The Potential Neuroprotective Role of Chemokine Receptor GPR75 › ~rmapcsp › MRes Imperial...
Transcript of The Potential Neuroprotective Role of Chemokine Receptor GPR75 › ~rmapcsp › MRes Imperial...
The Potential Neuroprotective Role
of Chemokine Receptor GPR75
byChristopher Parker
Leukocyte Biology Section, Faculty of Medicine,
Sir Alexander Fleming Building, Imperial College London,
London, SW7 2AZ
Thesis for Masters of Research in Biomedical Research
August 2010
Supervisor: Dr James Pease
Words 4,988
Abstract
Chemokine receptors typically elicit chemotaxis of leukocytes, mediating
homeostatic and pro-inflammatory migration. Abnormal chemokine function is
found in several inflammatory disorders, including multiple sclerosis and other
neurological disorders with inflammatory pathology, such as Alzheimer’s
disease. Our understanding of the role of the chemokine system in these
disorders is incomplete and recent evidence obtained by in vitro studies
suggest that chemokines may also have a neuroprotective role. G protein-
coupled receptor 75 (GPR75) is a deorphanised receptor for the chemokine
RANTES/CCL5. GPR75 activation by CCL5 was reported to protect the
mouse hippocampal cell line HT22 from amyloid-β induced toxicity. It is
hypothesised that GPR75 provides endogenous protection from oxidative
stress in the brain. An established in vitro model of oxidative stress was used
to test this hypothesis in HT22 cells. Cells were pre-treated with varying
concentrations of CCL5 before addition of glutamate and cell viability
recorded. Increasing concentrations of CCL5 had no significant effect on
mean cell viability. GPR75 was then investigated using transient transfection.
GPR75 was poorly expressed on the cell surface of the murine pre-B
lymphoma cell line L1.2, precluding further study. Characterisation of
endogenous cell types expressing GPR75 is warranted to form further
functional hypotheses.
Abbreviations
AD Alzheimer's disease
AIDS Acquired Immune Deficiency Syndrome
bp (s) Base Pair(s)
ddH2O Double distilled H2O
DMEM Dulbeccos' Modified Eagle Medium
FBS Fetal Bovine Serum
FC Flow Cytometry
FITC Fluorescein Isothiocyanate
GPCR G protein-coupled receptor
GPR75 G protein-coupled receptor 75
HA Haemagglutinin
hGPR75 Human GPR75
HIV Human Immunodeficiency Virus
IC50 Half Maximal inhibitory Concentration
IP3 Inositol Triphosphate
kb Kilobase
LB Luria Broth
MAb Monoclonal Antibody
MAPK Mitogen activated protein kinase
MEM Minimal Essential Media
mGPR75 Murine GPR75
mCCL5 Murine CCL5
MIP-1α Macrophage Inflammatory Protein-1-α
MS Multiple Sclerosis
PBS Phosphate Buffered Saline
PCR Polymerase Chain Reaction
PD Parkinson’s disease
PKC Protein kinase C
PLC Phospholipase C
RANTES Regulated upon Activation, Normally T-cell Expressed and
presumably Secreted
ROS Reactive Oxygen Species
RPMI Roswell Park Memorial Institute
RT Reverse Transcription
SE Standard Error
Introduction
G protein-coupled receptor 75 (GPR75) reportedly belongs to the chemokine
receptor family of G protein-coupled receptors (GPCRs) [1]. GPCR’s are
seven-transmembrane proteins involved in signal transduction of extracellular
stimuli to intracellular environments. Chemokine receptors are activated by
binding of chemotactic cytokines, or chemokines; a superfamily of protein
ligands which are highly conserved, plurifunctional and involved in the
modulation of cellular activities such as chemotaxis, phagocytosis, cell
activation, proliferation and apoptosis [2]. Chemokines are divided into two
main sub-families: CXC and CC; based on the number and spacing of N-
terminal cysteine residues. Receptors are divided into two main sub-families:
CXCR and CCR; based on the family of chemokine to which they bind. In
chemokine annotation, the letter ‘X’ denotes the relative position of an amino
acid interspersed with conserved N-terminal cysteine residues. A single
chemokine may bind many chemokine receptors, whilst a single receptor may
have multiple chemokine ligands, which is often termed promiscuity. The
cellular immune response to circulating chemokines is determined by the
complement of chemokine receptors present on their cell surface.
The primary function of chemokines is to guide the migration of circulating
leukocytes [2]. Chemokines elicit migration through a process called
chemotaxis, whereby chemokine-chemokine receptor interaction promotes
cell movement along an increasing chemokine concentration gradient [2].
Migration can be considered homeostatic, i.e. cell movement during normal
tissue maintenance or development, or pro-inflammatory, i.e. chemotaxis of
effector cells from the blood to sites of infection.
Our understanding of the role of the chemokine system in normal
physiological and pathophysiological conditions is incomplete. In addition to
the already established role in HIV-infection and AIDS [4], increasing
evidence suggests that the chemokine system may play an important role in
neuroinflammatory diseases such as multiple sclerosis (MS) and neurological
diseases with an inflammatory component such as Alzheimer’s disease and
cerebral ischemia [3].
In the human central nervous system, chemokine receptors such as CCR3,
CCR5, CX3CR1, CXCR2, CXCR3 and CXCR4 are constitutively expressed
by microglia, astrocytes, oligodendrocytes and neurons [3]. Under normal
physiological conditions, studies show that these chemokine receptors can
function in neuronal migration during brain development [5], cell proliferation
and trophic support [6] and in modulation of neurotransmission [7].
MS is an inflammatory disease of the central nervous system, characterised
by myelin sheath destruction, axonal pathology and progressive neurological
dysfunction [8]. Evidence suggests that several chemokine receptors, such as
CCR3 and CCR5, can promote the pathological response, by attracting
leuckocytes to sites of inflammation [9-11]. Interestingly, in the experimental
autoimmune encephalitis (EAE) mouse model of the disease, CCR1 knockout
mice develop a far less severe form of the disease [12] and administration of
anti- Macrophage Inflammatory Protein-1-α (MIP-1α)/CCL3 antibody has been
shown to reduce disease severity [13].
Alzheimer’s disease (AD) is a neurodegenerative disorder that causes
progressive memory impairment and dementia [14]. The AD brain is
characterised by extracellular plaques composed of the neurotoxic amyloid-β
protein [14]. These extracellular plaques are commonly enclosed by activated
microglia and astrocytes, forming the neuritic plaque [15]. The disease results
in neuronal loss and inflammation is a key component of the disease [43].
There is evidence that the chemokine system may contribute to inflammatory
pathology in AD. Receptors such as CCR3, CCR5, CXCR2 and CXCR3 are
expressed in areas of the AD brain including the hippocampus [3] - the
primary site of degeneration in AD [16]. CCR3 and CCR5 are detected on
astrocytes, microglia and endothelial cells and expression is increased in the
AD brain compared to controls [17]. Amyloid-β and oxidative stress, which are
present at the lesion site, can promote the release of chemokines such as
CCL3 and RANTES (Regulated upon Activation, Normally T-cell Expressed
and presumably Secreted)/CCL5 from surrounding tissue [18, 19].
Accordingly, CCL5 expression is upregulated in the cerebral microcirculation
of the AD brain [20]. The brains high metabolic rate and reduced ability for
cellular regeneration makes it particularly susceptible to insults accompanying
chronic inflammation such as oxidative damage.
Recent evidence suggests that CCL5 and other inflammatory proteins could
have a neuroprotective role [21, 22]. Treatment of primary cortical neuronal
cultures with CCL5 enhances survival. Also, exposure of neuronal cultures to
CCL5 prior to treatment with neurotoxic agents causes a significant reduction
in neuronal cell death [20]. These reports provide promise that therapies
aiming to exploit the neuroprotective mechanisms of the chemokine system
could counter the detrimental inflammatory processes caused by its
upregulation.
Recently, a novel CC chemokine receptor G protein-coupled receptor 75
(GPR75) has been identified with a potential role in neuroprotection [1].
GPR75 is a deorphanised receptor for chemokines CCL5 and CCL3. GPR75
is located on chromosome 2p16, is transcribed from a single exon and
produces a 540 amino acid protein [23]. Several characteristics distinguish
GPR75 as an atypical chemokine receptor. (1) GPR75 shares 12-16%
homology with chemokine receptors of the same class, compared to 50% in
the majority of chemokine receptors [24]. (2) Signalling is coupled to the
intracellular Gαq protein [1, 24], compared to Gαi in other chemokine
receptors [25]. (3) GPR75 is not expressed in typical chemokine receptor
locations such as leukocytes and spleen, instead expression is almost
exclusively in the central nervous system [1, 23, 26]. In attempting to identify
endogenous ligands for the receptor using GPR75 transfectants, Ignatov et
al. (2006) found that CCL5 and CCL3 activated intracellular signalling
pathways that resulted in activation of inositol triphosphate (IP3),
phospholipase C (PLC), p44/p42 mitogen-activated protein kinase (MAPK)
and Akt, ultimately triggering a rise in intracellular calcium. Importantly, the
same study reported that activation of murine GPR75 (mGPR75) is protective
against amyloid-β induced cell death in the mouse hippocampal cell line
HT22, which express mGPR75 endogenously. This report provides evidence
for a neuroprotective role for GPR75 in vivo and perhaps the chemokine
system in cases of neurological stress.
Despite these recent findings, little is known regarding the mechanism of
neuroprotection or the cell types in which GPR75 is found. It is hypothesised
that GPR75 provides endogenous defence from neuronal oxidative stress.
This study tests this hypothesis using an established in vitro model for brain
oxidative stress and attempts to investigate the typical chemokine receptor
characteristics of GPR75 in vitro.
Materials and Methods
Materials
Glutamate, oligonucleotide primers, mouse genomic DNA and TOPO
plasmids were obtained from Invitrogen (Paisley, UK). Glutamate was
dissolved in simple DMEM to a concentration of 250mM. Oligonucleotide
primers for murine CCR1, CCR3, CCR5 and GPR75 were re-suspended in
ddH20 to a concentration of 100µM and 20µM aliquots made for polymerase
chain reaction (PCR).
Dulbecco’s Modified Eagle Medium (DMEM), fetal bovine serum (FBS),
simple RPMI, phosphate buffered saline (PBS), IgG1 MAb and fluorescein
isothiocyanate–conjugated (FITC)-conjugated goat anti-mouse F(abI)2
antibodies were obtained from Sigma-Aldrich Company Limited (Dorset,
England). HT22 cells, a gift from Dr Peter Clark, were suspended in PBS and
stored in liquid nitrogen until use in this study. Simple RPMI was
supplemented with 10% FBS, 100 units/ml penicillin, 0.1 mg/ml streptomycin,
1mM sodium pyruvate, 50ml MEM and 50µM mercaptoethanol (all from
Sigma-Aldrich Company Ltd.) to make complete RPMI. DMEM was
supplemented with 10% FBS and 100 units/ml penicillin plus 0.1mg/ml
streptomycin (all from Sigma Aldrich Company Ltd.) to make complete
DMEM.
Taq polymerase, Pfu polymerase, Taq buffer (NH4SO4), Pfu buffer (with
MgSO4), deoxyribonucleotide trisphosphate (dNTP) bases (10mM) and MgCl2
(25mM) were obtained from Fermentas (York, UK). The IMAGE plasmid
pT7T3D-Pac, containing human GPR75 (hGPR75) cDNA, was a gift from Dr
Gregory Evans and was re-suspended in ddH20. Murine CCL5 (mCCL5) was
obtained from Peprotech EC Ltd. (London, UK) and suspended in ddH20 to a
concentration of 10μM. Anti-HA MAb was obtained from Covance (Crawley,
UK). Cell Titer Glo was obtained from Promega (Southampton, UK). All other
reagents were purchased from Sigma Aldrich Company Ltd. unless otherwise
stated.
Cell Culture
The immortal mouse hippocampal cell line HT22 were gently thawed and
transferred to a 75ml cell culture flask (Corning Incorporated, USA) containing
13 ml complete DMEM. Cells were maintained at or below 4 x 105 cells/ml
and were passaged by trypsinising.
The murine pre-B lymphoma cell line L 1.2 were cultured in complete RPMI
and maintained at a concentration of 5 x 105 cells/ml. HT22 and L1.2 cells
were kept at 37oC in a humidified 5% CO2 incubator. A haemocytometer was
used for cell counting.
Reverse Transcription Polymerase Chain Reaction (RT-PCR)
Murine CCR1, CCR3, CCR5 and GPR75 are known receptors for mCCL5.
Primers for these receptor sequences were obtained to determine mCCL5
receptor expression in HT22 cells (Table 1). Amplification was first
demonstrated on mouse genomic DNA, using Taq-based PCR and following
concentrations of PCR ingredients recommended by Fermentas. DNA was
amplified in a Peltier PTC-200 thermocycling machine (GMI, USA) by
denaturing at 94oC for 3 mins, followed by 39 cycles of: 94oC for 1 min, 55oC
for 30 s and 72oC for 1 min 30 s; followed by a final extending stage at 72oC
for 10 mins.
RNA was extracted from HT22 cells following the standard protocol of the
RNeasy Mini Kit from Qiagen (Crawley, UK). Prior to RT, DNA was digested
using the RNAse-Free Dnase I solution (Qiagen), to prevent contamination.
cDNA was obtained by RT of HT22 RNA following procedures in the
Superscript First-strand Synthesis System for RT-PCR (Invitrogen). Receptor
expression in HT22 cells was determined by PCR amplification of HT22 cDNA
using primers for murine CCR1, CCR3, CCR5 and GPR75, following identical
thermocycling parameters used for mouse genomic DNA amplification. As a
negative control RT-PCR was performed using HT22 RNA without the RT
enzyme. DNA was analysed using 1% agarose gel electrophoresis and
visualised under UV light.
Cytotoxicity Assays
All steps apart from luminescence measurement were performed in sterile
conditions. HT22 cells were re-suspended in complete DMEM to a
concentration of 3 x 104 cells/ml and 100μl seeded in wells of a 96-well plate.
Cells were left to adhere at 37oC in 5% CO2 for 24 hrs. Cell media was then
aspirated and 50μl of varying concentrations of glutamate (0, 1, 3, 5, 7, 10, 15
and 30mM) in simple DMEM added. Cells were incubated at 37oC with 5%
CO2 for 24hrs and cell viability measured by ATP-dependent Cell Titer Glo
luminescence using the TopCount NXT Microplate Scintillation and
Luminescence Counter machine from Packard (Connecticut, USA). Here, 50μl
Cell Titer Glo was added to each well before shaking at 70 rpm for 10 mins.
Next, 70μl of each well was transferred to a white opaque 96-well plate
(Perkin Elmer, Buckinghamshire) for luminescence counting.
The half-maximal inhibitory concentration (IC50) of glutamate was 5.9mM. A
6mM final concentration of glutamate was used in subsequent experiments to
examine the effect of mGPR75 activation on glutamate-induced toxicity. After
cell seeding, media was aspirated and 40μl of varying concentrations of
mCCL5 was added 1hr prior to addition of 10μl 30mM glutamate. Cells were
then incubated at 37oC with 5% CO2 for 24 hrs before luminescence counting,
as described above. Cell viability is expressed as a percentage of untreated
control luminescence. For each independent experiment, mean luminescence
values were obtained for 3 repeat measurements under each condition.
Amplification and cloning of human GPR75
For the purpose of hGPR75 expression analysis in transfected L1.2 cells, a
sequence encoding the influenza hemagglutinin (HA) epitope tag was coupled
to the full-length coding sequence of hGPR75 by PCR. The HA tag was in
frame with the N-terminus of the receptor, allowing detection of hGPR75 cell
surface expression through secondary antibody staining [27]. hGPR75 primer
pairs were designed and obtained from Invitrogen (Table 1). The forward
primer was designed to encode the Kozak sequence ‘CACC’, necessary for
ligation of HA-GPR75 into the TOPO entry vector and subsequent translation
initiation in mammalian cells [44]. Primers were used to amplify GPR75 from
the IMAGE vector pT7T3D-Pacl using Pfu-polymerase-based PCR. Next, 1μl
of the HA-GPR75 PCR product was cloned into the KanamycinR-containing
TOPO entry vector pENTR/SD/D-TOPO, following the pENTR Directional
TOPO Cloning Kit (Invitrogen) protocol, allowing entry into the Invitrogen
TOPO Gateway Cloning System (http://www.invitrogen.com).
Supercompetent OneShot E.Coli (Invitrogen) were transformed with the
reaction mixture and grown in kanamycin to amplify HA-GPR75-
pENTR/SD/D-TOPO DNA. Plasmid DNA was obtained by following
procedures in the FastPlasmid Miniprep Digestion Kit (5Prime, UK) and was
verified to contain recombinant plasmid by PCR, using the above HA-GPR75
specific primers. Plasmid DNA (~150ng) from a successful colony was cloned
into the AmpicillinR-containing TOPO destination vector pcDNA3.2/V5-DEST,
following the LR Reaction Kit (Invitrogen) protocol. The LR reaction mixture (1
μl) was then used to transform Supercompetent OneShot E.coli, which were
grown in ampiciillin and used to amplify HA-GPR75-pcDNA3.2/V5-DEST
DNA. Plasmid DNA was isolated using the FastPlasmid Miniprep Digestion Kit
and was verified to contain HA-GPR75 DNA by PCR, using the above HA-
GPR75-specific primers. The most successful recombinant cell culture, as
judged by DNA band intensity on an agarose gel (1%), was expanded by
growing overnight in LB and ampicillin (50µg/ml). The HiSpeed Plasmid
Purification Maxi kit (Qiagen) was used to isolate several hundred μg’s of HA-
GPR75-pcDNA3.2/V5-DEST DNA for transfection into L1.2 cells. Authenticity
of the HA-GPR75-pcDNA3.2/V5-DEST plasmid was verified by sequencing
(MWG Eurofins).
Transient Transfection of L1.2 Cells
All steps were performed in sterile conditions. L1.2 cells were counted and 1 x
107 cells were pelleted by centrifugation (160g, 5 mins) in a sterile 50ml falcon
tube. Cells were re-suspended in 800μl simple RPMI and dispensed into the
bottom of a 1ml sterile electroporation cuvette (BTX Harvard Apparatus,
USA). 10μg of HA-GPR75-pcDNA3.2/V5-DEST DNA and 50μl tRNA (10.5
mg/ml) was added to the cuvette, which was then incubated at 25oC for 20
mins, before electroporation (330V, 975µF) for 20-40ms using the BIO-RAD
Gene Pulser and the BIO-RAD Capacitance Extender Plus (Bio-Rad
Laboratories Inc., UK). The cuvette was then incubated at 25oC for 20 mins.
Cuvette contents were transferred to a 25ml tissue culture flask containing
10ml complete RPMI and incubated at 37oC in a 5% CO2 incubator for 4 hrs,
before addition of sodium butyrate to a final concentration of 10mM, to
promote gene expression. Cells were then incubated at 37oC with 5% CO2
overnight. As negative and positive controls, the identical transformation steps
were performed with empty pcDNA3 and HA-CXCR3-pcDNA3 plasmids
respectively.
Measuring Cell Surface Protein Expression Using Flow Cytometry
Approximately 5 x 105 transfected cells were added to 1ml of flow cytometry
(FC) buffer (0.01% NaN3, 0.1% BSA in HEPES-modified PBS) in FC tubes
and cells pelleted by centrifugation at 210g for 5mins. Supernatant was
discarded and cells were re-suspended in 100µl anti-HA MAb antibody
(diluted 1:100 in FC buffer). To control for non-specific binding of HA antibody,
the identical procedure was concurrently performed with 100µl IgG1 MAb
primary antibody (diluted 1:100 in FC buffer). Tubes were briefly vortexed and
incubated at 4oC for 15 mins. Next, 1ml FC buffer was added to tubes before
centrifugation at 210g for 5 mins, to wash excess antibody staining.
Supernatant was discarded and cells were re-suspended in 100µl FITC-
conjugated goat anti-mouse F(ab')2 secondary antibody (10mg/ml) (Dako,
Denmark). Tubes were briefly vortexed and incubated at 4oC for 15 mins. 1ml
FC buffer was then added and tubes centrifuged at 210g for 5 mins.
Supernatant was discarded and cells re-suspended in 500µl FC buffer. Tubes
were vortexed briefly before analysis using CellQuestPro software on the
Becton Dickinson FACS Caliber flow cytometry machine (BD Biosciences,
USA). Ten thousand events were collected and data from dead cells were
excluded by forward scatter/side scatter gating [28]. Fluorescence of the
FITC-conjugated goat F(ab')2 anti-mouse secondary antibody was detected by
the flow cytometer and used to calculate HA-specific staining, by subtracting
the mean fluorescence (FLH-1) of HA stained cells from the mean
fluorescence of IgG1 stained cells.
Statistical Analysis
Results are presented as the mean of n independent experiments, as
indicated. One-way ANOVA with Bonferonni’s multiple comparisons test was
used when comparing three or more means. Statistics were generated using
Prism (Graph Pad Software, San Diego, CA, USA). P values were considered
significant if p<0.05.
Results
Expression of murine CCR1, CCR3, CCR5 and GPR75 in HT22 cells
PCR using primers for murine CCR1, CCR3, CCR5 and GPR75 amplify
regions of size 546bp, 287bp, 523bp and 620bp respectively. Figure 1.a.
shows that primers were able to amplify all known mCCL5 receptors from
mouse genomic DNA. RT-PCR of HT22 RNA using identical primers showed
that mGPR75 is the only known mCCL5 receptor expressed in these cells
(Figure 1.b.). Therefore, mGPR75 activation in HT22 cells through addition of
mCCL5 has no confounding effects through activation of other chemokine
receptors. Alternate lanes contained the PCR reaction mix either without
mouse genomic DNA or the negative control RT reaction. These controls
reduced the chance of identifying false positive expression.
Glutamate cytotoxicity
Glutamate-induced toxicity in HT22 cells has been used to model neuronal
oxidative stress in vitro [29]. HT22 cells were allowed to adhere to the well of
a 96-well plate for 24 hrs, before incubation with 0-30mM glutamate for 24
hrs. Treatment with 3-30mM glutamate resulted in a step-wise decrease in
cell viability from 81.7% to 1.7% (Figure 2). The logarithmic dose-response to
glutamate formed a downward sloping sigmoidal curve and the IC50 for
glutamate toxicity was calculated as 5.9mM (logIC50 = -2.27±0.07).
Neuroprotection of murine GPR75 from glutamate-induced toxicity
It has previously been shown that mGPR75 activation by prior treatment with
CCL5 can prevent HT22 cell death induced by the neurotoxic amyloid-β [1].
This study next asked whether prior activation of mGPR75 could prevent
glutamate-induced oxidative toxicity in HT22 cells. Cells were pre-treated with
varying concentrations of mCCL5 for 1hr, before incubation with 6mM
glutamate for 24 hrs. Glutamate treatment resulted in a 50% reduction in cell
viability compared to untreated controls (Figure 3). Prior treatment with
mCCL5 did not significantly protect HT22 cells from glutamate-induced toxicity
in a dose-dependent manner. The maximum mean cell viability afforded after
glutamate treatment was 60.8% with 10nM concentrations of mCCL5. Pre-
treatment with 0.3nM mCCL5 provided the least protection from glutamate,
where mean cell viability was 46.8%. Cell viability measurements had a wider
variation with 10nM (n=2) and 30nM (n=2) pre-treatment with mCCL5.
Transient transfection of L1.2 cells with human GPR75
hGPR75 was coupled to a sequence encoding the HA tag by PCR and
subsequently cloned into the TOPO destination vector pcDNA3.2/V5-DEST,
using the TOPO Gateway Cloning System (Figure 4). HA-GPR75-
pcDNA3.2/V5-DEST DNA was transiently transfected into L1.2 cells. Cells
were first stained with anti-HA MAb or the isotype control IgG1 MAb primary
antibodies followed by the FITC-conjugated goat anti-mouse F(ab')2 seconday
antibody. HA-CXCR3-pcDNA3 transfection was used as a positive control for
the transfection protocol and empty pcDNA3 plasmid, which does not express
a receptor protein or HA tag sequence, served as a negative control. Using
flow cytometry, dead cells were excluded and HA-GPR75 cell surface
expression was determined (Figure 5 and 6). Mean fluorescence (FLH-1) for
HA-stained pcDNA3 transfected cells was 22.60 (arbitrary units), whereas
mean fluorescence for IgG1 stained cells was 7.41. The difference between
these values indicates HA-specific staining and is proportional to receptor cell
surface expression. Mean HA-specific staining for pcDNA3 transfections was
15.2, indicating the background level of HA staining. Mean HA-specific
staining for HA-GPR75-pcDNA3.2/V5-DEST transfected cells was 14.8833,
and for HA-CXCR3-pcDNA3 transfected cells was 41.1433. Mean HA-specific
staining of HA-CXCR3-pcDNA3 transfected cells was significantly higher than
pcDNA3 transfected cells (p<0.001) (Figure 6), indicating that the transfection
protocol was optimal and the staining procedure detects receptor cell surface
expression. Mean HA-specific staining of HA-GPR75-pcDNA3/V5-DEST
transfected cells was not significantly different from HA-specific staining of
pcDNA3 transfected cells. Moreover, HA-GPR75-pcDNA3.2/V5-DEST
transfected cells had significantly lower mean HA-specific staining than HA-
CXCR3-pcDNA3 transfected cells (p<0.001). These data indicate that HA-
GPR75 was not significantly expressed on the cell surface of transfected L1.2
cells.
Relatively few cells were acquired from one pcDNA3 transfection (Figure 4,
Exp. 2). However, mean luminescence was comparable to other pcDNA3
experiments, indicating that sufficient cells were obtained for analysis.
Discussion
The chemokine system plays an important role in inflammatory diseases,
including neurodegenerative diseases with contributing inflammatory
pathology such as AD, MS and AIDS-dementia complex [2, 3]. Evidence
exists for both a detrimental and protective role for chemokines in neuronal
survival [10, 12, 20]. Recently, a novel receptor for the chemokine CCL5 has
been identified, named GPR75. GPR75 is expressed predominantly in the
human and mouse central nervous system [1, 23, 26]. Reportedly, activation
of mouse GPR75 by CCL5 prevents neuronal cell death caused by the
amyloid-β protein [1]. Amyloid-β is toxic to neuronal cells via oxidative stress
mechanisms [30] [45]. It is therefore hypothesised that GPR75 has an
endogenous role in protection from oxidative stress in the central nervous
system. Exploiting the protective mechanisms of GPR75 could counter the
otherwise detrimental effects of chemokine upregulation in chronic
inflammation aswell as provide a potential therapeutic target for the treatment
of AD and other neurological diseases involving oxidative stress. This study
used the in vitro glutamate-induced toxicity model of oxidative stress to
investigate the protective effect of mGPR75 in HT22 cells [29]. Also, hGPR75
was transiently transfected into leuckoyte cells for further functional analysis.
This study first demonstrated that while mouse genomic DNA contains genes
for all known mCCL5 receptors: murine CCR1, CC3, CCR5 and GPR75
(Figure 1.a.), only mGPR75 is expressed in HT22 cells (Figure 1.b). These
findings agree with previous studies regarding the expression of mGPR75 in
HT22 cells [1].
It was shown that glutamate was toxic to HT22 cells with an IC50 of 5.9mM
(Figure 2). Similar glutamate concentrations have been extensively used to
study oxidative stress toxicity in HT22 cells, incurring similar losses of cell
viability [29, 31, 32]. Mechanisms of cell death in this model mimic those
observed in vivo in neurological diseases such as Parkinson’s disease and
cerebral ischemia, where brain glutathione is depleted [46], as well as in AD
and MS where there are high levels of oxidative stress [47].
It was next asked whether activation of mGPR75 could prevent glutamate-
induced toxicity. Increasing concentrations of mCCL5 pre-treatment did not
significantly protect HT22 cells from glutamate-induced toxicity (Figure 3).
This is in stark contrast to Ignatov et al (2006) where a single dose of mCCL5
was neuroprotective. It would be expected that if mGPR75 activation were to
oppose the effect of oxidative stress, a significant increase in cell viability
would be observed with the mCCL5 concentrations used. A number of factors
could explain the lack of neuroprotection observed.
Firstly, it is worthwhile examining the capabilities of the experiment. Although
this study confirmed the expression of mGPR75 mRNA transcripts [1], cell
surface expression of mGPR75 in HT22 cells has not been undoubtedly
demonstrated, meaning mCCL5 may not have activated mGPR75. Cell
differentiation is another unknown factor that can alter gene regulation and
result in loss or down-regulation of cell surface expression. Given that HT22
cells were maintained at a sub-confluent density and that mGPR75
expression was demonstrated shortly prior to cell viability assays, it could be
considered unlikely that this factor explains these observations. Therefore, our
study could be considered robust with respect to mGPR75 transcript but not
cell surface expression.
Another explanation for the insignificant neuroprotection observed could be
that mGPR75 is expressed at low levels endogenously in HT22 cells and
consequently the pro-survival mechanisms activated by mCCL5 are
insufficient to prevent cell death. Differential mechanisms of amyloid-β and
glutamate toxicity may also explain the preferential protection against
amyloid-β toxicity. While both models involve increases in ROS, the
intracellular pathways leading to and from this outcome are different.
Consequently, amyloid-β toxicity results in apoptosis [30] whereas glutamate
toxicity results in features of both apoptosis and necrosis [31]. It is concluded
that mGPR75 does not provide significant protection from oxidative stress in
HT22 cells. However, demonstration of mGPR75 surface expression in HT22
cells is a necessary pre-requisite for confirming this conclusion.
However, perhaps the most important consideration is the physiological
relevance and reproducibility of previous reports regarding the
neuroprotective action of mGPR75 [1]. Here, no definition was made
regarding whether human or mouse CCL5 was used to induce
neuroprotection via mGPR75. CCL5 was obtained from Bachem (Weial am
Rein, Germany). Inspection of the chemokine ordering catalog displays
ordering information for only hCCL5 (http://www.bachem.co.uk). This means
that hCCL5 was the only form of CCL5 used in this paper. Demonstration of
mGPR75 activation through exogenous application of hCCL5 may have little
physiological relevance and further studies are required to determine if
mCCL5 can activate mGPR75.
The typical chemokine receptor features that may be present in hGPR75 were
then investigated. Transient transfection of L1.2 cells has been used
previously for functional chemokine receptor analyses such as chemotaxis,
chemokine radio-ligand binding affinity assays, receptor post-translational
modifications and receptor export to the plasma membrane [34-36]. Transient
transfection of hGPR75 into L1.2 cells was performed as a pre-requisite to
performing functional studies of the receptor (Figure 4). hGPR75 mean HA-
specific staining was significantly lower than CXCR3 and not significantly
different from empty pcNA3 transfections, leading to the conclusion that
hGPR75 was poorly expressed on the cell surface of L1.2 cells. Intracellular
trafficking events such as receptor export, endocytosis and degredation
regulate cell surface expression [37]. One explanation for poor cell surface
expression of hGPR75 could relate to the effect of the HA tag on these
factors. However, previous experiments have demonstrated cell surface
expression of HA-chemokine receptor recombinant proteins without
compromise of receptor export or integration into the cell membrane [34, 35].
It is therefore believed that these results are not likely a consequence of HA
tag interference with normal receptor trafficking.
hGPR75 contains a large C-terminus of 169 residues, compared with around
50 amino acids found in other chemokine receptors [24]. It was recently
shown that C-terminal di-leucine motifs (i.e. LLXXL) are important for
trafficking of several chemokine receptors such as CCR3 and CXCR2 to the
cell surface of L1.2 cells, aswell as the neuronal receptor 5-HT in renal
epithelial and African green monkey cells [35, 38]. Examination of the amino
acid sequence of hGPR75 reveals a C-terminus lacking di-leucine motifs,
providing a possible explanation for poor receptor membrane expression in
L1.2 cells and supporting the view that C-terminal di-leucine motifs are
important for chemokine receptor export to the cell surface. The full length
protein contains several N-glycoslyation sites. These sites are known to be
important for sorting and trafficking, stabilisation of protein conformations and
protection from degredation [39]. The extent of N-glycosylation and other
post-translational modifications of hGPR75 transcripts and its effect on cell
surface expression are unknown. It might be expected that hGPR75
expression is restricted to a subset of cells which also express the appropriate
intracellular machinery to export it to the cell surface.
These results provide supporting evidence that GPR75 is an atypical
chemokine receptor in terms of structure, function and expression [24].
Transient expression of hGPR75 into neuronal cell lines such as HT22 cells
[1] is more likely to result in membrane expression, and therefore a
mechanism with which to study potential chemokine binding kinetics and
chemotaxis. These investigations may benefit first from confocal microscopy
of permeabilised HA-GPR75 transfected L1.2 cells coupled to HA-antibody
staining, in order to determine the sub-cellular localisation of HA-GPR75
following transcription. Western blotting of HA-GPR75 leukocyte transfectants
may also provide insight into the extent of post-translational modifications of
the nascent protein and provide an explanation for the poor cell membrane
expression found in this study.
The view that mGPR75 may be endogenously neuroprotective from amyloid-β
toxicity [1] derives from potentially physiologically irrelevant data and in this
setting first needs to be re-examined using mCCL5 to activate mGPR75. This
study has shown that mGPR75 does not have a significant neuroprotective
role from oxidative stress in HT22 cells. However, the trend towards
significance seen with increasing concentrations of mCCL5 pre-treatment
(Figure 3) suggests that GPR75 may have some beneficial action in vivo.
This trend may only become significant with a higher number of independent
experiments.
There is strong evidence that mGPR75 activation can protect neuronal cells
from amyloid-β induced toxicity [1]. The neuroprotective role of GPR75 in vivo
may be best explored with GPR75 knock-out mice in an Alzheimer’s disease
mouse model. Additionally, identification of other endogenous ligands,
together with cell type expression analysis will provide an important basis with
which to derive further functional hypotheses.
Figures
A B
1kbp750bp
500bp
250bp
Figure 1. mGPR75 is the only mCCL5 receptor transcript expressed in HT22
cells. A. mCCL5 receptors CCR1, CCR3, CCR5 and GPR75 amplified from
mouse genomic DNA (+ lanes). PCR was performed without mouse genomic
DNA (- lanes) as a negative control. B. CCR1, CCR3, CCR5 and GPR75 in
HT22 cells by amplification of RT reactions. RT-PCR was performed without
the reverse transcriptase enzyme (- lanes) as a negative control.
O0
20
40
60
80
100
120
-3 -2 -1
log [glutamate] M
Cel
l vi
abil
ity
(% c
on
tro
l)
Figure 2. HT22 cell dose response curve to glutamate treatment. The IC50
concentration of glutamate was calculated as 5.9mM (logIC50= -2.27±0.07).
Cells were incubated with 0 (n=6), 1 (n=6), 3 (n=6), 5 (n=4), 7 (n=4), 10 (n=6),
15 (n=4) and 30mM (n=5) glutamate for 24 hrs. Cell viability was determined
by ATP-dependent luminescence. Results presented are the mean of n
independent experiments ± standard error.
Control 0 0.1 0.3 1 3 10 300
25
50
75
100
6mM Glutamate
*** ******
*** ***
[RANTES] nM
Cel
l vi
abil
ity
(% c
on
tro
l)
Figure 3. HT22 cell viability in response to incubation with increasing
concentrations of mCCL5 prior to glutamate treatment. Treatment with 6mM
glutamate for 24 hrs resulted in a significant reduction in cell viability
(p<0.001). Prior treatment with varying concentrations of mCCL5 (0 (n=7), 0.1
(n=5), 0.3 (n=5), 1 (n=7), 3 (n=7), 10 (n=2) and 30nM (n=2)) for 1hr had no
significant effect on cell viability after treatment with glutamate. Cell viability
was significantly lower than untreated controls after pre-treatment with 0.1-
3nM but not 10 and 30nM mCCL5. Cell viability is expressed as a mean
percentage of untreated controls. Significance was calculated by one-way
ANOVA with Bonferonni’s multiple comparisons test.
+
pT7T3D-Pacl
hGPR75
hGPR75
HA
pENTR/SD/D-TOPO
AttL1
KanR
AttR1ccdB
AmpR
pcDNA 3.2/V5-DEST
HA-GPR75pcDNA 3.2/V5-DEST
GPR75
HA
AttL1
GPR75
HA
HA-GPR75pENTR/SD/D-TOPO
KanR
AmpR
AttL2
Figure 4
AttL2
AttR2
PCR
pENTR/SD/D-TOPO
ccdB
1. Coupling hGPR75 to HA sequence
3. Cloning HA-GPR75 into the TOPO Destination Plasmid
2. Cloning HA-GPR75 into TOPO Entry Plasmid
Figure 4. Cloning human GPR75 into a TOPO expression vector using the
TOPO Gateway Cloning System. hGPR75 was first coupled to a sequence
encoding the HA tag by PCR. HA-GPR75 was then cloned into the
kanamycinR TOPO entry plasmid pENTR/SD/D-TOPO, leaving HA-GPR75
flanked by the AttL1 and AttL2 sites. HA-GPR75-pENTR was transformed into
Supercompetent E.coli, grown in kanamycin, and positive transformants
selected for culture in LB and kanamycin. After isolation of pHA-GPR75-
ENTR/SD/D-TOPO DNA, the LR Reaction was used to clone HA-GPR75 into
the ampicillinR TOPO destination vector pcDNA3.2/V5-DEST, which uses the
enzyme LR Clonase. LR Clonase cuts HA-GPR75 from the entry plasmid at
the AttL1 and AttL1 sites and recombines into the AttR1 and AttR2 sites of the
destination plasmid, replacing the toxic counter selection gene ccdB. This also
creates a pENTR/SD/D-TOPO plasmid containing the ccdB gene. The
recombinant reaction mixture was transformed into Supercompetent E.coli
and transformants selected from an ampicillin agar plate for growth in LB and
ampicillin. E.coli harbouring the pENTR/SD/D-TOPO with ccdB gene die. HA-
GPR75-pcDNA3.2/V5-DEST DNA was isolated and used in subsequent
transfections.
pcDNA3 control
HA-GPR75
HA-CXCR3
21.1 15.75 8.75
14.51 18.98 11.16
42.47 41.45 39.51
IgG1HACounts
Experiment 1 Experiment 2 Experiment 3
FLH-1
Figure 5. Flow cytometry analysis of protein cell surface expression in L1.2
cells following transfection with pcDNA3, HA-GPR75-pcDNA3.2/V5-DEST or
HA-CXCR3-pcDNA3 DNA (rows labelled right-hand side). Fluorescence
(FLH-1, x-axis) is plotted against cell count (y-axis). Comparison of HA-
specific staining (inset top right) in HA-GPR75 transfections with empty
pcDNA3 (negative control) and HA-CXCR3 (positive control) tranfections
suggests that HA-GPR75 was poorly expressed on the cell surface of L1.2
cells. Cells were stained with FITC-conjugated mouse anti-goat F(AbI)2
secondary antibody following either HA or IgG1 isotype control primary MAbs
staining. HA-specific staining was calculated by subtracting the mean
fluorescence of IgG1 MAb stained cells (purple area) from the mean
fluorescence of HA MAb stained cells (green line).
Figure 6. Relative surface expression of HA-GPR75, compared with negative
empty pcDNA3 and positive HA-CXCR3 controls, in transfected L1.2 cells.
HA-GPR75 cell surface expression was not significantly higher than pcDNA3-
transfected cells, as measured by mean HA-specific staining. Both pcDNA3
and HA-GPR75 cell surface expression was significantly lower (p<0.001) than
HA-CXCR3 transfected cells. Cells were stained with anti-HA or IgG1 isotype
control MAb primary antibodies. The fluorescent FITC-conjugated goat F(ab')2
anti-mouse secondary antibody was used to calculate HA-specific staining, by
subtracting the mean FLH-1 fluorescence of HA stained cells from the mean
FLH-1 fluorescence of IgG1 stained cells. Data are expressed as mean
fluorescence ± standard error of 3 independent experiments. Statistical
analysis was carried out using one-way ANOVA with Bonferroni’s multiple
comparisons test.
pcDNA3 HA-GPR75 HA-CXCR30
5
10
15
20
25
30
35
40
45
*** ***
HA
-sp
ec
ific
flu
ore
sc
ence
Table 1. Oligonucleotide forward (F) and reverse primer (R) pairs used for
amplification of murine CCR1, CCR3, CCR5, GPR75 (upper) and
hGPR75 (lower). The size of the DNA fragment amplified is
indicated.
Gene (mouse) Sequence 5' to 3' Size bpCCR1 F AGCCTACCCCACAACTACAGAA 546CCR1 R CTTGTAGGGGAAATGAGGGCTACCR3 F ATGGCATTCAACACAGATG 287CCR3 R AATCCAGAATGGGACAGTGCCR5 F GGATTTTCAAGGGTCAGTTC 523CCR5 R AACCTTCTTTCTGAGATCTGGGPR75 F ACCTTGGTGACCTGCACTTT 620GPR75 R CTGTGGTCTGGAAGCATCAA
Gene (human)GPR75 F CACCATGTATCCATATGATGTCCCAGA- 1620
TTATGCCAACTCAACAGGCCACCTTCAGPR75 R TTAAACGGAGGGGACTGGAATC
References
1 Ignatov, A., Robert, J., Gregory-Evans, C. and Schaller, H. C. (2006)
CCL5 stimulates Ca2+ mobilization and inositol trisphosphate (IP3)
formation in cells transfected with G protein-coupled receptor 75. Br J
Pharmacol 149: 490-7
2 Charo, I. F. and Ransohoff, R. M. (2006) The many roles of
chemokines and chemokine receptors in inflammation. N Engl J Med
354: 610-21
3 Cartier, L., Hartley, O., Dubois-Dauphin, M. and Krause, K. H. (2005)
Chemokine receptors in the central nervous system: role in brain
inflammation and neurodegenerative diseases. Brain Res Brain Res
Rev 48: 16-42
4 He, J., Chen, Y., Farzan, M., Choe, H., Ohagen, A., Gartner, S.,
Busciglio, J., Yang, X., Hofmann, W., Newman, W., Mackay, C. R.,
Sodroski, J. and Gabuzda, D. (1997) CCR3 and CCR5 are co-
receptors for HIV-1 infection of microglia. Nature 385: 645-9
5 Lu, M., Grove, E. A. and Miller, R. J. (2002) Abnormal development of
the hippocampal dentate gyrus in mice lacking the CXCR4 chemokine
receptor. Proc Natl Acad Sci U S A 99: 7090-5
6 Bakhiet, M., Tjernlund, A., Mousa, A., Gad, A., Stromblad, S., Kuziel,
W. A., Seiger, A. and Andersson, J. (2001) CCL5 promotes growth and
survival of human first-trimester forebrain astrocytes. Nat Cell Biol 3:
150-7
7 Giovannelli, A., Limatola, C., Ragozzino, D., Mileo, A. M., Ruggieri, A.,
Ciotti, M. T., Mercanti, D., Santoni, A. and Eusebi, F. (1998) CXC
chemokines interleukin-8 (IL-8) and growth-related gene product alpha
(GROalpha) modulate Purkinje neuron activity in mouse cerebellum. J
Neuroimmunol 92: 122-32
8 Hamann, I., Zipp, F. and Infante-Duarte, C. (2008) Therapeutic
targeting of chemokine signaling in Multiple Sclerosis. J Neurol Sci
274: 31-8
9 Tani, M. and Ransohoff, R. M. (1994) Do chemokines mediate
inflammatory cell invasion of the central nervous system parenchyma?
Brain Pathol 4: 135-43
10 Tripathy, D., Thirumangalakudi, L., Grammas, P. (2010) RANTES
upregulation in the Alzheimer's disease brain: a possible
neuroprotective role. Neurobiol Aging 31: 8-16
11 Simpson, J., Rezaie, P., Newcombe, J., Cuzner, M. L., Male, D. and
Woodroofe, M. N. (2000) Expression of the beta-chemokine receptors
CCR2, CCR3 and CCR5 in multiple sclerosis central nervous system
tissue. J Neuroimmunol 108: 192-200
12 Rottman, J. B., Slavin, A. J., Silva, R., Weiner, H. L., Gerard, C. G. and
Hancock, W. W. (2000) Leukocyte recruitment during onset of
experimental allergic encephalomyelitis is CCR1 dependent. Eur J
Immunol 30: 2372-7
13 Karpus, W. J. and Kennedy, K. J. (1997) MIP-1alpha and MCP-1
differentially regulate acute and relapsing autoimmune
encephalomyelitis as well as Th1/Th2 lymphocyte differentiation. J
Leukoc Biol 62: 681-7
14 Selkoe, D. J. (1996) Amyloid beta-protein and the genetics of
Alzheimer's disease. J Biol Chem 271: 18295-8
15 McGeer, P. L., Itagaki, S., Tago, H. and McGeer, E. G. (1987) Reactive
microglia in patients with senile dementia of the Alzheimer type are
positive for the histocompatibility glycoprotein HLA-DR. Neurosci Lett
79: 195-200
16 Frisoni, G. B., Fox, N. C., Jack, C. R., Jr., Scheltens, P. and
Thompson, P. M. (2010) The clinical use of structural MRI in Alzheimer
disease. Nat Rev Neurol 6: 67-77
17 Xia, M. Q., Qin, S. X., Wu, L. J., Mackay, C. R. and Hyman, B. T.
(1998) Immunohistochemical study of the beta-chemokine receptors
CCR3 and CCR5 and their ligands in normal and Alzheimer's disease
brains. Am J Pathol 153: 31-7
18 Smits, H. A., Rijsmus, A., van Loon, J. H., Wat, J. W., Verhoef, J.,
Boven, L. A. and Nottet, H. S. (2002) Amyloid-beta-induced chemokine
production in primary human macrophages and astrocytes. J
Neuroimmunol 127: 160-8
19 Johnstone, M., Gearing, A. J. and Miller, K. M. (1999) A central role for
astrocytes in the inflammatory response to beta-amyloid; chemokines,
cytokines and reactive oxygen species are produced. J Neuroimmunol
93: 182-93
20 Tripathy, D., Thirumangalakudi, L. and Grammas, P. (2010) RANTES
upregulation in the Alzheimer's disease brain: a possible
neuroprotective role. Neurobiol Aging 31: 8-16
21 Kerschensteiner, M., Stadelmann, C., Dechant, G., Wekerle, H. and
Hohlfeld, R. (2003) Neurotrophic cross-talk between the nervous and
immune systems: implications for neurological diseases. Ann Neurol
53: 292-304
22 Orellana, D. I., Quintanilla, R. A. and Maccioni, R. B. (2007)
Neuroprotective effect of TNFalpha against the beta-amyloid
neurotoxicity mediated by CDK5 kinase. Biochim Biophys Acta 1773:
254-63
23 Tarttelin, E. E., Kirschner, L. S., Bellingham, J., Baffi, J., Taymans, S.
E., Gregory-Evans, K., Csaky, K., Stratakis, C. A. and Gregory-Evans,
C. Y. (1999) Cloning and characterization of a novel orphan G-protein-
coupled receptor localized to human chromosome 2p16. Biochem
Biophys Res Commun 260: 174-80
24 Pease, J. E. (2006) Tails of the unexpected - an atypical receptor for
the chemokine CCL5/CCL5 expressed in brain. Br J Pharmacol 149:
460-2
25 Viola, A. and Luster, A. D. (2008) Chemokines and their receptors:
drug targets in immunity and inflammation. Annu Rev Pharmacol
Toxicol 48: 171-97
26 Sauer, C. G., White, K., Stohr, H., Grimm, T., Hutchinson, A.,
Bernstein, P. S., Lewis, R. A., Simonelli, F., Pauleikhoff, D., Allikmets,
R. and Weber, B. H. (2001) Evaluation of the G protein coupled
receptor-75 (GPR75) in age related macular degeneration. Br J
Ophthalmol 85: 969-75
27 Field, J., Nikawa, J., Broek, D., MacDonald, B., Rodgers, L., Wilson, I.
A., Lerner, R. A. and Wigler, M. (1988) Purification of a RAS-
responsive adenylyl cyclase complex from Saccharomyces cerevisiae
by use of an epitope addition method. Mol Cell Biol 8: 2159-65
28 Vaidehi, N., Pease, J. E. and Horuk, R. (2009) Modeling small
molecule-compound binding to G-protein-coupled receptors. Methods
Enzymol 460: 263-88
29 Maher, P. (2001) How protein kinase C activation protects nerve cells
from oxidative stress-induced cell death. J Neurosci 21: 2929-38
30 Varadarajan, S., Kanski, J., Aksenova, M., Lauderback, C. and
Butterfield, D. A. (2001) Different mechanisms of oxidative stress and
neurotoxicity for Alzheimer's A beta(1--42) and A beta(25--35). J Am
Chem Soc 123: 5625-31
31 Tan, S., Wood, M. and Maher, P. (1998) Oxidative stress induces a
form of programmed cell death with characteristics of both apoptosis
and necrosis in neuronal cells. J Neurochem 71: 95-105
32 Maher, P. and Davis, J. B. (1996) The role of monoamine metabolism
in oxidative glutamate toxicity. J Neurosci 16: 6394-401
33 Greene, J. G. and Greenamyre, J. T. (1995) Exacerbation of NMDA,
AMPA, and L-glutamate excitotoxicity by the succinate dehydrogenase
inhibitor malonate. J Neurochem 64: 2332-8
34 Wise, E. L., Duchesnes, C., da Fonseca, P. C., Allen, R. A., Williams,
T. J. and Pease, J. E. (2007) Small molecule receptor agonists and
antagonists of CCR3 provide insight into mechanisms of chemokine
receptor activation. J Biol Chem 282: 27935-43
35 Wise, E. L., Bonner, K. T., Williams, T. J. and Pease, J. E. (2010) A
single nucleotide polymorphism in the CCR3 gene ablates receptor
export to the plasma membrane. J Allergy Clin Immunol 126: 150-7 e2
36 Mueller, A., Meiser, A., McDonagh, E. M., Fox, J. M., Petit, S. J.,
Xanthou, G., Williams, T. J. and Pease, J. E. (2008) CXCL4-induced
migration of activated T lymphocytes is mediated by the chemokine
receptor CXCR3. J Leukoc Biol 83: 875-82
37 Dong, C., Filipeanu, C. M., Duvernay, M. T. and Wu, G. (2007)
Regulation of G protein-coupled receptor export trafficking. Biochim
Biophys Acta 1768: 853-70
38 Carrel, D., Hamon, M. and Darmon, M. (2006) Role of the C-terminal
di-leucine motif of 5-HT1A and 5-HT1B serotonin receptors in plasma
membrane targeting. J Cell Sci 119: 4276-84
39 Hanisch, F. G. and Breloy, I. (2009) Protein-specific glycosylation:
signal patches and cis-controlling peptidic elements. Biol Chem 390:
619-26
40 Grammas, P. and Ovase, R. (2001) Inflammatory factors are elevated
in brain microvessels in Alzheimer's disease. Neurobiol Aging 22: 837-
42
41 Yates, S. L., Burgess, L. H., Kocsis-Angle, J., Antal, J. M., Dority, M.
D., Embury, P. B., Piotrkowski, A. M. and Brunden, K. R. (2000)
Amyloid beta and amylin fibrils induce increases in proinflammatory
cytokine and chemokine production by THP-1 cells and murine
microglia. J Neurochem 74: 1017-25
42 Tripathy, D., Thirumangalakudi, L. and Grammas, P. (2007) Expression
of macrophage inflammatory protein 1-alpha is elevated in Alzheimer's
vessels and is regulated by oxidative stress. J Alzheimers Dis 11: 447-
55
43 Wyss-Coray, T. (2006) Inflammation in Alzheimer disease: driving
force, bystander or beneficial response? Nat Med 12: 1005-15
44 Kozak, M. (1991) An analysis of vertebrate mRNA sequences:
intimations of translational control J Cell Biol 115:887-903
45 Behl, C., Davis, J. B., Lesley, R., Schubert, D. (1994) Hydrogen
peroxide mediates amyloid beta protein toxicity. Cell 77:817-27
46 Maher, P. (2005) The effects of stress and aging on glutathione
metabolism. Ageing Research Reviews 4:288-314
47 Lin, M.T., Beal, M.F. (2006) Mitochondrial dysfunction and oxidative
stress in neurodegenerative diseases. Nature 443:787-95