1

The mature virion of ectromelia virus, a pathogenic 1

poxvirus, is capable of intrahepatic spread and can 2

serve as a target for delayed therapy 3

Xueying Ma1,5, Ren-Huan Xu1,5, Felicia Roscoe1, J Charles Whitbeck2, Roselyn 4

J. Eisenberg3, Gary H. Cohen2 and Luis J. Sigal1,4 5

1Immune Cell Development and Host Defense Program, Fox Chase Cancer 6

Center, Philadelphia, PA 19111. 7

2Department of Microbiology, School of Dental Medicine and 3Laboratories of 8

Microbiology and Immunology, School of Veterinary Medicine, University of 9

Pennsylvania, Philadelphia, PA 10

Short title: The mature virion in spread and therapy of an OPV 11

4Correspondence to: Dr. Luis J. Sigal, email: Luis.Sigal@fccc.edu, Phone: 215-12

728-7061, FAX: 215-728-2409 13

5XM and RX contributed equally to this work 14

15

16

Copyright © 2013, American Society for Microbiology. All Rights Reserved.J. Virol. doi:10.1128/JVI.03158-12 JVI Accepts, published online ahead of print on 17 April 2013

on April 5, 2019 by guest

http://jvi.asm.org/

Dow

nloaded from

2

17

Abstract 18

Orthopoxviruses (OPV) which include the agent of smallpox variola virus, the 19

zoonotic monkeypox virus, the vaccine and zoonotic species vaccinia virus and the 20

mouse pathogen ectromelia virus (ECTV), form two types of infectious viral particles. 21

The mature virus (MV) which is cytosolic and the enveloped virus (EV) which is 22

extracellular. It is believed that MVs are required for viral entry into the host while EVs 23

are responsible for spread within the host. Following footpad infection of susceptible 24

mice, ECTV spreads lympho-hematogenously entering the liver 3-4 days post-infection 25

(dpi). Afterwards, ECTV spreads intra-hepatically killing the host. We found that 26

antibodies to an MV protein were highly effective at curing mice from ECTV infection 27

when administered after the virus reached the liver. Moreover, a mutant ECTV that does 28

not make EV was able to spread intra-hepatically and kill immunodeficient mice. 29

Together, these findings indicate that MVs are sufficient for the spread of ECTV within 30

the liver and could have implications regarding the pathogenesis of other OPVs, the 31

treatment of emerging OPV infections, as well as for strategies of preparedness in case 32

of accidental or intentional release of pathogenic OPVs. 33

34

on April 5, 2019 by guest

http://jvi.asm.org/

Dow

nloaded from

3

Introduction 35

Orthopoxviruses (OPVs) penetrate their natural hosts through epithelial surfaces 36

and disseminate stepwise to distant organs through the regional draining lymph node (D-37

LN) and then the blood to cause systemic disease (21, 35). For instance, the human 38

pathogen variola virus (VARV) penetrated through the respiratory epithelium to spread 39

lympho-hematogenously through the mediastinal lymph nodes. Thus, smallpox was 40

chiefly a systemic and not a respiratory disease (10, 19). Similarly, some of the gravest 41

complications of the smallpox vaccine, which is made with live vaccinia virus (VACV) are 42

due to lympho-hematogenous (LH) dissemination (7, 8, 12). The OPV ectromelia virus 43

(ECTV), the agent of mousepox, is a mouse pathogen that serves as an excellent model 44

for OPV pathogenesis and as the textbook paradigm for LH spread (21, 35). ECTV 45

penetrates through the skin of the footpad and spreads lympho-hematogenously through 46

the popliteal D-LN to seed the liver and spleen. Susceptible strains of mice such as 47

BALB/c usually die 7-12 days post infection (dpi) with extensive liver and splenic 48

necrosis due to massive viral replication. In resistant strains of mice such as C57BL/6 49

(B6), LH dissemination and viral replication are considerably controlled by the action of 50

the innate and adaptive immune responses and mousepox does not occur (13, 18, 37). 51

During the replication of VACV and likely all other OPVs, the first infectious 52

particle formed is the intracellular mature virus (MV) which consists of a core surrounded 53

by a single membrane bi-layer. While most MVs remain within the cytosol and only 54

released to the extracellular milieu by cell lysis, some MVs become wrapped by a double 55

membrane, transported to the plasma membrane through microtubules and exocytosed, 56

losing the outer membrane in the process. Most of the resulting enveloped virus (EV) 57

remains attached to the plasma membrane as cell-associated enveloped virus (CEV) 58

while some are released as extracellular enveloped virus (EEV). CEVs are important for 59

on April 5, 2019 by guest

http://jvi.asm.org/

Dow

nloaded from

4

cell-to-cell spread and EEV for long-range spread of VACV and probably other OPVs in 60

tissue culture. In addition, EV are thought to be essential for OPV spread within the host 61

(5, 6, 20, 31, 33). The MV and EV membranes each have a characteristic set of proteins 62

that play various roles in the virus life cycle and some of them have been shown to be 63

effective targets for vaccination in several OPV infection models (9, 14, 22-28, 33, 39). 64

However, it remains to be determined which of these proteins can serve as targets for 65

late therapy in a systemic model of OPV infection. 66

While prophylactic immunization with VACV is highly effective, treatment of 67

individuals exposed to pathogenic OPVs or with vaccine complications is less advanced. 68

In the US, vaccinia immunoglobulin (VIG) obtained from vaccinees is the only anti-OPV 69

treatment approved by the Food and Drug Administration (38, 40). However, VIG has 70

limited efficacy and, due to its nature, scarce. Still, it is not yet possible to supplant it with 71

or improve it with a cocktail of monoclonal antibodies (mAbs) because it is unknown 72

which specificities can protect and/or cure OPV infections (40). Of note, VIG can cure 73

ECTV infection when given to immunocompetent mice at 3 dpi but cannot cure severe 74

combined immunodeficient (SCID) mice from VACV infection (30). Here we demonstrate 75

that IgG1 mouse mAbs recognizing the MV protein L1R/EVM072 (VACV/ECTV) and the 76

EV protein A33R/EVM135 but not the EV protein B5R/EVM155 are effective at 77

preventing mousepox when administered immediately after infection. Of interest, the 78

L1R/EVM072 mAb as well as L1R/EVM072 polyclonal rabbit antiserum were also very 79

effective at preventing spread within the liver and curing ECTV infection when 80

administered after the virus reached the liver. Moreover, we show that an ECTV mutant 81

lacking a gene essential for EV formation (F13L/EVM036) can efficiently spread 82

intrahepatically. 83

on April 5, 2019 by guest

http://jvi.asm.org/

Dow

nloaded from

5

Materials and Methods 84

Ethics Statement 85

All animal work has been conducted according to relevant national and 86

international guidelines and with protocols approved by The Fox Chase Cancer Center 87

Institutional Animal Care and Use Committee. 88

Cells, viruses and recombinant proteins 89

Media and cells were as previously described (16, 17, 41). Stocks of ECTV 90

Moscow strain (ATCC VR-1374) were propagated in tissue culture as previously 91

described (41). ECTV deficient in EVM036 has been described (32). Production of 92

recombinant A33R, EVM135, B5R and EVM155 was as previously described (2, 22). 93

Production of polyclonal rabbit Abs was also as described (43). mAbs VMC-2, VMC-14 94

and VMC-78 (al IgG1) have been described previously (1, 2) and were either obtained 95

from BEI Resources (Manassas, VA) or produced and purified as described previously 96

(1, 2). 97

Mice and infections 98

BALB/c and C57BL/6 mice were purchased from Taconic Farms. Severe 99

combined immunodeficient (SCID) mice in a BALB/c background were bred at FCCC. 100

B6.129P2-Fcer1gtm1Rav N12 (Taconic Farms) were bred at FCCC with mousepox 101

susceptible B6.D2-(D6Mit149-D6Mit15)/LusJ (B6.D2-D6, Jackson) to generate B6.D2-102

D6-Fcer1gtm1Rav. Unless indicated, mice were infected with ECTV in the left footpad with 103

30 μl PBS containing 3×102 pfu. For the determination of survival, the mice were 104

monitored daily. To avoid unnecessary suffering, mice were euthanized and counted as 105

dead if imminent death was certain. For virus titers and histopathology, mice were 106

on April 5, 2019 by guest

http://jvi.asm.org/

Dow

nloaded from

6

infected with pfu PFU ECTV and euthanized when indicated and whole LNs or 100 mg 107

of liver were homogenized in PBS using a Tissue Lyser homogenizer (Qiagen). Virus 108

titers were determined on BS-C-1 cells in 6-well-plates as before (16, 17, 41). 109

Construction of recombinant baculovirus expressing soluble VACV and ECTV 110

proteins 111

The DNA sequence of the different proteins was amplified by PCR without a 112

transmembrane domain and cloned into the baculovirus transfer vector, pVT-Bac 113

downstream of, and in frame with, the mellitin signal sequence as previously described 114

for B5R (2). Two additional amino acid residues (DP) are present at the N-terminus of 115

the mature (signal-less) recombinant proteins. These are left over following cleavage of 116

the melittin signal sequence. The proteins were constructed with 6 histidine residues at 117

the C-terminus to allow for purification via nickel-NTA affinity chromatography. 118

Hybridoma selection and IgG purification 119

Murine hybridomas secreting antibodies against A33R were generated as 120

previously described (1). 121

ELISA for viral proteins 122

High-binding 96-well ELISA plates (Corning) were coated overnight at 4°C with 123

50μl recombinant A33R, EVM135, B5R or EVM155 protein (50μg/ml) or, for L1R and 124

EVM072, with cell lysates from VACV or ECTV infected cells respectively (2 ×107 pfu/ml) 125

in Phosphate-Buffered Saline (PBS), pH 7.0. Plates were washed twice with PBS, and 126

then blocked for 2 h at 37°C with PBS containing 0.05% Tween-20 (PBST) and 3% BSA. 127

Antibodies were serially diluted in PBST, 1% BSA, and 0.1 ml was added to each well. 128

on April 5, 2019 by guest

http://jvi.asm.org/

Dow

nloaded from

7

The plates were then incubated for 1 h at 37°C, washed four times with PBST and 0.1 ml 129

of horseradish peroxidase (HRP)-conjugated affinity purified goat anti-mouse IgGγ (KPL) 130

was added to each well at a dilution of 1:3,000 in PBST. The plates were incubated for 1 131

h at 37 °C, washed six times with PBST and 100μl Sure Blue TMB (KPL) was added to 132

each well. The plates were incubated at room temperature for 5–20 min. The reactions 133

were stopped by addition of 20μl 3M HCl. The OD was determined at 450 nm using a 134

microplate spectrophotometer (µQuant, Bio-Tek). 135

Plaque reduction assay 136

ECTV stocks were incubated for 1 h at RT with 100μg/ml of the indicating Abs. 137

The virus-antibody mixture (100 pfu/well) were added to confluent BS-C-1 cells (ATCC # 138

CL-26) in 24-well plates with 0.25 ml and the plates were incubated for 2 hours at 37°C. 139

Viral inoculums were removed after incubation, and cells were overlaid with 1ml fresh 140

DMEM media containing 2.5% FBS and 1% CMC. Cells were incubated for 5-7 days at 141

37°C in a 5% CO2 incubator. The cells were fixed with formaldehyde, and stained with 142

crystal violet. 143

Comet inhibition assay 144

Monolayers of BSC-1 cells in 6 well plates were infected with 60 pfu ECTV in 0.5 145

ml DMEM containing 2.5% FBS. After 2 h incubation at 37 °C, the media containing virus 146

was aspirated and fresh 2 ml DMEM containing 2.5% FBS and 50μg/ml of the 147

corresponding antibody was added. Cells were incubated for 5-7 days at 37 °C in a 5% 148

CO2 incubator and stained with crystal violet. 149

on April 5, 2019 by guest

http://jvi.asm.org/

Dow

nloaded from

8

Complement depletion 150

BALB/c mice were inoculated ip with 15 μg purified CVF Cobra Venom Factor 151

(CVF) from najia najia kaouthia (CompTech) at 4, 5 and 8 dpi. 10 µg CVF have been 152

shown to fully inhibit complement activity in mouse sera (11). Mice were bled at 5, 6 and 153

9 dpi and C3 depletion was assessed in serum by WB and using a commercial ELISA kit 154

for C3 (Immunology Consultants Lab) used according to manufacturer’s instructions. 155

RNA isolation 156

D-LNs were collected from infected or naïve mice and immediately placed in 157

RNAse-free tubes containing RNAlater (Ambion). RNA was extracted using RNAeasy kit 158

(Qiagen) as described and the DNA was digested during the process with DNAse 159

(Qiagen). 1 μl of the RNA was analyzed in a nanodrop 2000C (Thermo Scientific). 160

Reverse transcription 161

1 μg of RNA was retrotranscribed to cDNA using the High Capacity cDNA 162

Reverse Transcription kit (Applied Biosystems) according to manufacturer’s instructions. 163

Quantitative PCR (qPCR) 164

We used the Roche Universal library probe #7 and EVM166-specific 165

oligonucleotides gtgcaaagtgtccgcctatt and tctattaagaggtcgtctagtctttcc as indicated by the 166

manufacturer. Briefly, 1 μl of the cDNA from the reverse transcription reactions was used 167

as template. The PCR reactions were performed in a MX3005P (Agilent Technologies), 168

or a Mastercycler ep realplex2 (Eppendorf). The expression was normalized by GAPDH 169

expression and quantified using a standard curve generated with a plasmid containing 170

the EVM166 gene. 171

on April 5, 2019 by guest

http://jvi.asm.org/

Dow

nloaded from

9

Immunohistochemistry 172

Viral foci were detected using EVM135 rabbit antisera as described previously 173

(43). 174

Statistics 175

We used Prism software to determine significance of the differences between 176

groups. For survival experiments each group consisted of five mice. We determined 177

significant differences using the Log-rank test. For dot plots, each point represents an 178

individual mouse and differences were determined using the Mann-Whitney test or a 179

two-tailed unpaired t test as applicable. In all experiments P ≤ 0.05 = *, P ≤ 0.01=**, P ≤ 180

0.001=***, P ≤ 0.0001=****. All experiments were repeated a minimum of two but in most 181

cases three times. 182

183

184

Results 185

L1R A33R and B5R monoclonal antibodies (mAbs) recognize the ECTV ortholog 186

proteins and block their biological function 187

Previous work in several laboratories including ours has shown that immunization 188

against the EV proteins A33R/EVM135 and/or B5R as well as the MV protein L1R alone 189

or in combination can protect mice against intranasal VACV and/or ECTV and primates 190

against MPXV infection (9, 14, 22-28, 39) . Additional work showed that polyclonal Abs 191

(pAbs) or mAbs to these proteins alone or in combination can protect from intranasal 192

on April 5, 2019 by guest

http://jvi.asm.org/

Dow

nloaded from

10

VACV before or soon after infection (3, 11, 29). However, whether Ab treatment can 193

cure natural OPV infections after becoming systemic has not been explored. Given that 194

OPVs are antigenically similar, we tested a panel of VACV L1R, A33R and B5R mAbs 195

for reactivity to their respective ECTV orthologs EVM072, EVM135 and EVM155. The 196

L1R mAb VMC-2 reacted similarly in ELISA assays with plate bound VACV and ECTV 197

particles suggesting identical binding to L1R and EVM072 (Figure 1a). Plate-bound 198

recombinant A33R and EVM135 were recognized similarly by the A33R mAb VMC-78 199

(Figure 1b), and plate-bound recombinant B5R and EVM072 were also similarly 200

recognized by the B5R mAb VMC-14 (Figure 1c). 201

We have previously shown that VMC-2 (anti-L1R/EVM072) neutralized VACV 202

stocks which contain mostly MV (2). We now found that, as compared with no Ab VMC-2 203

also neutralized ECTV stocks in plaque reduction assays while the anti-A33R/EVM135 204

VMC-78 or the anti-B5R/EVM155 VMC-14 did not. Control polyclonal rabbit anti-L1R 205

(rL1R) also neutralized ECTV while rabbit EVM155 antisera (rEVM155) did not (Figure 206

1d). As expected, the A33R/EVM135 VMC-78 mAb and the B5R/EVM155 VMC14 mAb 207

inhibited comet formation in liquid media (Figure 1e top), a sign of distant EEV-208

dependent spread. Notably, not only control rEVM155 but also VMC-2 and rL1R 209

inhibited comet formation (Figure 1 e, bottom). In addition, VMC-14 partially neutralized 210

EV but VMC-78 or VMC-2 did not (reported as text). That anti-L1R Abs can inhibit 211

ECTV comet formation is somewhat surprising as it does not inhibit VACV comets. This 212

suggests differences in the spread of VACV and ECTV in tissue culture . The reasons 213

for this difference are unknown and grant future comparative studies. Nevertheless, from 214

these experiments we concluded that in addition to recognizing their respective VACV 215

targets; VMC-2, VMC-78 and VMC-14 also recognize and inhibit the biological function 216

of the respective ECTV orthologs EVM072, EVM135 and EVM155. 217

on April 5, 2019 by guest

http://jvi.asm.org/

Dow

nloaded from

11

Prophylactic treatment with mAbs to L1R/EVM072 and A33R/EVM135 but not 218

B5R/EVM155 protect mice from mousepox 219

We tested whether VMC-2, VMC-78 and VMC-14 could be used to prevent 220

mousepox. BALB/c mice were infected with 300 plaque forming units (pfu) ECTV in the 221

footpad, its natural route (18), and a few minutes later inoculated with 200 μg of the 222

different mAbs intraperitoneally (ip). We found that 200 µg VMC-2 and VMC-78 but not 223

VMC-14 significantly protected BALB/c mice from lethal mousepox (P=**, Figure 2a). 224

Protection with VMC-2 was more effective because the mice treated with this mAb did 225

not lose weight while those inoculated with VMC-78 did (Figure 2b). 226

Treatment with anti-L1R cures mice from mousepox when administered after 227

ECTV dissemination to the liver 228

We next determined when after infection ECTV becomes clearly established in 229

the liver of BALB/c mice infected with 300 pfu in the footpad. Immunohistochemical 230

analysis of liver sections showed few infection foci in the liver at 4 dpi and most were 231

comprised of a single cell. At 5 dpi, most foci were multicellular. During the following 232

days, the size of the individual foci gradually increased and finally coalesced to cover 233

most of the liver at 8-10 dpi. The increase in foci size was reminiscent of the growth of 234

viral plaques in semi-solid media and suggested that ECTV spread centrifugally to 235

nearby cells (Figure 2c). From these results we concluded that that, following infection 236

with 300 pfu in the footpad, ECTV is well established in the liver at 4-5 dpi. Thus, we 237

tested whether the different mAbs could cure mousepox when administered at these dpi. 238

BALB/c mice were treated with VMC-2, VMC-78 or mouse IgG1 at 4 or 5 dpi with 300 239

pfu in the footpad. All the mice treated with 200 µg VMC-2 at 4 or 5 dpi survived while all 240

those treated with 500 µg IgG1 succumbed. Mice treated with either 200 or 500 µg 241

on April 5, 2019 by guest

http://jvi.asm.org/

Dow

nloaded from

12

VMC-78 at 4 or 5 dpi were also significantly protected but in each group some mice 242

succumbed. Thus, together, VMC-78 was significantly less protective than VMC-2 (P=*, 243

Figure 2d). When organs from groups of mice treated with 200 µg mAbs at 5 dpi were 244

analyzed at 7 dpi (2 days after treatment) virus loads in the liver and spleen were 245

significantly lower in VMC-2 as compared to VMC-78 or IgG1 treated mice (Figure 2e). 246

Thus, treatment with anti-L1R/EVM072 mAb, was more effective at curing late 247

mousepox than treatment with anti-A33R/EVM135 mAb. In addition, 248

immunohistochemical analysis of the livers showed that the lesions in VMC-2 treated 249

mice at 7 dpi (2 days post-treatment) were fewer and smaller as compared with VMC-78 250

or IgG1 treated mice (Figure 2f) suggesting less efficient intrahepatic ECTV spread in 251

mice treated with VMC-2 than in mice treated with VMC-78 or IgG1. 252

To investigate whether the differential effects we were seeing were due to the 253

monoclonality of the Abs, we used rabbit antisera against VACV L1R (rL1R), ECTV 254

EVM135 (rEVM135) and EVM155 (rEVM155). Each antiserum reacted with its 255

respective target in ELISA. L1R antiserum was highly effective at reducing plaque and 256

comet formation while EVM-135 and EVM-155 antisera did not reduce plaques but 257

inhibited comets (Figure 1 and data not shown). When given at 0 dpi (Figure 2g, left) 258

L1R and EVM-135 but not EVM-155 antisera significantly protected BALB/c mice from 259

death (P=**). The protection afforded by L1R and EVM-135 antisera were not 260

significantly different. EVM-155 antiserum had significant protection but mostly by 261

delaying the time of death. At 2 dpi (Figure 2g, center), L1R and EVM135 but not 262

EVM155 antisera were protective. When given at 5 dpi, only the L1R antiserum was 263

protective (P=*, Figure 2g, right). In all cases, the positive control antiserum to the T1-264

IFNbp was protective (43) while naïve serum was not. Hence, the data with pAb confirm 265

that the MV protein EVM-072 is a better target for late Ab therapy than the EV proteins 266

on April 5, 2019 by guest

http://jvi.asm.org/

Dow

nloaded from

13

EVM-135 and EVM-155. Moreover, because rabbit Abs can activate mouse complement 267

in vivo to protect from VACV infection (11), these data suggests that the less effective 268

protection of the anti-EV mAbs was not due only to the lack of effector functions of the 269

IgG1 isotype. 270

Late control of ECTV by anti-L1R/EVM072 does not require antibody effector 271

functions 272

While unlikely because it is IgG1, an isotype with poor effector functions, it was 273

possible that mAb VMC-2 protected mice through antibody effector functions such as Fc-274

mediated antibody dependent cytotoxicity (ADCC) or Fc-dependent or -independent 275

complement (C’) activation. To test whether VMC-2 controlled ECTV through a 276

mechanism dependent on Fc receptors, B6.129P2-Fcer1gtm1Rav N12 (Fcer1γ-/-) which are 277

deficient in Fc receptor expression and signaling (34) were backcrossed to B6.D2-278

(D6Mit149-D6Mit15)/LusJ (B6.D2-D6) which are a C57BL/6 congenic strain susceptible 279

to mousepox (15). For unknown reasons, not all B6.D2-D6- Fcer1γ-/- succumbed to 280

mousepox suggesting that they are not as susceptible as the B6.D2-D6 parental strain 281

(reported as text). Still, B6.D2-D6- Fcer1γ -/- mice treated with VMC-2 at 5 dpi had 282

significantly lower ECTV loads in the liver and spleen (Figure 3a) as compared to those 283

treated with IgG1 indicating that VMC-2 reduced virus loads late in infection 284

independently of Fc receptors. To test whether C’ activation was required, ECTV 285

infected BALB/c mice were depleted of the C3 fraction of C’ with cobra venom factor 286

(CVF) administered three times (4, 11) . This treatment eliminated most C3 as 287

determined by ELISA (Figure 3b) and a similar schedule with a 33% lower dose has 288

been shown to fully inhibit C’ activity in mouse serum (11). All C3 depleted mice treated 289

on April 5, 2019 by guest

http://jvi.asm.org/

Dow

nloaded from

14

with VMC-2 survived mousepox while all control mice depleted of C3 but treated with 290

IgG1 succumbed (Figure 3c). 291

ECTV deficient in EV spreads in the liver and is lethal to severe combined 292

immunodeficient (SCID) mice. 293

The data above suggested that following LH spread, ECTV dissemination within 294

the liver is more dependent on MV than on EV. It has previously been shown that VACV 295

deficient in F13L is unable to make EV becoming manifest by its formation of small 296

plaques in tissue culture. It has also been demonstrated that VACV deficient in F13L is 297

highly attenuated (36). Very recently, we reported the generation of ECTV deficient in 298

EVM036 (ECTV-Δ036), the ortholog of VACV F13L. Similar to its VACV counterpart, 299

ECTV-Δ036 has a very small plaque phenotype in tissue culture indicating that EVs are 300

very important for ECTV spread in cultured cells. Furthermore, ECTV-Δ036 is non-301

pathogenic in immunocompetent BALB/c mice even at high doses (32). However, ECTV-302

Δ036 was lethal to SCID mice infected in the footpad (P=**, Figure 4a), but the time of 303

death was highly variable. This suggested that in the absence of adaptive immunity, an 304

OPV deficient in EV can still disseminate lympho-hematogenously albeit inefficiently. To 305

determine whether ECTV-Δ036 kills immunodeficient mice by replicating in the liver, we 306

infected SCID mice ip with a high dose of ECTV-Δ036 which permitted the rapid and 307

synchronized seeding of the liver. Under these conditions, ECTV-Δ036 was rapidly lethal 308

(P=**, Figure 4b) and transcripts of an ECTV gene (EVM166) in the liver and spleen 309

increased 104 fold from day 2 to day 6 suggesting rapid replication in these organs 310

(Figure 4c). Furthermore, immunohistochemical staining of the liver with Abs to EVM135 311

showed few infected cells at 2 dpi but massive infection at 8 dpi (Figure 4d) 312

demonstrating efficient EV-independent intrahepatic ECTV spread. 313

on April 5, 2019 by guest

http://jvi.asm.org/

Dow

nloaded from

15

Discussion 314

Given the threat of intentional release of variola virus, the zoonotic potential of 315

other OPVs, and the possible complications of the live smallpox vaccine, OPVs still 316

constitute a risk to human health. Hence, development of a cocktail of mAbs with the 317

potential of curing disseminated OPV disease and replacing VIG is of interest (40). Our 318

work here demonstrates that as measured by survival, viral loads and liver damage, 319

neutralizing Abs to the MV protein L1R/EVM072 are more effective than comet-inhibiting 320

Abs to the EV proteins A33R/EVM135 and B5R/EVM155 at controlling an otherwise 321

lethal ECTV when given after viral dissemination to susceptible but otherwise 322

immunocompetent mice. We have recently shown that blocking IgG1 mAbs to 323

B18R/EVM166, which encode a secreted, non-structural Type I interferon decoy 324

receptor, also cures mousepox when administered after viral dissemination (43). While 325

mAb VMC-78 to the EV protein A33R/EVM135 promoted survival when given at 5 dpi, it 326

did not significantly decrease virus loads or liver pathology 2 days after treatment. 327

Furthermore, mAb VMC-14 to the EV protein B5R/EVM155 Abs was not protective even 328

when given at the time of infection. These results were surprising because both proteins 329

have been shown to be good targets for vaccines in various ECTV and/or VACV models 330

(9, 11, 14, 22-29, 39). With the cautionary note that our experiment with ECTV do not 331

necessarily extend to every OPV, our results suggest that mAbs to L1R/EVM072 and to 332

B18R/EVM166 are both excellent candidates to be included in mAb cocktails for the late 333

treatment of OPV diseases, the former by controlling virus spread within tissues and the 334

latter by restoring Type I interferon signaling. The results also suggest that neutralizing 335

Abs to other MV proteins and blocking Abs to other secreted virulence factors should be 336

explored as additional components for a VIG replacement. 337

on April 5, 2019 by guest

http://jvi.asm.org/

Dow

nloaded from

16

It has been recently shown that a major mechanism whereby Abs to EV protect 338

from VACV is through the activation of complement (3, 4, 11), and all our mAbs are 339

IgG1, which are known to lack effector functions. Thus, it is possible that the deficient 340

protection by VMC-14 and VMC-78 that we observed is due to their isotype and this 341

could be explored using IgG2 mAbs. However, this doesn’t seem to be the only reason 342

because rabbit anti-L1R was also more potent and rabbit Abs have been shown capable 343

of using complement to help protect from VACV (11). It would also be of interest to test 344

these Abs in the recovery from infections with OPVs other than ECTV and VACV. In 345

addition, it is possible that combinations of specific EV, MV and virulence factor mAbs of 346

various isotypes will be even more effective at curing late mousepox than single Ab 347

therapy or VIG and this could be tested. 348

It is also important to note that we do not think that the L1R Abs can clear ECTV 349

singlehandedly. Rather, we think that passive immunization temporarily reduces virus 350

loads allowing for the development of active immunity. This is supported by our previous 351

reports that passive transfer of Abs or memory T cells protect only immunocompetent 352

hosts from mousepox (42, 43) and a report by Lustig et al showing that VIG does not 353

permanently protect SCID mice from VACV challenge (30). 354

Work with the prototypic OPV VACV established the current model that MVs are 355

important for initial OPV infection while EVs are essential for their spread within the host 356

(31, 33). Our results indicate that, at least for ECTV, this model must be revised. While 357

the possibility that some EVs are produced in the absence of EVM036 cannot be 358

discarded, our finding that ECTV-Δ036 eventually kills SCID mice when inoculated into 359

the footpad strongly suggests that EVs are very important albeit not absolutely essential 360

for LH spread. Unexpectedly, we also showed that L1R/EVM072 mAb protects from 361

on April 5, 2019 by guest

http://jvi.asm.org/

Dow

nloaded from

17

lethal mousepox by curtailing intrahepatic spread and that ECTV deficient in EVM036 362

rapidly disseminates within the liver of immunodeficient mice. Thus, our experiments 363

suggest a model where EVs are important in the initial LH spread while MVs are key for 364

ECTV intrahepatic spread. While the liver is not thought to be a target for VARV or other 365

human OPV infections, our work suggests the chance that other OPVs preferentially use 366

MV to spread within their target organs. The development of effective and reliable anti-367

OPV therapies for late exposure requires testing for this previously unsuspected 368

possibility. 369

Acknowledgements 370

We thank Fox Chase Cancer Center Laboratory Animal and Tissue Culture 371

Facilities for their services and Ms. Holly Gillin for assistance in the preparation of the 372

manuscript. This work was supported by NIAID grant U19AI083008 to LJS, NCI grant 373

P30CA006927 to FCCC and by a generous gift from the Kirby Foundation to the FCCC 374

Inflammation Group. 375

376

on April 5, 2019 by guest

http://jvi.asm.org/

Dow

nloaded from

18

377

References 378

1. Aldaz-Carroll, L., J. C. Whitbeck, M. Ponce de Leon, H. Lou, L. Hirao, S. N. 379 Isaacs, B. Moss, R. J. Eisenberg, and G. H. Cohen. 2005. Epitope-mapping 380 studies define two major neutralization sites on the vaccinia virus extracellular 381 enveloped virus glycoprotein B5R. J Virol 79:6260-6271. 382

2. Aldaz-Carroll, L., J. C. Whitbeck, M. Ponce de Leon, H. Lou, L. K. Pannell, J. 383 Lebowitz, C. Fogg, C. L. White, B. Moss, G. H. Cohen, and R. J. Eisenberg. 384 2005. Physical and immunological characterization of a recombinant secreted 385 form of the membrane protein encoded by the vaccinia virus L1R gene. Virology 386 341:59-71. 387

3. Benhnia, M. R., M. M. McCausland, J. Laudenslager, S. W. Granger, S. Rickert, 388 L. Koriazova, T. Tahara, R. T. Kubo, S. Kato, and S. Crotty. 2009. Heavily 389 isotype-dependent protective activities of human antibodies against vaccinia 390 virus extracellular virion antigen B5. J Virol 83:12355-12367. 391

4. Benhnia, M. R., M. M. McCausland, J. Moyron, J. Laudenslager, S. Granger, S. 392 Rickert, L. Koriazova, R. Kubo, S. Kato, and S. Crotty. 2009. Vaccinia virus 393 extracellular enveloped virion neutralization in vitro and protection in vivo depend 394 on complement. J Virol 83:1201-1215. 395

5. Blasco, R., and B. Moss. 1991. Extracellular vaccinia virus formation and cell-to-396 cell virus transmission are prevented by deletion of the gene encoding the 397 37,000-Dalton outer envelope protein. J Virol 65:5910-5920. 398

6. Blasco, R., and B. Moss. 1992. Role of cell-associated enveloped vaccinia virus 399 in cell-to-cell spread. J Virol 66:4170-4179. 400

7. Bray, M. 2003. Pathogenesis and potential antiviral therapy of complications of 401 smallpox vaccination. Antiviral research 58:101-114. 402

8. Bray, M., and M. E. Wright. 2003. Progressive vaccinia. Clinical infectious 403 diseases : an official publication of the Infectious Diseases Society of America 404 36:766-774. 405

9. Buchman, G. W., M. E. Cohen, Y. Xiao, N. Richardson-Harman, P. Silvera, L. J. 406 DeTolla, H. L. Davis, R. J. Eisenberg, G. H. Cohen, and S. N. Isaacs. 2010. A 407 protein-based smallpox vaccine protects non-human primates from a lethal 408 monkeypox virus challenge. Vaccine 28:6627-6636. 409

10. Chapman, J. L., D. K. Nichols, M. J. Martinez, and J. W. Raymond. 2010. Animal 410 models of orthopoxvirus infection. Vet Pathol 47:852-870. 411

on April 5, 2019 by guest

http://jvi.asm.org/

Dow

nloaded from

19

11. Cohen, M. E., Y. Xiao, R. J. Eisenberg, G. H. Cohen, and S. N. Isaacs. 2011. 412 Antibody against extracellular vaccinia virus (EV) protects mice through 413 complement and Fc receptors. PloS one 6:e20597. 414

12. Cono, J., C. G. Casey, D. M. Bell, C. Centers for Disease, and Prevention. 2003. 415 Smallpox vaccination and adverse reactions. Guidance for clinicians. MMWR. 416 Recommendations and reports : Morbidity and mortality weekly report. 417 Recommendations and reports / Centers for Disease Control 52:1-28. 418

13. Esteban, D. J., and R. M. Buller. 2005. Ectromelia virus: the causative agent of 419 mousepox. J Gen Virol 86:2645-2659. 420

14. Fang, M., H. Cheng, Z. Dai, Z. Bu, and L. J. Sigal. 2006. Immunization with a 421 single extracellular enveloped virus protein produced in bacteria provides partial 422 protection from a lethal orthopoxvirus infection in a natural host. Virology 423 345:231-243. 424

15. Fang, M., M. T. Orr, P. Spee, T. Egebjerg, L. L. Lanier, and L. J. Sigal. 2011. 425 CD94 is essential for NK cell-mediated resistance to a lethal viral disease. 426 Immunity 34:579-589. 427

16. Fang, M., and L. J. Sigal. 2005. Antibodies and CD8+ T Cells Are 428 Complementary and Essential for Natural Resistance to a Highly Lethal 429 Cytopathic Virus. J Immunol 175:6829-6836. 430

17. Fang, M., and L. J. Sigal. 2006. Direct CD28 Costimulation Is Required for CD8+ 431 T Cell-Mediated Resistance to an Acute Viral Disease in a Natural Host. J 432 Immunol 177:8027-8036. 433

18. Fenner, F. 1994. Mousepox (ectromelia), p. 412. In A. Osterhaus (ed.), Virus 434 infections of rodents and lagomorphs, vol. 5. Elsevier Science, Amsterdam ; New 435 York. 436

19. Fenner, F., D. A. Henderson, I. Arita, Z. Jezek, D. Ladnyi, and W. H. 437 Organization. 1988. Smallpox and its eradication. World Health Organization, 438 Geneva. 439

20. Fields, B. N., D. M. Knipe, and P. M. Howley. 2007. Fields' virology, 5th ed. 440 Wolters kluwer/Lippincott Williams & Wilkins, Philadelphia. 441

21. Flint, S. J., and American Society for Microbiology. 2009. Principles of virology, 442 3rd ed. ASM Press, Washington, DC. 443

22. Fogg, C., S. Lustig, J. C. Whitbeck, R. J. Eisenberg, G. H. Cohen, and B. Moss. 444 2004. Protective immunity to vaccinia virus induced by vaccination with multiple 445 recombinant outer membrane proteins of intracellular and extracellular virions. J 446 Virol 78:10230-10237. 447

on April 5, 2019 by guest

http://jvi.asm.org/

Dow

nloaded from

20

23. Golden, J. W., and J. W. Hooper. 2011. The strategic use of novel smallpox 448 vaccines in the post-eradication world. Expert review of vaccines 10:1021-1035. 449

24. Heraud, J. M., Y. Edghill-Smith, V. Ayala, I. Kalisz, J. Parrino, V. S. 450 Kalyanaraman, J. Manischewitz, L. R. King, A. Hryniewicz, C. J. Trindade, M. 451 Hassett, W. P. Tsai, D. Venzon, A. Nalca, M. Vaccari, P. Silvera, M. Bray, B. S. 452 Graham, H. Golding, J. W. Hooper, and G. Franchini. 2006. Subunit recombinant 453 vaccine protects against monkeypox. J. Immunol. 177:2552-2564. 454

25. Hooper, J. W., D. M. Custer, C. S. Schmaljohn, and A. L. Schmaljohn. 2000. 455 DNA vaccination with vaccinia virus L1R and A33R genes protects mice against 456 a lethal poxvirus challenge. Virology 266:329-339. 457

26. Hooper, J. W., D. M. Custer, and E. Thompson. 2003. Four-gene-combination 458 DNA vaccine protects mice against a lethal vaccinia virus challenge and elicits 459 appropriate antibody responses in nonhuman primates. Virology 306:181-195. 460

27. Hooper, J. W., J. W. Golden, A. M. Ferro, and A. D. King. 2007. Smallpox DNA 461 vaccine delivered by novel skin electroporation device protects mice against 462 intranasal poxvirus challenge. Vaccine 25:1814-1823. 463

28. Hooper, J. W., E. Thompson, C. Wilhelmsen, M. Zimmerman, M. A. Ichou, S. E. 464 Steffen, C. S. Schmaljohn, A. L. Schmaljohn, and P. B. Jahrling. 2004. Smallpox 465 DNA Vaccine Protects Nonhuman Primates against Lethal Monkeypox. J Virol 466 78:4433-4443. 467

29. Lustig, S., C. Fogg, J. C. Whitbeck, R. J. Eisenberg, G. H. Cohen, and B. Moss. 468 2005. Combinations of polyclonal or monoclonal antibodies to proteins of the 469 outer membranes of the two infectious forms of vaccinia virus protect mice 470 against a lethal respiratory challenge. J Virol 79:13454-13462. 471

30. Lustig, S., G. Maik-Rachline, N. Paran, S. Melamed, T. Israely, N. Erez, N. Orr, 472 S. Reuveny, A. Ordentlich, O. Laub, A. Shafferman, and B. Velan. 2009. 473 Effective post-exposure protection against lethal orthopoxviruses infection by 474 vaccinia immune globulin involves induction of adaptive immune response. 475 Vaccine 27:1691-1699. 476

31. Payne, L. G. 1980. Significance of extracellular enveloped virus in the in vitro and 477 in vivo dissemination of vaccinia. J Gen Virol 50:89-100. 478

32. Roscoe, F., R. H. Xu, and L. J. Sigal. 2012. Characterization of Ectromelia Virus 479 Deficient in EVM036, the Homolog of Vaccinia virus F13L, and its Application for 480 the Rapid Generation of Recombinant Viruses. J Virol. 481

33. Smith, G. L., A. Vanderplasschen, and M. Law. 2002. The formation and function 482 of extracellular enveloped vaccinia virus. J Gen Virol 83:2915-2931. 483

34. Takai, T., M. Li, D. Sylvestre, R. Clynes, and J. V. Ravetch. 1994. FcR gamma 484 chain deletion results in pleiotrophic effector cell defects. Cell 76:519-529. 485

on April 5, 2019 by guest

http://jvi.asm.org/

Dow

nloaded from

21

35. Virgin, H. W. 2007. Pathogenesis of viral infection, p. 335-336. In B. N. Fields, D. 486 M. Knipe, and P. M. Howley (ed.), Fields' virology, 5th ed, vol. 1. Wolters 487 kluwer/Lippincott Williams & Wilkins, Philadelphia. 488

36. Vliegen, I., G. Yang, D. Hruby, R. Jordan, and J. Neyts. 2012. Deletion of the 489 vaccinia virus F13L gene results in a highly attenuated virus that mounts a 490 protective immune response against subsequent vaccinia virus challenge. 491 Antiviral research 93:160-166. 492

37. Wallace, G. D., and R. M. Buller. 1985. Kinetics of ectromelia virus (mousepox) 493 transmission and clinical response in C57BL/6j, BALB/cByj and AKR/J inbred 494 mice. Laboratory animal science 35:41-46. 495

38. Wittek, R. 2006. Vaccinia immune globulin: current policies, preparedness, and 496 product safety and efficacy. International journal of infectious diseases : IJID : 497 official publication of the International Society for Infectious Diseases 10:193-498 201. 499

39. Xiao, Y., L. Aldaz-Carroll, A. M. Ortiz, J. C. Whitbeck, E. Alexander, H. Lou, H. L. 500 Davis, T. J. Braciale, R. J. Eisenberg, G. H. Cohen, and S. N. Isaacs. 2007. A 501 protein-based smallpox vaccine protects mice from vaccinia and ectromelia virus 502 challenges when given as a prime and single boost. Vaccine 25:1214-1224. 503

40. Xiao, Y., and S. N. Isaacs. 2010. Therapeutic Vaccines and Antibodies for 504 Treatment of Orthopoxvirus Infections. Viruses 2:2381-2403. 505

41. Xu, R. H., M. Cohen, Y. Tang, E. Lazear, J. C. Whitbeck, R. J. Eisenberg, G. H. 506 Cohen, and L. J. Sigal. 2008. The orthopoxvirus type I IFN binding protein is 507 essential for virulence and an effective target for vaccination. J Exp Med 508 205:981-992. 509

42. Xu, R. H., M. Fang, A. Klein-Szanto, and L. J. Sigal. 2007. Memory CD8+ T cells 510 are gatekeepers of the lymph node draining the site of viral infection. 511 Proceedings of the National Academy of Sciences of the United States of 512 America 104:10992-10997. 513

43. Xu, R. H., D. Rubio, F. Roscoe, T. E. Krouse, M. E. Truckenmiller, C. C. Norbury, 514 P. N. Hudson, I. K. Damon, A. Alcami, and L. J. Sigal. 2012. Antibody inhibition 515 of a viral type 1 interferon decoy receptor cures a viral disease by restoring 516 interferon signaling in the liver. PLoS pathogens 8:e1002475. 517

518

519

520

on April 5, 2019 by guest

http://jvi.asm.org/

Dow

nloaded from

22

Figures and legends 521

Figure 1. L1R A33R and B5R mAbs recognize the ECTV ortholog proteins 522

and block their biological function. a) L1R mAb VMC-2 was compared for reactivity 523

with plated VACV and ECTV viral particles. The Kd calculated with Prism software using 524

non-linear fit is indicated. b) As in A but using A33R mAb VMC-78 and purified 525

recombinant EVM135 and A33R in the ELISA. c) As in B but using B5R mAb VMC-14 526

and purified recombinant B5R and EVM155 in the ELISA. d) Plaque reduction assay 527

after treatment of ECTV stocks with mAbs or rabbit antisera as indicated. e) Comet 528

inhibition in the presence of the indicated mAbs or rabbit antisera. The pictures at the top 529

are from one experiment and the pictures at the bottom are from another one. 530

Figure 2. Prophylactic and post-exposure treatment with L1R/EVM72 mAb 531

protects from mousepox. a) BALB/c mice were infected with ECTV and immediately 532

treated with 200 µg of the indicated mAbs. Survival was monitored. b) The mice in A 533

were weighed at the indicated dpi. c) Liver sections from BALB/c mice infected with 534

ECTV were stained with anti-EVM135 at the indicated dpi. d) BALB/c mice were infected 535

with ECTV and treated with the indicated mAbs and doses at the indicated dpi. Survival 536

was monitored. e) BALB/c mice were infected with ECTV, treated with the indicated 537

mAbs at 5 dpi and virus titers determined in the indicated organs at 7 dpi. f) 538

Immunohistochemistry of the livers from the mice in e. g) Mice were infected with ECTV 539

and treated at the indicated dpi with the indicated rabbit sera. Survival was monitored. 540

Figure 3. Late control of ECTV by anti-L1R/EVM072 does not require 541

antibody effector functions. a) Virus titers at 7 dpi in the indicated organs of B6.D2-542

D6- Fcer1γ0/0 mice treated with the indicated mAbs at 5 dpi. b) C3 determined by ELISA 543

at the indicated dpi in the serum of BALB/c mice infected with ECTV and treated with 544

on April 5, 2019 by guest

http://jvi.asm.org/

Dow

nloaded from

23

with cobra venom factor (CVF) at 4, 6 and 8 dpi. c) Survival of BALB/c mice infected 545

with ECTV and treated with the indicated mAbs at 5 dpi and with CVF at 4, 6 and 8 dpi. 546

Figure 4. ECTV unable to make enveloped virus spreads in the liver and is 547

lethal to severe combined immunodeficient (SCID) mice. a) SCID mice were infected 548

with the indicated doses of ECTV-WT or ECTV-D036 in the footpad. Survival was 549

monitored. b) As in a but infected intraperitoneally. c) SCID mice were infected with 106 550

pfu ECTV-Δ36 ip. At 5 dpi copy numbers of transcripts of the ECTV gene EVM166 were 551

determined by qPCR in the indicated organs. d) SCID mice were infected with 106 pfu 552

ECTV-Δ36 and immunohistochemistry with anti-EVM135 sera was performed at the 553

indicated dpi. 554

on April 5, 2019 by guest

http://jvi.asm.org/

Dow

nloaded from

VMC-78

10 - 4 10 - 3 10 - 2 10 - 1 100 101 102 103-0.5

0.0

0.5

1.0

1.5

2.0

2.5

3.0

3.5

4.0

A33R Kd=0.015 nM

EVM135 Kd=0.013 nM

Antibody concentration(nM)

VMC-2

10 - 4 10 - 3 10 - 2 10 - 1 100 10 1

0.0

0.2

0.4

0.6

VV Kd=0.029 nM

ECTV Kd=0.029 nM

Antibody Concentration (nM)

OD

450nm

a b

VMC-14

10 - 4 10 - 3 10 - 2 10 - 1 100 101 102 103-0.5

0.0

0.5

1.0

1.5

2.0

2.5

3.0

3.5

4.0

B5R Kd=0.043 nM

EVM155 Kd=0.056 nM

Antibody concentration(nM)

c

Figure 1

e VMC-78 VMC-14No mAb

rEVM155rL1RNo Ab VMC-2

d

VMC-78 VMC-14 rEVM155rL1RNo Ab VMC-2

on April 5, 2019 by guest

http://jvi.asm.org/

Dow

nloaded from

dpi0 05 10 15 20 25

0

20

40

60

80

100

VMC-2

VMC-78

VMC-14

IgG1

Perc

ent surv

ival

PBS

5 10 15 20 25

80

90

100

110

120

VMC-2

VMC-78

dpi

% in

itia

l w

eig

ht

a

c

f

g

b

0 4 8 12 16

0

20

40

60

80

100 IgG1

200 ug VMC-2 at 4 dpi

200 ug VMC-2 at 5 dpi

200 ug VMC-78 at 4 dpi

500 ug VMC-78 at 4 dpi

500 ug VMC-78 at 5 dpi

dpi

Perc

ent surv

ival

d eSpleen (organ) Liver (gram)

IgG1 VMC-2 VMC-14VMC-78

IgG1 VMC-2 VMC-14 VMC-78

6

7

8

9

**** **

IgG1 VMC-2 VMC-14 VMC-78

0

2

4

6

8

10

Lo

g10 v

iru

s t

ite

r

****

****

****

** *

4 dpi 5 dpi 6 dpi 7 dpi 8 dpi 10 dpi3 dpiUninfected

40X

200X

0 5 10 15 20dpidpi dpi

0 5 10 15 20

Perc

ent sur v

ival

0 5 10 15 20

0

20

40

60

80

1000 dpi 2 dpi 5 dpi

Naïve

T1-IFNbp

EVM135

EVM155

L1R

Antisera

Figure 2

on April 5, 2019 by guest

http://jvi.asm.org/

Dow

nloaded from

IgG1 VMC-2

2

4

6

8

10

Lo

g10 v

iru

s(/

sp

lee

n) *

Spleena

IgG1 VMC-2

2

4

6

8

10

Lo

g10 v

iru

s/g

***

Liver

C3

ng

/ml

0 5 10 15 20

0

20

40

60

80

100

VMC-2 + CVF + ECTV

IgG1 + CVF + ECTV

dpi

Pe

rce

nt

su

rviv

al

cb

5 dpi

ECTV ECTV+CVF10 5

10 6

10 78 dpi

ECTV ECTV+CVF10 5

10 6

10 7

**** **

Figure 3

on April 5, 2019 by guest

http://jvi.asm.org/

Dow

nloaded from

EV

M166 C

op

ies/n

g R

NA

(L

og

10

)

dpi dpi2 5

0

2

4

6

8

10

2 50

2

4

6

8

10Liver Spleen

0 10 20 30 40 50 600

20

40

60

80

100

dpi

Pe

rce

nt

su

rviv

al

ECTV-WT

ECTV-∆036

0 5 10 15 20 25

ECTV-∆036 (105 pfu)

ECTV-∆036 (106 pfu)

ECTV-WT (104 pfu)

ECTV-WT (105 pfu)

dpi

Footpad (3,000 pfu) Intraperitoneal

0 dpi 2 dpi 5 dpi 7 dpi 8 dpi

40X

200X

a b c

d

*** ***

Figure 4

on April 5, 2019 by guest

http://jvi.asm.org/

Dow

nloaded from