JOURNAL OF BACTERIOLOGY, Aug. 2010, p. 4239–4245 Vol. 192, No. 160021-9193/10/$12.00 doi:10.1128/JB.00504-10Copyright © 2010, American Society for Microbiology. All Rights Reserved.

The Importance of the Small RNA Chaperone Hfq for Growth ofEpidemic Yersinia pestis, but Not Yersinia pseudotuberculosis,

with Implications for Plague Biology�

Guangchun Bai,1 Andrey Golubov,1† Eric A. Smith,1 and Kathleen A. McDonough1,2*Wadsworth Center, New York State Department of Health, 120 New Scotland Avenue, P.O. Box 22002, Albany,

New York 12201-2002,1 and Department of Biomedical Sciences, University at Albany, Albany, New York 122222

Received 3 May 2010/Accepted 22 May 2010

Yersinia pestis, the etiologic agent of plague, has only recently evolved from Yersinia pseudotuberculosis. hfqdeletion caused severe growth restriction at 37°C in Y. pestis but not in Y. pseudotuberculosis. Strains from allepidemic plague biovars were similarly affected, implicating Hfq, and likely small RNAs (sRNAs), in the uniquebiology of the plague bacillus.

Yersinia pestis, the etiologic agent of plague, poses a con-tinuing natural threat to human health, and recent concernsabout its potential use as a biological threat agent have in-creased our need to understand the biology of this deadlybacterial pathogen. Molecular evidence indicates that Y. pestisevolved from Yersinia pseudotuberculosis within the last 20,000years (1), and three-fourths of their genes remain at least 97%identical (8). The diseases caused by these two bacteria differgreatly, and only Y. pestis has the capacity for the complexprocess of flea-borne transmission (15, 24, 31). The extent towhich biological differences between these distinct bacterialpathogens are caused by altered expression of conservedgenes, rather than overt genetic differences, is not known.

Hfq functions as a posttranscriptional regulator by stabiliz-ing small RNAs (sRNAs) and facilitating their interactionswith mRNA targets (18, 20, 21, 35, 41, 43, 45, 48). Hfq’spleiotropic role in gene regulation is well established (29, 42,43), and its importance as a regulator of virulence in patho-genic bacteria is being increasingly recognized (3, 9, 10, 12, 25,27, 28, 33, 37, 38, 47). Hfq positively regulates the Y. entero-colitica-specific yst toxin gene (30) and is required for virulenceof Y. pseudotuberculosis (34) and a Pestoides variant of Y. pestis(19). However, the role of Hfq in the epidemic Y. pestis biovarshas not been explored.

Our interest in the regulation of differential gene expressionled us to generate hfq deletion mutants of Y. pestis and Y.pseudotuberculosis. Preliminary studies suggested species-spe-cific differences in the growth properties of these mutants. Inthis study, we report that epidemic Y. pestis strains are stronglydependent on Hfq for in vitro growth at 37°C but that Y.pseudotuberculosis strains are not. These results indicate thepotential for significant differences in the roles of sRNAs in the

physiology of these genetically related, but biologically distinct,bacterial pathogens.

Growth and cell morphology of the hfq mutant strains. TheHfq amino acid sequences are identical among eight se-quenced strains of Y. pestis and four of Y. pseudotuberculosis(http://www/ncbi.nlm.nih.gov/Blast.cgi). This protein shares98.6% identity with Escherichia coli Hfq over a 73-amino-acid(aa) N-terminal portion that is associated with RNA chaper-one function (39). This shared region is also highly conservedin Pseudomonas aeruginosa Hfq, which contains only 82 aa(40).

Deletion of hfq has a moderate effect on E. coli cell mor-phology, tolerance of stress conditions, and growth rate in richmedia, which is more pronounced at 25°C than at 37°C (42).We initially explored Hfq’s role in the growth of Y. pestis andY. pseudotuberculosis by generating hfq knockout mutations inY. pestis KIM6� (Pgm� pCD1� pMT1� pPst�) and KIM10�(Pgm� pCD1� pMT1� pPst�), as well as Y. pseudotuberculosisPTB52c (pYV�; serotype IB) and PTB54c (pYV�; serotypeIII). Mutations were generated by using homologous recom-bination to replace the entire hfq open reading frame (ORF)(306 bp) with a cat (chloramphenicol acetyltransferase) genecassette amplified from pKD3 (11). Mutations were initiallycomplemented with a single-copy hfq gene expressed from itsnative promoter and integrated into the chromosome 3� to oneof three tRNAAsn genes using pSPC471, which contains theYP-HPI pathogenicity island’s attachment and integration se-quences (6, 23) subcloned from pKR529 (generously providedby A. Rakin).

Bacterial growth in brain heart infusion (BHI) media wasmeasured visually on agar plates or by optical density (OD) inliquid cultures at 28 and 37°C. Cell morphology was also ex-amined by microscopy at selected time points. Growth ratesand morphology of the Y. pseudotuberculosis hfq mutants weresimilar to those of wild-type (WT) cells at either 28°C or 37°C(Fig. 1 and 2). In contrast, the Y. pestis mutants exhibitedsignificant temperature-dependent phenotypes. Growth of theY. pestis KIM6� and KIM10� hfq mutants was only moder-ately reduced at 28°C relative to that of the WT, but theyshowed little to no growth on either solid or liquid BHI me-dium at 37°C (Fig. 1). The Y. pestis hfq mutants also formed

* Corresponding author. Mailing address: Wadsworth Center, 120 NewScotland Avenue, P.O. Box 22002, Albany, NY 12201-2002. Phone: (518)486-4253. Fax: (518) 402-4773. E-mail: kathleen.mcdonough@wadsworth.org.

† Present address: Biology Department, University of Lethbridge,4401 University Drive West, Lethbridge, Alberta T1K 3M4, Canada.

� Published ahead of print on 11 June 2010.

4239

on January 23, 2020 by guesthttp://jb.asm

.org/D

ownloaded from

lengthened rods, which were significantly different from thesphere and short-rod morphology of WT, particularly at 37°C(Fig. 2).

Growth and morphology of the Y. pestis hfq mutants werelargely restored by addition of a single-copy WT hfq expressedfrom its immediate upstream promoter (Fig. 1 and 2). How-ever, we noted that complementation in Y. pestis was incom-plete, and the slight growth defect in Y. pseudotuberculosisPTB52c was not affected by hfq addition. Similar difficulties inachieving complete hfq complementation have been reportedpreviously for E. coli (42), but the basis of this defect is notknown. We investigated whether complementation was limitedby either inadequate levels of Hfq or lack of hfq coexpressionwith adjacent genes.

Transcription start sites (TSS) for hfq in Y. pestis and Y.

pseudotuberculosis were determined by primer extension ana-lyses. The TSS mapped to a position 90 nucleotides (nt) up-stream of the translation start site, confirming that hfq is ex-pressed from its immediate upstream promoter (Fig. 3A andB). However, hfq and hflX mRNA levels in the complementedstrain were lower than those in the WT (Fig. 3C). Furtherreverse transcription-PCR (RT-PCR) analyses showed that hfqwas also transcribed as part of a larger overlapping operon withmiaA and hflX (Fig. 3B and C), as it is in E. coli (42). Wereasoned that expression from this additional promoter up-stream of miaA could increase hfq levels in WT cells. A newhfq-complementing strain was generated using a multiple-copypCRII-based plasmid (Invitrogen), and increased hfq levelswere confirmed by Northern blot analysis (data not shown).This multicopy construct fully restored the growth defect of Y.

FIG. 1. Comparison of growth of hfq mutants with solid (A) and liquid (B) media. (A) WT, hfq null mutant (hfq), and complemented hfqmutant (com) strains of Y. pestis KIM6�, and Y. pseudotuberculosis PTB52c were streaked on BHI plates and incubated for 2 days at 28°C or 37°C,as indicated. (B) Growth curves of WT, hfq mutant (hfq), and complemented mutant (hfq-C) strains of Y. pestis KIM6� and Y. pseudotuberculosisPTB52c in BHI broth at 28°C or 37°C, measured by optical density. With both solid and liquid media, Y. pestis KIM10� results were similar tothose for Y. pestis KIM6� strains, while results for Y. pseudotuberculosis PTB54c were similar to those for PTB52c (not shown).

4240 NOTES J. BACTERIOL.

on January 23, 2020 by guesthttp://jb.asm

.org/D

ownloaded from

pestis hfq mutants at both 28°C and 37°C (Fig. 3D and E),indicating that Hfq alone is sufficient for complementation,provided that it is expressed at adequate levels.

Generality of the plague bacillus’ dependence on Hfq forgrowth. We were struck by the biological differences betweenY. pestis and Y. pseudotuberculosis with respect to their depen-dence on Hfq for growth at 37°C. Other investigators recentlyreported less dependence on Hfq for growth using an enzooticPestoides (sometimes called Microtus [49]) Y. pestis strain (19).The previous study did not measure growth at late time pointsor on solid media, where we observed the most dramaticgrowth restriction. However, strain differences may also berelevant. The enzootic Pestoides strains, which are virulentonly for small rodents, are thought to represent an evolution-ary intermediate between Y. pseudotuberculosis and epidemicY. pestis strains (14, 17). The phenotypic, biochemical, andgenetic profiles of Pestoides strains combine features that areotherwise considered specific for either Y. pseudotuberculosisor Y. pestis lineages (2, 4). KIM, the strain that we used,belongs to the Mediavalis biovar, one of three Y. pestis biovars

associated with epidemic plague and virulence for large mam-mals (including humans) as well as small rodents. We thereforeextended our study to determine whether KIM’s strong phys-iological dependence on Hfq also occurred in other epidemicplague biovars. hfq mutants were generated from representa-tive strains from the remaining two epidemic biovars, CO92R73 (Pgm� Lcr� pFra� pPst�) (biovar Orientalis) and KumaD11 (Pgm� Lcr� Pst� Fra� Gly� pMT2� pPCP2�) (biovarAntigua).

Growth of all Y. pestis mutants was severely restricted onBHI plates at 37°C (Fig. 4). As with the KIM mutants, theKuma and CO92 mutants showed little to no growth on BHIplates at 37°C (Fig. 4C). The Y. pestis Kuma hfq mutant, fromthe oldest epidemic biovar, grew slowly even at 28°C (Fig. 4A),taking up to 24 h to reach WT stationary-phase ODs at 600 nm(OD600) (not shown). The Kuma hfq mutant’s limited growthin liquid BHI medium at 37°C was similar to that of the KIMmutants (Fig. 4B), and the OD600 of the KIM and Kumamutants remained at 0.2 to 0.3 for up to 24 h (data not shown).However, the Y. pestis CO92 hfq mutant showed a significant

FIG. 2. Morphological comparison of Y. pestis KIM6� (A) and Y. pseudotuberculosis PTB52c hfq mutants (B). Cell membranes and DNA ofWT, mutant (hfq), and complemented mutant (hfq-C) strains were visualized by fluorescence microscopy. Overnight bacterial cultures were diluted1:100 into BHI broth without antibiotics and grown at either 28°C or 37°C with agitation. Heat-fixed smears were made with 10 �l of each cultureat 8 h and 24 h postinoculation. Bacteria were stained by addition of 3 �l phosphate-buffered saline (PBS) containing 1 �g/ml FM1-43 (MolecularProbes) for membranes and 2 �g/ml DAPI (4�,6�-diamidino-2-phenylindole) (Sigma) for DNA, covered with a poly-L-lysine treated coverslip, andimaged by fluorescence microscopy as described previously (13).

VOL. 192, 2010 NOTES 4241

on January 23, 2020 by guesthttp://jb.asm

.org/D

ownloaded from

increase in OD600 after 5 h at 37°C and formed sporadiccolonies on plates. Regrowth experiments with recovered bac-teria (not shown) suggested that this increased OD600 was dueto outgrowth of spontaneous suppressor mutants, consistentwith the suppressor colonies that we observed on BHI plates(Fig. 4C).

We further explored this suppressor phenomenon by quan-titating the relative frequencies of spontaneous suppressor mu-tations for each of the mutants after overnight growth at 28°C.Y. pestis CO92 hfq mutant suppressor clones were present at

levels �100-fold (Kuma) to �1,000-fold (KIM) higher thanwith the other mutants (Fig. 4D). These results show that theessential nature of hfq for Y. pestis’ multiplication at 37°C is ageneral phenomenon that occurs across all three epidemicplague biovars. However, cross-biovar differences, particularlywith respect to suppressor frequencies, suggest that there iscontinued genetic plasticity associated with this phenotype.

Biological implications of the plague bacillus’ dependenceon Hfq for growth. Y. pestis’ dependence on Hfq for in vitrogrowth at 37°C was surprising to us, particularly compared with

FIG. 3. Genetic analysis of the hfq locus in Y. pestis and Y. pseudotuberculosis. (A) Primer extension was used to map the TSS of hfq in Y. pestis(lane 1) and Y. pseudotuberculosis (lane 2). Total RNA of Y. pestis and Y. pseudotuberculosis was prepared from cultures grown at 28°C in BHIbroth. Primer KM2517 (5�GGATCTTGCAAAGATTGCCC) was end labeled with [�-32P]ATP (MP Biochemicals) using T4 polynucleotide kinase,and the reactions were performed as described previously (44). The TSS is indicated with an asterisk. A putative �10 sequence (TACAAT) isindicated with a black bar. The DNA ladder is the hfq upstream sequence generated with the same primer. (B) Gene arrangement comparisonof hfq in E. coli and Y. pestis. Numbers indicate the size of each intergenic region (in bp). Negative numbers indicate overlap of adjacent ORFs.(C) Semiquantitative RT-PCR using cDNA synthesized from WT, hfq mutant, and complemented Y. pestis strains. DNA contamination was ruledout, prior to all RT-PCR analyses, by PCR without reverse transcriptase using crr primers and 10 ng of RNA as the template (not shown). Notethat hflX levels were reduced in the hfq deletion mutant and complemented strains. Regions spanning hfq to the mia ORF (Up), and hfq to thehflX ORF (Down), were amplified by RT-PCR. The miaA-hfq (Up) amplification product from the WT strain indicates that hfq is transcribed withmiaA as part of a larger operon, in addition to its expression from the immediate upstream promoter shown by primer extension. PCR with crrprimers was used as a control for normalization of cDNA levels for different strains. (D) Growth curves of the Y. pestis KIM6� hfq mutant andcomplemented strains in BHI at 28°C. hfq-Csc, single-copy complementation; hfq-Cmc, multiple-copy complementation. (E) Growth curves of theY. pestis KIM6� hfq mutant and complemented strains in BHI broth at 37°C.

4242 NOTES J. BACTERIOL.

on January 23, 2020 by guesthttp://jb.asm

.org/D

ownloaded from

Hfq’s relative lack of importance for Y. pseudotuberculosisgrowth. In this respect, Y. pseudotuberculosis more closely re-sembles other bacterial pathogens, in which significant pheno-typic defects due to hfq deletion manifest only under host-associated stress conditions rather than standard in vitrolaboratory growth (for a review, see reference 9). For example,a Salmonella hfq deletion strain is highly attenuated duringmouse infection and defective for intracellular growth, but ithad only a slight in vitro growth restriction at 37°C (37). Like-wise, Vibrio cholerae and Brucella abortus hfq mutants are sig-nificantly compromised for growth in vivo but not in vitro(12, 33).

The Y. pestis hfq mutant’s limited growth at 37°C suggeststhat Hfq is essential for plague infection of a mammalian host,which is consistent with recent studies in which hfq null Pes-toides Y. pestis and Y. pseudotuberculosis showed decreasedsurvival in macrophages and mice (19, 34). However, the dif-ferent Hfq-dependent phenotypes observed in this studystrongly suggest that sRNAs also play a unique role in Y. pestisbiology and possibly in plague evolution. RNA regulators areassociated with “evolvability” (46), and it is tempting to spec-ulate that they have played a role in the divergence of Y. pestisfrom Y. pseudotuberculosis. Hfq interacts with sRNAs andmRNAs associated with both core genome and laterally trans-ferred gene sequences, facilitating cross-regulation and incor-poration of newly acquired genes into existing regulatory in-teractions (9, 37). For example, it has been suggested that Hfqstabilization of the SPI-1-encoded InvR sRNA facilitated theearly establishment of this pathogenicity island in the Salmo-nella lineage by downregulating expression of the core ge-nome-encoded OmpD porin (32, 36). Lateral gene transfer was

also critical for Y. pestis evolution (16), and Hfq has beenimplicated in the regulation of genes on all three of its plas-mids (19). The possible role of Hfq in the establishment ofnewly acquired genes in Y. pestis warrants further investigation.

The mechanism underlying Y. pestis’ dependence on Hfq forgrowth at 37°C is not yet clear, although it is likely to involvecore chromosomal genes. The similarity of the KIM6� andKIM10� results indicates that these hfq-associated phenotypesare not caused by the Y. pestis-specific pesticin plasmid. Like-wise, the presence of the YP-HPI pathogenicity island in all Y.pestis strains and Y. pseudotuberculosis PTB52c, but notPTB54c (22), argues against YP-HPI being the differentiatingfactor. All strains also lacked the low-calcium-response (Lcr)plasmid (pCD in Y. pestis or pYV in Y. pseudotuberculosis),which encodes the type 3 secretion system (T3SS) and is re-quired for the in vitro growth restriction that occurs with allpathogenic Yersinia strains when subjected to low calcium lev-els at 37°C (5, 26, 31). Therefore, the hfq-associated growthrestriction that we observed is distinct from Lcr-based growthcessation.

Nonetheless, Y. pestis undergoes Lcr-associated growth re-striction much more abruptly than Y. pseudotuberculosis, de-spite the presence of nearly identical Lcr plasmids (5, 7). Thisindicates that there are other important growth-associatedphysiological differences between these bacteria. This is con-sistent with functional inactivation of more than 10% of the Y.pestis genome relative to Y. pseudotuberculosis, including atleast one mutation in aspA that further distinguishes epidemicfrom Pestoides Y. pestis strains (4, 8). We propose that Hfq isinvolved in some of the compensatory gene regulation associ-ated with these gene inactivations.

FIG. 4. Growth of hfq mutants generated from different Y. pestis biovars. (A and B) Growth curves of Y. pestis hfq mutant strains comparedwith their respective WT strains at 28°C (A) and 37°C (B). (C) Growth comparison of different strains on BHI plates for 48 h at 28°C or 37°C.Note that the growth of the CO92 hfq mutant at 37°C is actually due to sporadic suppressor colonies. (D) Relative suppressor frequencies fordifferent Y. pestis mutants following overnight growth in BHI broth. Diluted cultures were spread on BHI plates in duplicate, followed by incubationat either 28°C or 37°C. The frequency of suppressor mutants was calculated as the ratio of CFU at 37°C to that at 28°C. All data shown arerepresentative of two biological repeats.

VOL. 192, 2010 NOTES 4243

on January 23, 2020 by guesthttp://jb.asm

.org/D

ownloaded from

Elucidation of Hfq’s unusual role in Y. pestis growth willprovide new insights into the unique biology of the plaguebacillus and the physiological factors that distinguish thisdeadly pathogen from its enteric relatives and progenitors.

We thank R. Losick and his lab for generously providing K.A.M.with the use of their imaging facility and many helpful discussions. Wealso thank A. Rakin for his kind gift of pKR29 and R. Perry forproviding Yersinia pestis CO92 and Kuma WT strains. We are gratefulto R. Lease and K. Spaeth for useful discussions, D. Schaak for tech-nical assistance, H. Vasudeva-Rao and G. Knapp for critical reading ofthe manuscript. We acknowledge the Wadsworth Center MolecularGenetics Core facility for DNA sequencing and the David AxelrodInstitute Imaging facility for use of microscopy resources.

This work was supported by grant AI06160602 from the NationalInstitutes of Health.

REFERENCES

1. Achtman, M., K. Zurth, G. Morelli, G. Torrea, A. Guiyoule, and E. Carniel.1999. Yersinia pestis, the cause of plague, is a recently emerged clone ofYersinia pseudotuberculosis. Proc. Natl. Acad. Sci. U. S. A. 96:14043–14048.

2. Anisimov, A. P., L. E. Lindler, and G. B. Pier. 2004. Intraspecific diversity ofYersinia pestis. Clin. Microbiol. Rev. 17:434–464.

3. Attia, A. S., J. L. Sedillo, W. Wang, W. Liu, C. A. Brautigam, W. Winkler, andE. J. Hansen. 2008. Moraxella catarrhalis expresses an unusual Hfq protein.Infect. Immun. 76:2520–2530.

4. Bearden, S. W., C. Sexton, J. Pare, J. M. Fowler, C. G. Arvidson, L. Yerman,R. E. Viola, and R. R. Brubaker. 2009. Attenuated enzootic (pestoides)isolates of Yersinia pestis express active aspartase. Microbiology 155:198–209.

5. Brubaker, R. R. 2005. Influence of Na(�), dicarboxylic amino acids, and pHin modulating the low-calcium response of Yersinia pestis. Infect. Immun.73:4743–4752.

6. Buchrieser, C., R. Brosch, S. Bach, A. Guiyoule, and E. Carniel. 1998. Thehigh-pathogenicity island of Yersinia pseudotuberculosis can be inserted intoany of the three chromosomal asn tRNA genes. Mol. Microbiol. 30:965–978.

7. Carter, P. B., R. J. Zahorchak, and R. R. Brubaker. 1980. Plague virulenceantigens from Yersinia enterocolitica. Infect. Immun. 28:638–640.

8. Chain, P. S., E. Carniel, F. W. Larimer, J. Lamerdin, P. O. Stoutland, W. M.Regala, A. M. Georgescu, L. M. Vergez, M. L. Land, V. L. Motin, R. R.Brubaker, J. Fowler, J. Hinnebusch, M. Marceau, C. Medigue, M. Simonet,V. Chenal-Francisque, B. Souza, D. Dacheux, J. M. Elliott, A. Derbise, L. J.Hauser, and E. Garcia. 2004. Insights into the evolution of Yersinia pestisthrough whole-genome comparison with Yersinia pseudotuberculosis. Proc.Natl. Acad. Sci. U. S. A. 101:13826–13831.

9. Chao, Y., and J. Vogel. 2010. The role of Hfq in bacterial pathogens. Curr.Opin. Microbiol. 13:24–33.

10. Christiansen, J. K., M. H. Larsen, H. Ingmer, L. Sogaard-Andersen, andB. H. Kallipolitis. 2004. The RNA-binding protein Hfq of Listeria monocy-togenes: role in stress tolerance and virulence. J. Bacteriol. 186:3355–3362.

11. Datsenko, K. A., and B. L. Wanner. 2000. One-step inactivation of chromo-somal genes in Escherichia coli K-12 using PCR products. Proc. Natl. Acad.Sci. U. S. A. 97:6640–6645.

12. Ding, Y., B. M. Davis, and M. K. Waldor. 2004. Hfq is essential for Vibriocholerae virulence and downregulates sigma expression. Mol. Microbiol. 53:345–354.

13. Eichenberger, P., P. Fawcett, and R. Losick. 2001. A three-protein inhibitorof polar septation during sporulation in Bacillus subtilis. Mol. Microbiol.42:1147–1162.

14. Eppinger, M., P. L. Worsham, M. P. Nikolich, D. R. Riley, Y. Sebastian, S.Mou, M. Achtman, L. E. Lindler, and J. Ravel. 2010. Genome sequence ofthe deep-rooted Yersinia pestis strain Angola reveals new insights into theevolution and pangenome of the plague bacterium. J. Bacteriol. 192:1685–1699.

15. Erickson, D. L., C. O. Jarrett, B. W. Wren, and B. J. Hinnebusch. 2006.Serotype differences and lack of biofilm formation characterize Yersiniapseudotuberculosis infection of the Xenopsylla cheopis flea vector of Yersiniapestis. J. Bacteriol. 188:1113–1119.

16. Ferber, D. M., J. M. Fowler, and R. R. Brubaker. 1981. Mutations to toler-ance and resistance to pesticin and colicins in Escherichia coli phi. J. Bacte-riol. 146:506–511.

17. Garcia, E., P. Worsham, S. Bearden, S. Malfatti, D. Lang, F. Larimer, L.Lindler, and P. Chain. 2007. Pestoides F, an atypical Yersinia pestis strainfrom the former Soviet Union. Adv. Exp. Med. Biol. 603:17–22.

18. Geissmann, T. A., and D. Touati. 2004. Hfq, a new chaperoning role: bindingto messenger RNA determines access for small RNA regulator. EMBO J.23:396–405.

19. Geng, J., Y. Song, L. Yang, Y. Feng, Y. Qiu, G. Li, J. Guo, Y. Bi, Y. Qu, W.Wang, X. Wang, Z. Guo, R. Yang, and Y. Han. 2009. Involvement of the

post-transcriptional regulator Hfq in Yersinia pestis virulence. PLoS One4:e6213.

20. Gottesman, S. 2004. The small RNA regulators of Escherichia coli: roles andmechanisms. Annu. Rev. Microbiol. 58:303–328.

21. Gottesman, S., C. A. McCullen, M. Guillier, C. K. Vanderpool, N. Ma-jdalani, J. Benhammou, K. M. Thompson, P. C. FitzGerald, N. A. Sowa, andD. J. FitzGerald. 2006. Small RNA regulators and the bacterial response tostress. Cold Spring Harbor Symp. Quant. Biol. 71:1–11.

22. Hare, J. M., and K. A. McDonough. 1999. High-frequency RecA-dependentand -independent mechanisms of Congo red binding mutations in Yersiniapestis. J. Bacteriol. 181:4896–4904.

23. Hare, J. M., A. K. Wagner, and K. A. McDonough. 1999. Independentacquisition and insertion into different chromosomal locations of the samepathogenicity island in Yersinia pestis and Yersinia pseudotuberculosis. Mol.Microbiol. 31:291–304.

24. Hinnebusch, B. J., A. E. Rudolph, P. Cherepanov, J. E. Dixon, T. G. Schwan,and A. Forsberg. 2002. Role of Yersinia murine toxin in survival of Yersiniapestis in the midgut of the flea vector. Science 296:733–735.

25. Kulesus, R. R., K. Diaz-Perez, E. S. Slechta, D. S. Eto, and M. A. Mulvey.2008. Impact of the RNA chaperone Hfq on the fitness and virulence po-tential of uropathogenic Escherichia coli. Infect. Immun. 76:3019–3026.

26. Kupferberg, L. L., and K. Higuchi. 1958. Role of calcium ions in the stim-ulation of growth of virulent strains of Pasteurella pestis. J. Bacteriol. 76:120–121.

27. Lucchetti-Miganeh, C., E. Burrowes, C. Baysse, and G. Ermel. 2008. Thepost-transcriptional regulator CsrA plays a central role in the adaptation ofbacterial pathogens to different stages of infection in animal hosts. Micro-biology 154:16–29.

28. McNealy, T. L., V. Forsbach-Birk, C. Shi, and R. Marre. 2005. The Hfqhomolog in Legionella pneumophila demonstrates regulation by LetA andRpoS and interacts with the global regulator CsrA. J. Bacteriol. 187:1527–1532.

29. Muffler, A., D. Fischer, and R. Hengge-Aronis. 1996. The RNA-bindingprotein HF-I, known as a host factor for phage Qbeta RNA replication, isessential for rpoS translation in Escherichia coli. Genes Dev. 10:1143–1151.

30. Nakao, H., H. Watanabe, S. Nakayama, and T. Takeda. 1995. yst geneexpression in Yersinia enterocolitica is positively regulated by a chromosomalregion that is highly homologous to Escherichia coli host factor 1 gene (hfq).Mol. Microbiol. 18:859–865.

31. Perry, R. D., and J. D. Fetherston. 1997. Yersinia pestis—etiologic agent ofplague. Clin. Microbiol. Rev. 10:35–66.

32. Pfeiffer, V., A. Sittka, R. Tomer, K. Tedin, V. Brinkmann, and J. Vogel. 2007.A small non-coding RNA of the invasion gene island (SPI-1) represses outermembrane protein synthesis from the Salmonella core genome. Mol. Micro-biol. 66:1174–1191.

33. Robertson, G. T., and R. M. Roop, Jr. 1999. The Brucella abortus host factorI (HF-I) protein contributes to stress resistance during stationary phase andis a major determinant of virulence in mice. Mol. Microbiol. 34:690–700.

34. Schiano, C. A., L. E. Bellows, and W. W. Lathem. 2010. The small RNAchaperone Hfq is required for the virulence of Yersinia pseudotuberculosis.Infect. Immun. 78:2034–2044.

35. Schumacher, M. A., R. F. Pearson, T. Moller, P. Valentin-Hansen, and R. G.Brennan. 2002. Structures of the pleiotropic translational regulator Hfq andan Hfq-RNA complex: a bacterial Sm-like protein. EMBO J. 21:3546–3556.

36. Sittka, A., S. Lucchini, K. Papenfort, C. M. Sharma, K. Rolle, T. T. Binnew-ies, J. C. Hinton, and J. Vogel. 2008. Deep sequencing analysis of smallnoncoding RNA and mRNA targets of the global post-transcriptional reg-ulator, Hfq. PLoS Genet. 4:e1000163.

37. Sittka, A., V. Pfeiffer, K. Tedin, and J. Vogel. 2007. The RNA chaperone Hfqis essential for the virulence of Salmonella typhimurium. Mol. Microbiol.63:193–217.

38. Sonnleitner, E., S. Hagens, F. Rosenau, S. Wilhelm, A. Habel, K. E. Jager,and U. Blasi. 2003. Reduced virulence of a hfq mutant of Pseudomonasaeruginosa O1. Microb. Pathog. 35:217–228.

39. Sonnleitner, E., I. Moll, and U. Blasi. 2002. Functional replacement of theEscherichia coli hfq gene by the homologue of Pseudomonas aeruginosa.Microbiology 148:883–891.

40. Stover, C. K., X. Q. Pham, A. L. Erwin, S. D. Mizoguchi, P. Warrener, M. J.Hickey, F. S. Brinkman, W. O. Hufnagle, D. J. Kowalik, M. Lagrou, R. L.Garber, L. Goltry, E. Tolentino, S. Westbrock-Wadman, Y. Yuan, L. L.Brody, S. N. Coulter, K. R. Folger, A. Kas, K. Larbig, R. Lim, K. Smith, D.Spencer, G. K. Wong, Z. Wu, I. T. Paulsen, J. Reizer, M. H. Saier, R. E.Hancock, S. Lory, and M. V. Olson. 2000. Complete genome sequence ofPseudomonas aeruginosa PAO1, an opportunistic pathogen. Nature 406:959–964.

41. Sun, X., I. Zhulin, and R. M. Wartell. 2002. Predicted structure and phyleticdistribution of the RNA-binding protein Hfq. Nucleic Acids Res. 30:3662–3671.

42. Tsui, H. C., H. C. Leung, and M. E. Winkler. 1994. Characterization ofbroadly pleiotropic phenotypes caused by an hfq insertion mutation in Esch-erichia coli K-12. Mol. Microbiol. 13:35–49.

43. Valentin-Hansen, P., M. Eriksen, and C. Udesen. 2004. The bacterial Sm-

4244 NOTES J. BACTERIOL.

on January 23, 2020 by guesthttp://jb.asm

.org/D

ownloaded from

like protein Hfq: a key player in RNA transactions. Mol. Microbiol. 51:1525–1533.

44. Vasudeva-Rao, H. M., and K. A. McDonough. 2008. Expression of the Myco-bacterium tuberculosis acr-coregulated genes from the DevR (DosR) regulon iscontrolled by multiple levels of regulation. Infect. Immun. 76:2478–2489.

45. Wassarman, K. M. 2002. Small RNAs in bacteria: diverse regulators of geneexpression in response to environmental changes. Cell 109:141–144.

46. Waters, L. S., and G. Storz. 2009. Regulatory RNAs in bacteria. Cell 136:615–628.

47. Wilson, J. W., C. M. Ott, K. H. Zu Bentrup, R. Ramamurthy, L. Quick, S.Porwollik, P. Cheng, M. McClelland, G. Tsaprailis, T. Radabaugh, A. Hunt,D. Fernandez, E. Richter, M. Shah, M. Kilcoyne, L. Joshi, M. Nelman-Gonzalez, S. Hing, M. Parra, P. Dumars, K. Norwood, R. Bober, J. Devich,

A. Ruggles, C. Goulart, M. Rupert, L. Stodieck, P. Stafford, L. Catella, M. J.Schurr, K. Buchanan, L. Morici, J. McCracken, P. Allen, C. Baker-Coleman,T. Hammond, J. Vogel, R. Nelson, D. L. Pierson, H. M. Stefanyshyn-Piper,and C. A. Nickerson. 2007. Space flight alters bacterial gene expression andvirulence and reveals a role for global regulator Hfq. Proc. Natl. Acad. Sci.U. S. A. 104:16299–16304.

48. Zhang, A., K. M. Wassarman, J. Ortega, A. C. Steven, and G. Storz. 2002.The Sm-like Hfq protein increases OxyS RNA interaction with targetmRNAs. Mol. Cell 9:11–22.

49. Zhou, D., Z. Tong, Y. Song, Y. Han, D. Pei, X. Pang, J. Zhai, M. Li, B.Cui, Z. Qi, L. Jin, R. Dai, Z. Du, J. Wang, Z. Guo, P. Huang, and R. Yang.2004. Genetics of metabolic variations between Yersinia pestis biovars andthe proposal of a new biovar, microtus. J. Bacteriol. 186:5147–5152.

VOL. 192, 2010 NOTES 4245

on January 23, 2020 by guesthttp://jb.asm

.org/D

ownloaded from