THE WOLD VEGETABLE CENTER FRUIT AND VEGETABLE · - Weak hybrid seed production technology, low...

1

Fruits and Vegetables Research Institute - FAVRI

REPORT

FOR THE ROJECT ENTITLED: “HUMIDTROPICS, A CGIAR RESEARCH PROGRAM”

Work package 3:

On-farm and on-station evaluation of promising technologies

Hanoi - 02/2014

2

Contents

I. Background ................................................................................................................................................ 4

PART 3.1 ....................................................................................................................................................... 6

ON-STATION EVALUATION OF IMPROVED VEGETABLE VARIETIES .............................................................. 6

I. INTRODUCTION .......................................................................................................................................... 6

2 MATERIALS AND METHOD ........................................................................................................................ 7

3. RESUTLS ................................................................................................................................................... 10

3.1 Tomato .............................................................................................................................................. 10

3.2 Chilli .................................................................................................................................................. 10

3.3. Bitter gourd trial .............................................................................................................................. 11

3.4 Vegetable soybean ........................................................................................................................... 15

PART 3.2 ...................................................................................................................................................... 20

EXPORT POSSIBLE MECHANISMS TO STRENGHTHEN SEED SUPPLY CHAIN FOR COMMERCIAL AND HOMESTEAD PRODUCTION ........................................................................................................................ 20

I. NATIONAL SEED POLICY AND REGULATION DOCUMENTED .................................................................... 20

1.1. Permitted lists of plant production and sales ...................................................................................... 20

1.2. Management of variety testing and certification ................................................................................ 21

1.3. Standards of seed quality ..................................................................................................................... 24

1.4. Management of seed import ............................................................................................................... 24

1.5. Management of production, sales, certification of plant seed quality ................................................ 24

II. CURRENT VEGETABLE SEED SUPPLY CHAIN IN SON LA AND DIEN BIEN PROVINCE ............................... 25

2.1. Objective .............................................................................................................................................. 25

2.2. Methodologies ..................................................................................................................................... 25

2.3. Results .................................................................................................................................................. 25

2.4 Constraints ........................................................................................................................................... 28

2.5 Conclusions ........................................................................................................................................... 28

2.6 Suggestions ........................................................................................................................................... 29

PART 3. 3. .................................................................................................................................................... 31

OBSERVE PERFORMANCE OF POTENTIAL ROOTSTOCKS FOR SUMMER TOMATO PRODUCTION IN MOC CHAU DISTRICT, ........................................................................................................................................... 31

SON LA PROVINCE ....................................................................................................................................... 31

I. Introduction ............................................................................................................................................. 31

3

2. Methodology ........................................................................................................................................... 32

3. Results ..................................................................................................................................................... 34

3.1. Observation of rootstock effect in Moc Chau in the spring - summer season 2013 ............................ 34

3.2. Observation of rootstock effect in Moc Chau in summer- autumn season 2013 .................................. 35

4. Discussion ................................................................................................................................................ 37

PART 3. 4 ..................................................................................................................................................... 38

CONDUCT A DISEASE SURVEY ON TOMATO IN MOCCHAU – MAISON AND CHARACTERIZE THE PATHOGENS ................................................................................................................................................ 38

1. Introduction ........................................................................................................................................ 38

2. Methods .................................................................................................................................................. 39

2.1. Place selection ...................................................................................................................................... 39

3. Results ..................................................................................................................................................... 41

3.1 Results of the first survey from 01st to 3rd October .............................................................................. 41

3.2 Results of the second survey from 30th to 31st December, 2013 ........................................................ 43

3.3. Result of pathogen identification ........................................................................................................ 45

PART 3.5 ...................................................................................................................................................... 65

EVALUATE THE EFFICACY OF SEX PHEROMONE LURES OF TOMATO FRUIT BORER IN MOC CHAU ........... 65

1.Introduction ............................................................................................................................................. 65

2. Material and methods ............................................................................................................................ 65

3. Results: .................................................................................................................................................... 65

4. Conclusion ............................................................................................................................................... 67

PART 3. 6 ..................................................................................................................................................... 68

EVALUATE CONTROL EFFICACY OF POTENTIAL BIOPESICIDES AGAINST TOMATO FRUIT BORER .............. 68

1. Methodology ........................................................................................................................................... 68

2. Results ..................................................................................................................................................... 68

4

I. Background The Northwest area is one of the most special economic zones in Vietnam. With

the diversity and uniqueness of natural conditions and resources as well as the traditional attractive culture, this area has many opportunities to develop the economics. However, Northwest has been the poorest region of Vietnam with the high poverty percentage accounting for 28.55% of the population living in this zone and the rate of malnourished children up to 39.1%. Besides of that, Northwest has faced to many difficulties of the integration process, climate change, poverty, intellectual limitations, along with the unreasonable exploitation and use of natural resources, threatening the sustainable development of the region.

Humidtropics belongs to 15 CGIAR Research Programs (CRPs) has been carried out in Vietnam in order to help poor farm families to increase their incomes from integrated agricultural system intensification. On the other hand, this program has also focused on preserving the land for future generations. With the system approaches, this program concentrates on the goal of improving overall productivity, and transform the lives of rural poor in the humid tropics.

In 2013, The World Vegetable Centre has combined with a number of research institutes in Vietnam including Fruit and Vegetable Research Institute, Hanoi University of Agriculture and Plant Protection Institute to implement a number of programs within the framework of the Humidtropisc project. In which, the works: on-farm and on-station evaluation of promising technologies has been conducting from August 2013 that concentrates on Son La and Dien Bien provinces with the objective of identifying suitable technologies for increasing vegetable productivity in commercial and homestead systems in two these provinces.

This Report is divided into six part follow activities:

Part 3.1: Conduct on-‐station evaluation of improved vegetable variety (tomato, chili, vegetable soybean, and bitter gourd).

Part 3.2: Explore possible mechanisms to strengthen seed supply chain for commercial and homestead production.

Part 3.3: Observe performance of potential rootstocks for summer tomato production in Moc Chau.

5

Part 3.4: Conduct a disease survey on tomato in Moc Chau and characterize the pathogens

Part 3.5: Observe control efficacy of sex pheromone of tomato fruit borer in Moc Chau.

Part 3.6: Evaluate control efficacy of potential biopesticides against tomato fruit borer.

II. Activities and implementers

No. Activity Execution time Staff involved Office 1 3.1 Conduct on- station

evaluation of improved vegetable variety (tomato, chili, vegetable soybean, and bitter gourd).

From Octorber. 2013 to February, 2014

1. Le Thi Thuy 2. Dang Hiep Hoa 3. To Thi Thu Ha 4. Nguyen Thi Lien Huong 5. Peter Hanson

FAVRI AVRDC

2 3.2 Explore possible mechanisms to strengthen seed supply chain for commercial and homestead production.

November, 2013 1. To Thi Thu Ha, 2. Andreas Ebert, 3. Peter Hanson

FAVRI AVRDC AVRDC

3 Observe performance of potential rootstocks for summer tomato production in Moc Chau.

From August, to December, 2013

1. Jaw-fen Wang. 2. Le Thi Thuy. 3. Truong Van Du

AVRDC FAVRI Green farm

4 Conduct a disease survey on tomato in Moc Chau and characterize the pathogens


1. Dang Thi Van 2. Le Thi Thuy. 3. Ha Viet Cuong 3. Jaw-fen Wang

FAVRI HUA AVRDC

5 Observe control efficacy of sex-‐pheromone of tomato fruit borer in Moc Chau.

From Octorber to December, 2013

1. Truong Van Nghiep 2. Le Thi Thuy 3. Srinivasan Ramasamy

FAVRI FAVRI AVRDC

6 Evaluate control efficacy of potential biopesticides against tomato fruit borer.


1. Le Duc Khanh 2. Nguyen Thi Thanh Hien 3. Srinivasan Ramasamy

PPRI PPRI AVRDC

6

PART 3.1

ON-STATION EVALUATION OF IMPROVED VEGETABLE VARIETIES

I. INTRODUCTION According to statistic data, the area of vegetable production in 2012 was 829.89

thousand hectares, an increase of 30% compared to 2005 (624.0 thousand hectares). The average yield was 168.6 quintal ha. Total vegetable production reached 13.992 million tons, valued at 680 trillion VND (approximately U.S.$ 3,238 million), accounting 9% of agricultural GDP of Vietnam, while occupied only 6% land area. The average production of vegetables per capita was 146 kg / year, higher than the world average (95 kg/person/year), and double more than the average ASEAN countries.

In Vietnam, about 80 kinds of vegetables are grown, of which almost 30 staple vegetables account for 80% of the total area and production. The main vegetable crops include tomato, pepper, cucumber, melon, bitter gourd, peas, beans, cowpeas, Cole crops and garlic. Garlic and onion is studied on cultivation technologies and preservation and processing technologies.

Agricultural production of vegetables in particular and Vietnam in general concentrated in households with very small area scale (less than 1000 m2/household).

The largest vegetable production areas are the Red River Delta (28.4% of grown area and 29.5% of the production). The highlands (mainly in Lam Dong province) is the country with the highest vegetable yield (vegetable yield is 1.35 times higher than the average national level). Especially around the major urban and industrial areas have formed the intensive vegetable growing areas, in which a part of the area is high-tech applications and food safety as region vegetables Ha Noi, Ho Chi Minh city, Lam Dong ... Commodity vegetables, crop rotation with food crops in the plains, accounting for 54% of the area and more than 55% production. Vegetables here focus for processing, export and providing for different regions in the country. Besides the commercial production, vegetables come from home garden.

Since its establishment (1990) Fruit and Vegetables Research Institute has considered vegetables and spice crops are one of the main research activities. Continuously since 1992 Institute is the agency in charge of vegetable breeding research of State and Ministry project. Although not as high as the funding priority and many coordination units (at least each topic has 5-7 institutions spread across the country), the research fund for each crop is very low. The number of products including seed and technical processes can surrender, but the quality is not high enough, the ability to compete with low foreign varieties. For example, the project: Study on selection, creation and building intensive production protocols of some key vegetable species (tomato, cucumber, watermelon, pepper, bitter melon) for the period 2005-2010 were

7

arranged 4,000 million VND the with 7 organizations involved. The project released 5 national varieties, 8 production test varieties; The Ministry released four production processes, training two doctors, 12 masters, published 18 articles ... In the target crops of the project, priority tomatoes at a fund of approximately 1000 million VND has created 6 varieties. Two national varieties of VT3 and DT 28 with annual common area is about 30-70 hectares / 20 000 ha of the country. The tomato test production varieties of the FAVRI as FM group, HPT, CARD area is even lower. In the period of 2008-2015, the Ministry has 4 tomato projects with 8-10 tomato varieties registered, including 4 national varieties. The quality of research is going to make sure it would be better. Some other reasons that make variety seed low competitiveness are:

- Weak hybrid seed production technology, low quality seeds, although there have been vegetable seed production projects supported.

- The seed supply and marketing system is not good. For instant, CARD-04 tomato has many good characteristics. It is from AVRDC breeding. They provided parent lines, and it is grown in Taiwan over 1000 ha but it is not development in the large production in Vietnam. - The researchers are less associated with production practices, so that the results should rarely accept in the production. Objectives

1. To evaluate AVRDC lines for agronomic characteristics, yield, pest and disease resistance 2. To identify AVRDC improved lines for Humidtropics action sites and as breeding material

for FAVRI programs. 2 MATERIALS AND METHOD

Field methods

Variety trials were conducted for crops and entries listed in Table 1. Entries in the tomato trial were replicated three times and arranged in a in a RCBD. Chili, bitter gourd and vegetable soybean trials were conducted as single replication observation trials. Trials were conducted in FAVRI fields, Hanoi Vietnam. Plots included 20-30 plants depending on the crop. Trials were sown and transplanted as follows:

Tomato: Sowing date: September 10, 2013 Transplanting date: October 17, 2013 Chili: Sowing date: August 28, 2013 Phytophthoracapsici inoculation date: September 20, 2013 Surviving plants were transplanted on November 10, 2013 Bitter gourd: Sowing date: October 8, 2013 Transplanting date: October 15, 2013. Vegetable soybean: Sowing date September 25, 2013 Traits measured included:

+ Crop duration

8

+ Horticultural characteristics + Yield and yield components + Disease incidence and severity. Foliar disease was assessed according to the following

AVRDC scale - 0: No symptoms - 1: Light – 1 to 19% leaf area affected - 2: Moderate 20 – 39% of leaf area affected- 3: Moderately severe 40 – 59% of leaf area affected - 4: Severe 60 – 79% of leaf area affected- 5: Highly severe> 80% of leaf area affected Viral infection was calculated as: Number of damaged plants / plot Disease = ---------------------------- -------- x100 (%) Total number of plants / plot Inoculation method for Phytophthoracapsici:

Zoospores and sporangia were prepared for inoculation. One month-old seedlings were inoculated by spraying a spore solution on roots. Lines were assessed for percent survival about 40 days after inoculation.

Data analysis of replicated trials will be done using IRRISTAT 5.0 software.

Table 1. AVRDC tomato, chili, bitter gourd and Vegetable soybean lines assessed in FAVRI trials, 2013

Code Internal Code Generation AVRDC code Note I TOMATO (Solanum

lycopersicum)

1 CLN3078C AVTO1008 2 CLN3447G AVTO1303 3 CLN3552A-4 AVTO1308 4 CLN3241P AVTO1312 5 CLN3212A-29 AVTO1238 6 CLN3284I AVTO1318 II CHILLI (Capsicum

annuum) Set name

1 ICPN 22-01 2 PP1037-7644-1 AVPP1105 ICPN 22-02 3 PP1037-7669-1 AVPP1106 ICPN 22-03 4 PP9852-173 AVPP9813 ICPN 22-04 5 PP1037-7683-1 AVPP1107 ICPN 22-05 6 PP1037-7694-1 AVPP1108 ICPN 22-06 7 PP9955-15 AVPP9905 ICPN 22-07

9

8 PP0837-7736 AVPP1109 ICPN 22-08. 9 PP1137-7819 AVPP1110 ICPN 22-09 10 PP1137-7868 AVPP1111 ICPN 22-10

III BITTER GOURD (Momordica charantia) 1 AVBG 1301 F8 12THBG1-03A6-13-1 Line evaluation 2 AVBG 1302 F8 12THBG2-04A6-12-2 Line evaluation 3 AVBG 1303 F8 12THBG2-04A6-14-3 Line evaluation 4 AVBG 1304 F8 12THBG2-06A6-20-4 Line evaluation 5 AVBG 1305 F8 12THBG3-07A6-2-5 Line evaluation 6 AVBG 1306 F8 12THBG3-07A6-6-6 Line evaluation 7 AVBG 1307 F8 12THBG3-08A6-5-7 Line evaluation 8 AVBG 1308 F8 12THBG3-08A6-11-8 Line evaluation 9 AVBG 1309 F8 12THBG3-08A6-18-9 Line evaluation 10 AVBG 1310 F8 12THBG3-09A6-20-10 Line evaluation 11 AVBG 1311 F8 12THBG4-10A6-7-11 Line evaluation 12 AVBG 1312 F8 12THBG4-10A6-16-12 Line evaluation 13 AVBG 1313 F8 12THBG4-10A6-19-13 Line evaluation 14 AVBG 1314 F8 12THBG4-11A6-3-14 Line evaluation 15 AVBG 1315 F8 12THBG5-13A6-1-15 Line evaluation 16 AVBG 1316 F8 12THBG5-13A6-17-16 Line evaluation 17 AVBG 1317 F8 12THBG5-14A6-9-17 Line evaluation 18 AVBG 1318 F8 12THBG5-15A6-2-18 Line evaluation 19 AVBG 1319 F8 12THBG6-16A6-1-19 Line evaluation 20 AVBG 1320 F8 12THBG6-17A6-2-20 Line evaluation 21 AVBG 1321 F8 12THBG6-18A6-13-21 Line evaluation 22 AVBG 1322 F8 12THBG6-19A6-14-22 Line evaluation 23 AVBG 1323 F8 12THBG6-20A6-19-23 Line evaluation 24 AVBG 1324 F8 12THBG6-21A6-8-24 Line evaluation 25 AVBG 1325 F8 12THBG6-21A6-12-25 Line evaluation 26 AVBG 1326 F8 12THBG6-22A6-12-26 Line evaluation 27 AVBG 1327 F8 12THBG7-24A6-11-27 Line evaluation 28 AVBG 1329 S5 THMC 113 PM screening 29 AVBG 1330 F12 THMC 143 PM screening 30 AVBG 1331 F11 THMC 144 PM screening 31 AVBG 1332 F12 THMC 145 PM screening 32 AVBG 1333 F12 THMC 153 PM screening 33 AVBG 1334 F11 THMC 167 PM screening 34 AVBG 1335 F11 THMC 170 PM screening 35 AVBG 1336 F11 THMC 177 PM screening IV VEGETABLE SOYBEAN

(Glycine max)

10

1 AGS292 2 AGS 377 AVSB9902 3 AGS 406 AVSB0103 4 AGS 430 AVSB0308 5 AGS 437 AVSB0403 6 AGS 457 AVSB0803 7 AGS 459 AVSB0810 8 AGS 469 AVSB0902 9 AGS 470 AVSB0903 10 AGS 471 AVSB0802 11 AGS346 (check

variety)

3. RESUTLS

3.1 Tomato Three lines CLN3212A-29, CLN3447G, CLN3552A-4 flowered earliest among entries

(Table 3.1.1). CLN3212A-29 showed good growth and vigor but suffered some fruit cracking. Fruit cracking was found in most entries. Fruit set of CLN3078C and CLN 3212A-29 was highest and lowest, respectively, among entries. Harvest is ongoing. No entries developed Tomato yellow leaf curl disease or bacterial wilt. Late blight was noted in a few entries.

Table 3.1.1: Horticultural characteristics of 6 tomato varieties in FAVRI

Lines Day to 50% flowering

Fruit setting (%) Day to harvest Growth habit

CLN3212A-29 37 16 - D CLN3284I 38 25 83 ID CLN3241P 39 17 - D CLN3078C 40 40 - SD CLN3447G 37 28 82 D CLN3552A-4 37 19 81 D

3.2 Chili Three of ten lines showed 100% survival after inoculation with Phytophthora capsici (Table 3.2.1) and these lines will be useful in breeding resistant varieties. Line ICPN 22-03 demonstrated strong growth, resistance to Phytophthora blight resistance and high and high yield.

Table 3.2.1: Percent Plant survival rate after inoculation with Phytophthora capsici

11

No PP Name Days after inoculation (%)

7 14 After 21 1 ICPN 22-01

100 0 0

2 ICPN 22-02

100 33.3 10 3 ICPN 22-03

100 100 100

4 ICPN 22-04

100 0 0 5 ICPN 22-05

100 0 0

6 ICPN 22-06

100 100 100 7 ICPN 22-07

100 0 0

8 ICPN 22-08.

100 100 100 9 ICPN 22-09

100 0 0

10 ICPN 22-10

100 0 0

Table 3.2.2. Fruit characters of AVRDC chili lines

No. PP name No. Of fruit/plant

Fruit Length (cm)

Fruit Wide (cm)

Fruit Peduncle

Length (cm)

Fruit Color Immature

1 ICPN 22-03

23.4±6.10 11.0±0.80 1.46±0.14 3.8±0.34 Ligh green 2 ICPN 22-06

5.7±2.10 7.5±0.52 1.38±0.14 2.1±0.08 Dark Blue

3 ICPN 22-08

13.8±4.50 11.8±1.06 1.11±0.10 33.3±0.25 Dark Blue

3.3. Bitter gourd trial Twenty-seven F8 lines from AVRDC were sown in the field and the experiment included one replication per entry with 5-10 plants per entry, depending on germination. Germination ranged from 7-90% (Table 3.3.1).Due to cold weather, the duration from transplanting to first female flower was long for most entries (Table 3.3.1) and some did not flower. Generally, fruit sizes were small size due to cold weather (Table 3.3.2) which also affected yield (Table 3.3.3). Three entries, THCM143, THCM 145 and THCM170 demonstrated high levels of powdery mildew resistance and could be useful resistance sources to this important disease.

12

Table3.3.1: Germination and crop duration of bitter gourd lines

No Name of line Germination rate (%)

Date from transplanting to first female flower (day)

Date from transplanting to harvesting maturity fruit (day)

1 12THBG1 – 03A6 – 13 60 - - 2 12THBG2 – 04A6 – 12 60 - - 3 12THBG2 – 04A6 – 14 90 35 65 4 12THBG2 – 06A6 - 20 80 - - 5 12THBG3 – 07A6 - 2 70 38 70 6 12THBG3 – 07A6 – 6 60 35 66 7 12THBG3 – 08A6 - 5 60 38 70 8 12THBG3 – 08A6 - 11 90 34 64 9 12THBG3 – 06A6 – 18 90 34 65 10 12THBG3 – 09A6 - 20 70 38 69 11 12THBG4 – 10A6 - 7 50 - - 12 12THBG4 – 10A6 – 16 50 - - 13 12THBG4 – 10A6 - 19 30 39 70 14 12THBG4 – 11A6 – 3 60 40 71 15 12THBG5 – 13A6 – 1 90 - - 16 12THBG5 – 13A6 - 17 40 - - 17 12THBG5 – 14A6 - 9 70 41 71 18 12THBG5 – 15A6 - 2 80 39 70 19 12THBG6 – 16A6 – 1 40 39 69 20 12THBG6 – 17A6 - 2 70 34 65 21 12THBG6 – 18A6 – 13 80 34 65 22 12THBG6 – 19A6 – 14 80 40 70 23 12THBG6 – 20A6 - 19 80 38 70 24 12THBG6 – 21A6 – 8 50 38 69 25 12THBG6 – 21A6 - 12 40 35 65 26 12THBG6 – 22A6 - 12 50 37 67 27 12THBG2 – 24A6 - 11 70 38 69 28 THCM 113 7 - - 29 THCM 143 53 - - 30 THCM 144 53 - - 31 THCM 145 67 - - 32 THCM 153 60 - - 33 THCM 167 47 - - 34 THCM 170 40 - - 35 THCM 177 73 - -

13

Table3.3.2: Fruit characteristics of AVRDC bitter gourd lines No Entry name Fruit

length (cm)

Fruit diameter

(cm)

Flesh thickness

(mm)

Fruit color Fruit type

1 12THBG1 – 03A6 - 13 - - - - - 2 12THBG2 – 04A6 - 12 - - - - - 3 12THBG2 – 04A6 - 14 11.0 3.0 3 Dark green Spiny,

sharp 4 12THBG2 – 06A6 - 20 - - - 5 12THBG3 – 07A6 - 2 17.4 5.2 8 Dark green Spiny,

sharp 6 12THBG3 – 07A6 – 6 14.8 3.7 5 Dark green Spiny,

sharp 7 12THBG3 – 08A6 - 5 6.3 3.2 3 Green

shoulder, yellow bottom

Spiny, sharp

8 12THBG3 – 08A6 - 11 6.4 3.5 3 Green shoulder, yellow bottom

Spiny, sharp

9 12THBG3 – 06A6 – 18 9.2 3.3 3 Green shoulder, yellow bottom

Spiny, sharp

10 12THBG3 – 09A6 - 20 10.2 3.8 3 Dark green Spiny, obtuse

11 12THBG4 – 10A6 - 7 - - - - - 12 12THBG4 – 10A6 – 16 - - - - - 13 12THBG4 – 10A6 - 19 10.6 2.8 3 Green Ridges,

smooth 14 12THBG4 – 11A6 – 3 15.2 5.6 2 Green Ridges,

smooth 15 12THBG5 – 13A6 – 1 - - - - - 16 12THBG5 – 13A6 - 17 - - - - - 17 12THBG5 – 14A6 - 9 8.5 3.1 2 Dark green Spiny,

sharp 18 12THBG5 – 15A6 - 2 11.8 4.2 3 Dark green Spiny,

sharp 19 12THBG6 – 16A6 – 1 20.0 3.3 4 Yellow green Spiny,

sharp, long

20 12THBG6 – 17A6 - 2 11.6 3.4 7 Dark green Spiny, sharp

21 12THBG6 – 18A6 – 13 12.4 3.1 3 Dark green Spiny, sharp

14

22 12THBG6 – 19A6 – 14 8.4 2.2 3 Dark green Spiny, sharp


24 12THBG6 – 21A6 – 8 15.1 3.4 4 Green Spiny, sharp



27 12THBG2 – 24A6 - 11 11.7 3.8 8 Dark green Mixed 28 THCM 113 - - - - - 29 THCM 143 - - - - - 30 THCM 144 - - - - - 31 THCM 145 - - - - - 32 THCM 153 - - - - - 33 THCM 167 - - - - - 34 THCM 170 - - - - - 35 THCM 177 - - - - - Table 3.3.3. Yield components and yield of bitter gourd lines

No Name of line Fruit weight (g) Number fruit/plant Plant yield (g)

1 12THBG1 – 03A6 - 13 - - - 2 12THBG2 – 04A6 - 12 - - - 3 12THBG2 – 04A6 - 14 25 3.1 77.5 4 12THBG2 – 06A6 - 20 - - - 5 12THBG3 – 07A6 - 2 120 5.2 624 6 12THBG3 – 07A6 – 6 60 4.1 247 7 12THBG3 – 08A6 - 5 19 5.5 103 8 12THBG3 – 08A6 - 11 19 9.1 169 9 12THBG3 – 06A6 – 18 40 5.1 203 10 12THBG3 – 09A6 - 20 40 2.4 96 11 12THBG4 – 10A6 - 7 - - - 12 12THBG4 – 10A6 – 16 - - - 13 12THBG4 – 10A6 - 19 40 1.7 67 14 12THBG4 – 11A6 – 3 9 2.4 21 15 12THBG5 – 13A6 – 1 - - - 16 12THBG5 – 13A6 - 17 - - - 17 12THBG5 – 14A6 - 9 18 3.7 67 18 12THBG5 – 15A6 - 2 50 2.4 12 19 12THBG6 – 16A6 – 1 60 4.6 277

15

20 12THBG6 – 17A6 - 2 38 9.7 371 21 12THBG6 – 18A6 – 13 33 6.5 217 22 12THBG6 – 19A6 – 14 20 2.7 54 23 12THBG6 – 20A6 - 19 29 3.8 110 24 12THBG6 – 21A6 – 8 50 4.5 225 25 12THBG6 – 21A6 - 12 37 4.3 155 26 12THBG6 – 22A6 - 12 36 3.3 115 27 12THBG2 – 24A6 - 11 80 5 399 28 THCM 113 - - - 29 THCM 143 - - - 30 THCM 144 - - - 31 THCM 145 - - - 32 THCM 153 - - - 33 THCM 167 - - - 34 THCM 170 - - - 35 THCM 177 - - -

3.4 Vegetable soybean Agronomic characteristics

Compared to the check (AGS346) the entries did not grow well as reflected by short plants heights and few nodes. (Table 3.4.1).Most varieties matured earlier than the check but yield data were not collected because the experiment was destroyed by mice at the R7 stage.

Table 3.4.1.Agronomic characteristics of vegetable soybean lines grown at FAVRI in the Fall-Winter 2013 in Hanoi, Vietnam.

Varieties Plant height (cm)

Quantity of nodes

Quantity of branches

Days to Harvest

AGS 292 23.5 7.5 1.0 65 AGS 377 26.8 7.2 1.0 68 AGS 406 20.2 8.1 1.1 66 AGS 430 21.7 8.3 1.0 69 AGS 437 20.9 7.5 1.0 65 AGS 457 22.2 8.5 1.0 65 AGS 459 18.7 7.6 1.0 67 AGS 469 19.4 7.2 1.1 68 AGS 470 21.4 8.2 1.0 68 AGS 471 Not germinated AGS346 (check) 28.8 8.6 1.1 70

16

4. Future work

Trials were conducted one season only and evaluation of disease resistance, yield and adaptability of the four crops should be carried out in other seasons. son different seasons.

Trial better lines identified in the FAVRI trials inMoc Chau, Sonla. More materials from AVRDC should be obtained and tested at FAVRI and project sites.

References

Anonym, http://www.avrdc.org/LC/soybean/production/intro. html [January 12, 2011]

Danhua Zhu, Yingzhi Chen, Dekun Dong, Shenlong Zhu, Fẹngie Yuan, Xụjun Fu, Baiquan Li. 2010. Variety improvement and production of vegetable soybean in China

Kitamura, K.2001. Recent edamame production information and research advances in Japan.p.21-47. In: T.A. Lumpkin and Shanmugasundaram. S. The Second International vegetable soybean conference, Washington State University. Pullman, WA, USA.

Mongkolsilp, B. 2009. Situation of vegetable soybean in the central part of Thailand, The Second National Conference in Field Legume Crops, Chonburi, Thailand, August 27-29, 2009, 157-166.

Panizzi, M.C.C. and Mandarino, J.M.G. 1982. Soybean for human consumption: nutritional quality, processing and unilization, In Tropical Soybean Improvement and Production, FAO of the United Nations, Rome, Itali, pp. 241-254.

Sciarappa, W.J. 2011. Edamame: The vegetable soybean, http://www.rec. rutgers.edu [fs041(1).pdf] [January 12,2011].

Nguyen Thi ThanhThuy, Le NhuThinh and Dang Dinh Dam (2008). Situations of vegetable soybean consumption and proposed marketing solutions. Fruit and Vegetable Research Institute

http://www.avrdc.org/LC/soybean/production/intro

17

Appendix 1: Staff involved

No. Names Crop Office Email

1 Le ThiThuy Tomato FAVRI [email protected]

2 Dang HiepHoa Chilli FAVRI [email protected]

3 To Thi Thu Ha Bitter gourd FAVRI [email protected]

4 Nguyen Thi Lien Huong

Vegetable soybean

FAVRI [email protected]

Appendix 2: Some pictures of experiments in FAVRI

AVRDC Powdery Mildew resistant lines (left)

and VNese variety (right) in 2013

THMC 145 line

18

CLN3078C

CLN3241P line express yellow leaf disease

19

ICPN 22-03

ICPN 22-06

ICPN 22-08

20

PART 3.2

EXPORT POSSIBLE MECHANISMS TO STRENGHTHEN SEED SUPPLY

CHAIN FOR COMMERCIAL AND HOMESTEAD PRODUCTION To Thi Thu Ha, Peter Hanson, Andreas Ebert

I. NATIONAL SEED POLICY AND REGULATION DOCUMENTED

1.1. Permitted lists of plant production and sales - New certificated plant varieties of major crops (with the main crop: rice, corn,

peanuts and soybean) are added to the monthly updated list of varieties permitted for production and trading by the Minister of Agriculture and Rural Development (MARD) issued.

There is no permitted vegetable variety list issued by MARD. New vegetable varieties from public and private seed companies can be registered. However, they are not necessarily included on the list of permitted varieties..

- The additional list of varieties permitted for production and business (Issued together with Decision No. 40/2006/QD-BNN, May 22, 2006 of the Minister of Agriculture and Rural Development). For vegetables, crops permitted for production and sale are are listed below:

+ Brassicaceae/Cruciferae: cabbage, Brussels sprouts, cauliflower, broccoli, kohlrabi, broccoli, kale , mustard, bok choy, mustard book , radish, watercress, geese broccoli , pak choi, choysum, Chinese cabbage and other types of cole crops.

+ Solanaceae: Eggplant, brinjal eggplant, sweet peppers, hot peppers. Tomatoes. + Cucurbitaceae: Water melon, oriental melon, melon, Muskmelon, pumpkin, wax gourd, luffa,

bitter gourd, chayote, gourd. Cucumber : Phu Thinh restored cucumber varieties + Leguminoceae or Fabaceae: beans, peas, broad beans, yam, dragon beans,

water mimosa. + Umbeliferea or Apiaceae: Carrots, celery, celery, coriander, long coriander, dill,

water celery, centella. + Compositae: lettuce, chicory, lettuce, chrysanthemum, artichoke, wormwood. + Convolvulaceae: kangkong, cilantro, sweet potatoes. + Chenopodiaceae: beets, spinach. + Amaranthaceae: amaranth. + Basellaceae: white flower malabar spinach, purple flower malabar spinach.

21

+ Trapaceae: braces, water chestnut. + Malvaceae: okra. + Labiatae: lemon basil, sweet basil, Lang basil, shiso, marjoram , mint , purple

basil , Chinese motherwort and other herbs. + Zingiberaceae: ginger , turmeric, lesser galangal.

1.2. Management of variety testing and certification 1.2.1. Testing management

Up to now the procedures for testing new plant varieties are governed by Circular No. 48/2011/TT-BNNPTNT July 5, 2011 and 33/2013/TT-BNNPTNT June 21, 2013 issued National Technical Regulation on crop variety testing 21 National Technical Regulations on DUS and VCU testing of (tomato, chilli, cabbage, water melon, rice, maize, peanut, soybean, potato, sweet potato, cassava, mungbean, grape, cotton, tea, sugar cane, longan, dragon fruit, and mulberry. Other vegetable crop varieties are tested followed by Technical standards. 1.2.2. Stages of varietal testing

Testing of new varieties is the process of monitoring and evaluation in order to determine the variety cultivation and utilization value (VCU testing) and determine whether the new variety conforms to distinctness, uniformity and stability (DUS) for purposes of protection or certification

+ Purpose of VCU Testing: To assess new potential varieties for productivity, quality, maturity, pest and disease resistance, stress tolerance, ability to produce seeds, and determine whether the variety should be categorized as a national or local variety

There are two types of variety releases: 1. Recognised variety for trial production is a new agricultural plant variety that

has been assessed, has met standards, and the Ministry of Agriculture and Rural Development allows for trial production. Recognised varieties for trial production are grown in small areas at limited scale.

2. New plant varieties (formerly known as the National Variety) is a new agricultural plant variety that has successfully completed trial production tests, has met certain requirements and received official recognition from the Ministry of Agriculture and Rural Development. New Plant Varieties (National Varieties) can be grown throughout the country on large areas. ‘New Plant Variety’ is the highest and most desired level reserved for superior varieties that successfully pass all five testing stages. Varieties that do not pass stage five remain at stage 4 ‘Recognised variety for trial production’. Most new public and private varieties are entered into formal varietal release testing.

There are five stages of variety testing (Diagram 1)

22

1. Breeder create/select: (on-station) conducted by inventors of the variety. 2. Basic test: Variety meets standards for VCU and DUS and is considered promising

based on testing in at least 3 seasons, of which two tests are done in the same season. (For example, tests might be conducted in spring 2012, winter 2012, and spring 2013 so two of the three trials were conducted in the spring season. Basic tests of vegetable varieties are conducted by the variety inventor. Basic tests of main crops only (rice, corn, peanuts and soybeans) are conducted by an appointed organization (Annex 1). 3. Production test: carried out in two seasons in different locations and conducted

by the inventor and the relevant provincial Dept. of Agriculture (DARD). The inventor should inform DARD about the variety production test and they evaluate the new variety together. If the variety is considered suitable in the test locations, DARD will certify/recommend the new varieties for production on a larger scale. Production trial size must be of a minimal size ranging from 5-20 ha depending on the crop and at least 2/3 of the Provincial Departments of Agriculture and Rural Development conducting the trials should accept the variety for large scale production and the proposed certification. 4. Basic and Production tests are required for release of public varieties and seed

company varieties. The decision whether or not to certify a variety as a Production Variety by MARD is based on trial data. Production varieties are produced in large scale and the data from the production varieties will be considered for registry as new variety (National varieties). 5. Decision to certify a National variety is based on approval by the professional

scientific council organized by the Department of Crop Production – MARD to evaluate the test results and decide on certification. For the crop variety of a new species, the certified variety must ensure that the crop does not affect the environment, biosecurity, cultivation value and proper use and high economic efficiency. The new variety must produce at least 10 % higher yield or are more profitable than the common plant varieties commonly grown at the location.

23

Diagram 1: Process of new variety testing and release in Vietnam

1.2.3. Testing organizations

- National testing (Official Testing): is a form of testing by the National Center for Testing of Seed, Plant Products or other appointed organization (Annex 1). These organizations conduct testing. If lack sufficient facilities/staffs, they can appoint the inventors to do it through their guidance. This is ccompulsory for new plant varieties on the list of major crops and encouraged for other crops. Except for the major crops, new varieties of crops may be tested by the inventors.

1.2.4. Certification of new crop varieties

New crop varieties are certified after showing superior results from Basic and Production testing, are judged to be DUS, and are certified by MARD. Varieties of major

24

crops must meet DUS requirement. The plant varieties beside major crops are encouraged DUS testing for protection of plant varieties.

1.3. Standards of seed quality Seed quality must meet certain legal standards for purity, number of weed seed,

humidity, germination, and quality is assessed by National Center for Testing of Seed, Plant Products

1.4. Management of seed import is governed by the following documents:

- Follow the Circular 88/2011/TT-BNNPTNT of the Ministry of Agriculture and Rural Development: Guiding the implementation of Decree No. 12/2006/ND-CP dated 23/01/2006 of the Government detailed provisions for implementation of the Commercial Law with respect to international purchasers and sales of goods; and agency for sale and purchase, processing and transit of goods involving foreign parties

- Decision No. 10/2010/QD-TTg dated February 10, 2010 of the Prime Minister on certificates of free sale for exports and imports.

Importation of plant varieties on the list of plant varieties is permitted for production and business in Vietnam without obtaining permission.

Department of Crop Production must approve importation of varieties not on the list of plant varieties permitted for production and business in Vietnam including

Import of plant varieties for testing and trial production;

Imports of plant varieties to serve the purpose of international cooperation, sample exhibiting, as gifts and to implement programs and projects.

1.5. Management of production, sales, certification of plant seed quality is specified by a number following documents:

- Decision No. 106/2008/QDD-BNN dated 29/10/2008 of the Ministry of Agriculture and Rural Development to issue regulations to specify and manage the sampling operation, the inspection, testing laboratories, certification bodies of quality seed products and crop fertilizer.

- Circular No. 79/2011/TT-BNNPTNT dated November 14, 2011 of the Minister of Agriculture and Rural Development providing the certification and announcement of plant seed quality conforming with technical regulations. This Circular provides the order and procedures for certification and announcement of technical-regulation

http://vietnamlaw.info/vbpl/36252/quality-control/regulations-on-the-issuance-of-certificates-of-free-sale-cfs-for-domestic-products-.vlo

25

conformity of plant seeds on the list of products and goods of group 2 promulgated by the Ministry of Agriculture and Rural Development. This Circular applies to domestic and foreign organizations and individuals engaged in the production and trading of plant seeds and certification of plant seed quality conforming with technical regulations.

- Circular No. 87/2011/TT-BNNPTNT dated 27/12/2011 of the Ministry of Agriculture and Rural amend and supplement Article 20 of Circular No. 79/2011/TT-BNNPTNT GCT certificate suitable technical regulations.

II. CURRENT VEGETABLE SEED SUPPLY CHAIN IN SON LA AND DIEN BIEN PROVINCE

2.1. Objective To verify seed production and supply in Son La and Dien Bien province.

2.2. Methodologies Interview directly farmers, traders and seed company/shop in each location.

The information collected included:

- How the seed is produced or where the seed can be sourced from.

- Growing season and harvesting.

- Problems and potential of seed production and distribution

2.3. Results These results based on the survey in Dien Bien district – Dien Bien province.

The report for Son La province will be added later.

Điện Bien district is located in the south-western part of Dien Bien province. The north of Dien Bien district is adjacent to Muong Lay district with, Laos to the west and south, Dien Bien Dong to the east. Dien Bien city is located in the north-eastern part of Dien Bien district. There is a border gate to Laos named Tay Trang (Na U commune). The total land area of Dien Bien district is 163,985.45 ha with 108.389 people, including eight ethnic groups.

2.3.1. Vegetable seed production

- Production by farmers

Farmers mostly produce their own seed for the next season. They also buy the seed at the shop in the local market, far 10-20 km from their house. Farmers mainly produce seed of brassicas and some small amounts of cucumber, luffa, chilli, Malabar spinach seed..

26

Farmers also collect seedlings of forest plants from the forest and bring home to transplant in the garden or footpath.

Production by public organizations: The Agricultural Seed Station of Dien Bien district targets seed distribution (mainly rice and maize) to 6 districts in Dien Bien province. In 2008, the income from vegetable seed distribution reached 400 million VND. Vegetable seed was sourced from East West Seed Company and the Vietnam National Vegetable, Fruit and Agricultural Product Corporation Ltd. (VEGETEXCO). The Agricultural Seed Station had land for vegetable seed production in the highlands (Sin Ho station). However, this activity has been discontinued as no orders for vegetable seed production were received.

Kinds of vegetable seed distributed: cole crops, carrot, tomato, potato.

Mungbean and black gram are also grown in eastern Bien Bien, Cua Chua and Tuan Giao districts, but farmers take care of the seed supply themselves.

There is no seed directly distributed from a foreign seed company.

Chilli, drill and mustard seed production in the garden

Choysum, Chinese kale, and Mong mustard are grown in the same time for seed.

2.3.2. Seed retail businesses - Seed shop at the market

There are 2 seed shops in the market where they sell vegetable seed. The quantity of seed is small.

Crops included 1) local seed of radish, mustard, bean; 2) domestic company seed of amaranth, Chinese mustard, kale, long coriander; 3) imported seed of Chinese cabbage, cucumber, broccoli, celery…

27

The domestic seed companies marketing seed are Hung Nong, Phu Nong, Trung Nong, Tan Nong, Tre Viet.

Seed shop at the market Local variety seed sold at market

- Seed at Agricultural Material Agency.

This is a Level 1 agency, which means that the materials are coming directly from the factory to her shop (wholesale). They deliver the agricultural products to smaller shops in different communes. These small commune shops sell the products to the farmers.

This agency distributes agricultural materials to the communes of Dien Bien, Lai Chau, and Cua Chua districts. They did not trade seed because the government subsidises 50% of the seed price (rice, maize) in Dien Bien and it is not economical for them to sell crop seeds. They hope to be able to venture into trading of vegetable seed. As a level 1 agency, it would be easy for them to distribute the seed to level 2 agency and commune shops. They would be willing to repack seed into small packs for home garden purposes, and are willing to work with many different kinds of vegetable crops for distribution to small-scale farmers.

28

Agricultural material agency Materials at the shop

In Dien Bien, there is no official organization testing new vegetable varieties because of small scale production. The seed are bought businessmen and sell accidently. If farmers find the good variety, other farmers can follow next season.

2.4 Constraints - Seed multiplication is mostly done by the households themselves. They

don’t have skills in seed production and simply leave it to nature. In the same garden, they have Mong mustard, choy sum, and kale crops flowering at the same time. So the identity of the crop variety cannot be maintained and the seed quality degenerates.

- They don’t apply fertilizer and water to the flowering plants, so the seed quality is often poor.

- In the garden, people mostly use open-pollinated local varieties of cole crops (2-3 kinds). Yield, in general, is low. High value crops such as tomato, vegetable beans, cauliflower, chayote, etc. have not been introduced to these communities.

- The seed shop is very far from the village (10-20 km) and only very few vegetable crops can be purchased from the shop/market. The product portfolio is restricted to Indian mustard, Chinese mustard, and radish.

- There is no seed package nor seed storage of local varieties which reduces seed quality and germination rate.

2.5 Conclusions - The main vegetable crops for seed production are cole crops, spice crops.

Small seed production is of local chilli, eggplant, cucumber. Farmers use poor seed production technqiues leading to

- poor quality seed. - The vegetable seed supply chain in northwest Vietnam is not established

and the linkage between farmers, distributors and seller is weak.

29

2.6 Suggestions - Restore local varieties. This could best be done at FAVRI where

appropriate facilities (net house) are available to isolate the different varieties of cross-pollinating crops. Thereafter, good quality seed of these varieties could be re-introduced to the commune with a likely yield increase of 10-20% compared with the degenerated varieties;

- Provide training on saving your own seed in selected communities for the establishment of a community seed bank to maintain the varietal properties of minor, locally well adapted indigenous vegetable crops.. The training includes awareness of varietal differences and the importance of planting good quality seed.

- Set-up vegetable seed production at the Agricultural Seed Station of Dien Bien district for common vegetable crops such as tomato, pepper, cauliflower, eggplant, cucumber, bitter gourd, and pumpkin with technical support from FAVRI. The Station has appropriate land in the highlands.

- Establish a linkage between seed producer (Agricultural Seed Station and farmer field), distributor (the Agricultural material agency level 1, 2 and commune), and farmers.

30

ANNEX1

Pointed DUS testing organizations in Vietnam

1. National Center for Testing of Seed, Plant Products and Fertilizers, is the lead agency under the following stations: Station Van Lam - Hung Yen; Station Tu Liem - Ha Noi; Regional Center for Central and West Originally, the South Central region (Ba Ria Vung Tau station).

2. Northern Mountainous Agriculture and Forestry Science Institute (Phu Tho);

3. Fruit and Vegetable Research Institute (Gia Lam, Hanoi);

4. Plant Resources Center;

5. Research Centre potatoes, vegetables and flowers in Da Lat;

6. The Western highlands Agro-forestry Science & technical Institute (Dak Lak);

7. Southern Horticultural Research Institute (Tien Giang);

8. Cotton Research Institute and Agricultural Development (Ninh Thuan).

31

PART 3. 3. OBSERVE PERFORMANCE OF POTENTIAL ROOTSTOCKS FOR

SUMMER TOMATO PRODUCTION IN MOC CHAU DISTRICT, SON LA PROVINCE

Le Thi Thuy, Truong Van Du., Jaw-fenWang

I. Introduction Son La is a mountainous province with the natural area of 14174.44 km2. There are

11 administrative units including 1 city and 10 districts, with 12 ethnic groups living. This

is one of the most important political and economical center of the North West. The

favorable natural conditions have the potential for commercial agricultural

development and diversification.

Vegetable production in Son La has increased in acreage and production. The

vegetables products mainly target Ha noi market, especially during off-seaseon. For

example, tomato is produced during off season in Moc Chau, Mai Son. The total tomato

production area is 99 ha (Table 1).

Table 1. Tomato production in Sơn La in 2005 and 2010

Districts

2005 2010

Area (ha) Production

(tons) Area (ha)

Production

(tons)

Mai Son District 31.0 287.0 31.0 188.0

Moc Chau District 33.0 682.0 23.0 469.0

Son La Province 99.0 1,322 99.0 1,322

At Co Noi commune, Mai Son district, tomato was planted in April and harvested

from July to next February. The annual area of tomato is about 30 hectares. The yield

can reach nearly 120 tons/ha (Khanh, 2012). The major tomato variety is VL2910 from

Hoa Sen Company, which is indeterminate and easy to grow. However, economic value

of VL2910 is not high due to its small low fruit size.

32

In Moc Chau district, tomato production is concentratelyin the Moc Chau town and

Dong Sang commune. The largest planting acreage was 33ha in 2005, and then

decreased to about 20ha in 2010,the yield is about 20 ton/ha. This is lower than the

average yield of tomato in Vietnam, 25.79 ton/ha (GSO, 2012). The contribution of

tomato crop in agricultural production in Son La reduced from 4.8% to 3.5 %. Farmers

have replaced tomato with other higher economic value vegetables such as: common

bean, Meo mustartd, Chinnese cabbage salad, shallot to satisfy the market and

consumer demand. In addition, severity of tomato pest and diseases has increased.

Farmer used more pesticides and chemical fertilizers without having successful control.

There is not proper crop used for rotation. The production costs are creasing but yield

was reducing. Fruit and Vegetable Research Institute is evaluating rootstocks to resolve

the urgent need of managing soil-born diseases. The tomato grafting technique was

introduced in Moc Chau during the past 2 years concentrating in Moc Chau and

Dongsang commune with two to three ha area. The farmers in these locations have not

paid attention on the use of grafted tomato, because they thought tomato grafted onto

eggplant rootstock would have slower growth and did not show the ability to tolerate

the flooding condition in the highland. Therefore, the objective of this study was to

demonstrate the advantages of using the resistant tomato and eggplant rootstocks

before planning of large scale dissemination.

2. Methodology The field trials were conducted in two seaseons, spring to summer and summer

to auntum in 2013. In spring- summer season, the data were collected from 4 tomato

growers at Dong Sang commune and Moc Chau commune by direct interview. Five

treatments of two rootstocks and two commercial scions were tested (Table 2). Anna

and P375 were used as scions. They are indeterminate cultivars. Combination of Anna

and Vimina 1 (Vinh, 2006) and P375 with EG203 (Thuy, 2010) was found to be suitable in

earlier studies.

33

Table 2. Recombination of rootstock and scion tested in spring-summer seaseon 2013

No. Name of farmer Tomato scion

Origin of scion Rootstock

Origin of rootstock

Day of transplant

Day of harvest

Day of data collection

1 Truong Van Du Anna Seminis NS1 FAVRI 3, Dec 7, Oct 10, Feb

Truong Van Du Anna Seminis

Vimiana1 (Hawaii 7996)

Institute of Agriculture Science Southern (IASS) 3, Dec 20, Jun 10, Feb

2 Mui Thi Thuong Anna Seminis 25, Mar 28, Jun 10, Feb

3 Tran Duy Hung P375 Known-you seed

Vimiana1 (Hawaii 7996) IASS 3, Dec 20, Jun 10, Feb

4 Pham Thi May P375 Known-you seed 4, May 7, Mar 10, Feb

In summer – auntum season, the data were collected in 7 fields at Dong Sang

commune, Moc Chau district and Conoi commune, Mai Chau district. Field size of the

trials ranged from 320 to 1200m2. The rootstock varieties evaluated were listed in Table

3. MonganT11, a tomato hybrid cultivar, although not tested yet for its disease

reaction by artificial infection, it has shown good field resistance to bacterial wilt when

compared to the other variaties in Red River delta. It is widely planted in summer -

autumn season in the Nam Dinh, Hai Duong province. The seeds of Hawaii7996, a

tomato variety (code VI043614) and EG203, an eggplant variety, were directly provided

from AVRDC.

34

Table 3. Recombination of rootstock and scion tested in summer-autum seaseon 2013

No. Location Name Tomato scion Rootstock Origin of

rootstock

1

Moc Chau

Truong Van Du Savior EG203 AVRDC

2 Truong Van Du Savior MonganT11 France

3 Mui Thi Thuong Savior Hawaii7996 AVRDC

4 Tran Duy Hung Mongan T11 Non grafted AVRDC

5 Pham Thi May P375 NS1 FAVRI

6 Mai Chau

Lo Van Hai VL2910 Hawaii7996 AVRDC

7 Nong Thi Hoa VL2910 EG203 AVRDC

Major pest and diseases, such as tomato yellow leaf curd diseases (TYLCD), bacterail

wilt, late blight, and fruit worm were recorded. The severity score of pests and diseases

were recorded based on the AVRDC guidance. Total yield and fuit price were evaluated

after harvest.

3. Results 3.1. Observation of rootstock effect in Moc Chau in the spring - summer season 2013

The major pests and diseases seriously damaged tomato crop in Moc Chau is

bacterial wilt and late blight. However, late blight, appearing in both nursery and field,

could be control by spraying fungicides. In the conventional production, farmers spray

20-25 times per crop cycle. Bacterial wilt cannot be controlled by chemical measures.

Bacterial wilt appeared in all treatments in Moc Chau, 10% to 30% of wilting plant was

observed. Bacterial wilt occurred at flowering stage of tomato in Field 2, 3 and 4, but

delay of symptom was occurred at Field 1 which tomato was grafted at green fruit stage.

Tomato, Anna grafted on rootstock NS1 and Vimiana1 could reduce and delay bacterial

wilt comparing with the non-grafed plants (Table 4).

It was difficult to control tomato yellow leaf curl virus disease. If disease resistant

varieties were not used, the percentage of infected plants can be reached to 100%. In

35

the field, P375 was infected by TYCLV from 60-70%, even farmers applied pesticide

frequently to control insect vector.

Anna/NS1 showed wilting symptoms. Many plant died at green fruit stage.

However, the yield of Anna/NS1 combination still reached 78.83 tons/ ha, whiles the

yield of Anna/Vimina1 was only at 30-40 tons/ha.

Table 4. Major damages and yield on tomato trials in spring-summer season.

No. Line Bacterail wilt (%)

TYCLV (%)

Leaf minor (%)

Fruit worm (%)

Yield (kg/ha)

Price (VND/kg)

Gross income VND/ha

1 Anna/NS1 10-20 30-40 70-80 10-15 78,830 7,000 551,810

Anna/Vimiana 1 15-20 30-40 70-80 10-15 41,390 7,000 289,730

2 Anna 20-30 30-40 70-80 33,940 6,000 200,040

3 P375/Vimiana 1 20-30 60-70 40-50 <10 48,010 6,500 312,060

4 P375 20-30 60-70 40-50 <10 51,320 6,500 333,580

3.2. Observation of rootstock effect in Moc Chau in summer- autumn season 2013

Nomally, the summer - autumn is the season with high temparature and humidity.

However, during the time of trial, prolonged heavy rain of 7-10 days and alternate hot

and dry westerly wind (from Lao to central Vietnam) significantly affected tomato plants

growth. Especially hoarfrost usually occurs from mid-October to December, causing

serious dead tomato plants. In these trials, hoarfrost caused severe damages in Moc

Chau, but minor damages in Mai Chau.

The tested tomato varieties in Moc Chau and Mai Chau were infected by TYCLV with

infection rate ranged from 0 to 47.9%. MonganT11 was the highest infected plants,

while there was no TYCLV symptom on Montavi/NS1 plants. Yellow leaf symptoms

caused by unknown reasons, occurred commonly in the summer season, especially on

36

the MonganT11. The superiority of rootstock has not been fully evaluated because plant

infected by yellow leaf dead very quickly, only have 3-4 times of harvesting. Late blight

disease usually appears after drizzling rain or hoarfrost. Farmers sprayed fungicides

continuously with the interval of 3 to 7 days. The specific chemical such as Ridomi

(Metalaxy M 40g/kg + Mancozeb 649g/kg), Aliet (Fosetyl Aluminium. 800g/kg) were

used, the cost of fungicide is relatively high. Percentage of fruit damaged by Helicoverpa

armigera occurred at 3rd and 4th harvest, range from 4.3 to 7.9%.

Bacterail wilt infected rate on tomato plants was low comparing with the spring-

summer season. Bacteril wilt symptom occurred at harvesting stage in all fields, Mr.

Tran Duy Hung’s field had the highest rates of bacterial wilt. There were 245

MonganT11 non-grafted plants died in total 2800 plants (8.8%). The lowest percentage

of tomato bacterial wilt infection belongs to Mr Truong Van Du with 12 died / 1914

tomato plants of Savior/EG203 variety (0.6%). Tomato was grafted on NS1, Hawaii 7996

and EG203 rootstock had low infected rate (0.6-4.6%) and the most resistant was

eggplat rootstock EG203 (Table 5). During October, the temperatures began to decline,

which was not in favor for the development of bacterial wilt, while tomato prices on the

market continued to rise. Farmers thought that grafted joint should be covered by the

soil to improve nutrient supply to the scion and harvested quckly. Therefore, the role of

disease resistance of EG203 eggplant is unclear

Until December 2013, tomato (both VL2910 and Savior) grafted onto eggplant

rootstock showed the highest yield.

Table 5. Major damages and yield on tomato trials in summer-autumn season.

No. Varieties Bacterail wilt (%)

TYCLV (%)

Yellow leaf

Late blight

Fruit worm (%)

Yield (kg/ha)

Price (VND/kg)

Gross income VND/ha

1 Savior/EG203 0.6 3.6 2 1 6.1 70,840 8,500 602,160

Savior/MonganT11 8.4 4.4 2 1 4.8 67,760 8,500 575,940

2 Savior/HW7996 4.6 3.9 2 1 4.3 65,140 8,500 553,710

37

3 Mongan T11 8.8 47.9 3 1 5 49,540 6,000 297,250

4 Montavi/NS1 0.9 0.0 1 1 4.7 77,140 7,500 578,570

5 VL2910/HW7996 2.7 19.3 1 1 7.9 87,430 6,500 568,290

VL2910/EG203 1.3 21.9 1 1 6.5 92,000 6,500 598,000

4. Discussion Incidence of bacterial wilt in the spring-summer season was higher than in summer

- autumn season on tomato plants in Moc Chau. The rootstocks of NS1, Hawaii7996, and

EG203 had better resistance of bacterial wilt than MonganT11 and Vimina1 rootstocks.

It is necessary to conduct further experiments to assess the potential of using disease-

resistant rootstocks for tomato in Moc Chau and other intensive tomato production

areas in Son La province, especially in those areas where tomato plants have been

cultivated continuously for many years The potential of rootstock varieties NS1 and

Hawaii7996 will be tested in Son La from June of 2014.

References

1. GSO, (2012) Vegetables statistics. Statistical publisher. 2012

2. Khanh. N.K (2012), “the new crop on the old land”, http://

http://stp.vista.vn/index.asp?mstl=3744&type=2

3. Thuy, L.T. (2010). Results of investigation and transferring technique of grafted

tomato seedling on eggplant rootstock in the north of Vietnam. Agriculture and

Rural Development Magazine. Special issue of 20th anniversary of FAVRI, 3/2010. pp

80-87.

4. Vinh, N. Q., and Ngo, X. C. (2006). Grafting and growing tomatoes by grafted

seedlings to protect from bacterial wilt (Ralstonia solanacearum) on 3500-4,000 ha

each year in Lam Dong Province, Viet Nam. Viet Nam: Institute of Agricultural

Sciences for Southern Viet Nam.

http://stp.vista.vn/index.asp?mstl=3744&type=2

38

PART 3. 4 CONDUCT A DISEASE SURVEY ON TOMATO IN MOCCHAU – MAISON

AND CHARACTERIZE THE PATHOGENS Dang Thi Van, Le Thi Thuy, Ha Viet Cuong and Jaw-Fen Wang

1. Introduction Sonla is a mountainous province with a total area of 14,174.44km2 at an average

altitude of 1050m in the North West region of Vietnam. Although the suitable area for

agriculture is only around 13% (CEMA, 2011), the favorite natural conditions for

vegetable development around of the year facilitate Sonla a production of vegetables,

especially during the off-season for the demand from the lowland regions. Tomato

production is very important that creates high income for farmers of Sonla. Favorite

weather conditions and convenient transportation makes tomato become one the

main off-season vegetables from Sonla. Currently, diseases on tomato have caused

severe yield loss, low quality of fruits, and high expense for protection. This has resulted

in the decrease the production area in Sonla. Proper diagnosis and understanding of

severity of plant diseases is the prerequisite for controlling plant diseases. However,

there is only a few investigation associated with tomato diseases in Sonla so far. In this

study, FAVRI carried out disease surveys on tomato in Mocchau and Maison districts in

Sonla province in order to collect related information. The results from this study could

contribute to the sustainable Sonla is a mountainous province with a total area of

14,174.44km2 at an average altitude of 1050m in the North West region of Vietnam.

Although the suitable area for agriculture is only around 13% (CEMA, 2011), the favorite

natural conditions for vegetable development around of the year facilitate Sonla a

production of vegetables, especially during the off-season for the demand from the

lowland regions. Tomato production is very important that creates high income for

farmers of Sonla. Favorite weather conditions and convenient transportation makes

tomato become one the main off-season vegetables from Sonla. Currently, diseases on

tomato have caused severe yield loss, low quality of fruits, and high expense for

39

protection. This has resulted in the decrease the production area in Sonla. Proper

diagnosis and understanding of severity of plant diseases is the prerequisite for

controlling plant diseases. However, there is only a few investigation associated with

tomato diseases in Sonla so far. In this study, FAVRI carried out disease surveys on

tomato in Mocchau and Maison districts in Sonla province in order to collect related

information. The results from this study could contribute to the sustainable

development of tomato production in Sonla.

2. Methods 2.1. Place selection

According to public information from Sonla statistic office, total tomato production

area in Sonla was around 100 ha in 2010, mainly distributed in 5 locations including

Sonla city, Phuyen, Mocchau, Yenchau and Maison districts (Table 1).

Table 1: Tomato area of Sonla in the year 2010 Total area Sonla city Phuyen

district Mocchau District

Yenchau District

Maison district

109 29,0 8,0 23,0 18,0 31,0

Base on this data, communes Chienghac, Dongsang, Anthai, and Mocchau Farm town

in Mocchau district and Conoi in Maison district were selected for information

collection.

2.2. Date of collection

- The first collection: from 01st to 3rd October, 2013

- The second colletion: from 30th to 31st December, 2013

2.3. Data collection sheet

FORM FOR DATA COLLECTION OF TOMATO DISEASES

Date....... ...Month ........... year 201.....................................

Province................................

.......District...............................Commune........................................

Village….

.........................................................................................................................................

40

Name of

grower.................................................................................................................................

Area or total tomato plants..…………………………….................................................................

Tomato

cultivar.................................................................................................................................

Ratio of viral disease (TYLCV,

Tospovirus)...................................................................................

Ratio of bacterial disease (BW ,

Xanthomonas).............................................................................

Ratio of fungal disease (late blight, Fusarium wilt, early blight)……………………..................

General interview questions:

- Growing season

- Farming habit: rotation or non rotation

- Pesticide/fungicide and the use

- Type of planting materials: grafting or non grafting tomato

Tips for disease survey:

- Field observation method: Go inside and take a look for the whole field. Note the

gradients caused by air current and water flow. Observe signs and symptoms on plants

and investigate the presence of hot spots. Take record on farm history and clear photos.

- Interview method: Show the disease photos to the growers including bacterial wilt,

bacterial canker, Fusarium wilt, late blight and viral diseases as well as point out the

corresponding symptoms on plants in the field. Afterward, ask them to estimate the

disease severity in their tomato field.

2.4. Sampling method: Based on the kinds of symptoms, plant samples were collected.

* Follow up information: It is far from FAVRI to Maison and Mocchau. Therefore, after

the first survey several farmers in each location were selected as resource persons for

further communications.

41

3. Results 3.1 Results of the first survey from 01st to 3rd October

In generally, four sites were visited at the first survey including Conoi commune from

Maison district and Chienghac, Dongsang, Mocchau Farm town from Mocchau district.

Results were summarized as bellow.

3.1.1 Survey information of tomato in Conoi commune, Maison district (01st October, 2013)

In 2013, tomato production area in Conoi was more than 20ha and concentrated in

three villages including Docdo, Phuongnam and Binhminh. Total of five farmer groups

were selected for interview, including two from Docdo, one from Phuongnam and two

from Binhminh. Interview was carried out on working time in the field, simultaneously,

field observation was done together with the grower (Table 2 and 3).

Tomato in Conoi has a long harvest period, usually, from June to September for green

mature fruits and from September to next February for ripe fruits. There is no crop in

the field during February to March. Here, farmer continuously grows single cultivar

tomato, indeterminate VL2910, in the same field without rotation. In this study, all

farmers used non grating tomato as planting materials. Pesticides were applied for a

two-week interval. Fungicides were used in a high frequency, a 7 to 10-day interval

under normal weather; but a 5 to 7-day, even a 3-day interval during the raining season.

Especially, fungicide application was made immediately after rain fall or heavy fog.

Field observation was done together with growers in 9 tomato fields, that were selected

ramdomly from group interview. Leaf spot symptom was found in every fields. However,

the symptom was neither specific of early blight nor late blight, the disease still needs to

be identified. According to Mrs. Tinh and Mrs. Lan, the disease appear and develop after

rain in the warm season, then decrase when the weather is cool and stop in winter

season every year. There was no bacterial canker-like symptom in the visited fields, but

wilting (abour 90% incidence) was found in Mrs. Tinh’s field (around 100 m2) from

Docdo village (Fig. 1). In Binhminh village, farmers mentioned that there were several

wilting plants at flowering stage, however, they could not identify what is the causal

agent. We could not find wilting plants in this visit. No typical symptom of TYLCV or

42

Tospovirus was found in most visited fields, except 2 plants showed virus-like symptom

in Mrs. Lan’s field (Fig. 2). A total of 15 samples, including 3 wilting plants, 10 leaf

spots and 2 virus-like symptoms were collected in Conoi commune.

Mrs. Tinh and Mrs. Lan were selected as the resource persons for contacting in Conoi

of Maison

3.1.2. Survey information of tomato in Chienghac commune of Mocchau district (2nd

October, 2013)

Taliet village, the largest tomato production area, in Chienghac was selected as the

survey site. Mostly vegetables in Taliet were grown in a big open field (about 20ha)

including tomato, onion/shallot, Meo mustartd, cabbage and Chinese cabbage. Tomato

could be grown year round, however, summer-autumn (transplanted inMay to June)

and winter-spring (transplanted from October to December) were the main seasons.

The tomato production area in summer-autumn season in 2013 was around 5ha and

harvested from September or October to next January. This survey was conducted at

the beginning of harvesting stage (Table 4).

It is different from Conoi, farmers in Taliet own smaller fields ranging from hundreds

to one thousand square meters. Tomatoes were cultivated in rotation with other

vegetables such as onion/shallot, Meo mustartd, cabbage, Chinese cabbage. Similar

with Conoi, farmers in Taliet also use non-grafting tomato. The tomato cultivar used in

Taliet was more diverse than that in Conoi commune. A total of five tomato varieties,

including DV2962, Savior, VN3500, Mongan T11, and P375 were found. Pesticides were

used when insects appeared; and fungicides were frequently used with an interval of 7-

10 days or 10-15 days depending on the appearance of diseases.

Leaf spot symptoms similar with those found in Conoi were observed in every field in

Taliet. Specific symptom of late blight, early blight and Fusarium wilt was not observed.

In Thuong’s field, P375 variety showed TYLCV symptoms with a 30% incidence, but not

DV2962. Bacterial canker-like symptoms were found on fruits in Pham Van Hung’s field

(Fig. 3). A total of 9 samples were collected from Taliet including 6 leaf spots and 3 fruits

43

with bacterial canker-like symptoms (Table 5). Nguyen Van Dien was selected as the

resource person for follow-up information in Taliet.

3.1.3. Survey information of tomato in Dongsang commune, Mocchau district (2nd October, 2013)

Eleven gardens from Tunhien and Ang village were selected for survey. Tomatoes in

Dongsang were grown mostly in home garden integrated with other vegetables. Main

production season was the summer-autumn season with transplanting from the end of

June to July, harvest from the end of September to December. Farmers usually rotate

tomato and Meo mustard, cabbage, and French beans. Tomatoes grafted with eggplant

rootstock was commonly used (Table 6). Savior variety was grown in all visited gardens,

except May Lan’s. Pesticides were used when needed but fungicides were applied every

2 weeks, except Truong Van Du’s garden where tomatoes were planted under a high

tunnel.

Leaf spots were observed in all gardens, except Truong Van Du’s, but the symptoms

could not be recognized as late blight as well as early blight. No viral symptom and

bacterial canker was observed. Farmers indicated that wilting disease was severe in the

past. Currently, this disease was reduced when grafted tomato seedlings with eggplant

rootstock were used (Table 7). Totally, 10 samples were collected from Dongsang

including 4 wilting and 6 leaf spot symptoms.

Truong Van Du was selected as a resource person for contacting in Dongsang.

3.1.4. Survey information of tomato in Mocchau Farm town (2nd October, 2013)

In this survey, tomato plants only existed in Nguyen van Le’s field. Severe late blight

symptoms was observed (Fig. 4). A total of 5 samples were collected.

According to Nguyen van Le, the total vegetable area in Mocchau Farm town was

around 12ha, however, tomato was not suitable here due to the destructive outbreak of

late blight under such cool and wet conditions.

3.2 Results of the second survey from 30th to 31st December, 2013 According to Mrs. Tinh and Lan, disease severity reduced including the leaf spot

symptoms in Conoi. Therefore, the second survey was only conducted in Mocchau

44

district concentrating in Taliet village of Chienghac commune, Tunhien village of

Dongsang commune and Anthai village of Muongsang commune, instead of Mocchau

Farm town.

3.2.1 Survey information of tomato in Chienghac commune, Mocchau district

(December, 2013)

In Taliet of Chienghac, the tomato crop planted in May, 2013 (Table 3) was completed

and replaced by other vegetables. Information in this visit was collected from 23 fields

with a total area of around 1,7ha. No grafted tomato was used in the surveyed fields of

Taliet.

No specific symptom of viral diseases, late blight and early blight was found. Leaf spots

were found only on the old leaves of the summer-autumn tomato crop, and not on the

winter-spring tomato crop (Fig. 5). Wilting tomatoes with different growth stages were

observed in 7 visited fields (Table 9 and Fig. 6). It should be noted that two of these

fields with wilting plants were winter-spring crop planted in October when the weather

was cool in Mocchau. A total of 6 wilted plants were collected for pathogen detection

3.2.2 Survey information of tomato in Dongsang commune, Mocchau district

(December, 2013)

Tomatoes in Tunhien were almost destroyed by strong frost. Farmers could not

differentiate late blight symptom and frost damage. No obvious symptom of late blight

was observed on the survived leaves. Therefore, the data was not collected but some

samples were collected for pathogen isolation.

3.2.3 Survey information of tomato in Muongsang commune, Mocchau district

(December, 2013)

According to the interview with Dam Trong Dung, tomato production area in

Muongsang commune was about 10ha and mainly distributed in 4 villages including

Anthai, Lapo, Langa and Baisay.

In Anthai, tomatoes were present in 4 home gardens in December, 2013. Vegetables

observed included cabbage, salad, onion/shallot, kohlrabi, spicy vegetables, etc. Three

varieties were used including DV2962, VL3500 and Savior. All tomato observed was not

45

grafted (Table 10). No virus-like symptom was found . Tomatoes in Cuong Thuy´s

garden were nearly destroyed by heavy frost. Wilting was found in Mr. Quynh’s garden

with a 20% incidence. Three wilted plants were collected (Table 11).

3.3. Result of pathogen identification It is noted that an additional sample collection was carried out on 10 to 11 Octobe

but without general survey information. Based on the symptoms, samples were divided

to three group for identification causal agent including: wilting, fruit spot and leaf spot.

Several causal agents can cause wilting symptom in tomato including Ralstonia

solanacearum, Fusarium spp. and Sclerotium rolfsii. A total of 15 wilting samples were

characterized. Isolates were isolated on TZC medium from 9 wilting samples, and

assessed by PCR follow protocol of Seal et al., (1999) for confirming. Samples from

Dongsang and Chienghac of Mocchau were possitive reaction with primer Y2

(cccactgctgcctcccgtaggagt), OLI1 (gggggtagcttgctacctgcc), and BV345

(cgtcatccacaccaggtattaaccagt), indicated they are Ralstonia sp., while thoses collected

from Conoi of Maison were negative result. The other 6 wilting samples with tan to

brown-sunken on the stem base were isolated for fungi. Five isolations were identified

as Fusarium spp. and one was Rhizoctonia solani (Table 12).

Based on appearance of the fruit spot including spots with a dark brown center,

convex, surrounded by a distinct white halo, the disease was suspected to be bacterial

canker or "bird's-eye spots” caused by a positive gram bacterium. Bacterium was

isolated from a total of 12 spot lesions of different disease fruits (Table 13).

Consistently, one type of bacterium were isolated from all lesions. All isolates of this

bacterium showed morphological features similar to thoses of Xanthomonas sp. or

Corynebacterium sp. (Fig. 7). However, the identification has not been confirmed by PCR

yet.

For leaf spots, only the samples with typical symptoms were isolated. The

identification was based on morphologial features of spores and colony on PDA medium

(Table 14). Three samples with black spot without yellow surrounding were

characterized as Alternaria solani. and Colettotrichum sp. In the one leaf spots with

46

concentric rings, Alternaria solani was found but not other fungi. The 10 samples which

showed large dark brown lesions on leaf, stems and petioles, large brown and firm areas

in green fruit symptom were suspected to be late blight. However, fungi did not

germinate in potato pieces, which was used to stimulate of phytophthora infestans

development.

4. Discussion

No public survey on tomato diseases in Sonla was reported so far. In this study, leaf

spot was a very common symptom on the summer-autumn tomato crop. Alternaria

solani. and Colettotrichum sp were detected from samples with typical symptom.

However, most of leaf spot symptoms did not look like symptom of early blight as well

as late blight, they are still not diagnosticed for causal agent. The temperature during

summer to autumn in most aera of Maison and Mocchau (May to October) was not

suitable for the development of late blight symptoms. According to the interview with

farmers, leaf spots appear every year usually after rain and develop in warm condition.

In generally, the leaf spot symptoms result in frequent fungicide application by the

farmers. Therefore, it is important to identify the causal agent.

It was though that climate from end of autumn to spring season in Sonla was suitable

for development of late blight disease. However, phytophthora infestans was not

detected from all of typical symptom of late blight (table 14). It might due to the high

frequent of fungicides using by farmer that killed fungus before the samples were

collected. On the other hand, according to inteview to farmer, there was very heavy fog

during September, 2013 in Mocchau Farm town, it may resulted in the typical symptom

of late blight. Also the samples collected from Dongsang and Anthai in December could

not be differed from affection of frost or Phytophthora infestans (Fig. 8).

Wilting was severe in Taliet of Chienghac commune, even in the cool conditions of

December. It was also found in Dongsang commune, Anthai of Muongsang commune of

Mocchau and Conoi of Maison. All wilting samples from Mocchau were caused by

Ralstonia confirmed by PCR follow protocol of Seal et al., (1999) but not samples from

47

Conoi of Maison although bacterium grew in TZC media. It is similar to the result of the

last research in the year 2012, only one wilting samples from Conoi was possitive result

in PCR reaction (Ha Viet Cuong and Dang Thi Van, unpubliced data). It needs to be

further diagnosis for wilting disease in Conoi of Maison. The production of tomato in

Conoi were centralized in the larger fields. Mrs. Tinh indicated wilting symptoms

occurred in 2012 and increased in 2013. This disease is becoming destructive, and

should be diagnosed properly. In the lowland region, grafted tomato on resistant

rootstock has shown good effect in controlling bacterial wilt on tomato. The technology

could be evaluated, if the wilted plants were diagnosed to be caused by bacterial wilt.

TYLCV is the most important virus causing severe loss production of tomato in

Northern Vietnam (Man, 2001). The severity depends on the tomato variety and the

environmental conditions. Nien et al (2008) indicated the spring-summer season is

suitable for the development of TYLCV on tomato. In this survey, P375 variety was

susceptible to viral diseases with a 30% incidence, but DV2962, VL2910, Mongan T11

and Savior varieties were not severely infected. The tolerance/resistance of these

varieties needs to be further confirmed under the controlled conditions..

Tospovirus severely damages and reduces the yield of many economically important

crops worldwide (Pappu et al., 2009). Severity of Tospovirus has increased in South

Asia, South East Asia and South China (Hanson et al., 2009). However, there is no

information of tospovirus on tomato in Vietnam so far. In these two surveys, tospovirus–

like symptom was not found in Maison as well as in Mocchau. However, it has been

detected in previous study in Nguyen Thi Luyen’s garden in June, 2013 (Fig. 9).

Therefore, it needs to be further confirmed in the coming spring-summer season.

Farmers in Conoi spray fungicides more frequently than those in Mocchau. It might be

due to the longer production period and the continuous cropping habit in Conoi.

However, farmers in Mocchau closely grow diverse vegetables in a rather small field

might easily contaminate each other while applying pesticides and fungicieds. In the

future, efforts should be made on safe vegetable production in Sonla.

48

Acknowledgment: We would like to thank AVRDC- The World Vegetable Center for financial support of this work and farmers in Maison and Mocchau for providing information and assistance during survey.

Reference

Hanson, P., Deshpande, A., Ravi, K.V., Pascha, H., and Muniyappa, V. 2009. Conventional approaches for tomato resistant to Tospovirus. Proceeding of APSA-AVRDC workshop on Tospovirus and Thrips vectors. November, 2009. http://cema.gov.vn/modules.php?name=Content&op=details&mid=7761 Man, V. T., and Te L. L. 2001. Pathogen in Agricultural crops. In pages: 240-241. Agricultural publication. Nien, D. V. and Hue N. T. N. 2008. Savior- The heat tolerant and TYLCV resistant hybrid tomato variety. Vietnam Journal of Agricultural Science and Technology 3: 1-6. Pappu, H., Jones, R., and Jain, R. 2009. Global status of tospovirus epidemics in diverse cropping systems: Successes achieved and challenges ahead. Virus Res. 141: 219–236. Seal, Taghavi, Fegan, Hayward and Fegan (1999), Determination of Ralstonia (Pseudomonas) solanacearum rDNA subgroups by PCR tests. Plant Pathology, 48: 115–120. doi: 10.1046/j.1365-3059.1999.00322.x

http://cema.gov.vn/modules.php?name=Content&op=details&mid=7761

49

Table 2: General information of the visiting sites in Conoi commune of Maison

Name of the interview farmer

Village Area or total plants

variety Planting material (grafting/non grafting)

Farming habit

Transplanting time

Nguyen Van Dong

Doc do 1,5ha VL2910 non grafting Non rotation

April

Le Van Cuc Doc do 0.8ha VL2910 non grafting Non rotation

April

Pham Van Tho


April

Hoang Van Khanh


April

Le Thi Lan Doc do 1,7ha VL2910 non grafting Non rotation

April

Hoang Thi Tinh


April

Le Van Bien Doc do 0.8ha VL2910 non grafting Non rotation

April

Nguyen Van Vien

Phuongnam 1,7ha VL2910 non grafting Non rotation

April

Dang Van Binh

Phuongnam 0.9ha VL2910 non grafting Non rotation

April

Nguyen Van Dung


April

Tran Van Hoi Phuongnam 0.5ha VL2910 non grafting Non rotation

April

Pham Thi Hien


April

Hoang Thi Hoat


April

Doan Van Minh

Binh minh 0.9ha VL2910 non grafting Non rotation

April

Duong Thi The

Binh minh 1,2ha VL2910 non grafting Non rotation

April

Nguyen Thi Nu


April

Nguyen Thi Hien


April

Le Thi Hoan Binh minh 1,0ha VL2910 non grafting Non rotation

April

Hoang Van Binh


April

Ha Thi Nguyet


April

Tran Van Đai Binh minh 0.6ha VL2910 non grafting Non April

50

rotation Table 3. Disease survey of the visisting sites in Conoi commune of Maison


Wilting Leaf spot Virus like diseases

Data collection method

Sample collection

Nguyen Van Dong No + No interview 0 Le Van Cuc No + No interview 0 Pham Van Tho No ++ No Field observation

and interview 2 (stems with spots)

Hoang Van Khanh No ++ No Field observation and interview

0

Le Thi Lan No + 2 plants Field observation and interview

2 (virus-like)

Hoang Thi Tinh 100m2

of wilting

+++ No Field observation and interview

3 (wilting)

Le Van Bien No +++ No Field observation 2 (stems with leaf spots)

Nguyen Van Vien No ++ No interview 0 Dang Van Binh No ++ No interview 0 Nguyen Van Dung No ++ No Field observation

and interview 3 (stems with leaf spots)

Tran Van Hoi No ++ No Field observation and interview

0

Pham Thi Hien No + No interview Hoang Thi Hoat No + No interview 0 Doan Van Minh No ++ No interview 0 Duong Thi The No ++ No interview 0 Nguyen Thi Nu No + No Field observation

and interview 0

Nguyen Thi Hien No ++ No interview 0 Le Thi Hoan No + No interview 0 Hoang Van Binh No ++ No Field observation

and interview 3 (stems with leaf spots)

Ha Thi Nguyet No + No interview 0 Tran Van Đai No + No interview 0

51

Table 4: General information of the visiting sites in Chienghac commune of Mocchau


Village Area or total tomato plants

variety Planting material (grafting/non grafting)

Farming habit

Transplanting time

Pham Van Hung

Taliet 300m2 MonganT11 non grafting Rotation April, 2013

Nguyen Van Thuong

Taliet 500 m2 DV2962 and P375

non grafting Rotation May, 2013

Nguyen Van. Long

Taliet 400 m2 DV2962 non grafting Rotation May, 2013

Hoang Van Thinh

Taliet 500 m2 DV2962 non grafting Rotation May, 2013

Pham Van Quyet

Taliet 1000 m2 Savior non grafting Rotation June, 2013

Nguyen Van Dien

Taliet 500 m2 Savior non grafting Rotation June, 2013

Doan Minh Quang

Taliet 700m2 Savior non grafting Rotation June, 2013

52

Table 5. Disease survey of the visiting sites in Chienghac commune of Mocchau

Name of interview farmer

Bacterial disease leaf spot

Virus-like diseases


Sample collection

Pham Van Hung

20 plants with bacterial canker-like symptoms on fruits

+++ No Field observation and interview

3 fruits (Bacterial canker); 2 stems with leaf spots

Nguyen Van Thuong

No + TYLCV, 32 plants of P375 variety

Field observation and interview

0

Long Noi No ++ No Field observation and interview

2 stems with leaf spots)

Hoang van Thinh

No ++ No Field observation and interview

0

Pham Van Quyet


0

Nguyen Van Dien

No +++ No Field observation and interview

2 stems with leaf spots)

Doan Minh Quang


0

53

Table 6: General information of the visiting sites in Dongsang commune of Mocchau



Variety Planting material (grafting/non grafting)

Farming habit

Transplanting time

May Lan Tunhien 1.200 plants Mongan T11

Non grafting Rotation June

Le Van Phuong Tunhien 1.200 plants Savior Grafting plants Rotation June

Thao Uyen Tunhien 700 plants Savior Grafting plants Rotation June

Quoc Mai Tunhien 3.000 plants Savior Grafting plants Rotation June

Dung Tham Tunhien 1.500 plants Savior Grafting plants Rotation June

Phan Van Boi Tunhien 4.000 plants Savior Grafting plants Rotation June

Pham Thi Ngoc Tunhien 500 plants Savior Grafting plants Rotation June

May Hanh Tunhien 700 plants Savior Grafting plants Rotation June

Thanh Phuong Tunhien 800 plants Savior Grafting plants Rotation June

Truong Van Du Ang 10.000 plants

Savior Grafting plants Rotation June

Tran Van Cac Ang 3.000 plants Savior Grafting plants Rotation June

54

Table 7. Disease survey of the visiting sites in Dongsang commune of Mocchau


Wilting (%) leaf spot

Virus-like disease


Samples collection

May Lan 10-15 +++ 0 Field observation 2 wilting plants and 2 stems with leaf spots

Le Van Phuong 5-10 ++ 0 Field observation 0 Thao Yen 0 ++ 0 Field observation 0 Quoc Mai 0 ++ 0 Field observation 0 Dung Tham 0 +++ 0 Field observation 2 stems with leaf

spots Phan Van Boi 2-5 + 0 Field observation 0 Tran Van Cac 0 + 0 Field observation 0 Pham Thi Ngoc 0 ++ 0 Field observation 0 May Hanh 0 + 0 Field observation 0 Thanh Phuong 5-10 + 0 Field observation 2 wilting plants

and 2 stems with leaf spots

Truong Van Du 0 0 0 Field observation 0

55

Table 8: General information of the visiting sites in Chienghac commune of Mocchau


Address Area or total plants


Farming habit

Transplanting time

summer - winter season 2013 Hoang Van Phan

Taliet 1000m2 DV2962 non grafting rotation July, 2013

Ngo Van Ngoan

Taliet 1000 m2 DV2962 non grafting rotation July, 2013

Dinh Thi Xoa Taliet 1000 m2 DV2962 non grafting rotation July, 2013 Nguyen Van Huu


Nguyen van Thieu

Taliet 700 m2 Savior non grafting rotation July, 2013

Nguyen Thi Thuy

Taliet 1000 m2 Savior non grafting rotation July, 2013

Nguyen Van Thuong


Le Van Long Taliet 1500 m2 DV2962 non grafting rotation July, 2013 Nguyen Van Thinh


Pham Van Quyet

Taliet 1000 m2 Savior non grafting rotation June, 2013

Nguyen Van Dien

Taliet 500 m2 Savior non grafting rotation June, 2013

Quang Huong Taliet 700m2 Savior non grafting rotation June, 2013 Bui Thanh Hieu

Taliet 500 m2 VL3500 non grafting rotation June, 2013

Bui Van Tuyen

Taliet 1700 plants

DV2962 non grafting rotation July, 2013

Nghia Ha Taliet 400m2 DV2962 non grafting rotation July, 2013

winter- spring season 2013-2014 Nguyen Van Dien

Taliet 1000 m2 Savior non grafting rotation December

Thuan Hoan Taliet 500 m2 Savior non grafting rotation November Thuy Thuong Taliet 1000 m2 Savior non grafting rotation November Nguyen van Thieu

Taliet 500m2 Savior non grafting rotation December

Nguyen Van Thinh

Taliet 1000m2 Savior non grafting rotation December

Hoang Minh Tuan

Taliet 500 m2 unknown non grafting rotation Ealry October, 2013

Pham Van Hung

Taliet 400 m2 DV2962 non grafting rotation Late October, 2013

56

Table 9. Disease survey of the visiting sites in Chienghac commune of Mocchau


Wilting (%)

Leaf spot Virus-like disease


Sample collection

summer –autumn season, 2013 Hoang Van Phan 0 + 0 Field observation 0 Ngo Van Ngoan 0 + 0 Field observation 0 Dinh Thi Xoa 5 + 0 Field observation 0 Nguyen Van Huu 0 + 0 Field observation 0 Nguyen van Thieu 0 + 0 Field observation 0 Nguyen Thi Thuy 0 + 0 Field observation 0 Ngo Van Thuong 0 + 0 Field observation 0 Le Van Long 0 + 0 Field observation 0 Nguyen Van Thinh

0 ++ 0 Field observation 0

Pham Van Quyet 0 ++ 0 Field observation 0 Nguyen Van Dien 0 ++ 0 Field observation 0 Quang Huong 2 ++ 0 Field observation 0 Bui Thanh Hieu 2 ++ 0 Field observation 0 Bui Van Tuyen 40 ++ 0 Field observation 0 Nghia Ha 1 ++ 0 Field observation 0 winter- spring season 2013-2014 Nguyen Van Dien 0 0 0 Field observation 0 Thuan Hoan 0 0 0 Field observation 0 Thuy Thuong 0 0 0 Field observation 0 Nguyen van Thieu 0 0 0 Field observation 0 Nguyen Van Thinh

0 0 0 Field observation 0

Hoang Minh Tuan 20 0 0 Field observation 3 wilting plants

Pham Van Hung 40 0 0 Field observation 3 wilting plants

57

Table 10: General information of the visiting sites in Muongsang commune of Mocchau




Farming habit

Transplanting time

Nguyen Van Quynh

Anthai 1000 plants

Savior Non grafting rotation June

Nguyen Thi Tu Anthai 300 plants

Savior Non grafting rotation July

Cuong Thuy Anthai 500 plants

VL3500 Non grafting rotation September

Dai Lua Anthai 4500 plants

DV2962 and Savior

Non grafting rotation July and November

Table 11. Disease survey of the visiting sites in Muongsang commune of Mocchau


Wilting (%)

Leaf spot Virus-like disease


Sample collection

Nguyen Van Quynh 20 +++ 0 Field observation

3 wilting plants

Nguyen Thi Tu 0 + 0 Field observation

Cuong Thuy 0 Not clear because of frost affect

0 Field observation

Dai Lua 0 + 0 Field observation

Table 12. Disease diagnostic from wilting samples of tomato from Sonla

No.

Symptom Site of collection Date of isolation

Causal agent

Ralstonia solanacearum

Others

1

Witing

Dongsang, Mocchau 2ndOctober,

2013 +

2 Dongsang, Mocchau

2ndOctober, 2013 +

3 Coinoi, Maison

2ndOctober, 2013 -

4 Coinoi, Maison

2ndOctober, 2013 -

5 Coinoi, Maison

2ndOctober, 2013 -

58

6

Chienghac, Mocchau

11st October,

2013 +

7

Chienghac, Mocchau

11st October,

2013 +

8

Dongsang, Mocchau

12nd October,

2013 +

9

Dongsang, Mocchau

12nd October,

2013 +

10

Dongsang, Mocchau

12nd October,

2013

Fusarium sp.

11

Dongsang, Mocchau

12nd October,

2013

Fusarium sp.

12

Dongsang, Mocchau

12nd October,

2013

Fusarium sp.

13

Dongsang, Mocchau

12nd October,

2013

Fusarium sp.

14

Dongsang, Mocchau

12nd October,

2013

Fusarium sp.

15

Chienghac, Mocchau

12nd October,

2013

Rhizoctonia sp.

Table 13: Disease diagnostic from fruit spot samples of tomato from Sonla

No. Symptom Site of collection Date of isolation Causal agent

1 Fruit spot Dongsang, Mocchau

12nd October, 2013


12nd October, 2013


12nd October, 2013


12nd October, 2013


12nd October, 2013

59


12nd October, 2013

Suspected to be Xanthomonas or Corynebacterium but not PCR yet


12nd October, 2013


12nd October, 2013


12nd October, 2013


12nd October, 2013


12nd October, 2013


12nd October, 2013

Table 14: Disease diagnostic from leaf spot samples of tomato from Sonla

No. Symptom Site of collection Date of isolation Causal agent

1

Leaf black-spot without surrounding yellow

Conoi, Maison 12nd October, 2013

Alternaria sp., Colettotrichum sp.

2 Chienghac, Mocchau

12nd October, 2013


3 Dongsang, Mocchau

12nd October, 2013


4 Leaf spot with concentric rings Conoi, Maison

12nd October, 2013 Alternaria sp.

5

Large dark brown lesions on leaf, stems and petioles, large brown and firm areas

in green fruit

Mocchau Farm town 2nd,October, 2013

Suspected to be Phytophthora

infestans, but the isolates did not

germinate in potato pieces

6 Mocchau Farm town 2nd,October, 2013




10 Dongsang, Mocchau

02nd January, 2014


02nd January, 2014


02nd January, 2014

60

13 Anthai, Mocchau

02nd January, 2014

14 Anthai, Mocchau

02nd January, 2014

Fig. 1. Wilting symptom in Conoi commune of Maison on 1st October, 2013.

Fig. 2. Virus-like symptom in Conoi commune of Maison on 1st October, 2013.

61

Fig. 3. Bacterial canker-like in Taliet commune of Mocchau on 2nd October, 2013

Fig. 4: Late blight-like symptoms on tomato leaves and fruits in Mocchau Farm town, October 2013

62

Fig. 5: Tomato variety DV2962, planting in the end of October, showed no leaf spot symptom (Taliet, December, 2013)

Fig. 6: Wilting tomatoes at different growth stages of in Taliet (Chienghac commune) of

Mocchau, December 2013.

63

Fig. 7: Pure isolation of bacteria on KingB media. The cultures were isolated from bacterial canker- like lesions collected in Moc Chau (Son La).

Fig. 8: Late blight-like symptome appearred after heavy frost in Dongsang and Anthai communes of Mocchau, December 2013.

64

Fig. 9 : Tospovirus –like symptom on tomato fruits in Dongsang commune of Mocchau in June,

2013

65

PART 3.5

EVALUATE THE EFFICACY OF SEX PHEROMONE LURES OF TOMATO FRUIT BORER IN MOC CHAU

Truong Van Nghiep, Le Thi Thuy , Srinivasan Ramasamy

1.Introduction Annual losses due to insect pests in agricultural production are very large, accounting to

20%. Synthetic chemical insecticides have a major role to control the outbreak of pests. However, the massive use of pesticide has adverse effects on the environment and human health. To reduce these adverse impacts, scientists have studied and proposed different solutions, including the use of pheromones, one of the bio-control measures which is highly effective against many pests. This experiment was conducted with the aim of evaluating the sex-pheromone lures to control tomato fruit borer under field conditions.

2. Material and methods Variety: Savior from Sygenta

Sex-pheromone lures and traps were obtained from AVRDC

Location: The experiment was conducted at Ang village, Dong Sang Commune, Moc chau district.

The experiment was conducted with three replications, with 300-500 m2/replication (one replication/household). Six traps - 3 with pheromone lures and 3 traps without lures were kept for 300 m2 area. For 500 m2 area, 10 traps - 5 with pheromone lures and 5 without pheromone lures were kept. The traps were replaced with new ones after 42 days. The sex-pheromone trap was hung in position horizontal to the inflorescence. The study was conducted from October to December 2013. Data were collected at five days intervals. The number of adults of Helicoverpa armigera and other pests in each trap was counted.

3. Results: Trapping of fruit borer adults with pheromone traps:

The major target species is Helicoverpa armigera. The results have been given in Table 1: Table 1: Composition of pest species attracted to the pheromone traps

No. Species Scientific name

1 Main pests of tomato plants

1.1 Fruit worm Helicoverpa armigera

1.2 Fruit worm Helicoverpa assulta

66

1.3 Fruit worm Spodoptera exigua

1.4 Unidentified

2 Other species composition

2.1 Yellow Fruit Flies (Bactrocera sp.)

2.2 Parasitic Bee (Amauro morpha acceta ameyathoracica)

2.3 Mosquito

2.4 Termite

2.5 Ladybird beetle (Coccinella septempunctata)

2.6 Aphids

2.7 Whitefly

2.8 Thrips (Thrips sp.)

The results from Table 1 showed that the species composition attracted by the pheromone traps is quite high, including the non-target species. After classification, we have identified the emergence of green fruitworm, Helicoverpa armigera (1) as a major pest. In addition, there are three other common pests on tomato plants: H. assulta (2), S. exigua (3) and unidentified species (4).

Fig. 1. Tomato pests

67

The number of adults trapped in the pheromone traps have been provided in table 2 and Figure 2. Although the traps with H. armigera pheromone lures are attractive to the major fruit borer species, the weekly mean trap catches were not significantly different from the traps without lures. This is mainly due to the fact that the pest population was lower during the winter season. Hence, the trial should be repeated during the spring season to confirm the effectiveness of H. armigera sex pheromone lures.

Table 2. Number of adults attracted by pheromone traps

Treatment No. of insects / trap / week

Traps with pheromone lure 2.20 ± 0.92

Traps without pheromone lure (check) 0.00 ± 0.00

T4df 2.40ns

Fig. 2. Comparison of the number of adults attracted to the pheromone traps

4. Conclusion The H. armigera sex pheromone lure was attractive. However, because of the weather

conditions the evaluation was not representative. Hence, the trial should be repeated. In addition, the pheromone traps, especially the sticky traps were not highly specific to the target pest(s), since it has attracted a plenty of other non-target pest and natural enemy species.

68

PART 3. 6 EVALUATE CONTROL EFFICACY OF POTENTIAL BIOPESICIDES

AGAINST TOMATO FRUIT BORER Le Duc Khanh, Nguyen Thi Thanh Hien (PPRI)

1. Methodology Tomato fruit borer (Helicoverpa armigera) larval populations were collected from the fields in

three districts in Hanoi area (Hoai Duc, Gia Lam and Dong Anh) in November 2013. A total of 188

larvae in all stages was collected from tomato fruits. Each individual was put into a plastic

container (15 cm X 15 cm), and was covered by mosquito net for pupation at 12-26°C and 50-

82% r.h. Tomato fruit and young corn were used as the food for larvae, and was changed daily.

The adults were fed with honey and fresh water (1: 9). Adults were kept in plastic cylinder cage

(30 cm X 8 cm) for mating and egg laying.

2. Results The percent adult emergence was very low; it was only 20% (38 adults out of 188 collected

larvae). Hence, the rearing of this pest in the laboratory at PPRI was not successful. The major

reason could be the dry season (the autumn in the North of Vietnam) for a prolonged time, and

hence the humidity and temperature are very low. The larval collection is being continued from

the tobacco fields. The bioassay with potential biopesticides against tomato fruit border will be

completed in May 2014.

THE WOLD VEGETABLE CENTER FRUIT AND VEGETABLE · - Weak hybrid seed production technology, low...

Documents

Transcript of THE WOLD VEGETABLE CENTER FRUIT AND VEGETABLE · - Weak hybrid seed production technology, low...