The iPlant Collaborative Vision Enable life science researchers and educators to use and extend...

20
The iPlant Collaborative Vision www.iPlantCollaborative.org Enable life science researchers and educators to use and extend cyberinfrastructure

Transcript of The iPlant Collaborative Vision Enable life science researchers and educators to use and extend...

Page 1: The iPlant Collaborative Vision  Enable life science researchers and educators to use and extend cyberinfrastructure.

The iPlant CollaborativeVision

www.iPlantCollaborative.org

Enable life science researchers and educators touse and extend cyberinfrastructure

Page 2: The iPlant Collaborative Vision  Enable life science researchers and educators to use and extend cyberinfrastructure.

•1986 DOE announces Human Genome Initiative-- $5.3 million to develop technology.

•1990 DOE & NIH present their HGP plan to Congress.

1997 Escherichia coli genome published

•1997 Yeast genome published

•2000 Fruit fly (Drosophila) genome published.

•2000 Working draft of the human genome announced.

•2000 Thale cress (Arabidopsis) genome published (2x).

•2002 Rice genome published (2x).

•2003 Human genome published.

•2006 First tree genome published in Science.

•2007 First metagenomics study published

Important Dates in Genomics

Page 3: The iPlant Collaborative Vision  Enable life science researchers and educators to use and extend cyberinfrastructure.

¢0.57

¢0.19

¢0.35

Sequ

ence

pro

ducti

on (B

illio

ns o

f bas

es/m

onth

)Se

quen

ce p

rodu

ction

(Bill

ions

of b

ases

/mon

th)

¢0.50¢0.50

¢1 ¢1

00

Cost: Cents per baseCost: Cents per base

1.01.0

00

2.02.0

3.03.0

19891989 19911991 19931993 19951995 19971997 19991999 20032003 2005200520012001

¢0.46

¢0.08

20072007

Human Genome completed

Economics of Scale

Human Genome launched

> ¢0.05

Slide: JGI, 2009

Page 4: The iPlant Collaborative Vision  Enable life science researchers and educators to use and extend cyberinfrastructure.

Another angle

Slide: Stein, 2010

Page 5: The iPlant Collaborative Vision  Enable life science researchers and educators to use and extend cyberinfrastructure.

Just as computer software is rendered in long strings of 0s and 1s, the GENOME or “software” of life is represented by a string of the four nucleotides, A, G, C, and T.

To understand the software of either - a computer or a living organism - we must know the order, or sequence, of these informative bits.

What is sequencing?

Slide: JGI, 2009

Page 6: The iPlant Collaborative Vision  Enable life science researchers and educators to use and extend cyberinfrastructure.

A GENOME is all of a living thing’s genetic material.

The genetic material is DNA (DeoxyriboNucleic Acid)

DNA, a double helical molecule, is made up of four nucleotide “letters”:A-- G--

T-- C--

What is a genome?

Slide: JGI, 2009

Page 7: The iPlant Collaborative Vision  Enable life science researchers and educators to use and extend cyberinfrastructure.

Exciting?

>mouse_ear_cress_1080 GAAATAATCAATGGAATATGTAGAGGTCTCCTGTACCTTCACAGAGATTCTAGGCTGAGAGCAGTGCATATAGATATCTTTCGTACTCATCTGCTTTTTCTGGTCTCCATCACAAAAGCCAACTAGGTAATCATATCAATCTCTCTTTACCGTTTACTCGACCTTTTCCAATCAGGTGCT TCTGGTGTGTCTACTACTATCAGTTTTAGGTCTTTGTATACCTGATCTTATCTGCTACTG AGGCTTGTAAAAGTGATTAAAACTGTGACATTTACTCTAAGAGAAGTAACCTGTTTGATGCATTTCCCTAATATACCGGTGTGGAAAAGTGTAGGTATCTGTACTCAGCTGAAATGGTGGACGATTTTGAAGAAGATGAACTCTCATTGACTGAAAGCGGGTTGAAGAGTGAAGATGGCGTTATTATCGAGATGAATGTCTCCTGGATGCTTTTATTATCATGTTTGGGAATTTACCAAGGGAGAGGTATCAGAATCTATCTTAGAAGGTTACATTTAGCTCAAGCTTGCATCAACATCTTTACTTAGAGCTCTACGGGTTTTAGTGTGTTTGAAGTTTCTTAACTCCTAGTATAATTAGAATCTTCTGCAGCAGACTTTAGAGTTTTGGGATGTAGAGCTAACCAGAGTCGGTTTGTTTAAACTAGAATCTTTTTATGTAGCAGACTTGTTCAGTACCTGAATACCAGTTTTAAATTACCGTCAGATGTTGATCTTGTTGGTAATAATGGAGAAACGGAAGAATAATTAGACGAAACAAACTCTTTAAGAACGTATCTTTCAGTTTTCCATCACAAATTTTCTTACAAGCTACAAAAATCGAACTATATATAACTGAACCGAATTTAAACCGGAGGGAGGGTTTGACTTTGGTCAATCACATTTCCAATGATACCGTCGTTTGGTTTGGGGAAGCCTCGTCGTACAAATACGACGTCGTTTAAGGAAAGCCCTCCTTAACCCCAGTTATAAGCTCAAAGTTGTACTTGACCTTTTTAAAGAAGCACGAAACGAAAAACCCTAAAATTCCCAAGCAGAGAAAGAGAGACAGAGCAAGTACAGATTTCAACTAGCTCAAGATGATCATCCCTGTTCGTTGCTTTACTTGTGGAAAGGTTGATATTTTCCCCTTCGCTTTGGTCTTATTTAGGGTTTTACTCCGTCTTTATAGGGTTTTAGTTACTCCAAATTTGGCTAAGAAGAGATCTTTACTCTCTGTATTTGACACGAATGTTTTTAATCGGTTGGATACATGTTGGGTCGATTAGAGAAATAAAGTATTGAGCTTTACTAAGCTTTCACCTTGTGATTGGTTTAGGTGATTGGAAACAAATGGGATCAGTATCTTGATCTTCTCCAGCTCGACTACACTGAAGGGTAAGCTTACAATGATTCTCACTTCTTGCTGCTCTAATCATCATACTTTGTGTCAAAAAGAGAGTAATTGCTTTGCGTTTTAGAGAAATTAGCCCAGATTTCGTATTGGGTCTGTGAAGTTTCATATTAGCTAACACACTTCTCTAATTGATAACAGAAGCTATAAAATAGATTTGCTGATGAAGGAGTTAGCTTTTTATAATCTTCTGTGTTTGTGTTTTACTGTCTGTGTCATTGGAAGAGACTATGTCCTGCCTATATAATCTCTATGTGCCTATCTAGATTTTCTATACAATTGATATTTGATAGAAGTAGAAAGTAAGACTTAAGGTCTTTTGATTAGACTTGTGCCCATCTACATGATTCTTATTGGACTAATCATTCTTTGTGTGAAAATAGAATACTTTGTCTGAACATGAGAGAATGGTTCATAATACGTGTGAAGTATGGGATTAGTTCAACAATTTCGCTATTGGAGAAGCAAACCAAGGGTTAATCGTTTATAGGGTTAAGCTAATGCTCTGCTCTTTATATGTTATTGGAACAGACTATTGTTGTGCCTATCTTGTTTAGTTGTAGATTCTATCTCGACTGTTATAAGTATGACTGAAGGCTTGATGACTTATGATTCTCTTTACACCTGTAGAAGGATTTAAGCTTGGTGTCTAGATATTCAATCTGTGTTGGTTTTGTCTTTCTTTTGGCTCTTAGTGTTGTTCAATCTCCTCAATAGGTATGAAGTTACAATATCCTTATTATTTTGCAGGGACGCACTTGATGCACTCCAGCTAGTCAGATACTGCTGCAGGCGTATGCTAATGACCTTGCATCAACATCTTTACTTAGAGCTCTACGGGTTTTAGTGTGT

Page 8: The iPlant Collaborative Vision  Enable life science researchers and educators to use and extend cyberinfrastructure.

This better?

Page 9: The iPlant Collaborative Vision  Enable life science researchers and educators to use and extend cyberinfrastructure.

Using Plants to Explore Genomics

A large number of genomes is publicly & freely available for analysis.

Page 10: The iPlant Collaborative Vision  Enable life science researchers and educators to use and extend cyberinfrastructure.

FindGene Families

Generate mathematical

evidence

Analyze large data amounts

Browse in context

Build gene models

Gatherbiological evidence

Annotation workflow

Get DNA sequence

Page 11: The iPlant Collaborative Vision  Enable life science researchers and educators to use and extend cyberinfrastructure.

Walk or…

Page 12: The iPlant Collaborative Vision  Enable life science researchers and educators to use and extend cyberinfrastructure.

Early concept (2009)

Page 13: The iPlant Collaborative Vision  Enable life science researchers and educators to use and extend cyberinfrastructure.

DNA Subway 2014

Page 14: The iPlant Collaborative Vision  Enable life science researchers and educators to use and extend cyberinfrastructure.

Coming into the Genome Age

For the first time in the history of science students can work with the same data and tools that are used by researchers.

Learning by asking and answering question.

Students generate new knowledge.

Page 15: The iPlant Collaborative Vision  Enable life science researchers and educators to use and extend cyberinfrastructure.

Workshop Objectives

Illustrate the evolving concept of “gene.” Conceptualize a “big picture” of complex, dynamic

genomes. Guide students to address real problems through modern

genome science. Use educational and research interfaces for bioinformatics. Work with “real” genome sequences gathered by students

– in the lab or online.

Page 16: The iPlant Collaborative Vision  Enable life science researchers and educators to use and extend cyberinfrastructure.

Molecular biology and bioinformatics conceptsRepeatMasker• Eukaryotic genomes contain large amounts of repetitive DNA.• Transposons can be located anywhere; they can mutate like any other DNA.

FGenesH Gene Predictor• Protein-coding information begins with start, followed by codons, ends in stop.• Codons in mRNA (AUG, UAA,…) have sequence equivalents in DNA (ATG, TAA,…).• Most eukaryotic introns have “canonical splice sites,” GT---AG (mRNA: GU---AG).• Gene prediction programs search for patterns to predict genes and their structure.• Different gene prediction programs may predict different genes and/or structures.

Multiple Gene Predictors• The protein coding sequence of a mRNA is flanked by untranslated regions (UTRs).• UTRs hold regulatory information.

BLAST Searches• Gene or protein homologs share similarities due to common ancestry. • Biological evidence is needed to curate gene models predicted by computers.• mRNA transcripts and protein sequence data provide “hard” evidence for genes.

Page 17: The iPlant Collaborative Vision  Enable life science researchers and educators to use and extend cyberinfrastructure.

What is a gene?

• Can we define a gene?• Has the definition of a gene changed?• How can we find genes?

Page 18: The iPlant Collaborative Vision  Enable life science researchers and educators to use and extend cyberinfrastructure.

An Evolution of Sorts…

• Genes as “independent hereditary units (1866), Mendel• Genes as “beads on strings” (1926), Morgan• One gene, one enzyme (1941), Beadle & Tatum• DNA is molecule of heredity (), Avery• DNA > RNA > Protein (1953), Crick, Watson, Wilkins• Transposons (1940s-50s), McClintock• Reverse transcription (1970), Temin & Baltimore• Split genes (1977), Roberts & Sharp• RNA interference (1998), Fire and Mello

Page 19: The iPlant Collaborative Vision  Enable life science researchers and educators to use and extend cyberinfrastructure.

Sequence & course material repository

http://gfx.dnalc.org/files/evidenceDon’t open items, save them to your computer!!

• Annotation (sequences & evidence)• Manuals (DNA, Subway, Apollo, JalView)• Presentations (.ppt files)• Prospecting (sequences)• Readings (Bioinformatics tools, splicing, etc.)• Worksheets (Word docs, handouts, etc.)• BCR-ABL (temporary; not course-related)

Page 20: The iPlant Collaborative Vision  Enable life science researchers and educators to use and extend cyberinfrastructure.