THE JOURNAL OF BIOLOGICAL CHEMISTRY Vol. 269, No. 16, Issue of April 22, pp. 12269-12276, 1994 0 1994 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in U.S.A.

Amphibian Allantoinase MOLECULAR CLONING, TISSUE DISTRIBUTION, AND FUNCTIONAL EXPRESSION*

(Received for publication, December 29, 1993, and in revised form, February 17, 1994)

Sueko Hayashi, Sanjay Jain, Ruiyin Chu, Keith Alvares, Bin Xu, Frank Erfurth, Nobuteru Usuda, M. Sambasiva Rao, Shweta K. Reddy, Tomoo NoguchiS, Janardan K. Reddy, and Anjana V. Yeldandis From the Department of Pathology, Northwestern University Medical School, Chicago, Illinois 60611 and the Wepartment of Biochemistry, Kyushu Dental College, Kokura, Kitakyushu 803, Japan

The chain of enzymes necessary to convert uric acid to its metabolic products urea and glyoxylic acid in verte- brates is truncated through the successive loss of allan- toicase, allantoinase, and urate oxidase during phyloge- netic evolution. Previous studies have assigned the localization of both urate oxidase and allantoinase to the peroxisome in the amphibian liver. This study re- ports the cloning of a cDNA encoding bullfrog (Rana catesbeiana) allantoinase, an enzyme that converts al- lantoin to allantoic acid. The cDNA is 2112 base pairs in length containing a 1449-base pair open reading frame which corresponds to a 483-residue protein (53,296 Da). Structural analysis of the deduced protein suggested two potential transmembrane segments and the pres- ence of a putative mitochondrial localization sequence in the amino terminus. Immunocytochemical analysis revealed that allantoinase is localized to mitochondria and not to peroxisomes. On Northern blotting, a single mRNA species was detected in the liver and kidney of frog but not in other tissues; this distribution was con- firmed by immunoblotting. The hepatic- and renal- spe- cific expression of allantoinase coincides with the dis- tribution of urate oxidase in these tissues in the frog. The allantoinase expressed in Saccharomyces cereuisiae and in Spodoptera frugiperda (Sf9) insect cells exhibits catalytic activity and is antigenically identical to the native frog enzyme.

The degradation of purines to uric acid is common to all vertebrates; however, the catabolism of uric acid vanes from species to species (1). Urate oxidase (EC 1.7.3.31, a peroxisomal enzyme that catalyzes the oxidation of uric acid to allantoin, occupies a pivotal position in the chain of enzymes responsible for the metabolism of purines (1, 2). Hydrolysis of allantoin by allantoinase (EC 3.5.2.5) results in the formation of allantoic acid for further metabolism by allantoicase (EC 3.5.3.4) to yield urea and glyoxylic acid (1 ,3) . The chain of these three enzymes responsible for the conversion of uric acid to urea, has become progressively truncated during evolution due to successive loss of allantoicase, allantoinase, and urate oxidase (1). Most mam- mals, with the exception of human and certain hominoid pri-

R37 GM23750 and by the Joseph L. Mayberry Sr. Endowment Fund. * This work was supported by National Institutes of Health Grant

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

to the GenBankrM/EMBL Data Bank with accession number(s) U03471. The nucleotide sequence(s) reported in this paper has been submitted

Northwestern University Medical School, 303 E. Chicago Ave., Chicago, 5 To whom correspondence should be addressed: Dept. of Pathology,

IL 60611. Tel.: 312-503-8144; Fax: 312-503-8240.

mates, possess urate oxidase in their livers ( 2 , 4 , 5 ) and excrete allantoin as the end product of purine metabolism, as these animals have lost allantoinase and allantoicase during phylo- genetic evolution (1). The loss of urate oxidase activity in hu- mans and hominoid primates, such as chimpanzee, gorilla, and orangutan, due to nonsense mutations in their urate oxidase gene, results in the excretion of uric acid as the end product of purine metabolism (1, 6, 7). In amphibia and fish, the degra- dation of uric acid proceeds all the way to urea and glyoxylate due to the presence of all three enzymes, namely urate oxidase, allantoinase, and allantoicase, in their livers (1, 3).

In the rat, and in most other animals that have urate oxidase activity, the enzyme is associated with the crystalloid or semi- dense inclusion present within the peroxisomes in hepatic pa- renchymal cells (5, 8). Allantoin generated in peroxisomes in mammalian hepatocytes is excreted in urine, but the mecha- nism of allantoin transport out of the peroxisome remains un- clear. The presence of all three enzymes of uric acid catabolism in fish and amphibian liver led to studies on their subcellular distribution (3). In marine fish liver density gradient centrifu- gation data suggested that urate oxidase, allantoinase, and allantoicase are associated with peroxisomes (9). In the am- phibian liver, urate oxidase and allantoinase have also been found in peroxisomal fractions (3). Since allantoinase and al- lantoicase are co-purifiable from frog liver, it was suggested that these two enzyme activities are located in the same protein or that allantoinase and allantoicase form a complex in vivo (10, ll), thus implying their localization within the same sub- cellular compartment.

Molecular analysis of the genes encoding urate oxidase, al- lantoinase, and allantoicase is an essential step in our attempts to elucidate the biological properties of these enzymes, as well as the genetic events that resulted in their progressive extinc- tion during vertebrate evolution (5-7, 12, 13). We and others have shown that the loss of urate oxidase activity in man and hominoid primates is due to nonsense mutations in the gene encoding this protein (6, 7). In this report, we provide the first characterization of amphibian allantoinase cDNA, including the predicted amino acid sequence and the functional expres- sion of the cloned gene in both the baculovirus insect cell sys- tem and yeast.

EXPERIMENTAL PROCEDURES General Methods-Total RNAfrom different frog tissues was isolated

using a single-step acid guanidinium thiocyanate-phenol-chloroform ex- traction procedure according to Chomczynski and Sacchi (14). Frog liver total RNA was prepared as described by Schoenberg et al. (15). The standard reaction mixture for all PCR' experiments was 10 Trig-

RACE, rapid amplification of cDNA ends; RT, reverse transcription; bp, The abbreviations used are: PCR, (DNA) polymerase chain reaction;

base pair(s); kb, kilobase(s); PAGE, polyacrylamide gel electrophoresis; SEI, S. frugiperda insect cells; Ni-NTA, nickel-nitrilo-triacetic acid.

12269

12270 Frog Allantoinase cDNA Cloning and Expression

0 500 1000 1500 2000 I base pairs

rALN

FIG. 1. Schematic representation of frog allantoinase cDNA clones. The cDNA clones rlALN and xALN were obtained from screening hgtll R. catesbeiana and AZAPXenopus liver cDNA libraries, respectively. 5' RACE and 3' RACE represent R. catesbeiana cDNA clones derived by RACE-PCR for 5' and 3' ends, respectively, with allantoinase-specific primers. rALN is a composite cDNA clone of R. catesbeiana allantoinase, and ALN,,, is the full-length coding sequence with 6 histidine residues (solid bar) used for expression studies. The allantoinase coding region is indicated by the stippled bar, and the open bar indicates untranslated regions. Relevant restriction sites are indicated. A scale in base pairs is .. shown at the top.

HCl, pH 7.6, 50 m~ KCI, 1.5 m~ MgCl,, 50 p dNTPs, and 2.5 units of Ampli-Taq" DNApolymerase (Perkin-Elmer Corp.) in a total volume of 100 pl. All PCR reactions were hot-started at 72 "C with Taq po- lymerase after one cycle of denaturation at 95 "C for 5 min. 5' and 3' RACE-PCR products specific for allantoinase, confirmed by Southern blotting (16), were purified by electroelution from 0.8% agarose gels and cloned in pGEM-T vector by using pGEM-T Vector Systems kit (Pro- mega). Atleast three independent positive clones from both 5' and 3' RACE-PCR were sequenced in both directions using dideoxy chain ter- mination method (17) to rule out PCR amplification errors.

Construction and Screening of Frog Liver cDNA Library-Bullfrog (Rana catesbeiana) liver cDNA library in hgtll was constructed and screened with frog ALN antibodies (10). A 1.5-kb cDNA clone (rlALN) was obtained. The open reading frame of this clone revealed that it was missing the 5' end of the coding region and part of the 3'-untranslated region. Several attempts to obtain overlapping clones from the R. cates- beiana hgtll liver cDNA library were unsuccessful. We then screened a Xenopus liver cDNAlibrary (151, cloned in A Z A P (generously donated by Dr. Daniel R. Schoenberg), with the 1.5-kb ALN cDNA isolated from the hgt l l library and obtained several clones. These were sequenced but none yielded significant additional sequence data. It was then decided to undertake 5' and 3' RACE-PCR (18), using the total liver RNA isolated from R. catesbeiana.

5' RACE-PCR Protocol-The core reagents used were from the 5' RACE system kit (Life Technologies, Inc.). Frog liver total RNA (10 pg) was reverse transcribed using an anti-sense primer, ALN VI1 (5'-GT- CATCTGGGCGAGAGT-3'), from the 1.5-kb cDNA clone. cDNA synthe- sis was done in a final volume of 20 pl. First, total RNA was denatured along with 1 pmol of the primer in a volume of 13 pl a t 70 "C for 5 min. The reaction was kept on ice for 2 min, and the contents were then briefly spun in the microcentrifuge. Then 7 pl of a reaction mix was added such that the final reaction contained 0.5 mM dNTPs, 10 m~ dithiothreitol, 200 units of SuperScript RT, 40 units of rRNAsin (Pro- mega), and 1 x synthesis buffer. The reaction was incubated at 42 "C for 60 min. At this point remaining RNA was digested with 1.5 units of RNase H a t 37 "C for 10 min, and then the RNase and RT were heat- denatured at 70 "C for 10 min. The contents were collected by brief centrifugation and were either kept on ice for further processing or stored at -20 "C.

The product of the reverse transcribed cDNA was purified to remove primers (Magic PCR Preps, Promega), and then 16 pl of the eluate was tailed with dCTP according to the manufacturer's instructions (Life Technologies, Inc.). First round of PCR was carried out with 5 p1 of tailed cDNA using a poly(G1) anchor primer (Life Technologies, Inc.) and a nested anti-sense primer, ALN-GSP1(5'-TGC'M'GTAGCATAGG- TATCAG-3'). Thermal cycler conditions were: 95 "C, 1 min; 50 "C, 1 min; 72 "C, 2 min (auto-extension 3 s ) , for 35 cycles, and then 1 cycle a t 72 "C for 10 min. The products from the first round were reamplified at an annealing temperature of 53 "C using the nested universal amplifi- cation primer, UAP (Life Technologies, Inc.) and the anti-sense primer

ALN-GSPP has the manufacturer's UDG cloning site at the 5' end. The second round PCR products were purified to remove primers and were further re-amplified at an annealing temperature of 56 "C with the primers JKR 5 (5'-CGCCACGCGTCGACTAGTACGGGIIGG- GIIG-3') and ALN-GSP2. A 300-bp product was obtained, which was detectable on Southern blots using the 1.5-kb ALN cDNA fragment obtained from the library screening as probe. The positive band was purified and cloned as explained above.

3' RACE-PCR Protocol-The cDNA synthesis strategy was the same

ALN-GSP2 (5'-CUACUACUACUAAGCCACCAGGTAAAATACATC-3').

as for the 5' RACE method except that the adapter primer, AP (Life Technologies, Inc.) was used to synthesize the cDNA. Thermal cycler conditions were the same as those of the 5' RACE-PCR for all the PCR rounds. For the first round of PCR, we used ALN IV (5"GGGATCACT- GCTATTGTAG-3') and AP. The second round of the PCR was done with SJ1 (5'-CUACUACUACUAGTCGACGTAAAGGAGCCATTAAAGCCAWAAAGTGG- 3') and UAP (Life Technologies, Inc.). SJ1 has a UDG cloning site and a Sal1 linker at the 5' end. The third round ofthe PCR was with SJ1 and O L E 8 (5'-GGCCACGCGTCGACTAGTAC-3'). OL158 is a nested primer in AP to increase the PCR specificity. A 600-bp product was obtained that was detectable on Southern blots (16) using the 1.5-kb ALN cDNA fragment. The positive band was purified and cloned as explained above.

Purification of Frog Liver Allantoinase and Sequence Analysis of a Peptide-Allantoinase was purified from bullfrog liver as previously described (10). The purified protein was run on a 10% SDS-PAGE and stained with Coomassie Brilliant Blue R-250 for 10 min and destained with 50% methanol, 7% acetic acid for 30 min. The band corresponding to ALN was cut from the gel and electroeluted according to Hunkapiller et al., (19). The protein was precipitated with methanol and washed with methanol four times to remove as much of the Coomassie stain as possible. The protein was then run on a 10% SDS-PAGE and electro- phoretically transferred to nitrocellulose (20). The filter was stained with Ponceau Red for 90 s and washed with 1% acetic acid for 90 s. The band corresponding to allantoinase was cut, transferred to an Eppen- dorf tube, and washed with 1 ml of HPLC-grade water. The water was removed, and the damp blot was frozen immediately and left at -70 "C. The trypsin digest of the cut bands was separated by reverse phase high performance liquid chromatography (William S. Lane, Harvard Micro- chemistry Facility, The Biological Laboratories, Harvard IJniversity) and the amino acid sequence analysis of peptide ALN-NT36 was per- formed with an Applied Biosystems model 477AProtein Sequencer with model 120A Online PTH-AA Analyzer (Applied Biosystems).

Strategy to Obtain Full-Length Allantoinase,H,,-The cDNA made using the AP as explained above in the 3' RACE section was amplified using the PCR with sense primer SJ5 (5'-GCTCTAGAGCTTGGTGG- ATCCAGACTGTGC-3') and antisense primer SJ7 (5"TCCCCCGGGG-

The primer SJ5 has an adapter for the restriction enzyme XbaI at the 5' end, and the primer SJ7 is made such that it inserts six histidine codons before the translation stop codon. It also has an adapter for SmaI at the 3' end. Thermal cycler annealing temperature was 58 "C, and other PCR conditions were the same as described above. A 1.6-kb PCR product was obtained which was cloned into the pGEM-T vector as described above to give pGEM-TALN,,,,, and sequenced.

Expression of Allantoinase(H!,, in the Yeast Saccharomyces cere- uisiae-The full-length allantomase,,,,, fragment was excised from pGEM-TALN,,,,, with the restriction enzymes XbaI and SmaI and li- gated into the XbaI and SmaI sites of the Escherichia coli-yeast shuttle vector pYPGE15 (gift from Richard Gaber, Northwestern Uni- versity) to obtain pYF'GE15ALN,,,,,. JM109 bacterial cells were trans- formed with this recombinant plasmid, and transformants were se- lected on ampicillin plates. The vector DNA was isolated using standard protocols, and the orientation of the insert was reconfirmed by restriction mapping. A small volume (50 pl) of yeast A303 (Mata,ura3-52,trplPl,his3AZOO,leu2Al; gift from Richard Gaber, Northwestern University) competent cells were transformed with 0.8 ng of pYPGE15ALN,,,,, by electroporation (Electro Cell manipulator 600, BTX electroporation system; resistance = 2.5 kV, charging voltage = 1.5 kV, resistance timing = 1291, and 100 pl of the reaction solution

GATTAGTGGTGGTGGTGGTGGTGGATATGTGGTAGGl'TC'M'CC-3').

Frog Allantoinase cDNA Cloning and Expression

-63 ACATAGAGAAGACTAGAAGAAGATWGCCGIT

~ G G A T C C A G A C T G T G C A G T G A C A A C A C A A T 0 G C T T n : A A A ~ A A A C C A G G A A T A A T G A A T A T C A C A C C G M M

GGA~APGATAPGTGTCATTCGAPGTAPGPGAGTCATACPGGCCAATACTATATCTTCCTGTGATATAA?T V I Q A N T I S S C D I I

A ? T P G T G A T G G C A P G A T T P G C P G T G T C C T C G C A W G G A A A A C A T ~ A C C P G T G G A G C C A P G T n ; ~ G A T I S D G K I S S V L A W G K H V T S G A K L L D

12271

GTA GGG GAC CX; GTG GTC A X GCX GGC ATC ATT GAC CCT CAT GTA CAT GTC AAC GPG CCT GGA CGC ACA GAC V G D L V V M A G I I D P H V H V N E , P G R T D

r r X ; G p G G G c T A C a ; G A C T G C C A C A c ? T ; ~ G ( L T G c T G G A G G G A T c A C T ~ A T T G T A G A T A ~ ~ C m I I A c W E G Y R T A T L A A A G G I T A I V D M P L N

p G c C X ; c ( 3 T C C C A C C A C A ~ G T A A c C A A T T M : C A C A c C A P G c K : c p G ~ G C T A P G P G A c p G r r X : T A T G n : S L P P T T S V T N F H T K L Q A A K R Q C Y V

G A T G T A G C A T I T T M : G G T G G T G T C A T T ~ G A T A A T C F G ~ G A A c r C , A T A C C T A ~ C m C A A ~ C n ~ D V A F W G G V I P D N Q V E L I P M L Q A G V

GCTGGATM:AAATGTTM:C?TATAAACPETGGAGn;C(IAGPr:mcerCATGTCAGP~~GATCTACAC A G F K C F L I N S G V P E F P H V S V T D L H

A C A G C C A T G T C C G A A ? T A C A A G G A A C C A A C F G I G I T C T A C T G m C A T c c a G A A ~ G A A A T A G C A A A A C C T T A M S E L Q G T N S V L L F H A E L E I A K P

G C C C C A G P G A T T G G A G A T T C C A C A C ? T T A T C A A A C A T I T T n : G A C T c r a ; c c c A G A T G A C A T G G A A A ? T G C T A P E I G D S T L Y Q T F L D S R P D D M E I A

G ( a G I 1 3 c A A c ? T ; G n : G C T G A T c 1 T T G T c A A c A G T A C A A A G T A ~ T G T C A C A I T G T A C A C C n ; T c A T c A ~ A V Q L V A D L C Q Q Y K V R C H I V H L S S A

c A A ~ C X ; A c C A T A A T c P G A A A A G C A A p d ; G F G G C C G G A G C C c c C C X ; A C T G T A G p G A c c A c r r ~ C A T T A C Q S L T I I R K A K E A G A P L T V E T T H H Y

C T A T C C c r C , p d ; c ~ G p G C A C A ? T C C C ~ G G T G C C A C G T A C ? T C A A A T G C T G C c C t C C T G n ; P G A G G C C A T L S L S S E H I P P G A T Y F K C C P P V R G H

~ A A C A p G G A A G c T c 1 T T G G A A T G C A c l r ~ ~ G G C C A T A T A G A C A T C ~ G ~ ~ G R c C A T T c A C C A R N K E A L W N A L L Q G H I D M V V S D H S P

~ A C A C C A G A C C T C A P G ~ C T A A A A G P G G G A G A T T A c A X ~ G C C T M : G G A G G A A T T T C T T ( a C T A c p G C T P D L K L L K E G D Y M K A W G G I S S L Q

m G G A c r C , C C T C ? T ~ T G G A c C ~ G C A P d ; A A C C G a ; G G C ~ T C T ? T G A C T G A T G I T T C C C P G T n ; ? T G F G L P L F W T S A R T R G F S L T D V S O L L

P G C ~ A A T A C G G C C A A A C X ; T G C G G C ~ G G C A T C G T A A P G G P G C C A ? T A A P G T M ; ~ A ~ A A T G C I C A T T S S N T A K L C G L G I V K E P L K W V M M L I

TGGTCATCTGGGATCCTGACAAPGPEirT1Y:ACGn;cAPGAAAATCATATM:ATCACAPGAATAPGCTCACCC W S S G I L T K S F R C K K M I F I T R I S S P

C A T A T C T G G G A T T C C ? T C ? T C A P G G A A A P G T C A T M : C T A C T C ~ ? T C G P G G G A C T C ? T G ~ A ? T T C A A P G H I W D S F F K E K S W L L L F E G L L F I S K

-31

42 14

114 38

186 62

258 86

330 110

402 134

474 158

546 182

618 206

690 230

762 254

278 834

302 906

978 326

1050 350

1122 374

1194 390

1266 422

1338 446

1410 470

1491 403

1586 1681 1776

1966 1871

2049

FIG. 2. Nucleotide and deduced amino acid sequence of frog allantoinase. The positive numbers of nucleotide sequence start at the first ATG codon; negative numbers are used for residues in the 5'-untranslated region. The deduced amino acid residues for the single open reading frame are numbered starting with the first methionine. The in-frame termination codon TAG upstream of the initiation codon, the initiation codon ATG, the termination codon TAA and the putative polyadenylation signal sequence ATl'AAA are shown in boldface. Double underlining indicates the residues in the putative mitochondrial presequence. Peptide sequence confirmed by Edman degradation analysis of allantoinase is underlined.

was plated on URA(-) plates. Positive colonies were used to inoculate URA-deficient media. We also tested the untransfected parent A303 strain on W D media as a negative control. Homogenates were made from cultures in exponential phase (1 x 10' cells) by homogenization with 425-600-pm glass beads (21) in Laemmli buffer (22) and analyzed by immunoblotting (20). The homogenates were also assayed for allan- toinase activity as described below.

Expression of Allantoinase in Insect Cells-The full-length allanto- inase fragment was obtained from pGEM-TALN,,,,, using XbaI and SmaI and cloned into the XbaI and SmaI sites of the baculovirus trans- fer vector PVL1392 (Invitrogen) and used to generate a recombinant virus. The resultant virus stock was used to infect S. frugiperda (SEI) insect cells and the recombinant allantoinase expressed under the con- trol of the polyhedrin promoter (23). The infected St9 cells were used for enzyme assay and for the purification of allantoinase on a Ni-NTA affinity column. Allantoinase activity was assayed as described previ- ously (10). A unit of enzyme activity is defined as the amount of enzyme that catalyzes a formation of product of 1 pmoUmin at 37 OC.

Northern Blot Hybridization Analysis of Allantoinase Sequences-

Total RNA was isolated from frog tissues by the guanidinium thiocya- nate method (14, 151, glyoxylated and electrophoresed on a 1% agarose slab gel, and transferred to a nylon filter for blot-hybridization analysis. Blots were hybridized with a frog allantoinase cDNA probe (rlALN).

immunoblotting-SDS-PAGE was carried on 10% gels at a constant current of 70 mAat 15 "C and transferred onto nitrocellulose membrane (Sigma) using a semidry transfer apparatus (Bio-Rad). After blocking with 5% nonfat dry milk powder in phosphate-buffered saline (Blotto), the membrane was incubated with the rabbit anti-allantoinase anti- body (10) diluted in 50% Blotto (1:lOOO). The washes were done with phosphate-baered saline, 0.05% Tween 20. The secondary antibody was goat anti-rabbit IgG conjugated to horseradish peroxidase (Amer- sham Corp.). Chloronaphthol was used as chromogen.

Immunocytochemical Localization of Allantoinase in Frog Liver and KidneySmal l pieces of frog liver and kidney were fixed by immersion in 4% paraformaldehyde, 0.1% glutaraldehyde in 0.1 M sodium phos- phate, pH 7.4, for 16 h (5 ) . After rinsing in 0.1 M sodium phosphate buffer, pH 7.4, containing 0.15 M NaCl and 0.1 M lysine for 1 h, tissues were dehydrated in graded series of ethanol and embedded in Lowicryl

12272 Frog Allantoinase cDNA Cloning and Expression

4- KLVTAGVAAA-GITASTLLYD Yeast Cytochrome CI

- - TATLAAAGG 1 TA - - 1 V - D F rog A l l an to inase m a o e m e mema 0 0

+ /

-3 I 1 I I

100 200 300 400 FIG. 3. Hydrophobicity plot of frog allantoinase protein. The hydrophobicity plot was constructed using the Kyte-Doolittle (26) algorithm

with a window of 11 amino acids. Values above the zero axis correspond to hydrophobic segments. The two transmembrane segments predicted by the method of Klein et al. (27) are circled, and the segment sequence shown. The boxed area most likely represents the sequence that targets the allantoinase to the mitochondrial inner membrane, since this has significant homology to the cytochrome c, inner membrane targeting sequence (31). The closed circles indicate identity and the open circle similarity between cytochrome c , and allantoinase sequence. Adash indicates a gap to

flanking the targeting sequence. The scale a t the bottom of the plot indicates amino acid position. maximize the alignment. The hydrophobic regions that target to intermembrane space seem to have charged amino acids, such as Lys and Asp,

1 2 3 4 5 6

-28s

-1 8s

FIG. 4. Northern blot analysis of frog allantoinase mRNk Total RNA (30 pg) from frog liver (lane 2 ), heart (lane 3 ), intestine (lane 4 ), kidney (lane 5 ), and lung (lane 6 ) was denatured, electrophoresed in 1% agarose gel, and blotted onto nylon filters. The filters were hybridized with "P-labeled rlALN cDNA. Rat liver total RNA (30 pg) is loaded in lane 1. RNA size markers from frog 28 and 18 S ribosomal RNA are indicated.

K,M at -20 "C. Post-osmification of the tissues was omitted. Ultrathin sections were cut and immunostained with allantoinase antibodies us- ing the protein A-gold immunocytochemical approach as previously de- scribed (5).

RESULTS

Isolation and Nucleotide Sequence of the Frog Allantoinase cDNA-About 5 x lo4 clones of a h g t l l liver cDNA library constructed with poly(A) RNA from a bullfrog (R. catesbeiana) were immunoscreened with anti-frog allantoinase antibody. Several positive clones were obtained carrying cDNA inserts ranging in size from 0.5 to 1.5 kb. Sequencing of the largest isolate, designated rlALN, revealed a 1486-bp cDNA contain-

1 2 3 4 5 6 7

- 106.0kD

- 80.0kD

J 52kD - 49.5kD

- 32.5kD

- 27.5kD

frog allantoinase. Homogenates of selected tissues (100 pg of proteid FIG. 5. Immunoblot analysis of tissue specific expression of

lane) from adult frog were analyzed for the expression of allantoinase protein by Western blotting using an antiserum to frog liver allantoin- ase. Extracts from frog liver (lane I ) , lung (lane 2), brain (lane 3 ) , intestine (lane 4), kidney (lane 5), spleen (lane 6 ) . and heart (lane 7) were subjected to SDS-PAGE on a 10% gel, and transferred onto a nitrocellulose membrane. Immunoblot analysis with anti-frog allanto- inase confirmed the liver and kidney specific expression of allantoinase. Molecular weight in daltons of prestained molecular weight markers (Bio-Rad) used: phosphorylase b = 106,000, bovine serum albumin = 80,000, ovalbumin = 49,500, carbonic anhydrase = 32,500, soybean tryp- sin inhibitor = 27,500, and lysozyme = 18,500.

ing an open reading frame of 1350 bp (see clone rlALN in Fig. 1) before reaching an in-frame termination codon TAA. The calculated molecular weight of the peptide, with 450 amino acids, encoded by rlALNwas less than the apparent molecular weight, 53,000, of frog liver allantoinase as determined by SDS- PAGE (11). The insert in this clone thus appeared to lack the NH,-terminal region of the protein. Several other clones iso- lated from the h g t l l cDNAlibrary did not extend this sequence and were incomplete in the 5' end. In order to obtain the full allantoinase cDNA sequence, we then screened a XZAP Xeno- pus liver cDNA library (15) with radiolabeled rlALN and ob- tained 14 clones. Restriction analysis and nucleotide sequenc- ing of the largest clone confirmed the rlALN cDNA sequence

Frog Allantoinase cDNA Cloning and Expression 12273 "" .. .

- . .

. . . .

. . .* . . . A

M

B liver (B 1 were incubated with antibodies against frog allantoinase and the antigen antibody complexes visualized by the protein A-gold method as

PIC. 6. Immunocytochemical localization of allantoinase in frog kidney and liver. Sections of Lowicryl-embedded frog kidney ( A ) and

described under "Experimental Procedures." Labeling as indicated by the presence of gold particles is restricted to the mitochondria (M) and not seen in the peroxisome (P). The distribution of gold particles in the mitochondrion is predominantly over the cristae.

and extended the sequence by an additional -140 bp in the 3"noncoding region (see xALN in Fig. 1). We then performed RACE-PCR in the 5'- and 3'-directions, using bullfrog liver RNA to isolate cDNAs harboring extended rlALN sequence (Fig. 1). Both 5' and 3' end PCR amplifications yielded clones that were identical in their respective regions of overlap (Fig. 1). Given the relatively high error of Taq polymerase, we con- firmed the sequences of clones, 5' RACE and 3' RACE, by isolating and sequencing several independent clones obtained under the same conditions. In addition, a cDNA clone contain- ing the entire allantoinase coding sequence, which was derived using RT-PCR for expression studies (see clone ALN,,, in Fig. 1) as described under "Experimental Procedures," also revealed the identical nucleotide sequence.

The nucleotide sequence of putative full-length allantoinase composite cDNA (see rALN in Fig. 1) derived from the compos- ite rlALN, 5' RACE, and 3' RACE clones, is shown in Fig. 2. The cDNA is 2112 bp in length, containing an open reading frame of 1449 bp (Fig. 2). This open reading frame is flanked by -63 bp of 5'-untranslated sequence, including an in-frame TAG stop codon 60 bp (nucleotide residues -60 to -58) upstream of the predicted start codon (Fig. 2). The start of the coding se- quence was defined by the first ATG downstream of an in-frame stop codon, and the surrounding sequences (ACAATGG) con- form to a consensus sequence for the translation initiation site (24). The rALN contains 600 bp (nucleotide residues 1450- 2049) of 3"untranslated sequence which includes a putative polyadenylation signal ATTAAA (located at nucleotide residues 2014-2019) 19 bp upstream of a short poly(A) stretch of 17 residues (Fig. 2).

The encoded polypeptide of 483 amino acids has a calculated M , of 53,296. The amino acid sequence underlined in Fig. 2 is that obtained for a tryptic peptide derived from purified frog liver allantoinase, and the sequence agrees absolutely with that deduced from the cDNA sequence. The 3"terminus of the frog allantoinase does not contain a typical peroxisomal target- ing signal (Ser-Lys-Leu) or a conserved variant for import into peroxisomes (25). Hydrophobicity analysis of allantoinase was performed by the method of Kyte and Doolittle (26). Two trans-

membrane segments are predicted by the method of Klein et al., (271, suggesting that allantoinase may be an integral mem- brane protein (Fig. 3). The polypeptide regions a t amino acids 57-73 and 150-166 are also hydrophobic.

Tissue Distribution of Frog Allantoinase-Northern hybrid- ization was performed with total cellular RNA derived from selected bullfrog tissues. Using rlALN as the probe, a 2.3-kb mRNA species was detected in liver and kidney (Fig. 4). The same result was later obtained when a cDNA covering the entire coding region (ALN,,,) was isolated and used as the probe. The mRNA size (2.3 kb) of frog allantoinase obtained by Northern blot analysis was slightly longer than the rALN se- quence of 2112 bp. The nearly 200-bp difference between the hybridizable mRNA species observed in the Northern blot and the length of the cloned rALN cDNA is most likely due to 5'- and or 3"noncoding sequences that may be missing from the cloned rALN cDNA. The Northern blot results, however, con- firm that the rALN cDNA is nearly full-length and that the gene is transcribed. No allantoinase mRNA was detected in adult bullfrog heart, intestine, or lung (Fig. 4). Allantoinase mRNA was also not detected in rat liver (Fig. 4, lane 1 ). The distribution of allantoinase protein in various frog tissues was also investigated by Western blot analysis. Fig. 5 illustrates the expression of allantoinase protein ( M , - 52,000) in the liver and kidney of adult frog and not in other tissues such as brain, heart, lung, intestine, and spleen. The immunoblotting results of allantoinase distribution are in agreement with the mRNA expression patterns in frog tissues and indicate that the allan- toinase expression is tissue-specific.

Subcellular Localization of Allantoinase-To ascertain the subcellular localization of allantoinase, we utilized the protein A-gold immunocytochemical localization procedure. Allantoin- ase was localized predominantly in the mitochondria and not in the peroxisomes (Fig. 6). All mitochondria in hepatic parenchy- mal cells revealed allantoinase. In the kidney, mitochondria of proximal tubular epithelium were labeled with gold particles (Fig. 6 A ) , but those of the distal tubules were devoid of the enzyme. Allantoinase in the mitochondria appears to be local- ized to the inner mitochondrial membrane (Fig. 6B).

12274

A 1 2 3 - 5

a 6

" 11 "

""0

C

c

B 1 2

52kD

3 4 5 6

-52kD

D 1

"52kD

t I 1 I I I T I I I I I 12 24 36 48 60 72

Time (hours) FIG. 7. Analysis of allantoinase expressed in Sf9 insect cells. A, SDS-PAGE analysis of whole cell lysates of Sf9 insect cells infected with

the recombinant baculovirus containing frog allantoinase cDNA tagged with 6 histidine residues. Cells were grown, infected with the virus, and harvested a t 12 h (lane 1 ), 24 h (lane 2 ) , 36 h (lane 3), 48 h (lane 4 ) , 60 h (lane 5). and 72 h (lane 6) after infection. Cell lysates (100 pg of proteln) were subjected to SDS-PAGE and stained with Coomassie Brilliant Blue R-250. The arrow indicates the position of allantoinase (52 kd). B, an immunoblot of the Sf9 cell lysates, corresponding to the intervals in panel A, with antibodies raised against frog liver allantoinase. C, time course of expression of allantoinase activity in Sf9 cells infected with the recombinant baculovirus. Insect cells were grown in a monolayer in 75-cm tissue culture dishes. When the growth reached 75% confluence, they were infected with the recombinant virus at time zero. Cells were then harvested a t 12, 24 36, 48, 60, and 72 h after infection and assayed for allantoinase activity. The values are expressed as the average of two infections. D, recombinant allantoinase purified from Sf9 cell lysates infected for 72 h. The histidine-tagged allantoinase expressed in Sf9 cells was purified on a Ni-NTA affinity column. The purified protein (10 pg) was subjected to SDS-PAGE and stained with Coomassie Brilliant Blue R-250. Molecular weight markers are the same as those used in Fig. 5.

Functional Expression of Allantoinase in Insect Cells and in Yeast-To determine if the isolated cDNA clone ALN,,, encodes functional allantoinase, plasmids were constructed and cloned into both yeast expression vector and baculovirus transfer vec- tor. Fig. 7 summarizes the results of expression experiments using baculovirus-Sf9 insect cells. The time course of produc- tion of allantoinase in insect cell lysates is demonstrated in Fig. 7A by SDS-PAGE and Coomassie Brilliant Blue R-250 staining. Allantoinase protein with six histidine residues encoded by ALN,,, (Mr- 52,000) was detected as early as 12 h after infec- tion and reached peak levels by 72 h after infection (see Fig. 7A, lanes 2-6). The identity of these bands was confirmed by West- ern hybridization using a polyclonal antibody specific for frog allantoinase (Fig. 7B). These blots were performed on crude insect cell lysates. An immunoreactive signal for a 52-kDa band appeared, and the intensity of the band revealed a clear time course of expression of allantoinase (Fig. 7B 1. To assess allan- toinase activity, lysates were solubilized in 0.1% deoxycholate and the ability of the enzyme to convert allantoin to allantoic acid was measured. Fig. 7C summarizes the results of expres- sion of allantoinase activity in Sf9 cells infected with the re- combinant baculovirus. The recombinant allantoinase was pu-

rified by a single-step procedure from the Sf9 insect cell lysates using a Ni-NTA affinity column, which binds the histidine tag. The purified allantoinase protein is shown in Fig. 70.

The expression of frog allantoinase in yeast cells is demon- strated in Fig. 8. Homogenates were made from transfected and untransfected yeast cells and were analyzed for recombinant allantoinase by Western blotting using antibodies raised against frog liver allantoinase. A 52-kDa immunoreactive band was detected in transfected yeast cell lysates but not in control yeast cells (see Fig. 8, lanes 1 and 2 1. The molecular weight of the allantoinase expressed in yeast is similar to that of the frog liver allantoinase (see Fig. 8, lane 3). The yeast cells expressing recombinant allantoinase exhibited allantoinase activity (0.35 unitdmg protein); in control untransfected yeast cells, the en- zyme activity was barely detectable.

DISCUSSION The degradation of the purine moieties of nucleic acids, ad-

enine and guanine, results in the formation of uric acid in all animals with the exception of spiders, leeches, and freshwater mussels (1). Uric acid possess antioxidant activity and is ca- pable of scavenging deleterious reactive oxygen intermediates

Frog Allantoinase cDNA

1 2 3

- 106.0kD

- 80.0kD

Cloning and Expression 12275

*.. d ~ 5 2 k D -49.5kD

-32.5kD

-27.5kD

- 18.5kD

FIG. 8. Immunoblot analysis of allantoinase expressed in yeast. Extracts (total soluble protein) from transfected (lane 1 ) and untransfected (lane 2) yeast cells were subjected to immunoblot anal- ysis using anti-frog allantoinase. Adult frog liver extract (100 pg) is used in lane 3 as positive control. Molecular weight markers are the same as those used in Fig. 5.

such as peroxyl radical, hydroxyl radical, and singlet oxygen (28). Urate oxidase, the first of the three enzymes involved in the conversion of uric acid to urea, oxidizes uric acid to allan- toin (1). Allantoin is then converted to allantoic acid by allan- toinase, and allantoic acid to urea by the enzyme allantoicase (1). The absence of urate oxidase in humans and in some homi- noid primates accounts for the accumulation of uric acid to concentrations approaching saturation in these species. Other mammals have urate oxidase activity and thus excrete uric acid as the end product of purine metabolism. The view that the longer lifespan of human and hominoid primates may be re- lated to the antioxidant role of uric acid has generated renewed interest in the biological, molecular, and evolutionary aspects of enzymes that participate in the degradation of uric acid to urea. The availability of rat (12, 13) and baboon (7) liver urate oxidase genomic and cDNA probes facilitated the identification of nonsense mutations responsible for the extinction of the urate oxidase gene in the human and hominoid primates (6,7). Since mammals do not have allantoinase and allantoicase ac- tivity, it is possible that these two genes are either deleted or have undergone deleterious mutations during mammalian evo- lution. To explore these possibilities, it is essential to have information on allantoinase and allantoicase genes, both of which are functionally active in lower vertebrates (1-3, 9-11).

In the present study, a nearly complete cDNA sequence for allantoinase was derived from frog liver h g t l l cDNA library and by amplification of the cDNA 5' and 3' ends. Sequencing of the cDNA has provided the complete deduced amino acid se- quence of this protein. This cDNA was shown to encode for frog allantoinase by: (i) identification of a peptide sequence from the purified enzyme in the deduced amino acid sequence, (ii) ascer- taining that the molecular mass of the protein predicted from the nucleotide sequence agreed with previous reports of allan- toinase purified from frog liver (10, ll), (iii) demonstrating the appearance of a protein with M, 52,000 that was immunoreac- tive with antibodies specific against frog liver allantoinase when the cloned gene was expressed in yeast, as well as in insect cells, and (iv) showing that the expressed allantoinase in yeast and insect cells exhibits enzymatic activity.

483

472

FIG. 9. Comparison of frog and yeast allantoinase. Deduced amino acid sequence of frog and yeast are aligned to maximize identity. Frog allantoinase residues identical with yeast are shown as vertical bars, + indicates similar amino acids, and gaps indicated by dashes were introduced into the protein sequence to facilitate their alignment.

A search for sequence homology of frog liver allantoinase in the CenBank data base (release 79, October 15,1993) revealed no significant similarities to other nucleotide sequences. Com- parison of the predicted peptide sequence of the frog allantoin- ase reported here with the amino acid sequence of the yeast allantoinase (29), which is the only other known sequence of allantoinase, is shown in Fig. 9. The predicted yeast allantoin- ase peptide sequence contains 472 amino acid residues, com- pared to 483 amino acid residues for frog allantoinase. The amphibian allantoinase was found to have less than 37% amino acid identity (and 49% similarity) by alignment with the most conserved residues of the yeast allantoinase (29). This low de- gree of identity explains the lack of significant nucleotide se- quence homology between yeast and frog allantoinase cDNAs and the failure of yeast allantoinase to cross-react with the antibodies raised against frog liver allantoinase (see Fig. 8, lane 2 ). Yeast allantoinase could have arisen early in evolution and may represent the ancestor of allantoinase expressed in fish and amphibia (1). This supports the hypothesis that allan- toinase and allantoicase proteins evolved early but were lost during mammalian evolution.

Allantoinase mRNA was found to be expressed in a tissue- specific manner in the adult bullfrog. The allantoinase mRNA and the immunoreactive allantoinase protein were found only in the liver and kidney (Figs. 4 and 5). It is of interest to note that urate oxidase, the enzyme that degrades uric acid to al- lantoin, is also expressed only in liver and kidney in frog (30). The co-expression of the first two enzymes of uric acid degra- dation in the liver and kidney is biologically relevant, serving to optimize the degradation of uric acid and its metabolite allan- toin in the same tissues. The last of the three enzymes of uric acid degradation, allantoicase, is present in liver in frogs and fish (9-11). Earlier studies have shown that urate oxidase, allantoinase, and allantoicase are located in the peroxisomes of marine fish liver (10, 11). The compartmentalization of all three enzymes in peroxisomes could facilitate efficient degra- dation of uric acid. Using density gradient centrifugation pro- cedures, Scott et al. (3) assigned urate oxidase and allantoinase to amphibian hepatic peroxisomes. Evidence has been pre- sented that allantoinase and allantoicase exist as a protein complex in frog liver (10, ll), implying that these two proteins

12276 Frog Allantoinase cDNA Cloning and Expression

are also localized within the same organelle in the frog liver. Our immunocytochemical localization results reveal the pres- ence of allantoinase in the mitochondria of frog liver and kid- ney, however, and not in peroxisomes (Fig, 6). In earlier studies, we have shown that in the frog, urate oxidase is localized within the semidense inclusions of peroxisomes in liver paren- chymal cells and in the proximal tubular epithelium of kidney (30). Thus, the direct visual evidence presented here clearly indicates that the uric acid degrading enzymes urate oxidase and allantoinase are not localized within the same organellar compartment.

The amino acid sequence of the frog allantoinase reveals some interesting features and provides molecular support for its mitochondrial localization. This protein has a basic amino- terminal sequence of 25 amino acids ( 4 lysines, 2 arginines, and no other charged amino acids), and this segment reveals the overall characteristics of presequences of imported mitochon- drial proteins (31,321. The proposed precursor sequence has a net basic charge, rich in positively charged amino acids argi- nine and lysine, rich in neutral polar amino acids serine and threonine, and devoid of acidic residues and tryptophan (31). A cluster of basic residues is found in the precursor sequence near the putative cleavage site to generate the mature form of the protein (Fig. 2). The molecular masses of the precursor and the mature subunit of allantoinase were calculated to be 53,296 and 51,596 Da, respectively, which are close to the value (52,000 Da) of the mature allantoinase estimated by SDS- PAGE analysis of the purified protein and by Western blot analysis. Further studies are needed to confirm the identity of the presequence and establish the site where cleavage would occur. Hydrophobicity analysis of the allantoinase protein in- dicated that it contained two potential transmembrane seg- ments (amino acids 57-73 and amino acids 150-166) (Fig. 3). In addition, a putative inner membrane spanning sequence simi- lar to that present in cytochrome c1 (32) is also observed in allantoinase (amino acid sequence 92-105 TATLAAAGGI- TAIV” in the allantoinase gene has considerable identity to “TAGVAAA--GITASTL,” which targets cytochrome c , to the mitchondrial inner membrane; dash indicates a gap, and bold- face indicates a match).

The present studies raise several important questions con- cerning the role of peroxisomes and mitochondria in uric acid metabolism in amphibia. Whether allantoin produced within peroxisomes is transported to mitochondria or that it simply diffuses out of the peroxisome is unclear. I t is also of interest to clarify the nature of association between allantoinase and al- lantoicase, or how they form a complex in the frog liver (10,ll). The present study suggests that allantoinase and allantoicase enzyme activities cannot be exhibited by the same protein, since the allantoinase cDNA sequence has a stop codon up- stream of the open reading frame. The allantoicase mRNA should be a different gene product than that of allantoinase. This study on amphibian allantoinase cDNA provides the first reported sequence information for a vertebrate allantoinase. Sequence comparisons with other allantoinases are needed to

elucidate the structural relationship. To understand the co- ordinated expression of the enzymes responsible for the degra- dation of uric acid to urea, it will be necessary to establish the structure of all three genes, the molecular basis for their tissue and subcellular distribution, and the factors controlling their expression. The allantoinase cDNA reported here will likely enable investigations of the molecular basis for the silencing of the allantoinase gene during mammalian evolution.

structing the A g t l l frog liver cDNAlibrary. We are grateful to Dr. Daniel Acknowledgments-We thank Usha Sathian for assistance in con-

R. Schoenberg for advice in the preparation of high quality frog liver RNA and for the giR of the A Z A P Xenopus liver cDNA library.

REFERENCES 1. Keilin, J. (1959) Biol. Reu. 34,265-296 2. Campbell, J. W. (1991) Environmental and Metabolic Animal Physiology

(Presser, C. L., edj pp. 277-334, Wiley-Liss, New York 3. Scott, P. J., Visentin, L. P., and Allen, J. M. (1969) Ann. N. Y Acad. Sci. 168,

244-264 4. Friedman, T. B., Polanco, G. E., Appold, J. C.,and Mayle, J. E. (1985) Comp.

Biochem. Physiol. 818, 653-659 5. Usuda, N., Reddy, M. K., Hashimoto, T., Rao, M. S., and Reddy, J. K. (1988)

Lab. Inuest. 68, 1OCL111 6. Yeldandi, A. V., Yeldandi, V., Kumar, S., Murthy, C. V. N., Wang, X., Alvares, K.,

7. Wu, X., Muzny, D. M., Lee, C. C., and Caskey, C. T. (1992) J. Mol. Euol. 34, Rao, M. S., and Reddy, J. K. (1991) Gene (Amst.) 109,281-284

8. Alvares, K., Widrow, R. J., AbuJawdeh, G. M., Schmidt, J. V., Yeldandi, A. V., 178-184

Rao. M. S., and Reddy, J. K. (1992) Proc. Natl. Acad. Sci. U. S. A. 89,

9. Noguchi, T., Fujiwara, S., Takada, Y., Mori, T., and Nagano, M. (1982) J. 490849 12

10. Noguchi, T., Fujiwara, S., and Hayashi, S. (1986) J. Biol. Chem. 261, 4221- Biochem. (Tokyo) 92, 525-529

4223 11. Hayashi, S., Fujiwara, S., and Noguchi, T. (19891 J. Biol. Chem. 264, 3211-

12. Reddy, P. G., Nemali, M. R., Reddy, M. K., Reddy, M. N., Yuan, F’. M., Yuen, S., 3215

Lamer, T. G., Shiroza, T., Kuramitsu, H. K., Usuda, N., Chisholm, R. L., Rao, M. S., and Reddy, J. K. (1988) Proc. Natl. Acad. Sci. U. S. A. 86,

13. Wang, X., Kawano, H., Alvares, K., Reddy, P. G., Getto, H., Rao, M. S., and 9081-9085

14. Chomczynski, F’., and Sacchi, N. (1987)Anal. Biochem. 162, 156159 Reddy, J. K. (1991) Gene (Amst.) 97, 223-229

15. Schoenberg, D. R.. Moskaitis, J. E., Smith, L. H., and Pastori, R. L. (1989) Mol.

16. Southern, E. M. (1975) J. Mol. Biol. 98, 503-517 17. Sanger, F., Nicklen, S., and Coulson, A. R. (1977) Proc. Natl. Acad. Sci. U. S. A.

18. Frohman, M. A., Dush, M. K., and Martin, G. R. (1988) Proc. Natl. Acad. Sci.

Endocrinol. 3, 805-814

74, 5463-5467

19. Hunkapiller, M. W., Lujan, E., Ostrander, F., and Hood, L. E. (1983) Methods U. S. A. 86,8998-9002

20. Towbin, H., Staehelin, T., and Gordon, J. (1979) Proc. Natl. Acad. Sci. U. S. A.

21. Becker, D. M., and Leonard, G. (1991) Methods Enzyrnol. 194, 182-187 22. Laemmli, U. K. (1970) Nature 227, 680-685 23. Summers, M. D., and Smith, G. E. (1987) Tex. Agric. Exp. Stn. Bull. 1566,

24. Kozak, M. (1989) J. Cell Biol. 108, 229-241 25. Gould, S. J., Keller, G.-A., Hosken, N., Wilkinson, J., and Subramani, S. (1989)

26. Kyte, J., and Doolittle, R. F. (1982) J. Mol. Biol. 157, 105-132 27. Klein, P., Kanesha, M., and DeLisi, C. (1985) Biochim. Biophys. Acta 816,

28. Ames, B. N., Cathcart, R., Schwiers, E., and Hochstein, P. (1981) Proc. Natl.

29. Buckholz, R. G., and Cooper, T. G. (1991) Yeast 7, 913-923 30. Usuda, N., Hayashi, S., Fujiwara, S., Noguchi, T., Nagata, T., Rao, M. S.,

31. Hurt, E. C., and Van Loon, A. P. G. M. (1986) ‘hnds Biochem. Sci. 11,204-207 32. Van Loon, A. P. G. M., Brandli, A. W., and Schatz, G. (1986) Cell 44, 801-812

Enzymol. 91, 227-236

76,435M354

27-29

J. Cell B~ol . 108, 1657-1664

468-476

Acad. Sci. U. S. A. 78, 68584862

Alvares, K., Reddy, J. K., and Yeldandi, A. V. (1994) J. Cell Sci., in press