The role of calmodulin in the gravitropic response of the Arabidopsis thaliana agr-3 mutant

Planta(1996) 199:343 351 P l m a t a

�9 Springer-Verlag 1996

The role of calmodulin in the gravitropic response of the Arabidopsis thaliana agr-3 mutant

William Sinclair 1, Ian Oliver 2, Paddy Maher 3, Anthony Trewavas 2

i Institute of Ecology and Resource Management, University of Edinburgh, Mayfield Road, Edinburgh, EH9 3JU, UK 2 Institute of Cell and Molecular Biology, University of Edinburgh, Mayfield Road, Edinburgh, EH9 3JU, UK 3 The Open University in Scotland, 10 Drumsheugh Gardens, Edinburgh, EH3 7QJ, UK

Received: 27 September 1995/Accepted: 30 November 1995

Abstract. Calmodulin, a primary plant calcium receptor, is known to be intimately involved with gravitropic sensing and transduction. Using the calmodulin-binding inhibitors trifluoperazine, W7 and calmidazolium, gravitropic curvature of Arabidopsis thaliana (L.) Heynh, ecotype Landsberg, roots was separable into two phases. Phase I was detected at very low concentrations (0.01 ~tM) of trifluoperazine and calmidazolium, did not involve growth changes, accounted for about half the total curvature of the root and may represent the specific contribution of the cap to gravity sensing. Phase II commenced around 1.0 taM and involved inhibition of both growth and curvature. The agr-3 mutant exhibited a reduced gravitropic response and was found to lack phase I curvature, suggesting that the mutation alters either use or expression of calmodulin. The sequences of wild-type and agr-3 calmodulin (CaM-I) cDNAs, which are root specific were completely determined and found to be identical. Upon gravitropic stimulation, wild-type Arabidopsis seedlings increased calmodulin mRNA levels by threefold in 0.5 h. On the other hand, gravitropic stimulation of agr-3 decreased calmodulin mRNA accumulation. The possible basis of the two phases of curvature is discussed and it is concluded that agr-3 has a lesion located in a general gravity transmission sequence, present in many root cells, which involves calmodulin mRNA accumulation.

Key words: Arabidopsis - Calmodulin - Gravitropism

Introduction

Gravitropic bending of shoots and roots is a primary means whereby plants adjust their patterns of growth in

Abbreviations: CaM = calmodulin; TFP = trifluoperazine; W5 = N- (6-aminohexyl)-t-naphthalenesulfonamide; W7 = N-(6-aminohexyl)- 5-chloro- 1-naphthalenesulfonamide Correspondence to: A. Trewavas; FAX: 44 (131) 650 5392; E-mail: [email protected]

response to the environment. Curvature results from a redistribution of growth rates between the two sides of the stimulated organ and for many years it has been assumed that such growth redistributions are regulated by gradi- ents of auxin across the tissue (for reviews, see Evans 1991; Trewavas 1992). More recently, this emphasis on auxin has shifted as it has become clear that Ca z+ also plays a significant role in the control of curvature (Hepler and Wayne 1985; Poovaiah and Reddy 1987; Roux and Serlin, 1987). Two roles for curvature have so far been identified. Firstly, it is thought that gravitropic signalling initiates a redistribution of wall-bound calcium (Roux and Serlin 1987 and references therein). Calcium accumulations have been detected on the slower-growing side of both shoots and roots (Roux and Slocum 1982; Lee et al. 1983a), although this may not always be observed (Bagshaw and Cleland 1994). Since exogenously applied Ca 2+ has fre- quently been reported to inhibit growth, and chelators to promote growth, these observations provide a simple means of curvature control, a point elegantly demon- strated by Lee et al. (1983b). The mechanism whereby wall-bound calcium can be redistributed is not under- stood but has been suggested to involve direct diffusion coupled to a mobilising agent (Bj6rkman and Cleland 1991) and may involve calmodulin (Roux and Serlin 1987). In roots, high concentrations of calcium have been local- ised to the amyloplasts, which are constituents of the gravisensing cells (Chandra et al. 1982; Busch et al. 1993).

A second role for Ca 2 + in gravitropism is as a com- ponent of intracellular gravi-transduction chains. Cal- modulin (CAM) is the primary plant calcium receptor and there is strong evidence for the involvement of CaM in the transmission of the gravity signal (Poovaiah et al. 1987; Stinemetz et al. 1987). Higher concentrations of CaM have been found in the root tip region than in the remainder of the root (Biro et al. 1984; Allan and Trewavas 1985; Stinemetz et al. 1987). Dauwalder et al. (1986) demon- strated that very high concentrations of CaM are specifically associated with the amyloplasts of pea statocytes, whereas in other root cap and meristem cells the concentration is low and largely cytoplasmic. The direct involvement of CaM in gravisensing has been investigated using

344

the Mer i t cul t ivar of corn, which requires l ight to become o r thograv i t rop ic . U p o n i l lumina t ion there was a r ap id fourfold increase in C a M act ivi ty which cor re la ted well with the acquis i t ion of g rav i t rop ic sensi t ivi ty (Stinemetz et al. 1987). I l l umina t ion of the Mer i t roo t cap is k n o w n to increase pro te in synthesis and l ight has also been repor ted to induce C a M m R N A accumula t ion (Fe ldman and G i l d o w 1984; Ziel inski 1987). Recent studies using C a M - an tagonis t s have p rov ided substant ia l , a l though indirect evidence, for the invo lvement of C a M in the gravi ty response (Bj6rkman and L e o p o l d 1987; St inemetz et al. 1987, 1992). The involvement of C a M may be complex. Arabidopsis has at least six different isoforms of C a M m R N A , each having a different d i s t r ibu t ion pa t t e rn within the p lan t (Ziel inski et al. 1990; Ling et al. 1991; Perera and Ziel inski 1992; G a w i e n o w s k i et al. 1993). I t is poss ible to envisage tha t gravi ty sensing and t ransmiss ion might involve only one or a few of the isoforms present. Cal- m odu l in isoforms have not been as t ho rough ly charac ter - ised in o ther plants .

P r i m a r y advances in unde r s t and ing the mechan i sm of g rav i t rop ic t r ansmiss ion and response in roo ts have been m a d e with the i so la t ion of g rav i t rop ic mutan t s from Arabidopsis (Mahe r and M a r t i n d a l e 1980; Lin et al. 1988; C a s p a r and P i c k a r d 1989; Kiss et al. 1989). Previous pub l i ca t ions from this l a b o r a t o r y r epor t ed the i so la t ion of a series of ag rav i t rop ic and par t i a l ly agrav i t rop ic mutan t s (agrl-3) which are t hough t to be allelic and in which only the roo t has a l tered g rav i t rop ic sensit ivity (Bell and M a h e r 1990). The ra te of roo t g rowth of all the agr m u t a n t s is ident ical to tha t of the wild type (Wt), but the m u tan t s i sola ted exhib i ted differing degrees of t ropic sensitivity. The roo ts of agr-1 were to ta l ly agrav i t rop ic whilst agr-2 and agr-3 disp layed bo th reduced rates and an ear l ier cessa t ion of curvature . Bell and M a h e r (1990) suggested tha t the agr-3 p h e n o t y p e may be d iagravi t ropic .

Evidence conce rn ing the basis of the agr m u t a t i o n would in tu rn p rov ide in fo rmat ion on the mechan i sm of g rav i ty - induced curva tu re and t ransmiss ion of the gravi ty st imulus. Since C a M is clear ly an essential c o m p o n e n t in g rav i t rop ic responses we set out to examine the poss ibi l i ty tha t agr was re la ted to some a l te ra t ion in the cellular behaviour , express ion or use of CaM. This a p p r o a c h was reinforced by the d e m o n s t r a t i o n that a n u m b e r of Paramecium mutan t s with "s teer ing" failures result f rom single amino acid m u t a t i o n s in C a M (Lukas et al. 1989). Since the agr-3 pheno type , which is d iagrav i t rop ic - l ike might be cons idered ana logous to a steering muta t ion , we have conf ined ou r s tudy to this pa r t i cu la r mutant .

Materials and methods

Plant material. Wild-type and agr-3 Arabidopsis thaliana (L.) Heynh, ecotype Landsberg seeds were either (i) sown directly on the surface of nutrient agar plates, and incubated at 4 ~ in total darkness for 48 h and then under continuous illumination (210 gmol quanta-m-2.s-1) at 24 ~ in a vertical orientation in growth cabi- nets, or (ii) sown onto the surface of trays containing a 1 : 1 mixture of Levington potting compost and Perlite (silvaperl). The seedlings were grown in a 16-h daylength regime at a minimum of 16 ~ for approximately 5-6 weeks before being used for CaM extraction.

W. Sinclair et al.: Calmodulin in a gravitropic Arabidopsis mutant

Application of CaM-antagonists. A series of agar plates was set up, with increasing concentrations of the CaM-antagonist under exam- ination. Appropriate volumes of the antagonist stock solutions were added to the cooling molten agar and thoroughly mixed prior to plate pouring. Final concentrations of antagonist tested were within the range 0.001-100 gM. Two-day-old seedlings grown on agar plates were given a 6-h period of dark growth before being transferred to the agar plates containing the CaM-antagonists. The seedling roots were aligned to the vertical, the plate photographed and reorientated through 135 ~ to the vertical. The plates were then returned to the growth cabinet in darkness for periods up to 48 h before being photographed again.

Measurement of root curvature and growth. The growth characteristics of seedlings were determined using time-lapse photography. The base of each Petri dish was marked with a straight line so that roots could be correctly aligned either with the vertical or at 135 ~ for gravistimulation. The root angle was defined as the angle between the root axis before and after stimulation. Measurements of root angle were made from enlarged photographs of the plates using a protractor with an accuracy of 0.5 degrees. All root angles were expressed as mean and standard error of the mean. Root lengths were measured from the enlarged photographs using a stereometric measurement and analysis program (Miller Systems, Raleigh, N.C., USA), with an accuracy of 0.1 mm.

Calmodulin extraction and characterisation. Arabidopsis leaf tissue was homogenised in chilled extraction buffer [-50 mM Tris, pH 7.5; 5 mM EGTA; 1 mM 2-mercaptoethanol; 1% (w/v) polyvinylpyr- rolidone (PVP)] and filtered through two layers of muslin. The filtrate was adjusted to 55% saturation with ammonium sulphate, the pH adjusted to 7.0 and centrifuged at 10 500.g for 60 rain. The pH of the resultant supernatant was adjusted to 4.1 and again centrifuged at 10500"9 for 60 rain. Resuspension buffer [-10 mM Tris, pH 8.0; 1 mM MgCI/; 1 mM 2-mercaptoethanol; 200mM NaC1; 1 mM phenylmethylsulfonyl fluoride (PMSF)] was added to the pellet and the solution dialysed overnight against the same buffer. After clarification (l1600.g for 10min) the solution was boiled for 2 min and re-clarified at 11 600"9 for 10 min. The supernatant was then applied to a W-7 agarose affinity column (pre-equilibrated with resuspension buffer). Unbound protein was removed with resuspension buffer until Azs0,m < 0.005. Elution buffer (10 mM Tris, pH 8.0; 5 mM EGTA; 1 mM 2-mercaptoethanol; 200 mM NaCI; 1 mM PMSF) was then applied to collect fractions with increased Azso,m from the column. These fractions were pooled, dialysed against 50 mM sodium phosphate buffer (pH 7.0) plus 0.4 mM CaCI2, and snap-frozen in liquid N2. Estimation of CaM extracted was determined both spectrophotometrically and by Bio-Rad protein assay. Assay of CaM was performed by phosphodiesterase activation (Cheung 1971).

Isolation of RNA and DNA and Polymerase chain reaction (PCR) amplification and cloning of Arabidopsis CaM mRNA. Total RNA was isolated from 1-g samples of 72-h-old agar-grown Arabidopsis seedlings by the method of Chomczynski and Sacchi (1987). Ara- bidopsis DNA was isolated from leaf tissue by the method of Dellaporta et al. (1983). For PCR amplification of CaM mRNA, oligonucleotides were designed from consensus sequences already known for the desired sequence (Ling et al. 1991). The primer sequences used to amplify CaM mRNA were arbitrarily designated Primer 1 : 5' GCATATCTCCACCAATCATGCA 3' which was com- plementary to bases 470 491 in the deduced sequence of CAM-1 (Ling et al. 1991) and Primer 2: 5' ATGGCIGAYCARYTIACIGA 3' which corresponded to base numbers 718 738 in the deduced sequence of CAM-2 (Ling et al. 1991). The cDNA was prepared from total Arabidopsis root RNA by the method of Clackson et al. (1991) and PCR amplification of the cDNA sequences carried out by an adaption of the method outlined by Claekson et al. (1991). The PCR reaction mixture consisted of reaction buffer (10mM Tris-HC1, pH 8.3; 50 mM KC1; 1.5 mM MgC12; 0.01% (v/v) Tween-20; 0.01% (w/v) gelatin; 0.01% (v/v) NP-40); 200 gM dNTP mixture; 25 ~tmol

W. Sinclair et al.: Calmodulin in a gravitropic Arbidopsis mutant 345

Primer 1; 25 lamol Primer 2; 10 lal of cDNA reaction mixture; 27 ~tl distilled H20; 1 I~1 DNA polymerase. The mixture was overlayed with 100 lal mineral oil. Amplification was carried out under the following conditions: l cycle of 94 ~ for 3 min followed by 35 cycles of 94 ~ for 30 s, 50 ~ for 45 s and 72 ~ for 90 s. This was followed by 1 cycle of 10 min at 72~ After visualisation on agarose gels, PCR products were isolated from the gel and cloned into pBlue- script S K ( - ) plasmid which had been digested with Sma I. The PCR products were cloned into the digested plasmid by the method of Sambrook et al. (1989).

Sequencin9 of DNA. Sequencing of double-stranded plasmid DNA was performed by the dideoxynucleotide chain termination method (Sanger et al. 1977) using T7 DNA Polymerase (Pharmacia-LKB) according to the manufacturer's instructions. The sequencing reac- tions were labelled with a-[3sS]-dATP and separated on 6% acryl- amide, 7 M urea gels.

Northern blottin9 of CaM mRNA. Agarose gels of RNA extracts were capilliary-blotted onto nitrocellulose membrane saturated in 20 x SSC (3 M NaC1, 0.3 M CH3COONa) as described in Sambrook et al. (1989). After transfer was complete, the membrane was rinsed in double-distilled H20 for l0 min, and the membranes allowed to air dry. Hybridisation of 32p-labelled (Feinberg and Vogelstein 1983, 1984) CaM cDNA probe was carried out essentially as described below. Membranes were prehybridised in 50 ml of hybridisation solution [4 • SSC, 1% sodium lauryl sulphate (SLS), 2 x Denhardt's solution (50 x stock comprises 5 g Ficoll, 5 g PVP, 5 g bovine serum albumin in 500ml), 10% Dextran sulphate and 20 mM Tris-HCl, pH 7.6] at 65 ~ for 60 min. This was replaced by 20 ml hybridisation solution containing labelled probe. The membranes were incubated overnight in glass bottles at 65 ~ in a hybridisation oven. The membranes were then washed as described: 2 • 30 min in 4 x SSC, 1% SLS at 65 ~ 2 x 30 min in 2 x SSC, 0.5% SLS at room temperature; 2 x 30 min in 2 x SSC at room temperature. The membranes were then exposed to X-ray film (Cronex-4) for appropriate lengths of time.

R e s u l t s

Differences in 9rowth and tropic curvatures between Wt and agr3 roots. To characterise the tropic responses of Wt and agr-3 roots, seedlings were grown in darkness for 2 d. The seedlings were transferred onto new agar with the roots in approximate a l ignment and then the roots were carefully s traightened with a b lun t needle. This was done as over- layering the seedlings with mol ten agar resulted in posi- t ional d is rupt ion to the seedlings and thus differing degrees of gravitropic s t imulat ion. The dishes were then oriented so that the roots were in a downward direct ion and they were then allowed to grow for 4 h before being rotated 135 ~ to the vertical to init iate tropic s t imulat ion. We used 135 ~ gravis t imula t ion rather than the 90 ~ used previously (Bell and Maher 1990) in order to increase the gravi ta t ional s t imulus applied to the roots. Time-lapse pho tography was used to estimate the subsequent degree of curvature and the con t inued growth of the roots. Nu- merous measurements showed that the transfer and the s t ra ightening of the roots did no t detectably affect either growth or curvature (Sinclair 1993).

Figure 1A illustrates the gravi tropic sensitivity and the growth characteristics of the roots of seedlings of both Wt Arabidopsis and the m u t a n t agr-3 used in this study. Whereas the Wt roots commenced bend ing soon after gravis t imulat ion, those of agr-3 exhibited a more pro- nounced lag period. Once bend ing had commenced it was

120

~3 20

o,

2O0

120

12

~ 2

w' I agr-3

A /2 ,',,'0 2',

Time (Hours)

t

T

3

B

Time (Hours)

�9 ~ W t

24 48

Time (Hours)

Fig. 1A-C. Gravity-induced curvature of Wt and agr-3 Arabidopsis roots on receipt of single and double gravity stimulations. A Wt and agr-3 seedlings with vertically growing roots were gravistimulated by rotation of 135 ~ Curvature of the roots was measured for a total period of 24 h. Bars represent means _ SE (n = 48). B Wt and agr-3 seedlings with vertically growing roots were rotated to 90 ~ to the vertical and curvature measured after 24 h. An additional 90 ~ gravity stimulus was then imposed and curvature again measured after a further 24 h (n = 48). C Root growth of the seedlings used in experiment in B

slower and ceased earlier than in Wt at an eventual average angle of 65-70 ~ to the vertical. An impor t an t and notable feature was the much greater variabil i ty in the final curvatures achieved by agr-3 roots as indicated by the larger error bars. The agr-3 m u t a n t clearly has a gravisensing mechan i sm but this mechan i sm lacks pre- cision and the root is unable to discr iminate better than approximate ly 65 ~ to the vertical. The longer lag period, greater variabil i ty in angle achieved and slower reorienta- t ion imply that the gravisensing capabil i ty has been im- paired. O n occasions, some agr-3 roots were observed to bend upwards on initial s t imula t ion and orient slowly downwards in the opposi te direct ion thus undergo ing a ro ta t ion of near ly 180 ~

Bell and Maher (1990) suggested that aor-3 might represent a diagravi t ropic phenotype, with hor izonta l ly or ientated growth. To investigate this possibili ty a double reor ienta t ion experiment was carried out (Fig. 1B). In this experiment, roots of Wt and agr-3 were s t imulated at 90 ~ to the vertical and the bend ing angle measured after 24 h. The roots were then oriented by a further 90 ~ to the vertical and the bend ing angle measured again after 24 h.

346 W. Sinclair et al.: Calmodulin in a gravitropic Arabidopsis mutant

The effect on the Wt and agr-3 was similar. The roots of the Wt bent a total of 181 ~ while that of agr-3 bent only 110 ~ in two approximate increments of 55 ~ each. This experiment confirms that the agr-3 root is unable to discriminate better than 45 ~ (equivalent to half the degree of stimulation) to the vertical but also suggests that agr-3 is probably not a diagravitropic but a plagiogravitropic phenotype. These double reorientation treatments did not affect root growth which was identical in the Wt and agr-3 (Fig. 1C).

Calmodulin-binding inhibitors distinguish two phases in Arabidopsis root curvature. To test whether agr-3 might be related to changes in CaM we first carried out a series of simple measurements on the effects of CaM-binding inhibitors on growth and curvature of Wt. The CaM- binding inhibitors trifluoperazine (TFP), calmidazolium and W7 (and W5 as a supposed inactive analogue of W7, Hidaka et al. 1981) were included in agar on which the roots were grown after gravitropic stimulation by rotation to 135 ~ . Curvature and growth measurements were made 24 h after stimulation. The results are presented as dose response curves and are shown in Fig. 2.

Inhibition of curvature could be clearly separated into two phases. For T F P and calmidazolium the first phase (I) was detected as having commenced at concentrations as low as 0.01 ~M (Fig. 2A, B) and finished at about 0.1 txM. The second phase (II) commenced at 1 ~tM and was virtually complete at 100 ktM. Phase I occurred in the absence of inhibition of root growth but Phase II occurred commensurate with growth inhibition. Although these two events might be causally related, root curvature could be accomplished with very low rates of differential growth. Figure 2C shows that two phases of inhibition were also detectable with W7 but Phase I did not start until higher concentrations (0.1 pM) and the plateau region between Phases I and II (1-5 ~tM) was truncated. W5, an inactive analogue of W7, is generally considered to be an effective inhibitor at much higher concentrations. Figure 2D shows that a higher concentration (1.0 ~M) was indeed required to inhibit curvature but this concentration also inhibited growth and the two phases observed in Figs. 2A-C were no longer detectable.

Since CaM is a pr imary plant calcium receptor, the use of other inhibitors which impair calcium signalling might also reveal the two phases of bending inhibition observed in Fig. 2, thus helping to clarify their origin. That this is not the case is shown in Fig. 3. We used a variety of channel blockers (lanthanum, gadolinium, Verapamil), EGTA and ruthenium red to try and detect two phases of curvature inhibition. We also used two auxins (IAA and 2,4-dichlorophenoxyacetic acid) both of which are known to inhibit growth and one of which (IAA) is believed to participate in the curvature process. Figure 3 shows the effects of La ~ +, Verapamil, IAA and EGTA as representa- tive of these data; data for the other inhibitors/regulators did not fundamentally differ from these. For the first three of these inhibitors/regulators, inhibition of both growth and bending parallel each other. We did not detect two phases of curvature inhibition and the inhibition of bending which did occur accompanied a concomitant inhibition of growth. Gadol inium ions have been claimed

140 ,2.8 1 4 0 ~ .2.8

lO t ~t,. ~ ~2.0 100~" T " ~ - w ~ , , , ~ ]2.0

60 ~ - ~ " ~ 1 [ 2 60~ ~ ~1.2

0 .4 20[ t ~ I | ~ '~0 .4

0 0.01 0.1 1.0 10 100 0 0.01 0,1 1.0 10 100 TFP ~M) Calmidazollum (p.M)

140er----._._=_= j2.8 1 4 0 ~ .2.8 2.4 _ 2 .4

~oo ~ ""*._'~'~ 12.0 100~ --,4-'g~2.0 80t T "-.~.~'~x. JL6 sot ~._Y1.6 60 t x " ~ ' ~ -~ 1.2 60 '0:28 '~f ~ II "~,o.4 20[ LP to.4

.20 r . . . . . . . . . . . . . . . . . . . tO.O .20 r . . . . . . . . . . . . . . JO.O 0 0.01 0.1 1.0 10 100 0 0.01 0.1 1.0 10 100

W.7 0xM) W-5 (~M)

Fig. 2A-D. Dose response curves of inhibition of root growth and gravity-induced curvature of Wt Arabidopsis roots by the CaM- binding inhibitors TFP, calmidazolium, W7 and W5. Seedlings were placed on agar containing the appropriate concentration of inhibitor and the roots vertically positioned. Root growth and gravity- induced curvature were measured 24 h after rotation of the seedlings by 135 ~ Bars represent SE (n = 48). Filled symbols represent curvature in degrees (left axis); open symbols represent root growth in mm (right axis)

140_ .2.8 140~-...---.~._..a.,~ _ , 12.8 1 ~ ~ ~ 42.4 120 k-----g..~ . " - y ' - ~ _ ~2.4 100[ " ~ - ] [ ~ o 72.0 1007 " ~ ~ ]2.0 80 f ~ . x ~ 1.6 ~ I * " ~ " ~ 1 . 6

~~ A t 0.8 z o l - ! 1 1o.8 . . . . . . . . . . . . : o t . . . . . . 1~

0 0.01 0.1 1.0 10 tO0 0 0.01 0.1 1.0 10 100

Lanthanum (~tM) Verapamil (pM)

140 / .~ 2.8 �9 2.4

60 [ ~lr 1.2

" o O.Ol o.1 1.o lo ~ IAA (I~M)

140~ ~ ~ 2.8 1 2 0 ~ . J 2.4 100 ~ - " ~ ~ 2.0 80 [" ="n~f"lkz'] 1 6

l ~ . - 1 ~ 1:2 :" F r x ~o.8

-20 [ . . . . . . . . . . . . . . . . . . . . . . . . . . J 0.0 0 0.01 0.1 l.O 10 100

EGTA (I.tM)

Fig. 3A-D. Dose response inhibition of root growth and gravity- induced curvature of Wt Arabidopsis roots by La 3 +, Verapamil, IAA and EGTA. Method, axes and symbols as in Fig. 2

to be a relatively specific inhibitor of tropic curvature (Millet and Pickard 1988). Gadolinium, however, inhibited growth and curvature in parallel and only at concentrations above 10 ~tM; much higher than La 3 +. Again IAA caused parallel inhibitions of growth and bending, an unexpected result if a gradient of auxin across the tip specifically regulates the curvature processes. Only with EGTA (Fig. 3D) was some discrepancy noted between the inhibitory effects on growth and bending, with greater effects on bending, which confirms previous observations (Lee et al. 1983a).

W. Sinclair et al.: C a l m o d u l i n in a gravi t ropic Arbidopsis m u t a n t

We used the above observations in order to clarify the nature of the agr-3 mutation. The agr-3 seedlings were treated in the same way as Wt in Figs. 2 and 3 and the data are shown in Figs. 4 and 5. Figure 4 summarises the effects of the CaM-binding inhibitors on the bending of agr-3 and Fig. 5 the effects of La 3 +, Verapamil, IAA and EGTA. It is quite clear from Fig. 4 that agr-3 roots do not possess two detectable curvature phases observed in Wt roots (Fig. 2). Curvature and growth inhibition occurred commensurately starting at about 0 .3-1.0gM calmidazolium, T F P and W7 concentrations. We suggest that this implies that agr-3 roots only possess phase II curvature. It should be noted that W5 only commenced curvature inhibition at 10 ~tM, an order of magnitude higher than W7, and again higher than the Wt with W5. The effects of the calcium signalling inhibitors were similar to the effects on Wt seedlings, although E G T A had a slightly lower inhibitory effect on the growth of agr-3, compared to the Wt.

347

equivalent inhibition in agr-3 suggests that these roots do not possess phase I. Alternatively, application of Ca /+ might inhibit the establishment of a Ca ~ + gradient across the tip.

We therefore decided to characterise and sequence the CaM cDNA from Wt Arabidopsis and the agr-3 mutant. However, we could not obtain sufficient root material from Arabidopsis for any of these measurements and consequently we had to rely on the less satisfactory procedure of isolating and purifying CaM (on phenothiazine affigel) from shoots of Wt and aor-3 plants. We used a protocol devised for spinach CaM purification. Table 1 shows the CaM yields obtained in a number of purifications. These calmodulins were separated by SDS gel electrophoresis. Only a single band (CaM-l) was detected (other isoforms were much less abundant) and identical mobilities and EGTA-induced mobility shifts were observed for CaM

140= .2.8 1 2 o ~ _ . 12.4 Is the a9 r mutation a calmodulin mutation? The above lO0~---.--.,t~, "--rm2a4~. ]2.0

data, selective inhibition of tropic bending by CaM-bind- so ing inhibitors, and the presence of two phases of bending 6~ ~ " ~ ' ~ i ~

A I0.8 inhibition (one of which is apparently lost in agr-3) sug- o[ ~ ~ 1o.4 gested to us the possibility that agr-3 might be a form of -20 . . . . . . . . . . . . . . . 0.0 CaM mutation. Further supportive evidence for this hy- 0 0.0x 0.1 L0 ~0 ~00 pothesis came from data in which the roots of Wt and Lanthanum (gM) agr-3 were grown on media with increasing Ca 2 § concentrations. These data are shown in Fig. 6. The growth of Wt 140w-----~...~ o ~ ~ 2.8 and agr-3 roots was inhibited to the same extent by the 120} u ~ , t 2.4

l O 0 ~ - i ~ ' r r ~ - ~ , . ~ - t 2.0 range of calcium concentrations used. But the bending of 80 ~ - - - , -----4.~ _-~ L6 agr-3 roots was unaffected by e x o g e n o u s l y - a p p l i e d C a 2 + 60[ "-'t-t.~ 1.2

4o[ ~-~ ~o.8 in the range up to lO0 pM, concentrations which do cause 20o [ ~ t 0.4 a significant reduction (25 %, or approximately 40 ~ in Wt -zo . . . . . . o.o curvature, leading to agr-3 and Wt total tropic curvature o O.Ol oa ]o responses becoming identical. One interpretation of this IAA (p.M) observation is that the phase I curvature present in Wt roots is inhibited in part or in total by these low concentrations of externally added Ca 2 +. The failure to observe

1 4 0 ~ . . . . . _ . . . ~ = _ _ 12.8 12o~ " ~'~"~a--~L~ . t2.4 xoo t . . . -~o . . . . h.o

,o I B t 0.8

-20 ~ . . . . . . . . . I 0 0.01 0.1 1.0 10 100

Verapamil (p.M)

1 4 0 f i . . . . . . ~ = . _ 1 2.8 120 t ~ . ~ 2.4 1~]~ . ~ . ~ ~2.o 80'~ " " " ' ~ t ~ l L a a ' ~ ' ~ "1 1.6

] ~ 0.8 O[ " ' " 10. 4

-20 ' . . . . . . . . . . . . . . . . . . J 0.0 1.0 100 0 0.01 0.I 1.0 10 100

EGTA (BM)

Fig. 5. Dose response inhibi t ion of root g rowth and grav i ty- induced cu rva tu re of agr-3 Arabidopsis roots by La 3 +, Verapamil , IAA and E G T A . Method , axes and symbo l s in Fig. 2

1401 _ /2 .8 140 1 _ i 2.8 120 ~ " " ~ 3 - 0 ~ . . ~ ~ ~ 2.4 1 2 0 ~ n M ~ 7.4

" n "%' 0.8

.gf . . . . . . . . . .Of . . . . . . . . . . . . . . . . 0 0.01 0.1 1.0 18 1 ~ 0 0.01 0.1 1.0 10 1 ~

TFP (laM) C ~ m i d ~ l l u m {~M)

1 4 0 ~ IZ8 140~ _ 12.8 1 2 0 ~ u ~2.4 1 2 0 ~ f ~ ~ u - ~2.4

~ ~ . . . ' ~ h.6 "~.~ ~ [ g ' ~ l l ~ ''2 o.s 2 ~ f 1 ~ I I ~ 1"2 o.8 O[ ~ ~ ]0.4 0 l Jl.J ]0.4

. . . . . . . . . . . . . . . . . . 1 0.0 f . . . . . . . . . . . . . . 1 0.0 O 0.01 0.1 1.0 10 100 0 0.01 0.1 1.0 10 100

W-7 (p.M) W-5 (l.tM)

Fig. 4 A - D . Dose response curve of inhibi t ion of root g rowth and grav i ty- induced curva tu re of agr-3 Arabidopsis roots by the C a M - b inding inhibi tors T F P , ca lmidazol ium, W7 and W5. Me thod , axes and symbo l s as in Fig. 2

1 4 0 ~ ~ 2.8 1 2 0 ~ z_ 7 2.4 1 ~ ~ ~ 2 . o 80~ = - - ~ . J l . 6

40[ A lo.s to4

. . . . . . . . . . . . 0.0 0 0.01 0.1 1.0 10 100

Calcium (pM)

1 4 0 t 4 2.8 1 2 0 ~ t 2.4

40 0.8 2oIB o4 o[ . . . . . . . . . . Jo .o

0 0.01 0.1 1.0 10 100

Calcium (pNl)

Fig. 6A, B. Dose response inhibi t ion of root g rowth and gravi ty- induced curva tu re in W t (A) and agr-3 (B) Arabidopsis roots by CaCIz. Methods , axes and symbo l s as in Fig. 2

348

Table 1. Quantification of calmodulin extracted from Wt and the a~tr-3 Arabidopsis mutant

Spectrophotometer Protein assay

Hg/100 g FW SE (n) pg/100 gFW SE (n)

Wt 230.5 22.5 5 220.6 18.0 5 agr-3 239.0 16.0 4 221.8 17.1 4


kb A B C D E F G H

I v

e W t

-~ 2 o agr-3

0 1 10 100 1000

n g calrnodulin added

Fig. 7. Dose response activation of phosphodiesterase (PDE) by calmodulins isolated from Wt and agr-3 Arabidopsis seedlings

4.4

2.4

1.4

isolated from Wt and agr-3 plants (data not shown). The mobility of Arabidopsis CAM-1 was identical to spinach CaM separated on the same gel. In addition we tested the ability of these CaMs to activate phosphodiesterase (Fig. 7). So far as could be determined, the activating ability was identical between Wt and agr-3.

However, different CaM-binding proteins are believed to bind to different regions of CaM and our data could not eliminate the possibility of a mutation elsewhere in the sequence which was not necessary for phosphodiesterase activation. Thus we decided that the only way to identify a possible CaM mutat ion was to sequence both Wt and aor-3 cDNA. Preliminary experiments were carried out using Southern hybridisation, by digesting genomic D N A using 10 restriction enzymes and probing with a labelled Arabidopsis CAM-1 (CAM) partial cDNA (obtained from Dr J. Braam, Rice University, Texas, USA). In the case of EcoRV digestion (but not with digestion by nine other restriction enzmes) a single band difference was detected between Wt and agr-3 (data not shown). Consequently, the sequences of Wt and agr-3 CaM cDNA were determined from reverse-transcribed RNA isolated from the two plant types, using PCR amplification. Sequences were determined on each of two independently synthesised cDNAs and were combined. However, the sequences of both Wt and agr-3 CAM-1 CaM cDNA were effectively identical with only minor base differences which would not alter the coding sequence (data not shown).

At least five other CaM isoforms are present in Ara- bidopsis (Gawienowski et al. 1993) and thus we cannot conclude that no CaM sequence differences exist until these have been examined. It is thought that only CAM-1 is expressed in root tissue but expression of minor isoforms, in the root cap for example, would probably be missed in experiments looking at whole-root tissue.

To complete the investigation on CaMs we also elec- trophoretically separated RNA obtained from gravitropically stimulated and unstimulated Wt and agr-3 seedlings and estimated the amounts of CaM m R N A by Northern

Fig. 8. Northern blots of CaM mRNA levels of Wt (tracks A, B, E, F) and agr-3 (C, D, G, H) Arabidopsis seedlings. Tracks A D, agarose gel electrophoresis of total RNA from unstimulated seedlings (A, C) and from seedlings stimulated by rotation of 135 ~ for 0.5 h (B,D) Tracks E-H, Northern blots of gels A D, respectively, probed with end-labelled Arabidopsis CaM cDNA

hybridisations using cDNA labelled with CAM-1. The difficulties in obtaining sufficient gravitropically stimulated tissue for these investigations seriously constrained the practicable numbers of samples obtained. Figure 8 shows the amount of CaM mRNA detected on blots from gels in which 7 gg of total RNA was loaded in each lane. Lanes A and B show Wt RNA on an ethidium-bromide- stained agarose gel. Lane A is RNA extracted from unstimulated root tissue and lane B that from tissue rotated to 135 ~ to the vertical 0,5 h before isolation. Lanes C and D represent the equivalent RNA samples from agr-3 roots. Lanes E - H show the Northern blots derived from these gels.

Figure 8 shows convincingly that whereas gravitropic stimulation of Wt Arabidopsis roots caused an increase (at least three- to fourfold) in CaM mRNA levels, the response in agr-3 was clearly aberrant. There were higher levels in the unstimulated root and the amount under- went a substantial decline within 0.5 h of gravitropic stimulation.

Discussion

The agr-3 mutant is one of a series of gravitropic mutants isolated in this laboratory (Maher and Bell 1990). It is the weakest of the agr series and it is eventually able to

w. Sinclair et al.: Calmodulin in a gravitropic Arbidopsis mutant

assume an average angle of about 60-65 ~ to the vertical after stimulation at 135 ~ . The growth of the mutant agr roots is identical to that of Wt. In double-rotation experiments (Fig. 1B), where the roots were stimulated to 90 ~ on each reorientation, agr-3 curves until an angle of 40-45 ~ to the vertical is again reached. This clearly indi- cates an impairment in the accuracy with which the gravity vector is sensed. However, the lag period in response, the greater variability in final angle achieved and the slightly slower growth response on gravisignalling suggest a more fundamental change in both sensing and response. The agr-3 mutation is probably not a diagravitropic phenotype. All agr mutants are believed to be allelic, and further mapping by us (Sinclair 1993) clearly supports that contention.

Use of TFP, calmidazolium and, less clearly, W7 re- vealed that there were two phases I and II, in the inhibition of Wt curvature (Fig. 2). Phase I occurs in the absence of effects on growth and, in the case of T F P and calmidazolium, is complete at concentrations of about 0.1 JaM. We were able to detect effects of T F P and calmidazolium on curvature at very low concentrations (0.01 ~tM). Although doubts must always be expressed concerning the interpretation of inhibitor experiments, this low-concentration effect argues for a degree of specifi- city. Stinemetz et al. (1992) also reported that corn root curvature was selectively sensitive to CaM-binding inhibitors, but the concentrations required were very much higher, perhaps reflecting the greater thickness of the corn root. Calmodulin-binding inhibitors can inhibit both CaM-dependent enzymes as well as enzymes with CaM- like domains, such as CaM-dependent protein kinase (Roberts and Harmon 1992).

A crucial question which emerges is the identity of these two curvature phases. Traditional views of gravitropism have always emphasised that gravisensing occurs through sedimentation of amyloplasts (statoliths) in specialised cells (statocytes) in the root cap and that in- formation from the cap, perhaps conveyed by auxin, initiates asymmetric growth. However the isolation of a number of mutants which lack starch altogether have initiated a reassessment of this view (Caspar and Pickard 1989; Kiss et al. 1989; Kiss and Sack 1990). In particular, Kiss et al. (1989) studied gravitropic curvature in starchless Arabidopsis roots. They reported that these roots exhibited a longer induction or lag period before curvature commenced and that, subsequently, curvature rates were slower, but eventually full curvature was achieved in response to a 90 ~ stimulation. Taken at their face value this implies that the primary function of the statoliths is to improve the sensitivity of the root to gravi-signalling; some other less sensitive means of reacting to a gravity stimulus are, however, present.

We believe that Phase I of curvature described here may represent the specific contribution of the root cap statocytes to the curvature response. As indicated in the introduction, statocytes have much higher levels of CaM which is bound to the amyloplasts and is presumably in functional combination, whereas other root cells have lower CaM levels primarily located free in the cytoplasm. Amyloplast function should then be much more sensitive to inhibition by CaM-binding inhibitors and should re-

349

spond to lower concentrations (Fig. 2). Analyses by Cox (1986) show that the effect of increasing the cellular concentration of CaM is to enable activation of CaM-dependent enzymes to be accomplished at much lower free calcium concentrations. A higher CaM content could then result in cells which are sensitive to much smaller in- creases in free calcium concentration than other meriste- matic and growing cells in the root. If gravitransmission involves changes in intracellular calcium (Hepler and Wayne 1985; Roux and Serlin 1987; Sievers and Busch 1992), then statocytes have the molecular apparatus to respond to tiny gravitational stimuli. When agr-3 is gravi- signalled, there is a detectable lag before curvature com- mences, unlike the Wt (Fig. 1) but similar to the starchless Arabidopis mutant (Kiss et al. 1989). Furthermore, agr-3 lacks a Phase I type curvature (Fig. 4). We suggest, therefore, that Phase I might represent the specific contribution of the cap to gravi-sensing and response. It is less clear what Phase II may comprise but it could represent gravisensing and response by other cells in the root.

Figure 8 shows that Arabidopsis seedlings which were gravi-signalled increase their extractable level of CaM mRNA at least three- to fourfold. Specialised gravipercep- tive cells in these seedlings (the columella cells of the root cap for example, Kiss et al. 1989) can be estimated to be less than 0.01% of the total. Thus many (if not all) cells of the seedling are able to increase CaM mRNA levels in response to a gravitational stimulus and are thus gravisen- sitive, not just those containing amyloplasts. Wayne et al. (1990) have recently suggested that graviperception in giant algal cells could be mediated by compression of the basal plasma membrane as a result of the weight of the cytoplasm. They show there is sufficient potential energy in this mechanism to open numerous stretch-activated calcium channels. Their calculations also indicate that single (root) cells of higher plants could sense a gravity stimulus by a similar mechanism but there is only sufficient potential energy in the much lighter plant cell protoplast to open only one or a few channels. While gravity could be sensed and curvature initiated by the individual plant cell (if it is capable of growth), the noise which accompanies all channel behaviour would likely ensure that gravity perception would be weak and stochastic and the response slow and variable. Wayne et al. (1990) suggest that the primary reason the higher-plant graviper- ceptive ceils have starch-filled amyloplasts is simply to increase the density of the protoplast, i.e. to act like ballast, thus greatly refining the accuracy of graviperception. The statocyte possesses refined gravity sensing and a more sensitive calcium-response system.

However, an additional mechanism might improve gravisensing and response by plant cells which do not possess statoliths. It is known that horizontally oriented plant tissues experience tension on the top, and compression on the bottom, as a result of gravitational force. Responses induced by this tissue strain are seen most clearly with heavy tree branches and the induction of reaction wood. But the much lighter Arabidopsis root used here should still experience tension/compression with the greatest stress on the top and bot tom epider- mal cells when it is placed in a horizontal or 135 ~ posi- tion, although the extent of the stress would be small in

350

c o m p a r i s o n to heavy branches . Even if the hor izon ta l ly o r ien ted tissue is la id flat on a suppor t ing surface there will still be compress ive weight which will be exper ienced mos t by the l owermos t ep ide rma l cells and in pa r t i cu la r by the basa l p l a s m a m e m b r a n e s of these cells. This mechanism might help improve the accuracy of gravisensing by cells o the r than special ised gravisens ing cells bu t would still no t ma tch the sensi t ivi ty of the s tatocyte. We suggest tha t Phase II cu rva tu re might represent this c o m p o n e n t of bending. I f this was the only c o m p o n e n t of bend ing avai l- able to agr-3 roo ts then the curva ture character is t ics should be very s imilar to those of the starchless Arabidop- sis roo t (Kiss et al. 1989). However , the starchless roo t can assume a vert ical o r i en ta t ion with t ime after gravis ignal l - ing, whils t the agr-3 roo t cannot . Some further difference remains .

Touch signal l ing is perce ived as a result of differential t issue tens ion and compress ion (Pfeffer 1906) and touch signal l ing results in C a M m R N A accumula t ion (Braam and Davies 1990). If ho r i zon ta l ly p laced roots also experience changes in tens ion and compress ion (as suggested above) then C a M m R N A accumula t i on should result, and this was observed (Fig. 8). S t inemetz et al. (1987) showed tha t an accumula t ion of C a M in the cap great ly enhanced gravisens ing by corn roots . The agr-3 m u t a n t is unable to accumula t e C a M m R N A in response to gravi-s ignal l ing and possesses weak gravisens ing capabil i t ies . The gravi- induced accumula t ions of C a M m R N A observed here might then represent an i m p o r t a n t s tep in the gravisens ing / t ransmiss ion mechans im by bo th s ta tocytes and o ther cells of the root , and be necessary for the p roduc t ion of a full response. The p re sumed accumula t i on of C a M might then account in pa r t for the r emarkab l e sensit ivity of g rav icurva tu re to C a M - b i n d i n g inhib i tors (Fig. 2). This calls for a de ta i led s tudy of cel lular d i s t r ibu t ions and accumula t i on of C a M m R N A and C a M in W t and agr-3 after gravis ignal l ing, which is now in progress.

This research was supported by the Open University and the Agri- cultural and Food Research Council. Our thanks to Dr. Marc Knight, Dr. Heather Knight and Dr. Christine McPhie for construc- tive criticism of this manuscript.

References

Allan E, Trewavas AJ (1985) Quantitative changes in calmodulin and NAD kinase during early cell development in the root apex of Pisum sativum L. Planta 165:604-612

Bagshaw SL, Cleland RE (1994) Is wall-bound calcium redistributed during the gravireaction of stems and coleoptiles. Plant Cell Environ 16:1018-1090

Bell CJ, Maher EP (1990) Mutants of Arabidopsis thaliana (L.) Heynh with abnormal gravitropic responses. Mol Gen Genet 220:289-293

Biro RL, Daye S, Serlin BS, Terry ME, Datta N, Sopory SK, Roux SJ (1984) Characterisation of oat calmodulin and radioim- munoassay of its subcellular distribution. Plant Physiol 75: 382 386

Bj6rkman T, Cleland RE (1991) Root growth regulation and gravitropism in maize roots does not require the epidermis. Planta 185: 379-384

Bj6rkman T, Leopold AC (1987) Effect of inhibitors of auxin trans- port and of calmodulin on a gravisensing electric current. Plant Physiol 84:847-850


Braam J, Davis RW (1990) Rain-, wind- and touch-induced expression of calmodulin and calmodulin-related genes in Arabidopsis. Cell 60:357-364

Busch MB, K6rtje KH, Rahmann H, Sievers A (1993) Characteristic and differential calcium signals from cell structures of the root cap detected by energy-filtering electron microscopy (EELS/ESI) Eur J Cell Biol 60:88-100

Caspar T, Pickard BG (1989) Gravitropism in a starchless mutant of Arabidopsis implications for the starch-statolith theory of gravity sensing. Planta 177:185-197

Chandra S, Chabot JF, Morrison GH, Leopold AC (1982) Localisa- tion of calcium in amyloplasts of root cap cells using ion microscopy. Science 216:1221-1223

Cheung WY (1971) Cyclic 3',5'-nucleotide phosphodiesterase. Evid- ence for and properties of a protein activator. J Biol Chem 246: 2859-2869

Chomczynski P, Sacchi N (1987) Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 162:156-159

Clackson T, Gossow D, Jones PT (1991) General applications of PCR to gene cloning and manipulation. In: MJ McPherson, P Quirke, GR Taylor (eds) PCR: a practical approach. IRL Press, Oxford, pp 187-224

Cox JA (1986) Calcium-calmodulin interaction and intracellular function. J Cardiovasc Pharmacol 8 (suppl 6): 545-551

Dauwalder M, Roux SJ, Hardison L (1986) Cellular and subcellular localisation of calcium in gravistimulated corn roots. Proto- plasma 129:137 148

Dellaporta SL, Wood J, Hicks JB (1983) A plant DNA miniprepara- tion: version II. Nucleic Acids Res 12:387-395

Evans ML (1991) Gravitropism: interaction of sensitivity modula- tion and effector redistribution. Plant Physiol 95:1-5

Feinberg AP, Vogelstein B (1983) A technique for radiolabelling DNA restriction endonuclease fragments to a high specific activity. Anal Biochem 132:6-13

Feinberg AP, Vogelstein B (1984) Addendum "A technique for radiolabelling DNA restriction endonuclease fragments to a high specific activity". Anal Biochem 137:266-267

Feldman L J, Gildow V (1984) Effects of light on protein patterns in gravitropically stimulated root caps of corn. Plant Physiol 74: 208-212

Gawienowski MC, Szymanski D, Perera IY, Zielinski RE (1993) Calmodulin isoforms in Arabidopsis encoded by multiple diver- gent mRNAs. Plant Mol Biol 22:215-225

Hepler PK, Wayne RO (1985) Calcium and plant development. Annu Rev Plant Physiol 36:397-439

Hidaka H, Sasaki Y, Tanaka T, Endo T, Ohno S, Fuji Y, Nagata T (1981) N-(6-aminohexyl)-5-chloro-l-naphthalenesulfonamide, a calmodulin antagonist, inhibits cell proliferation. Proc Natl Acad Sci USA 78:4354-4357

Kiss JZ, Sack FD (1990) Severely reduced gravitropism in dark- grown hypocotyls of a starch-deficient mutant of Nieotiana sylvestris. Plant Physiol 94:1867 1873

Kiss JZ, Sack FD, Hertel R (1989) Amyloplasts are necessary for full gravitropic sensitivity in roots of Arabidopsis thaliana. Planta 117:198-206

Lee JS, Mulkey TJ, Evans ML (1983a) Gravity induced polar trans- port of calcium across root tips in maize. Plant Physiol 73: 874-876

Lee JS, Mulkey T J, Evans ML (1983b) Reversible loss of gravitropic sensitivity in maize roots after tip application of calcium chelators. Science 220:1375-1376

Lin TP, Caspar T, Somerville C, Preiss J (1988) Isolation and characterisation of a starchless mutant of Arabidopsis thaliana (L) Heynh lacking ADP glucose phosphorylase activity. Plant Physiol 86:1131-1135

Ling V, Perera I, Zielinski RE (1991) Primary structures of Ara- bidopsis calmodulin isoforms deduced from the sequences of cDNA clones. Plant Physiol 96:1196 1202

Lukas TJ, Wallen-Friedmann M, Kung C, Watterson DM (1989) In vivo mutations of calmodulin: A mutant Paramecium with altered

W. Sinclair et al.: Calmodulin in a gravitropic Arbidopsis mutant 351

ion current regulation has an isoleucine-to-threonine change at residue 136 and an altered methylation state at lysine residue 115. Proc Natl Acad Sci USA 86:7331-7335

Maher EP, Bell CJ (1990) Abnormal responses to gravity and auxin in mutants of Arabidopsis thaliana. Plant Sci 66:131-138

Maher EP, Martindale SJB (1980) Mutants of Arabidopsis thaliana with altered responses to auxin and gravity. Biochem Genet 18: 1041 1053

Millet B, Pickard BG (1988) Gadolinium ion is an inhibitor suitable for testing the putative role of stretch-activated ion channels in geotropism and thigmotropism. Biophys J $3, 155a

Perera IY, Zielinski RE (1992) Structure and expression of the Arabidopsis CAM-3 calmodulin gene. Plant Mol Biol 19: 649-664

Pfeffer W (1906) The physiology of plants. Volume 3 (translated by AJ Ewart) Clarendon Press, Oxford

Poovaiah BW, McFadden J J, Reddy ASN (1987) The role of calcium ions in gravity signal perception and transduction. Physiol Plant 71:401-407

Poovaiah BW, Reddy ASN (1987) Calcium messenger systems in plants. CRC Crit Rev Plant Sci 6:47-103

Roberts DM, Harmon AC (1992) Calcium-modulated proteins: targets of intracellular calcium signals in higher plants. Annu Rev Plant Physiol Plant Mol Biol 43:375-414

Roux SJ, Serlin BS (1987) Cellular mechanisms controlling light- stimulated gravitropism: role of calcium. Crit Rev Plant Sci 5: 205-236

Roux SJ, Slocum RD (1982) Role of calcium in mediating cellular functions important for growth and development in higher plants. Calcium Cell Funct 3:409-453

Sambrook J, Fritsch EF, Maniatis T (1989) Molecular Cloning: a laboratory manual. Cold Spring Harbor Press, New York

Sanger F, Nicklen S, Coulson AR (1977) DNA sequencing with chain-terminating inhibitors. Proc Natl Acad Sci USA 74: 5463-5467

Sievers A, Busch M (1992) An inhibitor of the Ca 2 § in the sarcoplasmic and endoplasmic reticula inhibits transduction of the gravity stimulus in cress roots. Planta 188:619-622

Sinclair WT (1993) The role of calmodulin in the altered gravitropic response of the agr- and aux-1 mutants of Arabidopsis thaliana (L.) Heynh. PhD thesis, The Open University

Stinemetz CL, Kuzmanoff KM, Evans ML, Jarret HW (1987) Correlations between calmodulin activity and gravitropic sensitivity in primary roots of maize. Plant Physiol 84: 1337-1342

Stinemetz CL, Hasenstein KH, Young LM, Evans ML (1992) Effect of calmodulin antagonists on the growth and gravirespon- siveness of primary roots of maize. Plant Growth Regul 11: 419-427

Trewavas AJ (1992) Forum: What remains of the Cholodny-Went Theory? Plant Cell Environ 14:1 12

Wayne RO, Staves MP, Leopold AC (1990) Gravity-dependent polarity of cytoplasmic streaming in Nitellopsis. Protoplasma 155:43-57

Zielinski RE (1987) Calmodulin mRNA in barley (Hordeum vulgate L.) apparent regulation by cell proliferation and light. Plant Physiol 84:937 943

Zielinski RE, Ling V, Perera I (1990) Structure and expression of genes encoding calcium-modulated proteins in higher plants. Curr Topics Plant Biochem Physiol 9:141-152

The role of calmodulin in the gravitropic response of the Arabidopsis thaliana agr-3 mutant

Documents

Transcript of The role of calmodulin in the gravitropic response of the Arabidopsis thaliana agr-3 mutant