposed function of lipid transfer proteins in plant defense. Deletions of the promoter from i t s 5’ end revealed that the 148 bp preceding the translational start site are sufficient for epidermis-specific expression. Sequence comparison identified an eight-nucleotide palindromic sequence CTACCTAC in the leader of Nfltpl, which i s conserved in a number of other lfp genes. By gel retardation analysis, the presence of specific DNA-protein complexes in this region was demonstrated. l h e characterization of these factors may lead to the identification of factors that control early events in epidermis differentiation.

Lipids are synthesized in the ER and in chloroplasts, from where they must be transported to various mem- branes via membrane vesicles, by lateral diffusion within the plane of the membrane through contact sites, or shut- tled by carrier molecules. In animals and fungi, LTPs can specifically bind different lipids and shuttle them between membranes (for a review, see Wirtz, 1991). In contrast, LTPs purified from plants have a broad phospholipid sub- strate specificity in vitro, similar to nonspecific LTPs of mammals (Douady et al., 1982; Kader et al., 1984; Watanabe and Yamada, 1986).

This work was supported by the Schweizerischer National- fonds and Stiftung zur Forderung der wissenschaftlichen For- schung an der Universitat Bern and the Human Capital Mobility Project, funded through the Bundesamt für Bildung und Wissen- schaft.

* Corresponding author; e-mail kuhlemeierQpfp.unibe.ch; fax 41-31-332-20-59.

The in vivo function of plant LTPs is controversial. The LTPs so far cloned contain a leader sequence responsible for insertion into the ER and subsequent secretion of the protein (Bernhard et al., 1991; Madrid, 1991). In situ hy- bridizations have shown accumulation of I tp transcripts in epidermal layers of tobacco (Fleming et al., 1992), tomato (Fleming et al., 1993), and Arabidopsis (Thoma et al., 1994), and anti-LTP antibodies recognized epitopes in cell walls and intercellular spaces in Arabidopsis (Thoma et al., 1993). Furthermore, in broccoli, LTP is the most abundant protein in the extracellular wax (Pyee and Kolattukudy, 1994, 1995). Such a specific localization of LTP in the epi- dermal cell wall is incompatible with a role in general lipid redistribution, and, in the light of a11 these observations, LTPs have been proposed to play a role in the transport of extracellular lipophilic material. This material could be required for the assembly of cutin (Sterk et al., 1991) and other amorphous barriers around the plant (Koltunow et al., 1990; Sossountzov et al., 1991; Kalla et al., 1994; Thoma et al., 1994).

Such extracellular LTPs might not simply play a passive role in the formation of structural barriers but might also have an active function in plant defense. Thus, in the course of an investigation of possible defense proteins in barley, Molina et al. (1993) isolated potent growth inhibi- tors of bacterial and fungal pathogens that acted synergis- tically with thionins. These substances were subsequently identified as nonspecific LTPs. The transcription of the ltp4 gene, coding for one of these proteins, was shown to be induced 9-fold 12 h after the inoculation of fungal patho- gen isolates (Molina and García-Olmedo, 1993).

We are primarily interested in the Ntltpl gene as an early marker for epidermis differentiation. In previous experi- ments we showed that the RNA is present in a11 aerial tissues but that abundance declines with age of the tissue (Fleming et al., 1992). It was concluded that expression was limited to the outer cell layer in young leaves and in the shoot apical meristem using in situ hybridization. How- ever, this was not the case in early leaf primordia, and expression was also observed in interna1 tissues. Here we present the results of promoter-GUS fusions in combina- tion with in situ hybridization, which corroborate and ex- tend the previous results. Our data are most easily incor- porated into a model in which LTPs play a role in the preformed defenses of the plant against pathogen invasion.

Abbreviations: LTP, lipid transfer protein; nt, nucleotide. 513

514 Canevascini et al. Plant Physiol. Vol. 1 1 2, 1996

Some discrepancies between RNA and GUS data are also apparent, which demonstrates the need for caution in in- terpreting results obtained with the GUS system. Finally, promoter deletion analysis identifies a 148-bp region suf- ficient for epidermis-specific expression.

MATERIALS AND METHODS

Nucleic Acid Manipulations

DNA manipulations were conducted using standard procedures as described by Sambrook et al. (1989). Escke- richia coli K12 strain BB-4 served as the host for plasmid amplifications.

Numbering of the Ntltpl gene was done so that the A of the initiator ATG was + l . The 5’ end of the mRNA was mapped to -106 (Fleming et al., 1992). The A nucleotide at position -1 was changed into C to create an NcoI site over the initiation codon using PCR. In all three constructs this NcoI site was used for fusion to the GUS-nos reporter gene derived from plasmid pMOGEN18 (Sijmons et al., 1990). Constructs with the full-length promoter of 1346 bp up- stream of the translation start site and 5’ deletions retaining 488 and 148 bp upstream, respectively, were cloned into the polylinker of pMON505 (Rogers et al., 1987).

The recombinant vector was mobilized from E. coli BB-4 into Agrobacterium LBA4404 in a triparental mating with E. coli HBlOl harboring pRK2013. Nicotiana tabacum cv Sam- sun were transformed as described by Horsch et al. (1985).

Plant Material

To determine the GUS activity of the primary transfor- mants, three clones were produced of each primary trans- formant and grown on Murashige-Skoog medium (Mu- rashige and Skoog, 1962) supplemented with 10 g/L SUC in a sterile environment with a 1ight:dark cycle of 16:8 h. When the plantlets had five to seven leaves, GUS activity was determined for the third leaf from the top of each plant in a fluorometric assay. As a control, three clones of a wild-type plant were used.

For experiments with seedlings, sterile transformant seeds (F, generation) were germinated on Murashige- Skoog supplemented with 10 g /L SUC and grown in a sterile environment with a 1ight:dark cycle of 16:8 h. At times indicated in the figure legends, roots and shoots of the seedlings were collected for RNA extraction and flu- orometric assays; they were cut 3 to 4 mm from the hypo- cotyl and the hypocotyl-root border region was discarded.

Determination of CUS activity

GUS activity in crude plant extracts was determined essentially as described by Jefferson (1987). Plant tissue was harvested and immediately homogenized by grinding in 0.5 mL of lysis buffer: 1 mM EDTA, 10 mM p-mercapto- ethanol, 0.1% Triton X-100 (Sigma), 50 mM Na,HPO,/ NaH,PO,, pH 7.0. Twenty-five microliters of the homoge- nate was added to 0.25 mL of lysis buffer containing 1 mM 4-methylumbelliferyl-~-~-glucuronide (Serva, Paramus,

NJ), vortexed, and incubated for 1 h at 37°C. The reaction was stopped with 1.75 mL of 0.2 M Na,CO, and fluores- cence was measured in a fluorometer (model TKO 100, A,, = 365 nm, A,,=460 nm; Hoefer Scientific Instruments, San Francisco, CA). Protein concentration was determined us- ing the Bio-Rad protein assay. For histochemical staining, plant tissues were incubated in 5-bromo-4-chloro-3-indoyl- P-D-glucuronic acid solution for 2 h to overnight until the blue staining had reached sufficient intensity. At the be- ginning of the reaction a slight vacuum was applied to permit a better infiltration of the substrate solution. Details of the staining, tissue embedding, and sectioning were described by Mandel et al. (1995).

RNA Analysis

RNA extractions and northern blots were carried out essentially as described by Fleming et al. (1992), with the only difference being that the full-length 710-nt-long XbaI- HindIII Ntltpl cDNA insert from the Bluescript vector pTM91-18 and the 1.4-kb EcoRI eIF-4A cDNA insert from the plasmid peIF-4A10 were used in a random primed reaction to synthesize the radioactive probes. As a control following hybridization with the Ntltpl probe, the mem- branes were stripped and hybridized with the eIF-4A probe, which hybridized to all of the RNA samples with similar intensity (results not shown). EIF-4A has been shown to be constitutively expressed in tobacco plants (Owttrim et al., 1994; Mandel et al., 1995). The intensity of the signals was measured on a molecular imager (model GS250, Bio-Rad).

In situ hybridization was performed as described by Cox and Goldberg (1988) and Sterk et al. (1991). As probes, sense and antisense transcripts of the ltpl cDNA (cutting the pTM91-18, respectively, with HindIII and XbaI and using the appropriate primers) were used.

Sequence Analysis

Sequence comparisons were performed with the GCG software (Wisconsin Genetics Computer Group, sequence analysis software package, version 6.2).

The sequences used in this work are stored in the Gen- Embl library with the following accession codes: N. tabacum cv Samsun ltpl, X62395; Hordeum vulgare cv Bomi ltpl and 472, X59253 and X69793, respectively; H. vulgare cv Hima- laya papi and cv kval, M15207 and X78205, respectively; and Sorgkum vulgare ltpl and 472, X71667 and X71668, respectively .

Electrophoretic Mobility Shift Assay

Nuclear extracts were prepared from leaf and root tissue of 8-week-old N. tabacum grown on hydroculture in a growth room. The method used was essentially that of Green et al. (1989). Probes were labeled by filling 3’ over- hangs using the Klenow fragment of E. coli DNA polymer- ase I and [a-32P]dCTP. DNA-binding reactions contained 1.5 to 2 Fg of poly(dI.dC), 1 X loading dye (8% glycerol, 1 X TBE [89 mM Tris, 89 mM boric acid, 2 mM EDTA], 0.02% bromphenol blue, and 0.02% xylene cyanol FF), 0.5 to 1.5

Tobacco ltpl 51 5

fmol (500-50.000 cpm) of radioactively labeled DNA frag- ments, and 3 to 4 Fg of nuclear extract. After a11 of the components were added, the reaction was adjusted to 10 FL with binding buffer (45 mM KCl, 1.1 mM EDTA, 0.5 mM DTT, 25 mM Hepes, pH 7.5, 5% glycerol). Specific unla- beled competitor (188- or 120-bp fragment), as well as unrelated DNA (35s DNA or Ntltpl-promotor sequence -1099 to -920), was included in the binding reactions. After a 20-min incubation at room temperature, samples were separated on a 4% native polyacrylamide gel in 0.25X TBE. If competitor DNA was used, 10 min of incubation were allowed before the probe was added and the reaction was incubated for a further 20 min. The gels were dried and autoradiographed.

RESULTS

Molecular Cloning and Analysis of the N t k p I Promoter

In previous work a cDNA and a genomic clone encoding a protein with homology to a maize LTP were isolated (Fleming et al., 1992). The 5’ end of the mRNA was deter- mined by nuclease S1 protection analysis. The genomic clone had only a 310-bp sequence upstream of the ATG. To obtain an additional upstream DNA region of the Ntltpl gene, the genomic clones that had been isolated previously (Fleming et al., 1992) were analyzed further. A 5-kb frag- ment was subcloned, sequenced, and found to contain a 1346-bp sequence upstream of the translation start codon (Fig. 1). This 1346-nt sequence contains the putative TATA box at position -135, -29 nt from the transcription start (Fleming et al., 1992).

The Ntltpl-promoter sequence was compared with other ltp-promoter sequences reported in the literature. An 18-nt AT-rich perfect palindrome (S1 box in Fig. 1) was found at position -603 and a second 8-nt perfect double palindrome CTAGCTAG (Dl box in Fig. 1) was found at position -57 and, partially conserved (6 of 8 nt identity), at position -95 in the leader region of the Ntltpl promoter. The D1 box is also present in the leader of H . vulgare ltpl and in its

-1346

-1210

-1190

-1110

-1030

-950

-810

-190

-710

-630

-550

-410

-390

-310

-230

-150

-10

putative homolog Hvpapi at position -44 and, partially conserved, at position -24 from the ATG (Mundy and Rogers, 1986; Skriver et al., 1992); in the promoter region of H. vulgare ltp2 at position -84 from the ATG (Kalla et al., 1994); in S. vulgare Itpl at position -184 and, partially conserved, three times more at position -103, -75, and -63 from the ATG; and in S. vulgare ltp2 at position -173 and, partially conserved, twice at positions -160 and -192 from the ATG (Pelèse-Siebenbourg et al., 1994) (Table I).

To investigate the spatial regulation of the Ntltpl pro- moter, the 1346-bp promoter fragment was fused to the GUS gene and transformed via Agrobacterium into N. taba- cum cv Samsun. Fifteen independent transformants were obtained and tested for GUS activity. The transformants showed different intensities of GUS activity, the highest being 150-fold more active than the lowest (Fig. 2). This variability in GUS expression is probably due to the tran- scriptional activity of the region in which the construct was inserted.

Tissue sections and intact seedlings of a11 the indepen- dent transformants at various stages of development were stained from 2 h to overnight and the pattern of GUS staining was recorded. Thirteen of 15 lines exhibited qual- itatively similar patterns of expression of GUS activity. The intensity of the GUS staining decreased with the age of the tissue, confirming the presence of a developmental gradi- ent in Ntltpl expression previously shown at the leve1 of Ntltpl transcript accumulation by Fleming et al. (1992).

The Ntltpl Gene 1s Specifically Expressed in the Mature Plant

Previous in situ hybridization data indicated that the Ntltpl transcript was localized to the leaf epidermis (Flem- ing et al., 1992). Analysis of leaf tissue from plants trans- genic for the 1346-GUS construct revealed that the pattern of GUS expression was indeed predominantly restricted to the epidermis, as shown in Figure 3, A and B. Moreover, GUS signal was not uniformly distributed within the epi- dermis; there seemed to be a higher concentration in the

-1271

-1191

-1111

-1031

-951

-811

-191

-111

-631

-551

-411

-391

-311

-231

- 1 5 1

- 7 1

13

Figure 1. Ntltpl promoter sequence of the 5’ region upstream from the ATG start codon. The nt’s are numbered starting from the A (+1) of the ATG start codon. The putative TATA box at position -1 35, the transcription start at position -106, and the ATG start codon are underlined. The 18-nt-long palindrome S1 at position -603 and the 8-nt-long palindrome D1 at positions -57 and, partially conserved, at position -95 are shown in bold type.

51 6 Canevascini et al. Plant Physiol. Vol. 11 2, 1996

Table 1. Sequences related to the 01 box found at the ATG-upstream region o f Itp genes from different species and the hva 1 gene from barley

Positionj

a b Species Gene Sequence Reference

N. tabacum cv Samsun Itpl CCAACACTAGCTCCTACT 11 -95 Fleming et ai., 1992

S. vulgare ltpl CTACTGCTCTAGCTACCTCC -1 75 Pèlese-Siebenburg et al., 1994 CCCCTAGCTAG ATACTT 49 -57

TCTCCTCACCAGCTAGCACT -103 CATTCAAACCTACTAC - 75 CACAACCTAGC -63

ltp2 CGCTAGCTAGCTACT -173 Pèlese-Siebenburg et al., 1994 TACCTAGCTC -160 TCTCCTCACCAGCTAG -92

H. vulgare cv Bomi ltpl CATCACTAGCTAGTACCT 23 -44 Linnestad et ai., 1991 CTACTGTTAGCTACAG ATT 43 - 24

ltp2 CCCCTAGCTACAAACTT -1 5 - 84 Kalla et ai., 1994

hval ACCCCCTAGCTAGTTTAA -293 -395 Straub et al., 1994 H. vulgare cv Himalaya PaPi CATCACTAGCTAGTACGT 23 -44 Mundy and Rogers, 1986

Consensus C CTAGCTAG TACT

a The distance (in bp) from the putative a: transcription start site; b: translation start site.

guard cells forming the stoma. This is apparent both in Figure 3B and, at a higher magnification, in Figure 3C. Cross-sections through transgenic stems also revealed a predominantly epidermis-restricted pattern of GUS expres- sion (Fig. 3D). However, within the sections there was also a component of GUS expression that was not restricted to the epidermis. For example, in Figure 3A some cells of the cortex on the adaxial side of the mid-rib of the leaf express the Ntltpl-GUS construct. A low GUS staining was also observed in the spongy parenchyma of leaves (Fig. 3B).

wt 9 81 84 50 78 7 64 2 40 1 75 53 59 3 82

Transformants nr.

Figure 2. Fluorometric activity of the 1346-GUS primary transfor- mants. Primary transformants were grown on Murashige-Skoog me- dium containing l O g/L Suc on a 1ight:dark cycle of 16:8 h at 25°C. When the plantlets had five to seven leaves, CUS activity was determined for the third leaf from the top of the plant (n = 3). wt, Wi ld type.

Such nonepidermal expression of the Ntlfpl promoter was most obvious in sections of tissue containing small nondifferentiated cells. For example, Figure 4, A to C, show longitudinal sections through the stem of an Ntltp’l-GUS transgenic plant taken at different positions along the apical-basal axis of the plant. In the most dista1 region (Fig. 4A) at the junction of the stem and a petiole, a high GUS expression can be observed in the axis, with the blue signal extending radially from the epidermis into the outermost layers of the cortex and the axillary meristem. At more proximal positions along the stem (Fig. 4, B and C), the signal in the cortex progressively decreases and the epider- mis-specific component of the expression pattern becomes more apparent.

Nonepidermal expression of the 1346-GUS construct is also observed in sections through vegetative (Fig. 4D) and floral (Fig. 4E) meristems, in cortical cells of the young leaf mid-rib (Fig. 4F), and, in germinating seedlings, in cortical cells of the young root at the boundary with the hypocotyl (Fig. 4G). In these examples (meristem, young leaf, and young root) it was difficult to distinguish any strong pref- erential expression of the GUS construct in the epidermis, indicating that the expression pattern observed was not simply the result of diffusion following a high localized activity of the ltpl promoter.

The Nfltpl Cene 1s Specifically Regulated during Cermination

The observation of expression of the 1346-GUS construct in young cells of the germinating root led us to examine further the expression pattern in the germinating seedling, since both our previous data (Fleming et al., 1992) and those of other groups (Skriver et al., 1992; Kotilainen et al., 1994; Pyee and Kolattukudy, 1995) suggested that LTP gene expression is restricted to aerial portions of the plant. However, examples in which an LTP protein (Thoma et al., 1993) or l t p transcripts (Molina and García-Olmedo, 1993; Krause et al., 1994) are found in roots are known.

Tobacco /fp1 517

uFigure 3. Histochemical GUS assay of the 1346-GUS transformants shows that the GUS stain ac-cumulates in the epidermis of mature tissues. Aand B, Hand cross-sections through a young leaf.Bars = 560 and 170 /am, respectively. C, Phase-contrast micrograph of a stripped epidermis. Theepidermis cells are out of focus because they arelying on a lower plane than the guard cells. Bar =40 /am. D, Hand cross-section through a youngstem. Bar = 420 jam.

Analysis of transgenic seeds following imbibition in-dicated a localized activity of the Ntltpl promoter to-ward the micropylar pole of the seed, as shown in Figure5A. This signal was predominantly visible in the integ-uments surrounding the micropyle, and, indeed, dissec-tion of the embryo from the seed coat followed by anal-ysis of GUS expression indicated that expression of theNtltpl promoter in the imbibing embryo was virtuallyundetectable (data not shown). Subsequent to the emer-

gence of the radicle, the GUS signal became apparentthroughout the hypocotyl and cotyledons of the seed-ling, and it remained high in the integuments surround-ing the micropyle (Fig. 5B). To verify the GUS expressionpattern seen in the germinating seedling, we performeda series of in situ hybridizations using an antisense probefor the Ntltpl transcript. Surprisingly, at a developmen-tal stage equivalent to that shown in Figure 5B, in situhybridization revealed a predominantly epidermis-

m

sp sp

Figure 4. Histochemical GUS assay of theNtltpl-GUS transformants showing that GUSactivity is very high and not epidermis-specificin young, growing tissues. A to C, Hand longi-tudinal sections through a 1-week-old stem.Bar = 830 /am. D, Longitudinal section of ashoot apical meristem. m, Meristem; Ip, leafprimordium. Bar = 40 /am. E, Longitudinal sec-tion of a floral meristem at the sepal stage, sp,Sepal primordium. Bar = 85 /am. F, Hand cross-section of a young petiole. Bar = 330 /am. G,Longitudinal section of the stem-root border re-gion in a young seedling, h, Hypocotyl; v, vas-cular tissue; e, root epidermis; c, cortex cells.Bar = 250 /am.

518 Canevascini et al. Plant Physiol. Vol. 112, 1996

D

f

Figure 5. Histochemical CUS assay of the Nf/tpl-GUS transformants and in situ hybridization. The Nt/fpl promoter drivesa developmentally regulated expression of the CUS marker gene during germination and seedling growth. A, Dark-fieldmicrograph of a 1-d imbibed seed. The CDS stain is revealed as a pink signal. The arrow shows the site of radiclepenetration. Bar = 280 fj.m. B, Dark-field micrograph of a 3-d-old seedling with the cotyledons still in the seed envelope.The thin arrow shows the endosperm at the site of the penetration. The thick arrow shows the hypocotyl adaxial site wherethe maximal CUS activity is found. Bar = 280 jam. C and D, Longitudinal (C) and cross-sections (D) of 3-d-old seedlings.The sections were hybridized with the Ntltpl cDNA antisense probe. Signal is seen as a dark precipitate in these bright-fieldmicrographs. The thick arrows show the hypocotyl adaxial site where the maximal Nf/(p1 mRNA concentration is found.Bars = 420 and 110 j^m, respectively. E, A 4-d-old seedling showing CUS activity in the bent hypocotyl marked by a thickarrow. Bar = 830 jim. F, Six-day-old seedlings showing GUS activity in roots at the hypocotyl-root border region. Bar = 1mm. G, Nine-day-old seedling showing GUS activity in root epidermis and in the shoot apex and the petioles of thecotyledons (thick arrow). The site of the root apex is marked by the thin arrow. Bar = 1 mm.

specific signal restricted to the cotyledons and hypo-cotyl, reaching the maximal intensity in the adaxial siteof the hypocotyl (arrow in Fig. 5, C and D).

As the cotyledons expanded and were drawn back-ward via the hypocotyl hook, GUS expression becamelimited to the hypocotyl region and the apex between thecotyledons (Fig. 5E). At a later stage of development, theapical hook unfurled and GUS expression was restrictedto a portion of tissue at the shoot/root boundary (Fig.5F). This area is equivalent to that shown in cross-sectionin Figure 4G, indicating a nonepidermal localization ofthe GUS signal.

The Ntltpl Promoter Is Active in the Root Epidermis

During subsequent elongation and formation of the firsttrue leaves, GUS expression in the aerial portion of theplant was highest in the region of the shoot apex (Fig. 5G).Previous data had indicated a gradient of Ntltpl expressionwithin the plant, with the highest level of Ntltpl transcriptsbeing measured in the apical part of the plant (Fleming etal., 1992). However, at this stage of seedling developmentthe most striking expression of the 1346-GUS construct wasobserved in the portion of the root that had generated root

hairs (Fig. 5G). Analysis of cross-sections (Fig. 6A) andlongitudinal sections (Fig. 6B) of roots at this stage ofdevelopment revealed the predominantly epidermal na-ture of this expression pattern. We have previously arguedthat histochemical GUS data are prone to misinterpretationand that it is essential to perform proper controls withconstitutively expressed genes (Mandel et al., 1995). Herewe show the expression of 35S-GUS and NeIF-4A10-GUS,both of which are expected to be evenly expressed in allcells of the root (Fig. 6, C and D). These promoters driveGUS expression in all cells of the root, and the patternobtained is clearly different from that seen with the Ntltplpromoter. Thus, we conclude that the Ntltpl gene directsexpression in the root epidermis, with occasional cells ofthe outer cortex showing relatively high GUS signals.

Since our previous analysis of mature roots had failed todetect significant levels of Ntltpl transcripts, we performeda northern blot analysis of Ntltpl transcript levels in RNAextracted from precisely staged root tissue following em-bryo germination. The results of this analysis, shown inFigure 7, A and B, indicate that Ntltpl transcripts areindeed present in young root tissue. The level of Ntltpltranscript is higher than that measured in RNA extractedfrom mature root tissue but is still relatively low comparedwith that measured in aerial parts of the plant (40 times less

Tobacco /fp1 519

Figure 6. Cross-section (A) and longitudinalsection (B) of roots of 16-d-old seedlings show-ing CDS activity in root tissue, e, Root epider-mis; c, cortex cells. Bars = 85 and 43 ^m,respectively. C and D, Cross-sections of roots of16-d-old seedlings of 4A-10-GUS (C) and 35S-CUS (D) transgenic plants. Bars = 90 and 100/urn, respectively.

than in expanding leaves, results not shown). The trend ofincreasing Ntltpl transcript level in the root during earlydevelopment correlated with the measured GUS activityin transgenic roots at equivalent stages (compare B and C,Fig. 6).

Delineation of Sequence Elements Required forEpidermis-Specific Expression

Two 5' deletions were constructed starting from the1346-GUS construct. These contained 488 and 148 bp ofsequence upstream of the translational start site, respec-tively. Since the 5' untranslated leader is 106-nt long (Flem-ing et al., 1992), the shorter deletion retains only 42 bp ofuntranscribed DNA, 13 bp of which are upstream of theTATA-box. The deletions were fused to the GUS-nos 3'reporter gene and introduced into tobacco. Ten and 14independent transgenic plants were obtained for the 488-GUS and the 148-GUS constructs, respectively. Fa seedlingswere separated into roots and shoots, and GUS enzymaticactivity was determined fluorometrically (Fig. 8). The ac-tivity in shoots was lower than in roots in all three trans-genic families. The -488 deletion did not show greatchanges in activity, compared with the -1346 deletion. Incontrast, GUS activity decreased consistently with the— 148 deletion, showing a particularly low expression inshoots.

To determine whether deletion of upstream DNA com-promised the spatial distribution of GUS expression, theenzyme was detected histochemically in plastic sections.The low activity and variability in shoots of the —148deletions precluded a reliable determination of tissue spec-ificity. In roots, however, expression was sufficiently highto obtain consistent results. A clear epidermis-specific ex-pression was observed with both deletions (—488 and— 148), which was indistinguishable from that shown inFigure 6, A and B, for the 1346-GUS construct. Therefore,we conclude that minimal elements required for epidermis-

specific expression reside in the 148 bp preceding the trans-lational start site.

Proteins Binding to the Minimal Sequence

Based on the results of the in situ localization studies,we focused our interest on the smallest promoter dele-tion construct, the 148-bp fragment, and attempted tocharacterize DNA-protein interactions by using electro-phoretic mobility shift assays. Tobacco nuclear proteinextracts were prepared from leaf and root tissue of8-week-old plants and were incubated with a 32P-labeled— 148 DNA fragment. When using leaf extracts, one re-tarded band was observed, indicating the formation of aDNA-protein complex (Fig. 9A). The addition of a 500-fold molar excess of unlabeled 148-bp fragment as aspecific competitor had no effect on binding of the la-beled probe. Only at a 1000-fold excess was bindingreduced. A fragment containing the cauliflower mosaicvirus TATA box, and added at the same molar concen-tration, did not interfere with binding.

We reasoned that the very high amount of competitorrequired might reflect the presence of abundant generaltranscription factors binding to the TATA box. Therefore, aslightly shorter fragment was created in which the TATAbox was no longer present (deletion —120 to —2; Fig. 9B).Three DNA-protein complexes were detected when thisfragment was used as a radiolabeled probe (Fig. 9B, lane 2).These interactions were competed away by increasingamounts of the nonlabeled 148-bp fragment (lanes 3-5). Itis interesting that a new band appeared with a highermigration rate when competition with the 148-bp fragmentwas carried out but not with the cold probe as a competitor.No competition was observed when an unrelated DNAfragment was included in the binding reaction. This indi-cates that the factors forming the three retarded complexesare specific for the Ntltpl —120 to -2 promoter sequence.

520 Canevascini et al. Plant Physiol. Vol. 112, 1996

900 nt -

I \

I10 11

t(days)

60

g o -

I 6 "

1 2-

S n -

_ B

i 1 1 n•

9 10 11t(days)

60

160 -

120 -

80 -

40 -

I

T

IT

7 8 9 10 11t (days)

60

Figure 7. Ntltpl mRNA concentration and GUS activity in roots aredevelopmental^ regulated. Seeds of the transformant number 40were germinated on Murashige-Skoog medium under a light:darkcycle of 16:8 h. Roots were collected from the 7-, 8-, 9-, 10-, and11-d-old seedlings grown on Murashige-Skoog medium and from60-d-old plants grown on soil (transformant no. 64) and, in parallel,RNA extracted and GUS activity measured in a fluorometric assay.Ten micrograms of total RNA was loaded in each lane for thenorthern blot. A, Northern blot hybridized with the Ntltp] antisenseprobe. B, Nf/rpl mRNA quantification. The bands of the northern blotshown in A were quantified on a phosphorimager. C, FluorometricGUS activity. The GUS activity of the 60-d-old plants (transformantnumber 64) cannot be directly compared with those reported for the7- to 11-d-old plants (transformant no. 40) because a different trans-formant line was used.

No specific interactions were detected with extracts de-rived from roots (results not shown).

DISCUSSIONOne approach to understanding the function of the var-

ious plant LTPs cloned is to analyze their pattern of ex-

pression during plant development; consensus patterns ofexpression presumably indicate consensus functions. Theuse of promoter-GUS fusions introduced into transgenicplants provides a powerful system for the relatively facileexamination of gene tissue expression pattern in variousorgans at various stages of development under various

60

13

'a

40 -00

oaex

o

CO

O

240

220

80 -

60 -

20 -

R S R S R S R SA1346 A488 A148 wt

nR S

A1346R SA488

R SA148

R Swt

B-Transcription

GUS nos 3'

-1346 ATG

GUS nos 3'

-488 ATG

GUS nos 31

ATG

Figure 8. A, Fluorometrically measured GUS activity of Nt/fp1-GUSconstructs in 15-d-old transgenic tobacco seedlings. Inset showsGUS activity measured in individual transgenic lines from which themean data (shown on top of the bars in the large graph) were derived.R, Root; S, shoot; wt, wild type; MU, methylumbelliferone. B, Sche-matic diagram of the constructs used to create the -1 346, -488, and-148 Itp deletion-GUS transgenic plants.

Tobacco /tp1 521

competitor:148 bp fragment35STATA

500x lOOOxSOOxlOOOx

B

competitor:148 bp fragment120 bp fragment-1099 to-920

20x lOOx 300x300x

lOOx SOOx

-Iruucription pTranlcription

-148 ATO -120 ATG

Figure 9. A, In vitro binding of nuclear leaf proteins to the 148-bp fragment of the Nf/fpl promoter. Radiolabeled fragments(0.64 fmol) were incubated with 2 jug of poly(dl.dC) in the absence (lane 1) or presence (lanes 2-6) of 4 fj.g of tobacconuclear leaf extract from 8-week-old tobacco plants. The molar excess of unlabeled competitor DNA in the binding reactionsare indicated. The 35S DNA is the minimal promoter of the cauliflower mosaic virus. Arrow, Large size complex; F, freeprobe. The scheme below the retardation assay shows the 148-bp fragment used in this experiment. B, In vitro binding ofnuclear leaf proteins to the Nf/tpl promoter sequence from -120 to -2 bp. Radiolabeled fragments (0.63 fmol, -120 to -2)were incubated with 1.5 jug of poly(dl.dC) in the absence (lane 1) or presence (lanes 2-8) of 3 ;u.g of tobacco nuclear leafextract. Arrows indicate the three new bands. F, Free probe. The scheme below the retardation assay shows the 120-bpfragment used in this experiment.

environmental conditions. Moreover, the cloning and anal-ysis of such promoter sequences allows the dissection ofregulatory elements within the promoter.

The Ntltpl Expression Pattern Contains BothEpidermal and Nonepidermal Components

In the 1346-GUS transformants GUS activity in relativelymature leaves and stems was predominantly epidermis-specific. This is in accord with our previous analysis ofNtltpl transcript distribution (Fleming et al., 1992) andwith the various reports on lip gene expression performedin other species (Sossountzov et al., 1991; Clark andBohnert, 1993; Fleming et al., 1993; Thoma et al., 1993,1994), in which at least some degree of epidermis specific-ity was described. However, even in mature leaves andstems at least some faint GUS staining was generally visi-ble in nonepidermal tissue. This nonepidermal expressionwas most apparent in tissue containing small, relativelynondifferentiated cells, e.g. apical meristems, axillary meri-stems, and hypocotyl tissue. In contrast, in situ hybridiza-tion analysis of these tissues revealed a predominantlyepidermal restriction of transcript distribution (Fig. 5, Cand D). However, it should be remembered that the twomethods of analysis, in situ hybridization and GUS histo-chemistry, reveal different aspects of gene expression. Insitu hybridization analysis provides an image of RNA dis-tribution at an instant in time, whereas GUS histochemistryreveals the accumulation of the GUS protein in cells over a

period of time. Analysis of GUS enzyme activity may thusreveal areas of promoter activity that are poorly resolvedby in situ hybridization.

Although lip 1 transcripts may accumulate in epidermalcells, our data indicate that the ltp\ gene is expressed tosome extent in some nonepidermal tissues.

One surprising observation in this study was the high GUSactivity in the roots during seedling germination. Our previ-ous analysis of Ntltpl mRNA accumulation failed to detectany transcripts in mature root tissue, in accord with the dataon other Itp genes. However, an analysis of Ntltpl transcriptlevels in RNA extracted from the precise developmental stageindicated by the GUS assay did reveal a low, but detectable,level of Ntltpl mRNA. This expression is predominantly, butnot exclusively, restricted to the epidermis and roothairs. In addition to providing an example of the powerof the GUS reporter gene system in revealing specificgene expression patterns, the activity of the Ntltpl pro-moter in the root epidermis has a bearing on the poten-tial function of the encoded LTP. The northern blot data(Fleming et al., 1992; this work) show that the NtltplmRNA accumulates at high levels in the young tissues inthe aerial part of the plant and at a much less extent inthe roots. This is also true for 10- to 20-d-old seedlings,in which the Ntltpl transcript accumulates 40 times morein the apex than in the roots (results not shown). In 10-to 20-d-old seedlings of Ntltpl-GUS transgenic lines,GUS activity was higher in roots than in aerial tissues

522 Canevascini et al. Plant Physiol. Vol. 112, 1996

(Figs. 5G and 8). A different GUS mRNA or GUS-protein stability in these tissues could explain this discrepancy.

In two cases we observed a clear discrepancy between the GUS data and the results obtained from in situ hybridization. Both in the shoot apical meristem (Flem- ing et al., 1992) and in young seedlings (Fig. 5, A-D) in situ hybridization shows clearly that expression is pref- erentially in the epidermis, whereas GUS studies do not. Explanations could include different sensitivity of the two assays, diffusion of the 5-bromo-4-chloro-3-indoyl- p-D-glucuronic acid reaction product, or lack of regula- tory elements in the promoter-GUS construct. Whichever explanation is accepted we believe that detailed histo- chemical data obtained with reporter genes are more trustworthy when they are accompanied by analysis at the RNA level. In the case of roots in which low RNA levels precluded in situ hybridization, we performed GUS assays with two constitutive control promoters (Fig. 6, C and D). Both the 35s and the NeIF-4A10 promoter clearly showed fairly uniform expression in a11 cell types of the root. The contrast of these expression patterns with that obtained for the Ntl tpl promoter (Fig. 6, A and B) instills confidence that Ntltpl expression is indeed limited to the root epidermis.

The Potential Role of LTP in Plant Defense

LTPs have been proposed to play a role in cutin deposi- tion. In agreement with this hypothesis, GUS activity in the Ntltpl-GUS transgenic plants was always detected in cells coated by a cutin layer. For example, the GUS staining was found in the epidermis of the aerial part of the plant, showing the highest apparent intensity in the guard cells (Fig. 3, A-C). The higher GUS activity in guard cells cor- relates with the higher concentration of LTPs in cell walls of guard cells observed in Arabidopsis by Thoma et al. (1993). A low GUS staining was observed in the spongy parenchyma of leaves, where the presence of a thin cuticle on the surface of the cells facing the stomatal space has been observed (Esau, 1969).

It appears to be generally accepted that roots do not synthesize cutin (Buvat, 1989; Thoma et al., 1993), so the expression of Ntltpl in root tissue would indicate that the encoded protein cannot function exclusively in cutin syn- thesis. However, it must be mentioned that for severa1 plants cutin deposition in roots has been reported (Scott et al., 1958; Esau, 1969).

An alternative hypothesis, that LTPs function in the in- tracellular trafficking of lipids (Sossountzov et al., 1991), is supported by our observation that the Ntltpl gene is ex- pressed to some level in various nonepidermal tissues. However, an exclusive function in such intracellular trans- port is difficult to reconcile with the observed epidermis- specific component of ltp gene expression reported both in this and other studies. In particular, the presence of signal peptide sequences and the extracellular immunolocaliza- tion of LTPs suggest that a major function of LTPs lies outside the plasma membrane, in particular in the epider- mis. (Bernhard et al., 1991; Thoma et al., 1993).

One correlation that can be drawn from this study is that a high Ntltpl promoter activity occurs in parts of the plant that are vulnerable to physical disruption and, thus, to potential invasion by pathogens. For example, tissue at the micropylar pole of the embryo, hypocotyl tissue at the shoot/root boundary, root hairs, stem/leaf axils, and leaf and stem epidermis are a11 areas of the plant that are liable to physical damage either as a result of plant growth or environmentally induced physical stress. Given that there is evidence that LTPs can function to inhibit pathogen growth (Terras et al., 1992; Molina and García-Olmedo, 1993; Molina et al., 1993) and that the specific expression of other genes with a potential role in plant defense has been shown to occur in similar parts of the plant, e.g. glucanase in the micropylar integuments (Vogeli-Lange et al., 1994); chalcone synthase at the rootlshoot boundary (Schmid et al., 1990), it is tempting to speculate that a significant function of LTP lies in being a component of a preformed defense at areas of likely pathogen invasion.

Promoter Elements Required for Epidermis-Specific Expression

Northern blot data indicated that the Ntltpl gene is rel- atively highly expressed in young aerial tissues and is barely detectable in roots. In contrast, the 1346-GUS con- struct confers a higher expression in roots than in shoots. The simplest explanation for this discrepancy is that quan- titative enhancer elements conferring expression in shoots are located upstream of -1346.

Promoter deletion analysis of the Ntltpl promoter indi- cates that 148 bp of the 5’ flanking region are sufficient to regulate a mainly epidermis-specific gene expression, but elements in the upstream sequences are necessary to achieve maximal expression of the GUS gene in transgenic F, seedlings. Indeed, gel retardation assays demonstrated that there was specific binding of leaf nuclear factors to the region between -438 and -203 (data not shown).

The protein-binding activities of most interest are the ones on the 148-bp fragment, since the minimal require- ments for correct spatial distribution are met by this DNA sequence. One retarded band could be detected by incuba- tion of this fragment with leaf nuclear protein extract. The DNA-protein complex migrated very slowly and hardly entered into the gel, indicating a large complex. A 1000- fold excess of unlabeled probe reduced binding, whereas a fragment containing the 35s TATA box did not. Our hy- pothesis is that the high excess of specific competitor re- quired reflects the presence of abundant general transcrip- tion factors associated with the Ntltpl TATA box, as is the case in other organisms (Conaway and Conaway, 1993; Buratowski, 1994). In a recently published work, the inter- action of initiator and downstream elements with subunits of the transcription factor IID complex (TATA box-binding protein-associated factors) was discussed and the data sug- gest the involvement of these interactions in promoter selectivity and transcriptional regulation (Verrijzer et al., 1995). In plants, evidence exists that points to sequences close to the TATA box as elements important for light regulation and tissue specificity (Morelli et al., 1985; Ku-

Tobacco ltpl 523

hlemeier e t al., 1989). Similarly, the region around the Ntltpl TATA box could play a role in epidermis-specific expression. On the other hand, a D N A sequence without the TATA box, extending from -120 to -2 bp, specifically interacted with nuclear proteins (Fig. 8B), suggesting that regulatory elements may reside downstream of the TATA box, possibly i n the transcribed DNA. Posttranscriptional control has been reported for the Medicago sativa Mspvp2 gene, which is related to nonspecific LTPs (Kuhlemeier, 1992; Deutch a n d Winicov, 1995). A good candidate for a regulatory element involved in posttranscriptional control could be the conserved double palindrome CTAGCTAG. Further experiments will be directed at establishing the mechanism of l t p gene regulation, determining whether the same or different elements confer epidermis specificity in roots and shoots, and finally, precisely delimiting these regulatory sequences together with identification of the protein factors that bind to them.

ACKNOWLEDCMENTS

We thank Michael Stalder for help with the isolation of the Ntltpl promoter, Roel op den Camp for stimulating discussions, and Dr. Christoph Sautter and Professor Dr. M. Riederer for ex- pertise in interpretation of the results. We are grateful to the gardening team of the Berne Botanical Garden for professional maintenance of the plants.

Received February 27, 1996; accepted June 27, 1996. Copyright Clearance Center: 0032-0889/96/ 112/0513/ 12.

LITERATURE ClTED

Bernhard WR, Thoma S, Botella J, Somerville CR (1991) Isolation of a cDNA clone for spinach lipid transfer protein and evidence that the protein is synthesized by the secretory pathway. Plant Physiol 95: 164-170

Buratowski S (1994) The basics of basal transcription by RNA polymerase 11. Cell 77: 1-3

Buvat R (1989) Protective tissues. In Ontogeny, Cell Differentia- tion, and Structure of Vascular Plants. Springer-Verlag, Berlin,

Clark AM, Bohnert HJ (1993) Epidermis-specific transcripts. Nu- cleotide sequence of a full-length cDNA of EPI12, encoding a putative lipid transfer protein. Plant Physiol 103: 677-678

Conaway RC, Conaway JW (1993) General initiation factors for RNA polymerase 11. Annu Rev Biochem 62: 161-190

Cox KH, Goldberg RB (1988) Analysis of plant gene expression. In CH Shaw, ed, Plant Molecular Biology: A Practical Approach. IRL, Oxford, pp 1-34

Deutch CE, Winicov I (1995) Post-transcriptional regulation of a salt-inducible alfalfa gene encoding a putative chimeric proline- rich cell wall protein. Plant Moi Biol 27: 411418

Douady D, Grosbois M, Guerbette F, Kader J-C (1982) Purifica- tion of a basic phospholipid transfer protein from maize seed- lings. Biochim Biophys Acta 710: 143-153

Esau K (1969) Die Epidermis. In Pflanzenanatomie. Gustav Fischer Verlag, Stuttgart, Germany, pp 109-133

Fleming AJ, Mandel T, Hofmann S, Sterk P, de Vries SC, Kuhlemeier C (1992) Expression pattern of a tobacco lipid trans- fer protein gene within the shoot apex. Plant J 2: 855-862

Fleming AJ, Mandel T, Roth I, Kuhlemeier C (1993) The patterns of gene expression in the tomato shoot apical meristem. Plant Cell 5: 297-309

pp 242-286

Green PJ, Kay SA, Lam E, Chua NH (1989) In vitro DNA foot- printing. I P I ; SB Galvin, RA Schilperoort, DPS Verma, eds, Plant Molecular Biology Manual. Kluwer Academic, Dordrecht, The Netherlands, chapter 811, pp 1-22

Horsch RB, Fry JE, Hoffman NL, Eichholtz D, Rogers SG, Fraley RT (1985) A simple and general method for transferring genes into plants. Science 227: 1229-1231

Jefferson RA (1987) Assay for chimeric genes in plants: the GUS fusion system. Plant Mo1 Biol Rep 5: 387405

Kader J-C, Julienne M, Vergnolle C (1984) Purification and char- acterisation of a spinach-leaf protein capable of transferring phospholipids from liposomes to mitochondria or chloroplasts. Eur J Biochem 139: 411-416

Kalla R, Shimamoto K, Potter R, Nielsen PS, Linnestad C, Olsen O-A (1994) The promoter of the barley aleurone-specific gene encoding a putative 7 kDa lipid transfer protein confers aleurone cell-specific expression in transgenic rice. Plant J 6: 849-860

Koltunow AM, Truettner J, Cox KH, Wallroth M, Goldberg RB (1990) Different temporal and spatial gene expression patterns occur during anther development. Plant Cell 2 1201-1224

Kotilainen M, Helariutta Y, Elomaa P, Paulin L, Teeri TH (1994) A corolla- and carpel-abundant, non-specific lipid transfer pro- tein gene is expressed in the epidermis and parenchyma of Gerbera hybrida var. Regina (Compositae). Plant Mo1 Biol 26:

Krause A, Sigrist CJA, Dehning I, Sommer H, Broughton WJ (1994) Accumulation of transcripts encoding a lipid transfer- like protein during deformation of nodulation-competent Vigna unguiculatn root hairs. Mo1 Plant-Microbe Interact 7:

Kuhlemeier C (1992) Transcriptional and post-transcriptional reg- ulation of gene expression in plants. Plant Mo1 Biol 19: 1-14

Kuhlemeier C, Strittmatter G, Ward K, Chua N-H (1989) The pea rbcS-3A promoter mediates light responsiveness but not organ specificity. Plant Cell 1: 471478

Linnestad C, Lonneborg A, Kalla R, Olsen O-A (1991) The pro- moter of a lipid transfer protein gene expressed in barley aleu- rone cells contains similar Myb and Myc recognition sites as the maize Bz-McC allele. Plant Physiol 97: 841-843

Madrid SM (1991) The barley lipid transfer protein is targeted into the lumen of the endoplasmic reticulum. Plant Physiol Biochem 29: 695-703

Mandel T, Fleming AJ, Krahenbiil R, Kuhlemeier C (1995) Def- inition of constitutive gene expression in plants: the transiation initiation factor 4A gene as a model. Plant Mo1 Biol29: 995-1004

Molina A, García-Olmedo F (1993) Developmental and pathogen induced expression of the barley genes encoding lipid transfer proteins. Plant J 4: 983-991

Molina A, Segura A, García-Olmedo F (1993) Lipid transfer pro- teins (nsLTPs) from barley and maize leaves are potent inhibi- tors of bacterial and funga1 plant pathogens. FEBS Lett 316:

Morelli G, Nagy F, Fraley RT, Rogers SG, Chua N-H (1985) A short conserved sequence is involved in the light-inducibility of a gene encoding ribulose 1,5-biphosphate carboxylase small sub- unit of pea. Nature 315: 200-204

Mundy J, Rogers J (1986) Selective expression of a probable amy- lasel protease inhibitor in barley aleurone cells: comparison to the barley amylase/ subtilisin inhibitor. Planta 169: 51-63

Murashige T, Skoog F (1962) A revised medium for rapid growth and bioassays with tobacco tissue cultures. Physiol Plant 15: 473497

Owttrim GW, Mandel T, Trachsel H, Thomas AAM, Kuhlemeier C (1994) Characterization of the tobacco eIF-4A gene family. Plant Mo1 Biol 26: 1747-1757

Pelèse-Siebenbourg F, Caelles C, Kader J-C, Delseny M, Puigdo- mènech P (1994) A pair of genes coding for lipid-transfer pro- teins in Sorghum vulgare. Gene 148: 305-308

Pyee J, Kolattukudy PE (1994) Identification of a lipid transfer protein as the major protein in the surface wax of broccoli (Brassica aleracea) leaves. Arch Biochem Biophys 311: 460468

971-978

411-418

119-122

524 Canevascini et al. Plant Physiol. Vol. 112, 1996

Pyee J, Kolattukudy PE (1995) The gene for the major cuticular wax-associated protein and three homologous genes from broccoli (Brussicu olerucea) and their expression pattems. Plant J 7: 49-59

Rogers SG, Klee MJ, Horsch RB, Fraley RT (1987) Improved vectors for plant transformation: expression cassette vectors and new selectable markers. Methods Enzymol 153: 253-277

Sambrook L, Fritsch EF, Maniatis T (1989) Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY

Schmid J, Doerner PW, Clouse SD, Dixon RA, Lamb CJ (1990) Developmental and environmental regulation of a bean chal- cone synthase promoter in transgenic tobacco. Plant Cell 2:

Scott FM, Hammer KC, Baker E, Bowler E (1958) Electron micro- scope studies of the epidermis of Alliunr cepu. Am J Bot 45: 449-461

Sijmons PC, Dekker BMM, Schremmeijer B, Venvoerd TC, van den Elzen PJM, Hoekema A (1990) Production of correctly processed human serum albumin in transgenic plants. Biotech- nology 8: 217-221

Skriver K, Leah R, Müller-Uri F, Olsen F-L, Mundy J (1992) Structure and expression of the barley lipid transfer protein gene Ltpl . Plant Mo1 Biol 18: 585-589

Sossountzov L, Ruiz-Avila L, Vignols F, Jolliot A, Arondel V, Tchang F, Grosbois M, Guerbette F, Migniac E, Delseny M, Puigdomenech P, Kader J-C (1991) Spatial and temporal ex- pression of a maize lipid transfer protein gene. Plant Cell 3:

Sterk P, Booij H, Schellekens GA, Van Kammen A, De Vries SC

619-631

907-921

(1991) Cell-specific expression of the carrot EP2 lipid transfer protein. Plant Cell 3: 907-921

Straub PF, Shen Q, Ho DTH (1994) Structure and promoter anal- ysis of an ABA and stress regulated barley gene, HVA1. Plant Mo1 Biol 26 617-630

Terras FRG, Goderis IJ, Van Leuven F, Vanderleyden J, Cammue BPA, Broekaert WF (1992) In vitro antifungal activity of a radish (Raphanus sativus L.) seed protein homologous to nonspecific lipid transfer proteins. Plant Physiol 1 0 0 1055-1058

Thoma S, Hecht U, Kippers A, Botella J, De Vries S, Somerville C (1994) Tissue-specific expression of a gene encoding a cell wall localized lipid transfer protein from Arubidopsis. Plant Physiol 105: 3 5 4 5

Thoma S, Kaneko Y, Somerville C (1993) A non-specific lipid transfer protein from Arubidopsis is a cell wall protein. Plant J 3: 427436

Verrijzer CP, Chen J-L, Yokomori K, Tjian R (1995) Binding of TAFs to core elements directs promoter selectivity by RNA polymerase 11. Cell 81: 1115-1125

Vogeli-Lange R, Fründt C, Hart CM, Beffa R, Nagy F, Meins F Jr (1994) Evidence for a role of P-l,3-glucanase in dicot seed ger- mination. Plant J 5: 273-278

Watanabe S, Yamada M (1986) Purification and characterisation of a non-specific lipid transfer protein from germinated castor bean endosperms which transfers phospholipids and galactolipids. Biochim Biophys Acta 876 116-123

Wirtz KWA (1991) Phospholipid transfer proteins. Annu Rev Bio- chem 6 0 73-99