THE JOURNAL OF BIOLOGICAL CHEMISTRY 0 1988 by The American Society for Biochemistry and Molecular Biology, Inc.

Vol. 263, No. 14, Issue of May 15, pp. 65384546,1988 Printed in U. S. A.

Primary Structure of the Archaebacterial Methanococcus vannielii Ribosomal Protein L 12 AMINO ACID SEQUENCE DETERMINATION, OLIGONUCLEOTIDE HYBRIDIZATION, AND SEQUENCING OF THE GENE*

(Received for publication, November 17,1987)

Olaf Strobel$, Andreas K. E. Kopkeg, Roza M. Kampg, August Bock$, and Brigitte Wittmann-LieboldgT From the §Man-Planck-Znstitut fur Molekulare Genetik, Abteilung Wittmann, Zhnestrabe 73, 1000 Berlin 33 (Dahlem) and the SLehrstuhl fur Mikrobiologie der Uniuersitat Munchen, Munchen, West Germany

The primary structure of ribosomal protein L12 from Methanococcus vannielii has been determined by direct amino acid sequence analysis with automated liquid phase Edman degradation of the entire protein and manual 4-N,N’-dimethylaminoazobenzene-4’-iso- thiocyanate/phenylisothiocyanate sequencing of frag- ments obtained by enzymatic digestion and by partial acid hydrolysis. The knowledge of the amino acid se- quences of these various fragments allowed the synthe- sis of two oligonucleotide probes complementary to the 6’- and the 3’-end of the gene, and they were used for hybridization with digested M. vannielii chromosomal DNA. Both oligonucleotide probes gave similar and clear hybridization signals. The plasmid pMvaXl con- taining the entire gene of protein L12 was obtained. The nucleotide sequence complemented the partial amino acid sequence, and it is in full agreement with the protein sequence and the amino acid analysis.

Comparison of secondary structural elements and hydrophobicity plots of the M. vannielii protein L12 with the known L12 sequences derived from other archaebacterial and eukaryotic sources show strong homologies among these sequences. They contain an exceptional highly conserved hydrophilic sequence area in the C-terminal part of the proteins. In compar- ison with eubacterial L12 proteins, the conservation is reduced to single amino acid residues. However, the eubacterial L12 proteins have hydrophilic regions sim- ilar to those of L12 from M. uannielii. These regions are predicted to be located at the surface of the pro- teins, as has been proven to be the case in crystallized Escherichia coli L12 protein. It is possible that the strongly conserved hydrophilic sequence regions form part of the factor-binding domain.

Ribosomes are present in all types of cells; on that account, they are useful organelles for studying the evolution of the organisms. The examination and comparison of ribosomes deriving from eubacterial, eukaryotic, and archaebacterial sources is challenging, since they vary considerably in size, net charge, and the number of their constituents (for review,

* The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “aduertisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

The nucleotide sequence(s) reported in this paper hos been submitted

5031 8 7. to the Gen3ankTM/EM3L Datu Bank with accession numberfs)

ll To whom correspondence should be addressed.

see Wittmann, 1986). Furthermore it is of interest to deter- mine the conserved parts of the ribosomal RNA and protein chains which should be mainly involved in the protein biosyn- thesis process of the ribosome.

It has been proposed that eubacteria, eukaryotes, and ar- chaebacteria have evolved independently from each other. Since Woese and Fox (1977) postulated the existence of these three independent kingdoms of organisms, efforts have been made to compare various biochemical parameters, e.g. nucleic acid or protein sequences (for review, see Matheson, 1985). For such comparative studies it is necessary to investigate several representatives of these kingdoms and, in the case of sequence comparison, to have complete sets of data. Compar- ison of ribosomal protein sequences derived from the different kingdoms have so far shown that the proteins derived from eubacteria are homologous to each other with varying degrees of similarity (up to 70% identities) depending on the ribo- somal protein examined (for review, see Wittmann-Liebold, 1986). The same similarity is found among eukaryotic ribo- somal proteins, e.g. those derived from yeast, Artemia salina, or rat. On the other hand, it is more difficult to correlate ribosomal protein sequences derived from eukaryotes with corresponding sequences of prokaryotes. Only recently, ribo- somal proteins from archaebacterial sources have been se- quenced completely. Interestingly, some of these sequences show similarities with eukaryotic ribosomal proteins and oth- ers with eubacterial proteins (Kimura and Langner, 1984; Arndt et al., 1986).

However, in some instances archaebacterial ribosomal pro- tein sequences do not show clear correspondence to either of the two other kingdoms (Kimura and Kimura, 1987; Hatak- eyama and Kimura, 1987). This may be due in part to incom- plete sets of sequence data known yet, especially in case of eukaryotic and archaebacterial ribosomal proteins. Further- more, it might be possible that ribosomes of archaebacteria possess a few additional proteins not present in those of other kingdoms, attributing to their special environmental adapta- tions.

Among the ribosomal proteins studied so far, many homol- ogous sequences are available only for protein L7/L12 which constitutes the “stalk” protuberance of the Escherichia coli ribosomal large subunit (Strycharz et al., 1978; Stoffler and Stoffler-Meilicke, 1984) and is the only protein present in four copies (Subramanian, 1975; Moller et al., 1983; Lee et al., 1981). Since this protein can be isolated under special condi- tions employing salt extraction (Hamel et al., 1972), it is available in relative high yield and thus allows sequence analysis even in cases where the cells and their ribosomes are

6538

Ribosomal Protein L12 of Archuebacterium Methunococcus a 20

Met-Glu-Tyr-Ilc - T y r - A l ~ - A l ~ - L w - L a r - L w - P l u l - ~ r - A l a - A ~ - L y . - G l u - V . l - T h r - O * I - G l u - A I ~ - H I - L y ~ - A l a - V ~ l -

brrwrrF"rrr"L7 L P M

1 1 13 "rV"rPrP

7 7 7 7 7 7

l a

CH 1

, 7 7 7 7 7 7

7 7 7 7 7 7 7 7 7 ~ cn 3

7 7 7 cn a

7 7 7 7 , s P 1

7 7 SP2

Th 1 Th 2 7 7

7 7

, Th l2 7 7 7 7

Th 13 7 7 7 7 7 7 7 7

" 7

Th 3

Th 4 Th 11

nls 3 7 7 7 7

30 40 Leu - HI - Ala - Gly - Gly - Ib - Ob - Ala - AM - AS^- A b - A- - H I - L y . - Ala - LOU - HI - Ah - A b - L w - WU - Gly - HI - ASP- Ik -

LPSD , r r

13 7 7 7 7 - 7 7 7 7 7 7 7

14 7 7 7

T5 I 7 7 7 7 7 7 7 7 7 7 7

QQ*7cH: 7 -7 7 7 7 7 7 7 7 ' 7 7 7 7 7 7 7 7 7 . CHS

SP a

Th 5 CH 0

, , sP3 7 7 7 7 7

- 7

Th 6

7 7 7 7 7 7 7 7 7 7 7

Th I Th O 7 7 7 7 7 7 7 7

7 7 7 Th U

HAC 1 W Z 7 7 7 7 7 7 7 7 7 e+

~h - Gb - A h - I* - Ab - Lys - A h - A h - IIc - Ala - Pro - Val - A h - Ala - Ala - A h - pto - Val - A h - Ala - Ala - A h - A h - Pro - A h - M m

1 4 T O

1 5

CH 5 cns

C n P

7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 -

7

7 7 7 7 7 7 7 7 " 7 7 7 7 7 " 7 7 7 7 7 1 7 7 7 - 7

7 7 7 7 7 7 7 7 7 - 7 7 7 7 7 7 - 7 7 7 1 7 7 7 7

7" 7 7 7 1 7 7 7 7 c n 7

c n 8 7 7 - 7 7 - 7 1 7 7

7.

5P3 spa

Th 8 Tho

W 3

7 7 7 7 7 7 7 7 7 7 7 SP 5

" 7 7 7 7 7 7 7 "

7 7 7

7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 1 7

ws 3-SP 1 7 7 7 7 7 7 7 - 7 7 7 7 7 7 7 7 7 - 7 7 7 7 7

m G ~ - V . l - L y ~ - L y s - G * l - W u - L y r - L y ~ - G * I - A . p - T h r - T h r - A l a - A I a - A h - A h - A h - G l y - L . u - G I ~ - A h - L . u - P h e - U e t

W

16 T I TO 7 7" 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7

T O

TO 7 7 7 -

7 7 7 " 7 7 7 " 7 7 7 7 7 " 7 " 7 7 7 7

cn s 7-7

c n 7

CH 8

SF3 SPO

% Th 0

" 7 7 7 7 7 7 7 7 7 7 7

7-7

nrc 3 * 4 7 - 7 7 7 7 7 7 7 7 7 7 7 7 7

H k 4.W I w r 3 - z p l , " 7 7 7 7 7 7 7 7 7 7 7

W r 4 - c n a

" " W C R S E v

FIG. 1. Primary structure determination of M. mnnielii L12 protein. Symbols: v, N-terminal auto- mated liquid phase sequencing; -, manual 4-N,N"dimethylaminoazobenzene-4'-isothiocyanate/phenylisothiocy- anate sequencing -O , carboxypeptidase Y (CPASE Y) digestion of the entire protein. The abbreviations used for peptides are: T, trypsin; CH, chymotrypsin; SP, S. aureus protease; Th, thermolysin; HAC, partial acid hydrolysis.

6540 Ribosomal Protein L12 of Archaebacterium Methanococcus 1 8

Met Glu Tyr Ile Tyr Ala GCN YTN ATG GAR TAY ATH TAY GCN Ala Leu

79 89

Lys lGlu Glu Lys Lys Glu Asp ThrlThr Ala Ala . . . AAR GAR GAR AAR AAR GAR GAY ACN ACN GCN GCN

Synthesized oligonucleotides:

a) ATGCAATACATATACCC degeneration: 24 G T C T

T T,(min) = 42OC

b) GTGTCTTCCTTCTTTTCTTC degeneration: 64

Tm(min) = 50°C A C T T C C

FIG. 2. Partial N-terminal amino acid sequence of protein L12 (residues 1-8) and of peptide T9 (residues 79-89), trans- lated into the nucleotide sequence. The sequence of the synthe- sized oligonucleotides is shown (mixtures of bases used for synthesis are written below each other).

3500 38'7

A B C D FIG. 4. Plasmid construct pMVAXl which is a 0.9-kb frag-

ment from ClaI digest of M. vunnielii DNA in pUC18, coding for the L7/L12 E. coli homologous ribosomal protein.

FIG. 3. Pattern of hybridization from oligo-LSC to M. van- nielii DNA digested with: A, EcoRI; B, HindIII; C, ClaI; D, Sau3A.

only obtainable in relatively low amounts. Schmid and Bock (1981) have described the ribosomal

protein pattern of Methanococcus vannielii. The L12 protein from this organism (originally named L8 in two-dimensional gel) was isolated and sequenced. In addition, we used the complementary nucleotide sequencing approach. In this pa- per, the complete amino acid sequence determination of the M. vannielii L12 protein is described together with the cloning and sequencing of the corresponding gene, detected by oligo- nucleotide hybridization. In addition, the comparison of this archaebacterial L12 protein with the L12 sequences from organisms of all three kingdoms is discussed.

EXPERIMENTAL PROCEDURES Materials-Trypsin, treated with L-1-tosylamido-2-phenylethyl

chloromethyl ketone, was purchased from Cooper, Freehold, PA; a-

Cia1 EcoRI Pst I Pstl PstI CLaI pMva X1 I I I I

9 x 3 ""4 '9uX3 k""

~"""-""""""""""" - FIG. 5. Cloned 0.9-kb M. vannielii CluI DNA fragment car-

rying the L12 gene. Restriction sites used for subcloning are shown in the upper part of the figure. In the lower part of the figure, the clones and the strategy used for sequencing are shown. The frame represents the protein coding region.

chymotrypsin was from Merck, Darmstadt (West Germany); ther- molysin was from Serva, Heidelberg (West Germany); and Staphy- lococcus aureus protease was from Miles, Slough (United Kingdom).

Polynucleotide kinase and all endonucleases were purchased from Boehringer Mannheim. The M13-3sS-sequencing kit was from Bio- labs, Beverly; [y3'P]ATP and [ C X - ~ ~ S I ~ A T P were supplied by Amer- sham, Buckinghamshire (United Kingdom). Genescreen membrane was from Du Pont-New England Nuclear. Agarose ultrapure, DNA- ligase, and E. coli DH5a strain were from Bethesda Research Labo- ratories. Some components of the growth media were from Difco. All other chemicals were proanalysis grade from Merck. Solvents and reagents for protein microsequencing were purified according to Witt- mann-Liebold (1983). All enzymes and the M13 sequencing kit were used under the conditions recommended by the supplier, unless otherwise specified.

The hydrophobicity plots, secondary structure predictions, and homology searches were done on a Vax computer with programs from the Genetics Computer Group (Devereux et al., 1984).

Protein Isolation and Sequencing-M. vannielii cells (DSM 1224) were prepared as described by Schmid and Bock (1981). Ribosomes were prepared as described by Wittmann (1974). Ribosomal protein L12 from 50 S subunits was isolated according to Hamel et al. (1972). The identity and purity of the protein were checked by two-dimen- sional polyacrylamide gel electrophoresis (Kaltschmidt and Witt- mann, 1970). Trypsin digests were performed at 37 "C and pH 8.1 in 0.1 M NMMA' buffer for 2 h. Digestions with a-chymotrypsin were performed at 37 "C and pH 8.1 for 4 h and with thermolysin at 53 "C

The abbreviations used are: NMMA, N-methylmorpholine ace- tate; HPLC, high-performance liquid chromatography; kb, kilobase; bp, basepair; TFA, trifluoroacetic acid.

Ribosomal Protein L12 of Archebacterium Methnococcus 6541

GCTGCAGGTCTTGGATTACTCTTCTAAAATTTTACCGAAAAAAATATATATGGAAATAAATAATTTCAAAAAAGAG~TCATACATCTTGGAGGTGTA

CTTTATGGAATACATATACGCAGCATTATTATTAAATTCAGCAAACAAAGAAGTAACCGAAGAAGCAGTTAAAGCAGTTTTAGTTGCAGGCGGTATC YetGluTyrIleTyrAlaAlaLeuLeuLeuAsnSerAlaAsnLysGluValThrGluGl~laValLysAlaValLeuValAlaGlyGlyIle

* * * * * * *

GAAGCTAACGATGCTAGAGTTAAAAGCATTAGTTGCAGCATTGGAAGGCGTTGACATTGCAGAAGCTATCGCAAAAGCTGCTATCGCACCAGTTGCAG GluAlaAsnAspAlaArgVa1LysAlaLsuValAlaAlaLeuGluGlyValAspIleAlaGluAlaIleAlaLysAlaAlaI1eAlaProValAlaAla-

CTGCTGCTCCTGTTGCAGCTGCTGCTGCTCCAGCTGAAGTTAAAAAAGAAGAAAAGAAGGAAGACACAACGGCTGCTGCAGCTGCAGGTCTTGG~ AlaAlaProValAlaAlaAlaAlaAlaProAlaGluValLysLysGluGluLysLysGluAspThrThrAlaAlaAlaAlaAlaGlyLeuGlyAla

TTTATTCATGTAATAAAGCTAAATTCCATTCTTT~TATTTTACCAAAATTAATTT LeuPheYetEnd

FIG. 6. Nucleotide and amino acid sequence of the ribosomal protein L12 from M. uannielii. The Shine Dalgarno sequence is marked (*) above the sequence. Terminator primary structure is underlined, and secondary structure formation is printed bold.

TABLE I Amino acid composition of the protein L12 from M. vannielii

determined by analysis with orthphthaldehyde precolumn derivatization (column 3) and with a Durrum 0-500

analyzer (column 4)

Amino Amino acid composition

acid Orthophthaldehyde Durrum analysis analysis Sequence

Asx 6 6.0 5.5 Glx 11 11.4 10.4 Ser 1 1.0 1.7 G ~ Y 5 5.3 5.0 Thr 3 2.8 2.7 Arg 1 1.1 0.7 Ala 33 33.8 33.2 TY r 2 2.1 1.8 Met 2 1.7 2.2 Val 10 9.0 10.4 Phe 1 0.9 0.8 Ile 5 5.1 5.1 Leu 8 7.7 8.1 LY s 8 8.1 8.3 Pro 3 n.d." (3.0) 3.1 Total 99 96.0 (99.0) 99.0

n.d., not determined.

and pH 8 for 2 h (NMMA buffer). For reasons of solutility, S. aurezu protease digests were made at 37 "C and pH 8 for 24 h also in 0.1 M NMMA buffer. The enzyme to substrate ratio was 1 to 50 in all experiments. Partial acid hydrolysis of protein L12 was done at 110 "C for 1 h in 2% aqueous acetic acid. Acid hydrolysis of protein L12 was done in 5.7 M HCI containing 0.02% 2-mercaptoethanol at 110 "C for 20,48, and 70 h, under vacuum. Amino acid analyses were performed on a Durrum D-500 analyzer and by HPLC using orthophthaldehyde precolumn derivatization (Ashman and Bosserhoff, 1985). The N- terminal region was sequenced in a Berlin liquid phase sequenator (Wittmann-Liebold, 1983) employing on-line detection of the phenyl- thiohydantoin derivatives by isocratic HPLC (Ashman and Witt- mann-Liebold, 1985). Manual degradations of the peptides were per- formed using the 4-N,N"dimethylaminoazobenzene-4'-isothiocya- nate/phenylisothiocyanate double coupling method according to Wittmann-Liebold et al. (1986).

DNA: Preparation and Blotting-". uannielii chromosomal DNA was prepared by the Sarkosyl method of Hofman et al. (1979). Total genomic digests were performed overnight. Gel electrophoresis of the digested chromosomal DNA (10 pg/lane) was carried out in 150 X 150 X 7 mm 0.8% agarose gels at 1.5 V/cm in TBE buffer (Maniatis et al., 1982) for 16 h. The DNA was denatured and transferred onto GeneScreen membranes essentially as described by Southern (1975) and Maniatis et al. (1982), but omitting the 0.5 M HCI treatment. Instead, the agarose gel was irradiated on a transilluminator (305 nm) for 5 min before blotting. The membranes were dried for 10 min at 90 "C, and DNA was cross-linked to the nylon membrane by UV illumination for 10 min, as described by Church and Gilbert (1984).

Preparation and Labeling of Oligonucleotides-Oligonucleotide mixtures were synthesized automatically on a DNA synthesizer (Ap- plied Biosystems, Forster City), purified on a Nucleosil C4 HPLC

column (16 X 250 mm inner diameter, 300 A pore size, 5 pm particle size) with a 100 mM triethylammonium acetate, pH 7/isopropyl alcohol gradient (similar to Becker ,et al., 1985). The purified oligo- nucleotides were detritylated and rechromatographed under the same conditions as used for the purification. The oligonucleotide mixtures were end-labeled with [-y-32P]ATP and polynucleotide kinase (Man- iatis et al., 1982) and separated from the unincorporated [-y-32P]ATP by passing the probes through a small column (5 ml) of Sephadex G- 25 fine in TE buffer (10 mM Tris.Cl, 1 mM EDTA, pH 8) (Maniatis et al., 1982).

Hybridization Procedure-Prehybridization was done for 1-4 h at 42 "C in polypropylene bags with 10 ml of 10 X Denhardt's solution, 6 X SSC (Maniatis et al., 1982), 0.1% sodium dodecyl sulfate, and 0.1% sodium pyrophosphate, filtered through a 0.2-pm filter. This procedure gave the best results in achieving a high signal to back- ground ratio for the hybridization with an oligonucleotide mixture probe. Hybridization was done overnight in 10 ml of the same solution except that the concentration of the Denhardt's solution was changed to 1 X instead of 10 X. The labeled oligonucleotide mixture (1 X lo' cpm) was used for hybridization of the nylon-bound DNA at several temperatures overnight. Washing after hybridization was done in 6 X SSC and 0.1% sodium dodecyl sulfate three times at room temper- ature for 1, 2 and 3 min, respectively, and each time with 300 ml of the solution. The last stringent wash was carried out in 1 X SSC, 0.1% sodium dodecyl sulfate at the appropriate temperature for 1 min. Autoradiographs of the hybridized membranes were usually done for 12-48 h at -80 "C with intensifying screen.

Cloning of the Gene-For preparation of the DNA fragments for cloning, 100 pg of M. vannielii DNA were digested overnight with 50 units of ChI restriction endonuclease at 37 "C. The digest was sepa- rated on a preparative 0.8% agarose gel, the hybridizing bands were sized out, and the DNA was eluted in a Biotrap (Schleicher & Schull) overnight at 4 "C with 2 V/cm. The eluted fragments were phenol- extracted and ligated into the AccI site of the pUC18 vector. The ligation mixture was transformed into competent DH5a cells using the calcium chloride procedure (Maniatis et al., 1982). The cells were plated along with 70 p1 of X-Gal solution (2% 5-hromo-4-chloro-3- indolyl-8-D-galactopyranoside in dimethyl formamide) on LB-plates containing 100 pg of ampicillin/ml. The plates were incubated at 30 "C for 36 h. Recombinants (colorless) were grown up in 2 ml of LB-broth with ampicillin (100 pg/ml) at 30 "C for 16-20 h and analyzed as follows. The cultures from sets of four clones were mixed and mini plasmid preparations were done according to the method of Birnboim and Doly (1979). The plasmid DNA was cut with KpnI and HindIII and separated on a 0.8% agarose minigel (85 X 70 X 5 mm, at 8 V/cm), blotted onto GeneScreen, and probed as described pre- viously. Pooled plasmid preparations which gave a strong signal were then screened separately to identify the positive clones.

Subcloning for DNA: Sequencing-The insert from one such clone (pMvaX1) was ligated into the KpnI and HindIII sites of M13mp18 and M13mp19. In addition, a KpnIIPstI subfragment and two PstI subfragments from the positive insert were cloned in M13mp18 or M13mp19 to get all orientations of the fragments within the vector. Partial digests of pMvaX1 using KpnI and PstI were also done to characterize the arrangement of the fragments. Nucleotide sequencing was carried out according to the Sanger didesoxy chain termination method (Sanger and Coulson, 1978) using [a-"SIdATP.

6542 Ribosomal Protein L12 of Archbacterium Methanococcus

c o n s e n s u s Y E Y I Y A A L L L N . A . K E . T E E N I K . V L . A A G 1 . . . E . R . K A L V A A . L E . V D

c o n s e n s u s I . E A . . . A A A A P V A A . A A . P . . . . . . . A . . K K E E K K E D . . . A A . A E . . . .

SacLl2 . . . . . . . HcuL12 MvaLl2 . . . . . . . . .

consensus G . G L G . L F G U

c o n s e n s u s M r Y v A A Y L L . a l g G N a . P S a a D I k . . L . S V G I E . D e r . l n k V . s e L e G K

YvaLl2 D I A E A I A . . . . . K A A I . . . . . . . . . . .

c o n s e n s u s . . l E a i I A e G q . K I A s v P t G C A . a a . a a p a A A A . a a g . A a . a . . E E K K E E

. . . AsaL12 S E E . E D E D . . Y G F G L F D

NvaLl2 .

YeL29 S . . . D D D . .

RliP2 S E E K K D E , . . .

. . . .

c o n s e n s u s S . e . e D e d . . . . . M G F C L F D

FIG. 7. a, primary structure similarity of M . vannielii L12 with other archaebacterial L12 proteins. Symbols: Sac, Sulfolobus acidocaldarius (Matheson et al., 1988); Hcu, H. cutirubrum (Matheson, 1985; Oda et al., 1988); Mva, M. vannielii (this paper). b, primary structure similarity of M. vannielii with eukaryotic L12 proteins. Symbols: YeL29, yeast Saccharomyces cerevisiae L29 (Itoh, 1981); AsaLl2, A. salina L12 (Amons et al., 1982); RliP2, rat liver P2 (Lin et al., 1982); MvaLl2, M. vannielii L12 (this paper).

RESULTS mixture of 24 different oligonucleotides, had a length of 17

Amino Acid Sequence Determinution-Partial sequence in- formation of ribosomal protein L12 was obtained by (i) N- terminal sequencing of intact protein with liquid phase se- quencing up to position 27; (ii) reversed phase HPLC sepa- ration of peptides generated by digestion with trypsin, chy- motrypsin, S. aureus protease, thermolysin, and partial acid cleavage of the entire protein, followed by manual microse- quencing thereof; (iii) by thin-layer fingerprinting of chymo- tryptic peptides on cellulose-coated sheets as detailed (Witt- mann-Liebold et al., 1977) followed by partial or complete sequencing (Fig. 1). For results of the peptide purification, see the Miniprint Section (Figs. Sl-SS).’

Synthesis of Oligonucleotide Probes and Hybridization-In order to achieve a reliable sequence of protein L12, the partial sequences were used for synthesis of oligonucleotide probes for hybridization with M. uannielii chromosomal DNA. The protein sequences were converted into the corresponding nu- cleotide sequence, and oligonucleotides were synthesized against the most unequivocable parts. Two oligonucleotide probes were used one was complementary to the N-terminal (5’) end (“oligo-L8N”) and the other matching a region in the C-terminal (3’) part (“oligo-LSC”) of the gene. Oligo-L8N, a

bases and an expected minimal melting point of 42 “C accord- ing to the equation: T,,, = 4(G + C) + 2(A + T) “C (Suggs et al., 1981). Oligo-LSC, a mixture of 64 different oligonucleo- tides, was 20 bases long and had an expected minimal melting point of 50 ”C (Fig. 2).

Although a variety of different known prehybridization and hybridization conditions were tested, only the procedure out- lined under “Experimental Procedures” gave optimal signal- to-noise ratios. The oligonucleotides were hybridized at 35 “C, and the first stringent wash was done at this temperature. After autoradiographies were made, a more stringent wash was done increasing the temperature by 5 “C. At 45 “C, oIigo- L8N and at 50 “C oligo-L8C gave clear hybridization results, showing the same pattern (Fig. 3). EcoRI, HindIII, Clal, and Sau3A chromosomal digests caused one hybridizing band per lane on the Southern blot. Signals were detected at 3.5 kb for the EcoRI digest, at 6-7 kb for the HindIII digest, at 0.9 kb for the CZuI digest, and at 1.5 kb for the Sau3A digest.

Cloning of Mua LIZ-The CZuI-digested DNA was chosen for cloning, since both oligonucleotides hybridized with the 0.9-kb band indicating the presence of the entire L12 gene in this fragment. Furthermore, this region of the gel had only few DNA fragments, and direct excision and ligation of the

Figs. Sl-S? are presented in miniprint at the end of this paper. hybridizing fragment yielded the desired clone within a rela- Miniprint is easily read with the aid of a standard magnifying glass, tive small number of recombinants. The hybridizing 0.9-kb Full size DhotocoDies are included in the microfilm edition of the DNA fragments were Prepared from the ChI chromosomal Journal that is available from Waverly Press. digest, ligated into pUC18, and introduced into competent

Ribosomal Protein L12 of Archebacterium Methanococcus 6543

[) Hydrophilicity >=1.3 0 Hpophobic i ty >=1.3

, . ...... ...... ...... ..... ..... ...... ...... ..... ..... ..... ...... .... ....::... .,. . . .

FIG. 8. Secondary structure prediction of M. vannielii L12 according to Chou and Fasman (1978), with hydrophobic, hydrophilic, and surface areas indicated.

DH5a cells to yield colorless colonies of recombinants against a background of nonrecombinant blue colonies. Since these gene products might interfere with regulation in the E. coli cells, we chose growing conditions without isopropyl-l-thio- p-D-galactopyranoside and at 30 "C to minimize expression of the incorporated genes. Recombinant clones were initially tested in pools of four with three pools giving clear signals at 0.9 kb when digested with KpnI and HindIII. These clones were then screened separately, and three positive clones giving the same restriction pattern were identified. The recombinant plasmid pMvaXl (Fig. 4) was digested with PstI and KpnI. The resulting fragments (one 233 bases KpnIIPstI fragment, one 371-bp PstI fragment, and a 354-bp PstI fragment) were subcloned in M13mp18 and M13mp19.

Subcloning and Sequencing-A partial restriction digest was performed on pMvaXl to examine the arrangement of the fragments and to identify the subfragments which hybri- dize to the probes. From a second partial PstI digest of KpnI linearized pMvaX1, the 604 bases hybridizing subfragment was isolated and cloned in M13mp18 which gave clone "pX2. The sequencing of lSpX2 yielded the sequence complementary to oligo-L8N from base 98 on. The whole sequence of this subfragment was determined by sequencing the clones "pX3 and "pX3; the overlapping was more than 100 bases. At the 3'-end of the fragment, we found a second PstI site directly after the religated PstI site which is also supported by align- ment with the amino acid sequence. It seems that PstI cannot cut both sites at one time.

The rest of the L12 gene was found at the 5'-end of the 233 bases fragment in clone "pX5, as we already knew from the partial digest.

The strategy for sequence determination of the L12 gene is illustrated in Fig. 5; the overall sequence was determined as given in Fig. 6.

DISCUSSION

Comparison of the Nucleotide and Amino Acid Sequence- In comparing the nucleotide sequence to that derived from

amino acid sequence determination, peptide Th4 (position 13-16, Fig. 1) could be arranged with the other peptides, and step four in peptide HAc2 (position 36-49) could be deter- mined as lysine. The last amino acid residue of protein L12 was identified as methionine, which could not be detected by amino acid sequencing but was found by carboxypeptidase Y treatment and by amino acid analysis of the entire protein or of peptide HAC 4-Ch2 (position 95-99). Furthermore, the correct arrangement of all peptides which was diffidult to prove in the amino acid sequence of L12 due to the presence of many alanine residues, could be confirmed by the nucleo- tide sequence. Finally, the amino acid analysis of protein L12 performed by analysis with ninhydrin and orthophthalde- hyde-HPLC analysis (Table I) is in excellent agreement with the sequence of protein L12 deduced from the nucleotide sequence.

Primary and Secondary Structure of the DNA-A Shine Dalgarno sequence complementary to the 16 S rRNA of M. uannielii (Balch et al., 1979) was found seven bases upstream of the structural gene. The L12 gene starts with an ATG codon for methionine, as expected, and ends with two TAA stop codons. A terminator sequence was deduced (Fig. 6) by the program "Terminator" of the UWGCG program package.

Homology of the Primary Protein Structure-The similarity of the protein sequence of L12 derived from M. vannielii with all other archaebacterial and eukaryotic L12 ribosomal pro- teins of known sequence (Wittmann-Liebold, 1986) is shown in Fig. 7. M. uannielii L12 has most similarities to other archaebacterial L12 sequences (Fig. 7a). Eukaryotic L12 pro- teins show good similarities to certain regions of the sequence (Fig. 76). The similarity of Mva L12 to eubacterial L12 proteins is limited to few amino acid residues (not shown). In every kingdom some regions of the protein (boxed in Fig. 7, a and b) are conserved.

The consensus sequence "KKEEKKEE" (residues 76-85 in M. uannielii L12) is found in all archaebacterial and eukary- otic L12 proteins, with slight modifications, except in Halo-

6544 Ribosomal Protein L12 of Archaebacterium Methanococcus

bacterium cutirubrum where almost all lysines are replaced with acidic residues, due to its special environmental adap- tation. Parts of this sequence are found in other locations of eubacterial L12 proteins, but less conserved. The consensus sequence “MEYIYAALL” (residues 1-9) is found with slight differences in all archaebacteria; in eukaryotes it is modified to “LYAAYLL.” The third conserved region is located at the C terminus, namely “LF” (residues 97-98 in M. vannielii L12) forms part of all archaebacterial and eukaryotic L12 proteins while the eukaryotes have the extended consensus “MGFGLFD” at this position.

The conserved sequence regions may constitute the binding site of protein L12 for the elongation factors or may be involved in the stalk protuberance formation of the 50 S ribosomal subunit (Liljas et al., 1986; Traut et al., 1986; Moller and Maassen, 1986).

Hydrophobicity of L12 Proteins-Hydrophobicity plots were made calculating the relative hydrophobicity by normalizing a region of 9 residues against the entire protein (Kyte and Doolittle, 1982). Very similar patterns were obtained for the eukaryotic and archaebacterial L12 proteins (Fig. S7a). Es- pecially striking in this group is the high hydrophilicity near the C terminus. An exception is the archaebacterium H. cutirubrurn L12, where no specially hydrophilic area could be detected, when normalized against the entire protein. This might be due to the generally hydrophilic character of proteins derived from this organism. The resulted hydrophobicity curve shows similarity with the pattern of the eubacterial L12 proteins and was therefore drawn together with them (Fig. S7b).

Secondary Structure Prediction-Secondary structure pre- dictions (Chou and Fasman, 1978) for the L12 proteins were performed in order to search for homologous regions (see Fig. 8). These predictions gave similar results for various L12 sequences. A very hydrophilic a-helical region was found in all kingdoms near the C termini of the proteins. The conserved sequence “KKEEKKEE” (residues 76-85 in L12 M. vannielii) discussed above is always part of this region which is predicted to be on the surface (formula of Emini et al., 1985).

The conserved hydrophilic region of the L12 proteins prob- ably exhibits a specific domain for binding the factors to the ribosome. With more archaebacterial L12 protein sequences available in the future, the role of this conserved amino acid will be further investigated.

Acknowledgments-We thank Ch. Weigel, K. Lechner, end H. Auer for valuable advice. Dr. J. McDougall is thanked for carefully reading the English version of the manuscript.

REFERENCES Amons, R., Pluijms, W., Kriek, J. & Moller, W. (1982) FEBS Lett. 146 , 143-

Ashman, K. & Wittmann-Liebold, B. (1985) FEBS Lett. 190,129-132 Arndt, E., Breithaupt, G. & Kimura, M. (1986) FEBS Lett. 194,227-234

Ashman, K. & Bosserhof, A. (1985) in Modern Methods in Protein Chemistry

Balch, W. E., Fox, G. E., Magrum, L. J., Woese, C. R. & Wolfe, R. S. (1979)

Becker, C. R., Efcavitch, J. W., Heiner, C. R. & Kaiser, N. F. (1985) J.

Birnboim, H. C. & Doly, J. (1979) Nucleic Acids Res. 7 , 1513-1523 Chou, P. Y. & Fasman, G. D. (1978) Adu. Enzymol. 47.45-148 Church, M. & Gilbert, W. (1984) Proc. Natl. Aead. Sci U. S. A. 8 1 , 1991-1995 Devereux, J., Haeberli, P. & Smithies, 0. (1984) Nucleic Acids Res. 12, 387-

Emini, E. A,, Hughes, J. V., Perlow, D. S. & Boger, J. (1985) J. Virol. 55,836-

Hamel, E., Koka, M. & Nakamoto, T. (1972) J. Biol. Chem. 247,805-814

Hofman, J. D., Lau, R. H. & Doolittle, W. F. (1979) Nucleic Acids Res. 7,1321- Hatakeyama, T. & Kimura, M. (1988) Eur. J. Biochem., in press

Itoh, T. (1981) Biochim. Biophys. Acta 671,16-24

Kimura, J. & Kimura, M. (1987) J. Biol. Chem. 2 6 2 , 12150-12157 Kaltschmidt, E. & Wittmann, H. G. (1970) Anal. Bwchem. 36,401-412

Kimura, M. & Langner, G. (1984) FEBS Lett. 175,213-218 Kyte, J. & Doolitle, R. F. (1982) J. Mol. Biol. 157 , 105-132 Lee, C. C., Cantor, C. R. & Wittmann-Liebold, B. (1981) J. Biol. Chem. 2 6 6 ,

Liljas, A., Kirsebom, L. A. & Leijonmarck, M. (1986) in Structure, Function 41-48

and Genetics of Rhsomes (Hardesty, B., and Kramer, G., eds) pp. 379-390, Springer-Verlag, Heidelberg

Lin, A,, Wittmann-Liebold. B., McNally, J. & Wool, I. G. (1982) J. Bid. Chem. 267,9189-9197

Maniatis, T., Fritsch, E. F. & Sambrook, F. (1982) Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor,

Matheson, A. T. (1985) The Bacteria, Vol. VIII, pp. 345-377, Academic Press, NY

Matheson, A. T., Louie, K. A. & Bkk, A. (1988) FEBS Lett., in press New York

Moller, W., Schrier, P. I., Maassen, J. A., Zantema, A., Schop, E., Reinalda, H., Cremers, A. F. M. & Mellema, J. E. (1983) J. Mol. Biol. 163,553-573

Moller, W. & Maassen, J. A. (1986) in Structure, Function and Genetics of Ribosomes (Hardesty, B., and Kramer, G., eds) pp. 309-325, Springer-Verlag,

147

(Tschesche, H., ed) pp. 155-173, Walter de Gruyter, Berlin

Microbiol. Reu. 4 3 , 260-296

Chromatogr. 326,293-299

395

839

1333

Oda, G., Roy, C., Yaguchi, M. & Matheson, A. T. (1988) FEBS Lett., in press Sanger, F. & Coulson, A. R. (1978) FEBS Lett. 8 7 , 107-110 Schmid, G. & Bock, A. (1981) J. @cteriol. 147,282-288 Southern, E. M. (1975) J. Mol. Bwl. 98,503-517 Stoffler, G. & Stoffler-Meilicke, M. (1984) Annu. Reu. Biophys. Bioeng. 13 ,

Heidelberg

303-330 Strycharz, W. A., Nomura, M. & Lake, J. A. (1978) J. Mol. Biol. 126, 123-140 Subramanian, A. R. (1975) J. Mol. Biol. 9 5 , l - 8 Suggs, S. V., Hirose, T., Miyake, T., Kawashima, E. H., Johnson, M., Itakura,

Traut, R. R., Tewari, D. S., Sommer, A., Gavino, G. R., Olson, H. M. & Glitz, K. & Wallace, R. B. (1981) EN-UCLA Symp. Mol. CeU. Biol. 23,682-693

D. G. (1986) in Structure, Function and Genetics of Ribosomes (Hardesty, B., and Kramer, G., eds) pp. 286-308, Springer-Verlag, Heidelberg

Wittmann, H. G. (1974) in Ribosomes (Chambliss, G., Craven, G. R., Davies, F., Davis, K., Kahan, L. & Nomura, M., eds) pp. 93-114, Cold Spring Harbor

Wittmann, H. G. (1986) in Structure, Function and Genetics of Ribosomes Laboratory, Cold Spring Harbor, NY

Wittmann-Liebold, B. (1983) in Modern Methods in Protein Chemistry (Hardesty, B., and Kramer, G., eds) pp. 1-27, Springer-Verlag, Heidelberg

Wittmann-Liebold, B. (1986) in Structure, Function and Genetics of Ribosomes (Tschesche, H., ed) pp. 229-266, Walter de Gruyter, Berlin

Wittmann-Liebold, B., Brauer, D. & Dognin, J. (1977) in Solid Phase Methods (Hardesty, B., and Kramer, G., eds) pp. 326-361, Springer-Verlag, Heidelberg

in Protein Sequence Analysis (Previero, A,, and Coletti-Previero, M.-A,, eds) pp. 219-232, North-Holland Publishing Co., Amsterdam

Wjttmann-Liehold, B., Hirano, H. & Kimura, M. (1986) in Advanced Methods

Erdmann, V. W., eds) pp. 77-90, Springer-Verlag, Heidelberg m Protein Microsequence Analysis (Wittmann-Liebold, B., Salnikow. J., and

Woese, C. R. & Fox, G. E. (1977) Proc. Natl. Acad. Sci. U. S. A. 74,5088-5090

Ribosomal Protein L12 of Archaebacterium Methunococcus 6545

C H 4 0 O C H 4

CH 1 0

6546 Ribosomal Protein L12 of Archaebacterium Methanococcus