Seediscussions,stats,andauthorprofilesforthispublicationat:https://www.researchgate.net/publication/308929064

TheRETE616QVariantisaGainofFunctionMutationPresentinaFamilywithFeaturesofMultipleEndocrineNeoplasia2A

ArticleinEndocrinePathology·October2016

DOI:10.1007/s12022-016-9451-6

CITATIONS

0

8authors,including:

SalvadorJDiaz-Cano

King'sCollegeLondon

268PUBLICATIONS2,350CITATIONS

SEEPROFILE

Availablefrom:SalvadorJDiaz-Cano

Retrievedon:07October2016

The RET E616Q Variant is a Gain of FunctionMutation Present in a Family with Features ofMultiple Endocrine Neoplasia 2A

Endocrine Pathology

William Grey, Rosaline Hulse, Anna Yakovleva, Dilyana Genkova, Benjamin Whitelaw, 

Ellen Solomon, Salvador J. Diaz-Cano, Louise Izatt   

ArticleFirst Online: 05 October 2016

DOI (Digital Object Identifier): 10.1007/s12022-016-9451-6

Cite this article as:

Grey, W., Hulse, R., Yakovleva, A. et al. Endocr Pathol (2016).

doi:10.1007/s12022-016-9451-6

Abstract

The REarranged during Transfection (RET) proto-oncogene is a receptor tyrosinekinase involved in growth and differentiation during embryogenesis and maintenanceof the urogenital and nervous systems in mammals. Distinct mutations across hotspotRET exons can cause Multiple Endocrine Neoplasia Type 2A (MEN2A) characterised bydevelopment of medullary thyroid cancer (MTC), phaeochromocytoma (PCC) andprimary hyperparathyroidism (PHPT), with a strong correlation between genotype andphenotype. Here, we report a 42-year-old man presented in the clinic with a unilateralPCC, with subsequent investigations revealing a nodular and cystic thyroid gland. Heproceeded to thyroidectomy, which showed bilateral C-cell hyperplasia (CCH) withoutevidence of MTC. His brother had neonatal Hirschsprung disease (HSCR). Genetictesting revealed the presence of a heterozygous variant of unknown significance (VUS)in the cysteine-rich region of exon 10 in the RET gene (c.1846G>C, p.E616Q), in both

pp 1–8

Authors Authors and affiliations

The RET E616Q Variant is a Gain of Function Mutation Present ... http://link.springer.com/article/10.1007/s12022-016-9451-6

1 of 10 10/7/16, 8:41 PM

affected siblings and their unaffected mother. Exon 10 RET mutations are known to beassociated with HSCR and MEN2. Variants in the cysteine-rich region of the RET gene,outside of the key cysteine residues, may contribute to the development of MEN2 in aless aggressive manner, with a lower penetrance of MTC. Currently, a VUS in RETcannot be used to inform clinical management and direct future care. Analysis ofRET reveals a gain of function mutant phenotype for this variant, which has notpreviously been reported, indicating that this VUS should be considered at risk forfuture clinical management.

Keywords

MEN2A RET proto-oncogene Hirschsprung Phaeochromocytoma C-cellhyperplasia

Electronic supplementary material

The online version of this article (doi:10.1007/s12022-016-9451-6 (http://dx.doi.org/10.1007/s12022-016-9451-6)) contains supplementary material, which is available toauthorized users.

(915 kb)Supp. Fig. 1Foci of C-cell hyperplasia revealed intrafollicular circumferentialproliferation of C-cell without nuclear atypia. No solid C-cell nests or stromalinvasion were identified (haematoxylin-eosin and immunohistochemical stain forcalcitonin, 100×). Method as described by Williams et al. [45]. (PPTX 915 kb)

(210 kb)Supp. Fig. 2A. In silico analysis of the RET51 protein sequence using theAlign-GVGD program (http://agvgd.iarc.fr (http://agvgd.iarc.fr/)). Mutations aredepicted as solid circles, labelled to the right. GV = Grantham Variation, GD = Grantham Deviation. B. Table summarising GD, GV and predicted class ofpathogenicity along the Align-GVGD scale (C0 = weakest pathogenicity, C65 = strongest pathogenicity). (GIF 70 kb)

(57 kb)Supp. Fig. 3Data for Empty Vector controls only from Fig. 2. The graph showsincreasing induction of Luciferase activity when serum, GDNF or both are added for16 h. (GIF 23 kb)

(16 kb)

E616Q

Supplementary material

12022_2016_9451_MOESM1_ESM.pptx

12022_2016_9451_MOESM2_ESM.tif

12022_2016_9451_MOESM3_ESM.tif

12022_2016_9451_MOESM4_ESM.docx

The RET E616Q Variant is a Gain of Function Mutation Present ... http://link.springer.com/article/10.1007/s12022-016-9451-6

2 of 10 10/7/16, 8:41 PM

Supplementary Table 1Patient features for all heterozygous RET E616Q familymembers at last clinical evaluation or age at operation. (DOCX 16.4 kb)

(18 kb)Supplementary Table 2Primers used in this study. Purpose is noted in the finalcolumn. (DOCX 18 kb)

(16 kb)Supplementary Table 3Further hereditary phaeochromocytoma and paragangliomagenes sequenced by NGMS during this study (PPGL) including; HGNC name,symbol, number, OMIM ID and clinical phenotype. The entire RET gene (20 exons)was sequenced during initial investigation and subsequent PPGL gene analysisconfirmed the heterozygous RET E616Q variant. In addition MLPA analysis of thefollowing genes was completed: RET, SDHAF2, SDHB, SDHC, SDHD and VHL.(DOCX 15 kb)

(16 kb)Supplementary Table 4Adapted from ARUP laboratories, University of Utah(www.arup.utah.edu/database/men2 (http://www.arup.utah.edu/database/men2)). Genetic and disease associated information for mutations generated inthis study, including our RET E616Q. N/R, not recorded, N/A, not applicable.(DOCX 15 kb)

12022_2016_9451_MOESM5_ESM.docx

12022_2016_9451_MOESM6_ESM.docx

12022_2016_9451_MOESM7_ESM.docx

References

1. Takahashi M, Ritz J, Cooper GM (1985) Activation of a novel human transforming gene,ret, by DNA rearrangement. Cell 42:581–588. doi: 10.1016/0092-8674(85)90115-1(http://dx.doi.org/10.1016/0092-8674(85)90115-1)CrossRef (http://dx.doi.org/10.1016/0092-8674(85)90115-1)PubMed (http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&dopt=Abstract&list_uids=2992805)

2. Takahashi M, Cooper GM (1987) ret transforming gene encodes a fusion proteinhomologous to tyrosine kinases. Mol Cell Biol 7:1378–1385.

3. Takahashi M, Buma Y, Iwamoto T, et al. (1988) Cloning and expression of the ret proto-oncogene encoding a tyrosine kinase with two potential transmembrane domains.Oncogene 3:571–578.PubMed (http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&dopt=Abstract&list_uids=3078962)

4. Manié S, Santoro M, Fusco A, Billaud M (2001) The RET receptor: function indevelopment and dysfunction in congenital malformation. Trends Genet 17:580–9.CrossRef (http://dx.doi.org/10.1016/S0168-9525(01)02420-9)

The RET E616Q Variant is a Gain of Function Mutation Present ... http://link.springer.com/article/10.1007/s12022-016-9451-6

3 of 10 10/7/16, 8:41 PM

PubMed (http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&dopt=Abstract&list_uids=11585664)

5. Jing S, Wen D, Yu Y, et al. (1996) GDNF-induced activation of the ret protein tyrosinekinase is mediated by GDNFR-alpha, a novel receptor for GDNF. Cell 85:1113–1124. doi:10.1016/S0092-8674(00)81311-2 (http://dx.doi.org/10.1016/S0092-8674(00)81311-2)CrossRef (http://dx.doi.org/10.1016/S0092-8674(00)81311-2)PubMed (http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&dopt=Abstract&list_uids=8674117)

6. Mise N, Drosten M, Racek T, et al. (2006) Evaluation of potential mechanisms underlyinggenotype-phenotype correlations in multiple endocrine neoplasia type 2. Oncogene25:6637–47. doi: 10.1038/sj.onc.1209669 (http://dx.doi.org/10.1038/sj.onc.1209669)CrossRef (http://dx.doi.org/10.1038/sj.onc.1209669)PubMed (http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&dopt=Abstract&list_uids=16715139)

7. Machens A, Dralle H (2007) Genotype-phenotype based surgical concept of hereditarymedullary thyroid carcinoma. World J Surg 31:957–968. doi:10.1007/s00268-006-0769-y (http://dx.doi.org/10.1007/s00268-006-0769-y)CrossRef (http://dx.doi.org/10.1007/s00268-006-0769-y)PubMed (http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&dopt=Abstract&list_uids=17453286)

8. Donis-Keller H, Dou S, Chi D, et al. (1993) Mutations in the RET proto-oncogene areassociated with MEN 2A and FMTC. Hum Mol Genet 2:851–856. doi: 10.1093/hmg/2.7.851 (http://dx.doi.org/10.1093/hmg/2.7.851)CrossRef (http://dx.doi.org/10.1093/hmg/2.7.851)PubMed (http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&dopt=Abstract&list_uids=8103403)

9. Mulligan LM, Kwok JB, Healey CS, et al. (1993) Germ-line mutations of the RET proto-oncogene in multiple endocrine neoplasia type 2A. Nature 363:458–460. doi:10.1038/363458a0 (http://dx.doi.org/10.1038/363458a0)CrossRef (http://dx.doi.org/10.1038/363458a0)PubMed (http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&dopt=Abstract&list_uids=8099202)

10. Eng C, Crossey PA, Mulligan LM, et al. (1995) Mutations in the RET proto-oncogene andthe von Hippel-Lindau disease tumour suppressor gene in sporadic and syndromicphaeochromocytomas. J Med Genet 32:934–937. doi: 10.1136/jmg.32.12.934(http://dx.doi.org/10.1136/jmg.32.12.934)CrossRef (http://dx.doi.org/10.1136/jmg.32.12.934)PubMed (http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&dopt=Abstract&list_uids=8825918)PubMedCentral (http://www.ncbi.nlm.nih.gov/pmc/articles/PMC1051771)

11. Hofstra RM, Landsvater RM, Ceccherini I, et al. (1994) A mutation in the RET proto-

The RET E616Q Variant is a Gain of Function Mutation Present ... http://link.springer.com/article/10.1007/s12022-016-9451-6

4 of 10 10/7/16, 8:41 PM

oncogene associated with multiple endocrine neoplasia type 2B and sporadic medullarythyroid carcinoma. Nature 367:375–376. doi: 10.1038/367375a0 (http://dx.doi.org/10.1038/367375a0)CrossRef (http://dx.doi.org/10.1038/367375a0)PubMed (http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&dopt=Abstract&list_uids=7906866)

12. Santoro M, Carlomagno F (2013) Central role of RET in thyroid cancer. Cold Spring HarbPerspect Biol 5:a009233. doi: 10.1101/cshperspect.a009233 (http://dx.doi.org/10.1101/cshperspect.a009233)CrossRef (http://dx.doi.org/10.1101/cshperspect.a009233)PubMed (http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&dopt=Abstract&list_uids=24296167)PubMedCentral (http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3839608)

13. Plaza-Menacho I, Mologni L, McDonald NQ (2014) Mechanisms of RET signaling incancer: current and future implications for targeted therapy. Cell Signal 26:1743–52. doi:10.1016/j.cellsig.2014.03.032 (http://dx.doi.org/10.1016/j.cellsig.2014.03.032)CrossRef (http://dx.doi.org/10.1016/j.cellsig.2014.03.032)PubMed (http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&dopt=Abstract&list_uids=24705026)

14. Dahia PLM (2014) Pheochromocytoma and paraganglioma pathogenesis: learning fromgenetic heterogeneity. Nat Rev Cancer 14:108–19. doi: 10.1038/nrc3648(http://dx.doi.org/10.1038/nrc3648)CrossRef (http://dx.doi.org/10.1038/nrc3648)PubMed (http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&dopt=Abstract&list_uids=24442145)

15. Drosten M, Hilken G, Bockmann M, et al. (2004) Role of MEN2A-derived RET inmaintenance and proliferation of medullary thyroid carcinoma. J Natl Cancer Inst96:1231–1239. doi: 10.1093/jnci/djh226 (http://dx.doi.org/10.1093/jnci/djh226)CrossRef (http://dx.doi.org/10.1093/jnci/djh226)PubMed (http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&dopt=Abstract&list_uids=15316058)

16. Cooper DS, Doherty GM, Haugen BR, et al. (2009) Revised American Thyroid Associationmanagement guidelines for patients with thyroid nodules and differentiated thyroidcancer. Thyroid 19:1167–1214. doi: 10.1089/thy.2009.0110 (http://dx.doi.org/10.1089/thy.2009.0110)CrossRef (http://dx.doi.org/10.1089/thy.2009.0110)PubMed (http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&dopt=Abstract&list_uids=19860577)

17. Kloos RT, Eng C, Evans DB, et al. (2009) Medullary thyroid cancer: managementguidelines of the American Thyroid Association. Thyroid 19:565–612. doi:10.1089/thy.2008.0403 (http://dx.doi.org/10.1089/thy.2008.0403)CrossRef (http://dx.doi.org/10.1089/thy.2008.0403)

The RET E616Q Variant is a Gain of Function Mutation Present ... http://link.springer.com/article/10.1007/s12022-016-9451-6

5 of 10 10/7/16, 8:41 PM

PubMed (http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&dopt=Abstract&list_uids=19469690)

18. Fialkowski EA, DeBenedetti MK, Moley JF, Bachrach B (2008) RET proto-oncogenetesting in infants presenting with Hirschsprung disease identifies 2 new multiple endocrineneoplasia 2A kindreds. J Pediatr Surg 43:188–190. doi: 10.1016/j.jpedsurg.2007.09.043(http://dx.doi.org/10.1016/j.jpedsurg.2007.09.043)CrossRef (http://dx.doi.org/10.1016/j.jpedsurg.2007.09.043)PubMed (http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&dopt=Abstract&list_uids=18206480)

19. Wells SA, Asa SL, Dralle H, et al. (2015) Revised american thyroid association guidelinesfor the management of medullary thyroid carcinoma. Thyroid 25:567–610. doi:10.1089/thy.2014.0335CrossRef (http://dx.doi.org/10.1089/thy.2014.0335)PubMed (http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&dopt=Abstract&list_uids=25810047)PubMedCentral (http://www.ncbi.nlm.nih.gov/pmc/articles/PMC4490627)

20. Tanaka M, Xiao H, Hirata Y, Kiuchi K (2003) A rapid assay for glial cell line-derivedneurotrophic factor and neurturin based on transfection of cells with tyrosine hydroxylasepromoter-luciferase construct. Brain Res Brain Res Protoc 11:119–22.CrossRef (http://dx.doi.org/10.1016/S1385-299X(03)00023-0)PubMed (http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&dopt=Abstract&list_uids=12738007)

21. Hayashi Y, Iwashita T, Murakamai H, et al. (2001) Activation of BMK1 via tyrosine 1062 inRET by GDNF and MEN2A mutation. Biochem Biophys Res Commun 281:682–9. doi:10.1006/bbrc.2001.4338 (http://dx.doi.org/10.1006/bbrc.2001.4338)CrossRef (http://dx.doi.org/10.1006/bbrc.2001.4338)PubMed (http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&dopt=Abstract&list_uids=11237712)

22. Arighi E, Popsueva A, Degl’Innocenti D, et al. (2004) Biological effects of the dualphenotypic Janus mutation of ret cosegregating with both multiple endocrine neoplasiatype 2 and Hirschsprung’s disease. Mol Endocrinol 18:1004–17. doi:10.1210/me.2003-0173 (http://dx.doi.org/10.1210/me.2003-0173)CrossRef (http://dx.doi.org/10.1210/me.2003-0173)PubMed (http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&dopt=Abstract&list_uids=14715928)

23. Plaza-Menacho I, Van Der Sluis T, Hollema H, et al. (2007) Ras/ERK1/2-mediated STAT3Ser727 phosphorylation by familial medullary thyroid carcinoma-associated RET mutantsinduces full activation of STAT3 and is required for c-fos promoter activation, cellmitogenicity, and transformation. J Biol Chem 282:6415–6424. doi:10.1074/jbc.M608952200 (http://dx.doi.org/10.1074/jbc.M608952200)CrossRef (http://dx.doi.org/10.1074/jbc.M608952200)

The RET E616Q Variant is a Gain of Function Mutation Present ... http://link.springer.com/article/10.1007/s12022-016-9451-6

6 of 10 10/7/16, 8:41 PM

PubMed (http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&dopt=Abstract&list_uids=17209045)

24. Menacho IP, Koster R, Sloot AM Van Der, et al. (2005) RET-Familial Medullary ThyroidCarcinoma Mutants Y791F and S891A Activate a Src/JAK/STAT3 Pathway, Independent ofGlial Cell Line − Derived Neurotrophic Factor of Glial Cell Line – Derived NeurotrophicFactor. 1729–1737.

25. Xing S (1998) Signal Transduction Pathways Activated by RET Oncoproteins in PC12Pheochromocytoma Cells. J Biol Chem 273:4909–4914. doi: 10.1074/jbc.273.9.4909(http://dx.doi.org/10.1074/jbc.273.9.4909)

26. Tacito A, Vivaldi A, Ciampi R, et al. (2013) Genetic Screening Of RET Can Identify NewMutations Even After 20 Years. Thyroid World Congr.

27. Wolfe HJ, Melvin KE, Cervi-Skinner SJ, et al. (1973) C-cell hyperplasia precedingmedullary thyroid carcinoma. N Engl J Med 289:437–41. doi:10.1056/NEJM197308302890901 (http://dx.doi.org/10.1056/NEJM197308302890901)CrossRef (http://dx.doi.org/10.1056/NEJM197308302890901)PubMed (http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&dopt=Abstract&list_uids=4587234)

28. DeLellis RA, Nunnemacher G, Wolfe HJ (1977) C-cell hyperplasia. An ultrastructuralanalysis. Lab Invest 36:237–48.PubMed (http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&dopt=Abstract&list_uids=839736)

29. Cooper GM, Stone EA, Asimenos G, et al. (2005) Distribution and intensity of constraint inmammalian genomic sequence. Genome Res 15:901–913. doi: 10.1101/gr.3577405(http://dx.doi.org/10.1101/gr.3577405)CrossRef (http://dx.doi.org/10.1101/gr.3577405)PubMed (http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&dopt=Abstract&list_uids=15965027)PubMedCentral (http://www.ncbi.nlm.nih.gov/pmc/articles/PMC1172034)

30. Iwashita T, Murakami H, Asai N, Takahashi M (1996) Mechanism of ret dysfunction byHirschsprung mutations affecting its extracellular domain. Hum Mol Genet 5:1577–80.CrossRef (http://dx.doi.org/10.1093/hmg/5.10.1577)PubMed (http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&dopt=Abstract&list_uids=8894691)

31. Hyndman BD, Gujral TS, Krieger JR, et al. (2013) Multiple functional effects of RET kinasedomain sequence variants in Hirschsprung disease. Hum Mutat 34:132–42. doi:10.1002/humu.22170 (http://dx.doi.org/10.1002/humu.22170)CrossRef (http://dx.doi.org/10.1002/humu.22170)PubMed (http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&dopt=Abstract&list_uids=22837065)

32. Coyle D, Friedmacher F, Puri P (2014) The association between Hirschsprung’s disease and

The RET E616Q Variant is a Gain of Function Mutation Present ... http://link.springer.com/article/10.1007/s12022-016-9451-6

7 of 10 10/7/16, 8:41 PM

multiple endocrine neoplasia type 2a: a systematic review. Pediatr Surg Int. doi:10.1007/s00383-014-3538-2 (http://dx.doi.org/10.1007/s00383-014-3538-2)PubMed (http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&dopt=Abstract&list_uids=24972642)

33. Tavtigian S V., Byrnes GB, Goldgar DE, Thomas A (2008) Classification of rare missensesubstitutions, using risk surfaces, with genetic- and molecular-epidemiology applications.Hum Mutat 29:1342–1354. doi: 10.1002/humu.20896 (http://dx.doi.org/10.1002/humu.20896)CrossRef (http://dx.doi.org/10.1002/humu.20896)PubMed (http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&dopt=Abstract&list_uids=18951461)PubMedCentral (http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3938023)

34. Cosci B, Vivaldi A, Romei C, et al. (2011) In silico and in vitro analysis of rare germlineallelic variants of RET oncogene associated with medullary thyroid cancer. Endocr RelatCancer 18:603–12. doi: 10.1530/ERC-11-0117CrossRef (http://dx.doi.org/10.1530/ERC-11-0117)PubMed (http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&dopt=Abstract&list_uids=21810974)

35. Santoro M, Melillo RM, Carlomagno F, et al. (2004) Minireview: RET: normal andabnormal functions. Endocrinology 145:5448–51. doi: 10.1210/en.2004-0922(http://dx.doi.org/10.1210/en.2004-0922)CrossRef (http://dx.doi.org/10.1210/en.2004-0922)PubMed (http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&dopt=Abstract&list_uids=15331579)

36. Kambouris M, Jackson CE, Feldman GL (1996) Diagnosis of multiple endocrine neoplasia[MEN] 2A, 2B and familial medullary thyroid cancer [FMTC] by multiplex PCR andheteroduplex analyses of RET proto-oncogene mutations. Hum Mutat 8:64–70. doi:10.1002/(SICI)1098-1004(1996)8:1<64::AID-HUMU9>3.0.CO;2-P(http://dx.doi.org/10.1002/(SICI)1098-1004(1996)8%3A1&lt%3B64%3A%3AAID-HUMU9&gt%3B3.0.CO%3B2-P)

37. Pelet A, Geneste O, Edery P, et al. (1998) Various mechanisms cause RET-mediatedsignaling defects in Hirschsprung’s disease. J Clin Invest 101:1415–1423. doi:10.1172/JCI375 (http://dx.doi.org/10.1172/JCI375)CrossRef (http://dx.doi.org/10.1172/JCI375)PubMed (http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&dopt=Abstract&list_uids=9502784)PubMedCentral (http://www.ncbi.nlm.nih.gov/pmc/articles/PMC508697)

38. Ibáñez CF (2013) Structure and physiology of the RET receptor tyrosine kinase. ColdSpring Harb Perspect Biol. doi: 10.1101/cshperspect.a009134 (http://dx.doi.org/10.1101/cshperspect.a009134)PubMed (http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&dopt=Abstract&list_uids=23378586)

The RET E616Q Variant is a Gain of Function Mutation Present ... http://link.springer.com/article/10.1007/s12022-016-9451-6

8 of 10 10/7/16, 8:41 PM

PubMedCentral (http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3552510)

39. Viola D ME, E M, L A, et al. (2014) Ret Oncogene and Thyroid Carcinoma. J Genet SyndrGene Ther. doi: 10.4172/2157-7412.1000214 (http://dx.doi.org/10.4172/2157-7412.1000214)

40. Diaz-Cano SJ, De Miguel M, Blanes A, et al. (2001) Germline RET 634 mutation positiveMEN 2A-related C-cell hyperplasias have genetic features consistent with intraepithelialneoplasia. J Clin Endocrinol Metab 86:3948–3957. doi: 10.1210/jc.86.8.3948(http://dx.doi.org/10.1210/jc.86.8.3948)CrossRef (http://dx.doi.org/10.1210/jcem.86.8.7739)PubMed (http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&dopt=Abstract&list_uids=11502837)

41. Ponder BA (1999) The phenotypes associated with ret mutations in the multiple endocrineneoplasia type 2 syndrome. Cancer Res 59:1736s–1741s; discussion 1742s.

42. Smith-Hicks CL, Sizer KC, Powers JF, et al. (2000) C-cell hyperplasia, pheochromocytomaand sympathoadrenal malformation in a mouse model of multiple endocrine neoplasiatype 2B. EMBO J 19:612–22. doi: 10.1093/emboj/19.4.612 (http://dx.doi.org/10.1093/emboj/19.4.612)CrossRef (http://dx.doi.org/10.1093/emboj/19.4.612)PubMed (http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&dopt=Abstract&list_uids=10675330)PubMedCentral (http://www.ncbi.nlm.nih.gov/pmc/articles/PMC305599)

43. Orgiana G, Pinna G, Camedda A, et al. (2004) A new germline RET mutation apparentlydevoid of transforming activity serendipitously discovered in a patient with atrophicautoimmune thyroiditis and primary ovarian failure. J Clin Endocrinol Metab 89:4810–6.doi: 10.1210/jc.2004-0365 (http://dx.doi.org/10.1210/jc.2004-0365)CrossRef (http://dx.doi.org/10.1210/jc.2004-0365)PubMed (http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&dopt=Abstract&list_uids=15472167)

44. Mears L, Diaz-Cano SJ (2003) Difference between familial and sporadic medullary thyroidcarcinomas. Am J Surg Pathol 27:266–7.CrossRef (http://dx.doi.org/10.1097/00000478-200302000-00018)PubMed (http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&dopt=Abstract&list_uids=12548176)

45. Williams ED, Ponder BJ, Craig RK (1987) Immunohistochemical study of calcitoningene-related peptide in human medullary carcinoma and C cell hyperplasia. ClinEndocrinol (Oxf) 27:107–114.CrossRef (http://dx.doi.org/10.1111/j.1365-2265.1987.tb00845.x)

Copyright information

The RET E616Q Variant is a Gain of Function Mutation Present ... http://link.springer.com/article/10.1007/s12022-016-9451-6

9 of 10 10/7/16, 8:41 PM

© 2016 Springer International Publishing. Part of Springer Nature.

Not logged in · Not affiliated · 80.4.33.173

© Springer Science+Business Media New York 2016

About this article

Print ISSN1046-3976

Online ISSN1559-0097

Publisher NameSpringer US

About this journal

Reprints and Permissions

The RET E616Q Variant is a Gain of Function Mutation Present ... http://link.springer.com/article/10.1007/s12022-016-9451-6

10 of 10 10/7/16, 8:41 PM

KEYWORDS:

Endocr Pathol. 2016 Oct 5. [Epub ahead of print]

The RET E616Q Variant is a Gain of Function Mutation Present in aFamily with Features of Multiple Endocrine Neoplasia 2A.Grey W , Hulse R , Yakovleva A , Genkova D , Whitelaw B , Solomon E , Diaz-Cano SJ , Izatt L .

AbstractThe REarranged during Transfection (RET) proto-oncogene is a receptor tyrosine kinaseinvolved in growth and differentiation during embryogenesis and maintenance of the urogenitaland nervous systems in mammals. Distinct mutations across hotspot RET exons can causeMultiple Endocrine Neoplasia Type 2A (MEN2A) characterised by development of medullarythyroid cancer (MTC), phaeochromocytoma (PCC) and primary hyperparathyroidism (PHPT),with a strong correlation between genotype and phenotype. Here, we report a 42-year-old manpresented in the clinic with a unilateral PCC, with subsequent investigations revealing a nodularand cystic thyroid gland. He proceeded to thyroidectomy, which showed bilateral C-cellhyperplasia (CCH) without evidence of MTC. His brother had neonatal Hirschsprung disease(HSCR). Genetic testing revealed the presence of a heterozygous variant of unknownsignificance (VUS) in the cysteine-rich region of exon 10 in the RET gene (c.1846G>C,p.E616Q), in both affected siblings and their unaffected mother. Exon 10 RET mutations areknown to be associated with HSCR and MEN2. Variants in the cysteine-rich region of the RETgene, outside of the key cysteine residues, may contribute to the development of MEN2 in aless aggressive manner, with a lower penetrance of MTC. Currently, a VUS in RET cannot beused to inform clinical management and direct future care. Analysis of RET reveals again of function mutant phenotype for this variant, which has not previously been reported,indicating that this VUS should be considered at risk for future clinical management.

C-cell hyperplasia; Hirschsprung; MEN2A; Phaeochromocytoma; RET proto-oncogene

PMID: 27704398 DOI: 10.1007/s12022-016-9451-6

[PubMed - as supplied by publisher]

Format: Abstract

1 1 1 1 2 1 3 4,5

Author information

E616Q

PubMed

Full text links

The RET E616Q Variant is a Gain of Function Mutation Present ... https://www.ncbi.nlm.nih.gov/pubmed/27704398

1 of 2 10/7/16, 8:41 PM

The RET E616Q Variant is a Gain of Function Mutation Presentin a Family with Features of Multiple Endocrine Neoplasia 2A

William Grey1 & Rosaline Hulse1 & Anna Yakovleva1 & Dilyana Genkova1&

Benjamin Whitelaw2& Ellen Solomon1

& Salvador J. Diaz-Cano3 & Louise Izatt1,4

# Springer Science+Business Media New York 2016

Abstract The REarranged during Transfection (RET) proto-oncogene is a receptor tyrosine kinase involved in growth anddifferentiation during embryogenesis and maintenance of theurogenital and nervous systems in mammals. Distinct muta-tions across hotspot RET exons can cause Multiple EndocrineNeoplasia Type 2A (MEN2A) characterised by developmentof medullary thyroid cancer (MTC), phaeochromocytoma(PCC) and primary hyperparathyroidism (PHPT), with astrong correlation between genotype and phenotype. Here,we report a 42-year-old man presented in the clinic with aunilateral PCC, with subsequent investigations revealing anodular and cystic thyroid gland. He proceeded to thyroidec-tomy, which showed bilateral C-cell hyperplasia (CCH) with-out evidence of MTC. His brother had neonatal Hirschsprungdisease (HSCR). Genetic testing revealed the presence of aheterozygous variant of unknown significance (VUS) in thecysteine-rich region of exon 10 in the RET gene (c.1846G>C,p.E616Q), in both affected siblings and their unaffected

mother. Exon 10 RET mutations are known to be associatedwith HSCR andMEN2. Variants in the cysteine-rich region ofthe RET gene, outside of the key cysteine residues, may con-tribute to the development of MEN2 in a less aggressive man-ner, with a lower penetrance of MTC. Currently, a VUS inRET cannot be used to inform clinical management and directfuture care. Analysis of RETE616Q reveals a gain of functionmutant phenotype for this variant, which has not previouslybeen reported, indicating that this VUS should be consideredat risk for future clinical management.

Keywords MEN2A . RET proto-oncogene . Hirschsprung .

Phaeochromocytoma . C-cell hyperplasia

Introduction

The REarranged during Transfection (RET) proto-oncogene,located at 10q11.2 (OMIM 164761), encodes a transmem-brane receptor tyrosine kinase originally found to be involvedin growth and differentiation [1–3]. The RET gene has keyroles in cellular proliferation, migration, differentiation andsurvival during embryogenesis and is mainly expressed inthe urogenital and nervous systems of mammals [4]. TheRET protein is activated through interaction with the Glialcell-derived neurotrophic factor (GDNF) family of ligands,and their co-receptors (GFRs), causing RET dimerisationand autophosphorylation [5, 6].

Multiple endocrine neoplasia type 2 (MEN2) is an autoso-mal dominant inherited tumour syndrome, caused by activat-ing mutations in the RET gene, leading to MEN2A (OMIM171400) and MEN2B (OMIM 162300) [7]. MEN2A ischaracterised by MTC, phaeochromocytoma (PCC; OMIM171300) and primary hyperparathyroidism PHPT [7].

Electronic supplementary material The online version of this article(doi:10.1007/s12022-016-9451-6) contains supplementary material,which is available to authorized users.

* Louise Izattlouise.izatt@gstt.nhs.uk

1 Cancer Genetics, Department of Medical and Molecular Genetics,Division of Genetics and Molecular Medicine, King’s CollegeLondon, London, UK

2 Clinical Endocrinology, King’s College Hospital London,London, UK

3 Histopathology, King’s College Hospital London, London, UK4 Clinical Genetics, Guy’s and St Thomas’ NHS Foundation Trust

London, Great Maze Pond, London SE1 9RT, UK

Endocr PatholDOI 10.1007/s12022-016-9451-6

Mutations in RET have been associated with various neu-roendocrine neoplasms and syndromes, including MEN2A,MEN2B [8, 9], PCC [10] and CCH-MTC [8, 11], where cor-relation between genotype and phenotype is observed (wellreviewed elsewhere [12, 13]). Activating mutations in RETshow a discrete distribution, and specific codons influenceboth molecular and clinical outcomes [14]. RET mutationsresulting in MEN2A occur in the extracellular domain andcause ligand-independent dimerisation and subsequent activa-tion of downstream signalling pathways [15]. Routinely, RET‘hotspot’ mutations (exons 10, 11, 13, 14, 15 and 16) arechecked in patients presenting with MEN2A, but there havebeen reports of families with MEN2A and RET mutationsoutside of these regions [16, 17]. In addition, some familiescarrying RET mutations have been reported to haveHirschsprung disease (HSCR, OMIM 142623), co-segregating with a MEN2A phenotype and RET exon 10 mu-tations. HSCR is characterised by congenital absence of en-teric innervation of the gastrointestinal tract. HSCR may bethe presenting feature in these MEN2A kindreds, with a childpresenting in infancy with intestinal obstruction before adultfamily members have developed MTC or PCC [18].

The American Thyroid Association (ATA) classifies RETmutations into three different genotype-phenotype groups, ac-cording to the risk levels for the development of medullarythyroid cancer (highest, high and moderate risk of aggressiveMTC [19]). This risk stratification is used to make age-specificrecommendations for pre-emptive thyroidectomy in individ-uals at risk of MTC/MEN2 [19]. A plethora of structural andfunctional investigations of the RET protein have revealed keyresidues for ligand-dependent and ligand-independentdimerisation, autophosphorylation and signalling pathway as-sociation, and this has been well reviewed [13]. Previous workon RET phosphorylation, signalling pathway activation andtransforming activity has allowed the timely investigation ofnew RET variants in vitro and their impact downstream ofRET activation in the presence of GDNFα [20–25].

Here, we report a family with features ofMEN2A carrying aheterozygous variant of unknown significance (VUS) in exon10 of the RET gene c.1846G>C (Glu616Gln; RET E616Q),previously reported in somatic tissue in a single patient withMTC, with no transforming activity in soft agar assays [26].

Material and Methods

Clinical Presentation

A 42-year-old man was admitted with an episode of dizzinessand collapse, BP 149/92. His ECG showed abnormal T-waves, and his serum troponin was elevated. Over the nexttwo years, he had episodic symptoms of flushing, profusesweating, severe headache and intermittent hypertension

(systolic BP >240 mmHg). Physical examination showed nofeatures of neurofibromatosis type 1. Plasma noradrenalinewas elevated at 46.80 nmol/L (0–4.14 nmol/L). A CT scanshowed a 70 × 60 mm left adrenal mass, which was avid onMIBG scan. Serum calcium, parathyroid hormone and phos-phate were within normal limits (Supp. Table 1).

He was blocked with phenoxybenzamine and propanololand underwent laparoscopic left adrenalectomy, which re-vealed a low histological risk phaeochromocytoma with noextra-capsular extension, lymphovascular or perineural inva-sion; no confluent necrosis or spindle cells were identified(Supp. Table 1). Post-operatively, his catecholamines returnedto normal.

Thyroid gland ultrasonography revealed a 1.2-cm heteroge-nous, vascular nodule with some calcification and three cysts.Fine needle aspiration cytology of the nodule was inconclusive.The basal serum calcitonin was detectable but within the nor-mal range at 4.8 ng/L (ULN <18.9 ng/L). In view of the suspi-cion of possible MEN2A, the thyroid multidisciplinary team(MDT) recommended a total thyroidectomy and level VIlymph node dissection. Several non-encapsulated hyperplasticnodules were identified. The largest of 1.2 cm with macro- andmicro-follicular growth patterns; no solid-diffuse areas, necro-sis or high nuclear grade were identified. The background pa-renchyma showed scattered foci of circumferential non-solid C-cell nests without nuclear atypia (≥50 C-cells/medium powerfield and >6 C-cell/follicle) and no histological evidence ofstromal invasion [27, 28] (Supp. Fig. 1) (Supp. Table 1).

His brother had a history of neonatal short segment HSCR,and his father had died of hepatocellular cancer aged 54. Thefamily was referred for genetic counselling and testing.

DNA Sequencing

The Big Dye Terminator v3.1 sequencing (Life Technologies)was carried out on an Applied Biosystems 3730xl capillarysequencer as per the manufacturers’ instructions. Sequencingprimers for both patient gDNA sequencing and pCDNA3.1(+)-RET mutation confirmation sequencing are detailed in sup-plementary table 2. Further gene testing was completed inUK-accredited laboratories (Supp. Table 3).

Bioinformatic Analysis

Genomic evolutionary rate profiling (GERP) scores were gen-erated to identify evolutionary constraint for the variant [29].

In silico analysis of mutation impact was performed byusing the web-based programmme (http://agvgd.iarc.fr)‘Align-Grantham Variation-Grantham Deviation’ (Align-GVGD) to calculate two scores for each amino acid substitu-tion, called Grantham Deviation and Grantham Variation,based on multiple different sequence alignments across eightdifferent species; humans, chickens, frogs, rats, mice, cattle,

Endocr Pathol

pigs and fish. A numerical score ranging from ‘C0’ (no dif-ference) to ‘C65’ (maximum difference) was obtained. Thisreflects the degree of difference between the mutant and wild-type sequence, and higher scores are assumed to be associatedwith more powerful transforming activity.

Cloning and Site-Directed Mutagenesis

Full-length wild typeHomo sapien RET51 cDNAwas synthe-sised in pUC57 (GeneWiz) with 5’ HindII and 3’ NotI restric-tion sites. RET51 cDNAwas cloned into pCDNA3.1(+) (LifeTechnologies), and correct orientation of the insert was con-firmed by colony PCR. Mutations were introduced into wildtype RET51 using the Q5 site-directed mutagenesis kit (NewEngland Biolabs) as per the manufacturers’ instructions.Primers were designed for individual base changes using theNEBchanger application (New England Biolabs). All muta-tions were confirmed by Sanger sequencing, and primers weredetailed in supplementary table 2.

Cell Culture

HEK 293T cells (DSMZ) were grown as monolayers inDulbecco’s Modified Eagle Medium (Life Technologies) sup-plemented with 10 % heat-inactivated foetal calf serum (LifeTechnologies), 1 % penicillin (Life Technologies) and 1 %streptomycin (Life Technologies). An appropriate amount ofmedium per vessel we termed ‘complete medium’ (i.e. 2 mlper well in a six well plate and 15 ml per 10 cm dish).Reducing 10 % heat inactivated foetal calf serum to 1 % wetermed ‘serum starvation medium’.

Protein Extraction and Western Blotting

Total protein was extracted from cell pellets in aradioimmunoprecipitation assay lysis buffer (RIPA; 50 mMTris HCl pH7.4, 1 % NP40, 0.25 % sodium deoxycholate,150 mM NaCl, 1 mM EDTA) and run on an 8 % SDS-PAGE gel. Western blots were carried out using the followingantibodies: anti-RET (Cell Signalling Technologies #3223),anti-PhosphoRET (Tyr1062, Santa Cruz sc-20252) andanti-β-tubulin (Cell Signalling Technologies #3700).Secondary antibodies conjugated to horseradish peroxidasewere purchased from Dako Inc. Bands were visualised usingChemiluminescent substrates (Thermo Fischer) and exposedto X-ray films (Thermo Fischer).

Luciferase Reporter Assay

HEK 293T cells were co-transfected with a serum responsiveelement (SRE)-driven firefly luciferase construct (pTAL-SRE-Luc; previously described and provided by Dr I. Plaza-Menacho [24]), Renilla control (pRL-TK was obtained from

Promega; E2241) and pCDNA3.1(+) containing RET wildtype, mutants or an empty vector using the ProfectionMammalian Transfection System (Promega) as per the manu-facturers’ instructions. Cells were incubated for 24 h withtransfection reagents in complete medium at high confluency.Transfection reagents in complete mediumwere replaced witheither serum starvation medium or complete medium± 100 ng/ml GDNFα (Peprotech) and grown for a further16 h. Cells were harvested in passive lysis buffer (Promega),and relative luciferase activity (RLA) was measured on aluminometer using the Stop & Glo system (Promega) as perthe manufacturers’ instructions. RLA is calculated asLuciferase activity/Renilla Activity.

Results

A heterozygous germline RET VUS c.1846G>C in exon 10was identified in the proband, his brother and mother withclinical features of MEN2A (Fig. 1a). This mutation resultsin a change at the amino acid level from glutamic acid toglutamine (E616Q). Sanger sequencing of DNA extractedfrom peripheral blood samples revealed E616Q to be a het-erozygous germline mutation in two first-degree relatives andthe proband (Fig. 1b).

The three family members with the E616QVUSwere eval-uated for MEN2A (Supp. Table 1). The proband had youngonset PCC (aged 42) and bilateral C-cell hyperplasia of thethyroid aged 43. No other mutations in the entire coding se-quence of RET nor in a PCC and paraganglioma gene panel(including SDHB/SDHC/SDHD/MAX/TMEM127 and VHL)were identified (Supp. Table 3). Family studies showed theE616Q VUS in the proband’s brother with HSCR and theunaffected mother, who remain under close surveillance forfeatures of MEN2 and have no clinical evidence of MTC,PCC or PHPT to date (Supp. Table 1).

Loss of function mutations in RET are the most frequentcauses of HSCR (accounting for 15–20 % sporadic cases ofHSCR and 50 % familial cases) and co-segregation of HSCRwith MEN2 is well described, often as a consequence of RETmutations in exon 10, at cysteine-rich codons 609, 611, 618and 620 [30–32].

Genomic evolutionary rate profiling (Gerp) analysis(Fig. 2) shows RET exon 10 to be highly conserved, with alimited number of residues not under evolutionary constraint.The E616Q VUS has a Gerp score of 3.71 with an averagescore across exon 10 being 2.28 (maximum 4.92, minimum−9.84), indicating that c.1846G is under higher than averageevolutionary constraint for exon 10. Analysis of variants usingthe Align GVGD classifier finds E616Q to be class C25, in-dicating an influence on structure that could cause a moderatelevel of functional alteration and transforming activity. This is

Endocr Pathol

Fig. 2 GERP analysis of RET exon 10 focusing on RETE616. TheGenome Evolutionary Rate Profiling (Gerp) score was calculated forexon 10 of RET using the UCSC genome browser (GRCh37/hg19).

Alignments from other eukaryotic species are shown for comparisonand c.1846G>C is highlighted by a red box. The average value acrossexon 10 is 2.28 min −9.84, max 4.92, our loci has a Gerp score of 3.71

Fig. 1 A heterozygous variant of unknown significance is present in afamily with features of MEN2A. a Pedigree for family with features ofMEN2 showing inheritance of the heterozygous E616Q RET variant. Theproband (II:2) presented with PCC aged 42 and was subsequently foundto have bilateral C-cell hyperplasia of the thyroid aged 43, withoutelevated calcitonin. The proband’s mother (I:2) and brother (II:3), who

was diagnosedwith neonatal HSCR, both carry theRET E616Q variant intheir germline. b Sanger sequencing confirmed initial genetic screens atthis loci for I:2, II:2 and II:3. The unaffected sister (II:1) was screened andnegative for E616Q. Samples were not available from the deceased father(I:1) or the unaffected sister (II:1)

Endocr Pathol

a higher score than other known moderate risk RETmutationsincluding V804M and Y791F (Supp. Fig. 2) [33, 34].

Comparison of overexpressed WT and previously describedRET mutants (Y791F, ATA moderate risk and M918T, ATAhighest risk) to the E616Q VUS, unstimulated in resting cells,reveals marginally more phosphorylated E616Q compared toWT at basal levels, but less than the strong autophosphorylationof M918T (Fig. 3). The serum responsive element (SRE)-drivenluciferase assay reports on RET-activated MAPK/ERK signal-ling [24]. Examining the serum responsive element activity,

when co-expressed with E616Q, in HEK 293T cells indicates amutant phenotype, even when serum starved (Fig. 4, Supp.Fig. 3). E616Q is significantly more active than WT under alltreatment conditions (−/− p = 0.0006, ± p= 0.0004, ± p = 0.0004,+/+ p= 0.0006), but does not reach a maximal activation as highas the strongly transforming mutant M918T. Results from bothphospho-RET western blots and SRE activity indicate thatE616Q is a moderate gain of function mutation, less severe thanM918T, but more active than WT RET and Y791F.

Discussion

Genetic testing plays an important role in the diagnosis andmanagement of patients with MEN2, MTC, multifocal C-cellhyperplasia, PCC and HSCR. If a VUS is identified duringgenetic testing, the impact on gene function is unclear and theresult cannot be used to inform medical management deci-sions. Identifying a specific RET mutation has implicationsfor diagnosis and management of the condition in the probandand may provide at-risk relatives with an opportunity to beoffered surveillance and risk-reducing thyroid surgery, to de-crease their future medullary thyroid cancer burden. Patientswith novel RET variants would not be advised to undergo risk-reducing thyroidectomy, unless evidence of pathogenicity hadpreviously been determined, or if there were abnormal resultsduring clinical surveillance and MDT consensus favoured op-erative intervention.

Our investigations identified a rare RET variant, E616Q inexon 10, in a kindred presenting with PCC and describe thein vitro and in silico analysis performed in conjunction withthorough clinical evaluation. The location of the E616Q VUSin the extracellular cysteine rich region is interesting in itself, asthis region of RET has been well investigated (reviewed wellelsewhere [13, 35]). Mutations in this domain normally residein the key cysteine residues, and alter ligand-dependent dimer-ization, causing gain of function [36], loss of function [37], orin the case of the Janus mutation, both (C609, C611, C618 orC620) [22]. The amino acid side chain alteration in E616Q,from a negatively charged (glutamic acid) to a polar unchargedside chain (glutamine), could play a role in protein folding andthe structure of RET, thereby influencing function in a moresubtle way [38]. E616Q had been previously reported as a RETmutation of uncertain significance in a patient with MTC [39](Supp. Table 4). However, it is not listed on dMUTB, HumanGenome Database or ARUP MEN2 databases, reducing thepossibility that it is a very rare polymorphism.

Whilst we were conducting our molecular analysis, anothergroup reported their investigations into the transforming activityof the E616QRETmutant, which showed no functional effect insoft agar assays [26]. Our in vitro data suggests that E616Q has amore moderate effect on RET function than stronglytransforming mutations (e.g. M918T), and may not be expected

Fig. 4 Analysis of Serum Responsive Element Activity in 293T cellsoverexpressed WT, Y791F, M918T and E616Q RET mutants. Cellswere co-transfected with a mammalian expression vector carrying theindicated version of the RET gene or the corresponding empty vectorcontrol, alongside a serum responsive element-driven Luciferaseconstruct and a constitutively expressed Renilla construct. Cells weretreated with the indicated medium and/or GDNFα supplement(100 ng/ml) for 16 h. Results of relative luciferase activity are presentedas fold change versus empty vector control transfected cells grownwithout serum or GDNFα (−/−). N = 3, (asterisk) p < 0.005 vs −/−treated, (section sign) p < 0.005 vs EV same treatment, (dollar sign)p < 0.005 vsWT same treatment

Fig. 3 Autophosphorylation of overexpressed WT, Y791F, M918T andE616Q RET mutants. Differential activity of RETE616Q protein mayaccount for patient phenotypes. Indicated WT or mutants of the RETgene were overexpressed in cells and probed for RET proteinabundance and phosphorylation of RET at Tyr1062. Actin was used asa loading control. Blots are representative of three independentexperiments

Endocr Pathol

to be transforming in soft agar assays. This lack of effect was alsodemonstrated previously by Cosci et al. (2001) [34] with anothermoderate risk RETmutant, A883T, which has high transformingactivity but shows no excess growth in soft agar assays. Indeed,increased colony formation in the soft agar assay ismore stronglycorrelated with tumour aggressiveness and metastatic potentialthan predicting the oncogenic potential of the mutation [34]. Asno other definitive mutation in RET was observed (despite ex-tending analysis to all RET exons), we postulated that the pheno-types observed in the proband could be due to a mutation in adifferent PCC predisposition gene. We checked eight PCC-associated genes (Supp. Table 3); this independently confirmedthe E616QRET variant, but found no other pathogenicmutationsincreasing the likelihood of the significance of the E616Q vari-ant, identified in the proband with a PCC and CCH and found toco-segregate with HSCR in the family.

Our in vitro results show low levels of ligand independentactivation (more than overexpression of the WT form, but lessthan the overexpression of the stronger mutation, M918T) andincreased activation in response to both serum and GDNF, clear-ly indicating gain of function activity for E616Q. Therefore, weexpect that the hyperactivity in these assays could account for thehistory of PCC. We postulated that the E616Q RET variant gainof function hyperactivity could provide a proliferative advantage,which would result in increased susceptibility for neoplastic de-velopment in the presence of other cooperative genetic alter-ations. CCH can take many years to progress into invasiveMTC, a process which depends on further somatic genetic mu-tations to trigger MTC development [40]. The probandunderwent thyroidectomy before MTC developed and remainsunder follow-up without further sequelae. The impact of geneticmodifiers on the clinical presentation of MTC inMEN2 familieswith the same genotype is frequently cited as a cause of pheno-typic variability [41]. This is also demonstrated in transgenicmouse models, where Ret mutants show 0–98 % penetranceforMTC. Thiswide variability depends on the background strainof the mice [42]. In a 2004 study, a RET mutant close to theE616Q VUS (R694Q) was reported in a patient with hypothy-roidism due to atrophic Hashimoto’s thyroiditis and primaryovarian failure, without any evidence of familial MTC orMEN2, including a lack of activation in soft agar transformingassays and autophosphorylation assays [43]. Therefore, it is notsimply the mutation resulting in a side chain alteration that isimportant in this region (outside of the key cysteine residues),but the specific locationmay be important for disruption of func-tion, possibly in combination with other mutated genes. CCHhas been found associated with other non-neoplastic conditions,such as chronic inflammations (including Hashimoto’s thyroid-itis) and hyperplastic and neoplastic follicular cell lesions. Thepatient had several adenomatous hyperplastic nodules (dominant1.2 cm), which suggest a combination of follicular-parafolliculargrowth factors contributing to the thyroid pathology. The CCHpathological phenotype (non-nodular without nuclear atypia) is

considered low risk for MTC development, and it is most com-monly found in non-familial conditions [44]. This variation inphenotypic effects, seen in both patients and mouse models,could account for variation seen in this family, underlined bythe fact the mother aged 67 (I:2) has not yet shown symptomsof MEN2. In a recent systemic review, where the associationbetween HSCR and MEN2A in patients and their unaffectedrelatives with confirmed exon 10 RET (C609, C611, C618 orC620) mutations was detailed, 20 unaffected individuals (5.9 %)were recorded and in addition, 64 (18.8 %) cases of HSCR hadnot yet developed MEN2A either, confirming frequent incom-plete penetrance of exon 10 RET phenotypes [32].

This study highlights the multifaceted function of uncom-mon RET variants and confirms the role of comprehensivegenetic testing in patients with rare disease to identify a pos-sible germline predisposition. Understanding the impact ofmutations on the structure and function of the RET proteinmay give more information on disease causing mutations thatdo not have classical transforming activity or have not beenshown to be differentially active in classical functional tests,similar to the VUS E616Q. Further investigations into RETstructure/function may elucidate the contribution E616Q canhave on MEN2 and impact on the management of patientswith similarly undescribed RET mutations.

Acknowledgments The study has an ethical approval 13/SC/0574(NRES Committee South Central - Hampshire A) sponsored by Guy’sand St Thomas’ NHS Foundation Trust (study number RJ114/N093) andalso registered at King’s College Hospital (study number KCH14-124).All subjects provided written, informed consent for the research study(ethical approval 13/SC/0574).

This work was supported by The Generation Trust (KCL) and Friendsof Guy’s Hospital Research Fund.

Author Contributions We thank the following people for theircontributions:

Dr Neil McDonald (The Francis Crick Institute)Dr Ivan Plaza-Menacho (UCL)Dr Simon Aylwin, Mr Klaus-Martin Schulte, Dr Dylan Lewis and

Professor Alan McGregor (KCH)Dr Paul Carroll, Dr Hosahalli Mohan, Celia Mills and Teresa

Brothwood, Michelle Weston and Dr Christine Patch (GSTFT)

Compliance with Ethical Standards

Conflict of Interest The authors declare that they have no conflict ofinterest.

Financial Disclosure Nothing to declare

References

1. Takahashi M, Ritz J, Cooper GM (1985) Activation of a novelhuman transforming gene, ret, by DNA rearrangement. Cell 42:581–588. doi: 10.1016/0092-8674(85)90115-1

Endocr Pathol

2. Takahashi M, Cooper GM (1987) ret transforming gene encodes afusion protein homologous to tyrosine kinases. Mol Cell Biol 7:1378–1385.

3. Takahashi M, Buma Y, Iwamoto T, et al. (1988) Cloning and ex-pression of the ret proto-oncogene encoding a tyrosine kinase withtwo potential transmembrane domains. Oncogene 3:571–578.

4. Manié S, SantoroM, Fusco A, BillaudM (2001) The RET receptor:function in development and dysfunction in congenital malforma-tion. Trends Genet 17:580–9.

5. Jing S, Wen D, Yu Y, et al. (1996) GDNF-induced activationof the ret protein tyrosine kinase is mediated by GDNFR-alpha, a novel receptor for GDNF. Cell 85:1113–1124. doi:10.1016/S0092-8674(00)81311-2

6. Mise N, Drosten M, Racek T, et al. (2006) Evaluation of potentialmechanisms underlying genotype-phenotype correlations in multi-ple endocrine neoplasia type 2. Oncogene 25:6637–47. doi:10.1038/sj.onc.1209669

7. Machens A, Dralle H (2007) Genotype-phenotype based surgicalconcept of hereditary medullary thyroid carcinoma. World J Surg31:957–968. doi: 10.1007/s00268-006-0769-y

8. Donis-Keller H, Dou S, Chi D, et al. (1993) Mutations in the RETproto-oncogene are associated with MEN 2A and FMTC. HumMol Genet 2:851–856. doi: 10.1093/hmg/2.7.851

9. Mulligan LM, Kwok JB, Healey CS, et al. (1993) Germ-line mu-tations of the RET proto-oncogene in multiple endocrine neoplasiatype 2A. Nature 363:458–460. doi: 10.1038/363458a0

10. Eng C, Crossey PA, Mulligan LM, et al. (1995) Mutations in theRET proto-oncogene and the von Hippel-Lindau disease tumoursuppressor gene in sporadic and syndromic phaeochromocytomas.J Med Genet 32:934–937. doi: 10.1136/jmg.32.12.934

11. Hofstra RM, Landsvater RM, Ceccherini I, et al. (1994) A mutationin the RET proto-oncogene associated with multiple endocrine neo-plasia type 2B and sporadic medullary thyroid carcinoma. Nature367:375–376. doi: 10.1038/367375a0

12. Santoro M, Carlomagno F (2013) Central role of RET inthyroid cancer. Cold Spring Harb Perspect Biol 5:a009233.doi: 10.1101/cshperspect.a009233

13. Plaza-Menacho I, Mologni L, McDonald NQ (2014) Mechanismsof RET signaling in cancer: current and future implications fortargeted therapy. Cell Signal 26:1743–52. doi: 10.1016/j.cellsig.2014.03.032

14. Dahia PLM (2014) Pheochromocytoma and paraganglioma patho-genesis: learning from genetic heterogeneity. Nat Rev Cancer 14:108–19. doi: 10.1038/nrc3648

15. Drosten M, Hilken G, Bockmann M, et al. (2004) Role ofMEN2A-derived RET in maintenance and proliferation ofmedullary thyroid carcinoma. J Natl Cancer Inst 96:1231–1239. doi: 10.1093/jnci/djh226

16. Cooper DS, Doherty GM, Haugen BR, et al. (2009) RevisedAmerican Thyroid Association management guidelines for patientswith thyroid nodules and differentiated thyroid cancer. Thyroid 19:1167–1214. doi: 10.1089/thy.2009.0110

17. Kloos RT, Eng C, Evans DB, et al. (2009) Medullary thyroid can-cer: management guidelines of the American Thyroid Association.Thyroid 19:565–612. doi: 10.1089/thy.2008.0403

18. Fialkowski EA, DeBenedetti MK, Moley JF, Bachrach B (2008)RET proto-oncogene testing in infants presenting withHirschsprung disease identifies 2 new multiple endocrine neoplasia2A kindreds. J Pediatr Surg 43:188–190. doi: 10.1016/j.jpedsurg.2007.09.043

19. Wells SA, Asa SL, Dralle H, et al. (2015) Revised american thyroidassociation guidelines for the management of medullary thyroidcarcinoma. Thyroid 25:567–610. doi: 10.1089/thy.2014.0335

20. Tanaka M, Xiao H, Hirata Y, Kiuchi K (2003) A rapid assay forglial cell line-derived neurotrophic factor and neurturin based on

transfection of cells with tyrosine hydroxylase promoter-luciferaseconstruct. Brain Res Brain Res Protoc 11:119–22.

21. Hayashi Y, Iwashita T, Murakamai H, et al. (2001)Activation of BMK1 via tyrosine 1062 in RET by GDNFand MEN2A mutation. Biochem Biophys Res Commun 281:682–9. doi: 10.1006/bbrc.2001.4338

22. Arighi E, Popsueva A, Degl’Innocenti D, et al. (2004) Biologicaleffects of the dual phenotypic Janus mutation of ret cosegregatingwith both multiple endocrine neoplasia type 2 and Hirschsprung’sdisease. Mol Endocrinol 18:1004–17. doi: 10.1210/me.2003-0173

23. Plaza-Menacho I, Van Der Sluis T, Hollema H, et al. (2007) Ras/ERK1/2-mediated STAT3 Ser727 phosphorylation by familial med-ullary thyroid carcinoma-associated RET mutants induces full acti-vation of STAT3 and is required for c-fos promoter activation, cellmitogenicity, and transformation. J Biol Chem 282:6415–6424.doi: 10.1074/jbc.M608952200

24. Menacho IP, Koster R, Sloot AM Van Der, et al. (2005) RET-Familial Medullary Thyroid Carcinoma Mutants Y791F andS891A Activate a Src/JAK/STAT3 Pathway, Independent of GlialCell Line − Derived Neurotrophic Factor of Glial Cell Line –Derived Neurotrophic Factor. 1729–1737.

25. Xing S (1998) Signal Transduction Pathways Activated by RETOncoproteins in PC12 Pheochromocytoma Cells. J Biol Chem273:4909–4914. doi: 10.1074/jbc.273.9.4909

26. Tacito A, Vivaldi A, Ciampi R, et al. (2013) Genetic Screening OfRET Can Identify New Mutations Even After 20 Years. ThyroidWorld Congr.

27. Wolfe HJ, Melvin KE, Cervi-Skinner SJ, et al. (1973) C-cell hyper-plasia preceding medullary thyroid carcinoma. N Engl J Med 289:437–41. doi: 10.1056/NEJM197308302890901

28. DeLellis RA, Nunnemacher G,Wolfe HJ (1977) C-cell hyperplasia.An ultrastructural analysis. Lab Invest 36:237–48.

29. Cooper GM, Stone EA, Asimenos G, et al. (2005) Distribution andintensity of constraint in mammalian genomic sequence. GenomeRes 15:901–913. doi: 10.1101/gr.3577405

30. Iwashita T, Murakami H, Asai N, Takahashi M (1996) Mechanismof ret dysfunction by Hirschsprung mutations affecting its extracel-lular domain. Hum Mol Genet 5:1577–80.

31. Hyndman BD, Gujral TS, Krieger JR, et al. (2013) Multiple func-tional effects of RET kinase domain sequence variants inHirschsprung disease. Hum Mutat 34:132–42. doi: 10.1002/humu.22170

32. Coyle D, Friedmacher F, Puri P (2014) The association betweenHirschsprung’s disease and multiple endocrine neoplasia type 2a: asystematic review. Pediatr Surg Int. doi: 10.1007/s00383-014-3538-2

33. Tavtigian S V., Byrnes GB, Goldgar DE, Thomas A (2008)Classification of rare missense substitutions, using risk surfaces,with genetic- and molecular-epidemiology applications. HumMutat 29:1342–1354. doi: 10.1002/humu.20896

34. Cosci B, Vivaldi A, Romei C, et al. (2011) In silico and in vitroanalysis of rare germline allelic variants of RET oncogene associ-ated with medullary thyroid cancer. Endocr Relat Cancer 18:603–12. doi: 10.1530/ERC-11-0117

35. Santoro M, Melillo RM, Carlomagno F, et al. (2004) Minireview:RET: normal and abnormal functions. Endocrinology 145:5448–51. doi: 10.1210/en.2004-0922

36. Kambouris M, Jackson CE, Feldman GL (1996) Diagnosis of mul-tiple endocrine neoplasia [MEN] 2A, 2B and familial medullarythyroid cancer [FMTC] by multiplex PCR and heteroduplex anal-yses of RET proto-oncogene mutations. Hum Mutat 8:64–70. doi:10.1002/(SICI)1098-1004(1996)8:1&lt;64::AID-HUMU9&gt;3.0.CO;2-P

37. Pelet A, Geneste O, Edery P, et al. (1998) Various mechanismscause RET-mediated signaling defects in Hirschsprung’s disease. JClin Invest 101:1415–1423. doi: 10.1172/JCI375

Endocr Pathol

38. Ibáñez CF (2013) Structure and physiology of the RET re-ceptor tyrosine kinase. Cold Spring Harb Perspect Biol. doi:10.1101/cshperspect.a009134

39. Viola D ME, E M, L A, et al. (2014) Ret Oncogene and ThyroidCarcinoma. J Genet Syndr Gene Ther. doi: 10.4172/2157-7412.1000214

40. Diaz-Cano SJ, De Miguel M, Blanes A, et al. (2001) GermlineRET 634 mutation positive MEN 2A-related C-cell hyperpla-sias have genetic features consistent with intraepithelial neo-plasia. J Clin Endocrinol Metab 86:3948–3957. doi: 10.1210/jc.86.8.3948

41. Ponder BA (1999) The phenotypes associated with ret mutations inthe multiple endocrine neoplasia type 2 syndrome. Cancer Res 59:1736s–1741s; discussion 1742s.

42. Smith-Hicks CL, Sizer KC, Powers JF, et al. (2000) C-cell hyper-plasia, pheochromocytoma and sympathoadrenal malformation in amouse model of multiple endocrine neoplasia type 2B. EMBO J 19:612–22. doi: 10.1093/emboj/19.4.612

43. Orgiana G, PinnaG, CameddaA, et al. (2004) A new germline RETmutation apparently devoid of transforming activity serendipitouslydiscovered in a patient with atrophic autoimmune thyroiditis andprimary ovarian failure. J Clin Endocrinol Metab 89:4810–6. doi:10.1210/jc.2004-0365

44. Mears L, Diaz-Cano SJ (2003) Difference between familial and spo-radic medullary thyroid carcinomas. Am J Surg Pathol 27:266–7.

45. Williams ED, Ponder BJ, Craig RK (1987) Immunohistochemicalstudy of calcitonin gene-related peptide in human medullary carci-noma and C cell hyperplasia. Clin Endocrinol (Oxf) 27:107–114.

Endocr Pathol

Patient Features I:2 II:2 II:3

Age at last clinical

evaluation or age at

operation

67 49 45

Basal serum

calcitonin (ng/l) <3.0(<4.8) <3.0(<11.8) <7.9(<11.8)

Plasma

metadrenaline

(pmol/L)

77(80-510) 155(80-510) 299(80-510)

Plasma

normetadrenaline

(pmol/L)

310(120-1180) 305(120-1180) 405(120-1180)

Plasma 3-

methoxytyramine

(pmol/L)

<120(<120) <120(<120) <120(<120)

Corrected serum

calcium (nmol/L) 2.22(2.15-2.60) 2.15(2.15-2.60) 2.15(2.15-2.60)

Adrenal imaging NAD Left adrenalectomy, nodular right adrenal

without discrete lesion NAD

Adrenal pathology N/A

L adrenal gland with low histological risk

PCC, measuring 70x46x35mm, with no

extra-capsular extension, lymphovascular or

perineural invasion; no confluent necrosis or

spindle cells were identified (aged 42)

N/A

Thyroid pathology

Echogenic nodule L

lower lobe 21 x23mm

FNA - non-diagnostic

(Thy1)

Several non-encapsulated hyperplastic

nodules were identified, the largest was

1.2cm with macro and microfollicular

growth patterns; no solid-diffuse areas,

necrosis or high nuclear grade were

identified. The background parenchyma

showed scattered foci of circumferential

non-solid C-cell nests without nuclear atypia

(> 50 C Cells/medium power field and >6 C-

cell/follicle) and no histological evidence of

stromal invasion (aged 43).

N/A

HSCR N/A N/A Short segment

(aged 2 days)

Name Sequence 5'-3' Strand Forward/Reverse Purpose

RET_gDNA_seq_F GGGATTAAAGCTGGCTATGG + Forward

Sequencing (Genomic

DNA)

RET_gDNA_seq_R CACAGCTCGTCGCACAGT - Reverse

Sequencing (Genomic

DNA)

RET_gDNA_seq_1F ACACTGCCCTGGAAATATGGG + Forward

Sequencing (Genomic

DNA)

RET_gDNA_seq_1R AAGTTTCATGGGGCCCACTC - Reverse

Sequencing (Genomic

DNA)

RET_gDNA_seq_2F GAGCCCCGGGGGATTAAAG + Forward

Sequencing (Genomic

DNA)

RET_gDNA_seq_2R GGAGGGAAGTTTCATGGGGC - Reverse

Sequencing (Genomic

DNA)

RET 1F CCGCAGTCCCTCCAGCCG + Forward Sequencing (Plasmid)

RET 1.1F AAAACGACGGCCAGTGAATT + Forward Sequencing (Plasmid)

RET 1.2F CTCGAGGGATGCTTACTGGG + Forward Sequencing (Plasmid)

RET 1.2R ATGCAGCCGTGTGCGGTACGT + Forward Sequencing (Plasmid)

RET 2F ATCTCTACGGCACGTACCG + Forward Sequencing (Plasmid)

RET 3F TCCAGCCTGCAGCTCCCT + Forward Sequencing (Plasmid)

RET 4F GAGCTGGTGGCCGTGTGC + Forward Sequencing (Plasmid)

RET 5F GGGACACCTGGGCCCAGC + Forward Sequencing (Plasmid)

RET 6F GCCCAGTACCTACTCCCTCTC + Forward Sequencing (Plasmid)

RET 7F ACCGACCAGCAGACCTCTAG + Forward Sequencing (Plasmid)

RET 8F ATGTTGTGGAGACCCAAGACA + Forward Sequencing (Plasmid)

RET 9F CTTCTGCATCCACTGCTACCA + Forward Sequencing (Plasmid)

RET 10F GTGGTCAAGGCAACGGCCTT + Forward Sequencing (Plasmid)

RET 11F AAGTGGGGCCTGGCTACCT + Forward Sequencing (Plasmid)

RET 12F CTACGTGAAGAGGAGCCAGG + Forward Sequencing (Plasmid)

RET 13F TGGAAGCAGGAGCCGGAC + Forward Sequencing (Plasmid)

RET 13.1F AAGAGGAGAGACTACTTGGA + Forward Sequencing (Plasmid)

RET 13.2F CCCGAACTGGCCTGGAGAGA + Forward Sequencing (Plasmid)

C620R_F GAAGTGCTTCCGCGAGCCCGA + Forward Site Directed

Mutagenesis

C620R_R TCCTCCTCAGGGAAGCAG - Reverse

Site Directed

Mutagenesis

C634R_F CGACGAGCTGCGCCGCACGGT + Forward

Site Directed

Mutagenesis

C634R_R CACAGTGGATCCTGGATGTCTTCG - Reverse

Site Directed

Mutagenesis

M918T_F GTTAAATGGACGGCAATTGAATCCCTTTTTG + Forward

Site Directed

Mutagenesis

M918T_R TGGAATCCGACCCTGGCT - Reverse

Site Directed

Mutagenesis

Y791F_F ATCAAATTGTTTGGGGCCTGC + Forward

Site Directed

Mutagenesis

Y791F_R GACATGTGGGTGGTTGAC - Reverse

Site Directed

Mutagenesis

E616Q_F CCCTGAGGAGCAGAAGTGCTTC + Forward

Site Directed

Mutagenesis

E616Q_R AAGCAGTTGCAGGTGCCA - Reverse

Site Directed

Mutagenesis

RET_1F GGAGAAGGCGAATTTGGAAAAG + Forward qPCR

RET_1R CAGGACGTTGAACTCTGACAG - Reverse qPCR

RET_2F TCCTCTTGCTCCACTTCAAC + Forward qPCR

RET_2R TGATGCCACTGAATGCCTG - Reverse qPCR

HGNCnameandsymbol HGNCnumber OMIM ClinicalPhenotype

MycassoicatedfactorX;MAX 6913 154950 HereditaryPPGL

PRKAR1A 9388 160980 Carneycomplex

Retproto-oncogene;RET 9967 164761 FMTC,MEN2A,MEN2B

Succinatedehydrogenasecomplex,assemblyfactor2;SDHAF2

26034 613403 HereditaryPPGL

Succinatedehydrogenasecomplex,subunitB,ironsulphur(Ip);SDHB

10681 185470 HereditaryPPGL

Succinatedehydrogenasecomplex,subunitC,integralmembraneprotein;SDHC

10682 602413 HereditaryPPGL

Succinatedehydrogenasecomplex,subunitD,integralmembraneprotein;SDHD

10683 602690 HereditaryPPGL

Transmembraneprotein127;TMEM127 26083 613403 HereditaryPPGL

VonHippel-Lindautumoursuppressor,E3ubiquitinproteinligase;VHL

12687 608537 VHLSyndrome

Location Genotype (cDNA) Codon Change Protein Change MEN2 Phenotype MTC Onset First Reference Exon 10 c.1858T>C TGC-CGC p.C620R MEN2A and FMTC 6 Donnis-Keller (1993) Exon 11 c.1900T>C TGC-CGC p.C634R MEN2A and FMTC 1.4 Donnis-Keller (1993) Exon 13 c.2372A>T TAT-TTT p.Y791F MEN2A FMTC 21 Berndt (1998) Exon 16 c.2753T>C ATG-ACG p.M918T MEN2B 0.17 Hofstra (1994)

Exon 10 c.1846G>C GAG-CAG p.E616Q MTC N/R Tacito (2013) Exon 10 c.1846G>C GAG-CAG p.E616Q CCH N/A This study