The Fur-Iron Complex Modulates Expression of the Quorum-SensingMaster Regulator, SmcR, To Control Expression of Virulence Factorsin Vibrio vulnificus

In Hwang Kim,a Yancheng Wen,a Jee-Soo Son,a Kyu-Ho Lee,a Kun-Soo Kima,b

Department of Life Sciencea and Interdisciplinary Program of Integrated Biotechnology,b Sogang University, Seoul, South Korea

The gene vvpE, encoding the virulence factor elastase, is a member of the quorum-sensing regulon in Vibrio vulnificus and dis-plays enhanced expression at high cell density. We observed that this gene was repressed under iron-rich conditions and that therepression was due to a Fur (ferric uptake regulator)-dependent repression of smcR, a gene encoding a quorum-sensing masterregulator with similarity to luxR in Vibrio harveyi. A gel mobility shift assay and a footprinting experiment demonstrated thatthe Fur-iron complex binds directly to two regions upstream of smcR (�82 to �36 and �2 to �27, with respect to the transcrip-tion start site) with differing affinities. However, binding of the Fur-iron complex is reversible enough to allow expression ofsmcR to be induced by quorum sensing at high cell density under iron-rich conditions. Under iron-limiting conditions, Fur failsto bind either region and the expression of smcR is regulated solely by quorum sensing. These results suggest that two biologi-cally important environmental signals, iron and quorum sensing, converge to direct the expression of smcR, which then coordi-nates the expression of virulence factors.

Pathogenic bacteria are equipped with complicated signaltransduction systems to sense various environmental factors

and swiftly adapt themselves to survive and propagate while incompetition with host cells. Each signal transduction pathway fora given environmental factor has been studied intensively, butrelationships among these pathways still remain to be defined.

Quorum sensing is a signal transduction process by which mi-croorganisms sense the population of the same or related speciesand communicate with each other via diffusible signal molecules,generally called autoinducers (1). As with numerous other patho-genic bacteria, quorum sensing plays pivotal roles in regulatingvirulence factors in Vibrio vulnificus. V. vulnificus is a Gram-neg-ative bacterium that causes fatal primary septicemia after the in-gestion of contaminated seafood or during wound infection (2–5). Quorum sensing in V. vulnificus is not well understood butappears to be closely related to that of Vibrio harveyi and Vibriocholerae (6). V. vulnificus harbors homologs of LuxPQ, a sensor fora borate diester autoinducer (AI-2), and carries a luxS gene, en-coding the AI-2 synthase (7). A homoserine lactone autoinducer(AI-1) has been detected in one strain of V. vulnificus (8); however,in many other well-studied strains, such as YJ016, CMCP6, andMO6-24/O, whose genome sequences have been completely de-termined (9–11), the effort to identify an AI-1 compound or agene responsible for AI-1 biosynthesis has been unsuccessful. Ananalysis of the genome sequences of these three strains has uncov-ered homologs of luxU and luxO, which encode proteins respon-sible for the transduction of signals via a phosphorelay from asensor protein. These signals are funneled to the master regulator,SmcR, a homolog of LuxR in V. harveyi (7, 12), which subse-quently induces the expression of vvpE, a gene encoding an elas-tase (13), and represses yegD, a gene encoding a chaperone (14).SmcR also represses the expression of hlyU (15), a gene encodingan activator that induces the expression of the virulence factorsvvhAB and rtxA, encoding a hemolysin and an Rtx protein (amultifunctional autoprocessing toxin) (16), respectively.

Iron is an essential element for living organisms and is required

for many biological metabolic pathways, including oxygen trans-port, photosynthesis, the trichloroacetic acid cycle, and respira-tion (17). However, the solubility of iron is extremely low at neu-tral pH; hence, biologically available iron is scarce and mostorganisms struggle to obtain iron. On the other hand, an excess ofintracellular iron is deleterious to cells because it leads to the pro-duction of toxic free radicals. For these reasons, cells must metic-ulously control intracellular iron levels (18). Iron also plays animportant role in the pathogenicity of bacteria. In pathogens suchas Escherichia coli, V. cholerae, and Corynebacterium diphtheriae,iron levels dictate the expression of virulence-associated genes(19–21), and the production of those virulence factors reaches amaximal level when the concentration of iron is lower than thatrequired for optimal growth (22). For the iron-associated regula-tion of genes, many bacteria employ ferric uptake regulator (Fur),a small protein that, in complex with iron, regulates multiplegenes by binding to upstream sequences called Fur boxes (23–25).Genes in the Fur regulon have been identified as relevant not onlyfor iron uptake/utilization, including siderophores and the tonsystem (17, 23), but also for pathogenicity, including a Shiga-liketoxin and the Pseudomonas exotoxin A (19, 26). The Fur protein ofV. vulnificus functions as a homodimer of approximately 16-kDamonomers and affects the expression of diverse genes, includingthose for iron utilization and superoxide dismutase (27).

Even though both quorum sensing and iron-dependent regu-lation have been studied intensively for Vibrio species, no relation-

Received 24 March 2013 Returned for modification 7 May 2013Accepted 22 May 2013

Published ahead of print 28 May 2013

Editor: A. Camilli

Address correspondence to Kun-Soo Kim, kskim@sogang.ac.kr.

Copyright © 2013, American Society for Microbiology. All Rights Reserved.

doi:10.1128/IAI.00375-13

2888 iai.asm.org Infection and Immunity p. 2888–2898 August 2013 Volume 81 Number 8

on May 17, 2020 by guest

http://iai.asm.org/

Dow

nloaded from

ships between these two global regulatory pathways have beenexplored. Recently, we showed that the Fur-iron complex andquorum sensing in V. vulnificus coordinately regulate siderophoreproduction to achieve appropriate intracellular levels of iron (28).Under iron-limiting conditions, vvsAB, encoding vulnibactin, asiderophore of V. vulnificus, showed no significant expression atlow cell density, but it was expressed fully at high cell densitythrough SmcR-mediated induction. Under iron-rich conditions,vvsAB expression was repressed regardless of cell density. Theseresults suggested that the two environmental signals, iron and celldensity, are important for modulation of this virulence factor andthat these two regulatory circuits are linked. In this study, wefurther investigated the effect of iron on the expression of viru-lence factors known to respond to quorum sensing in V. vulnificus.We found that signals from both iron levels and population den-sity are funneled to the master regulator, SmcR, a homolog of V.harveyi-type LuxR, which then coordinately regulates the expres-sion of virulence factors.

MATERIALS AND METHODSStrains, plasmids, and culture conditions. The bacterial strains and plas-mids used in this study are listed in Table 1. E. coli strains were cultured inLuria-Bertani (LB) broth supplemented with appropriate antibiotics at37°C. V. vulnificus strains were cultured in LB broth or thiosulfate citratebile salt sucrose (TCBS) agar at 30°C. When necessary, either ferroussulfate (25 �M) as an iron source or 2,2=-dipyridyl (100 �M) as an ironchelator was added exogenously to the LB broth when the A600 value of theculture reached approximately 0.1.

Assay of proteolytic activity. Strains of V. vulnificus were culturedovernight in LB medium and subcultured in fresh LB broth containing

100 �M 2,2=-dipyridyl or 25 �M FeSO4. Protease activity was measuredquantitatively using the assay described previously (29). Specific activitieswere normalized to cell density.

Bioluminescence assays. Overnight cultures of V. vulnificus strainsgrown in LB were inoculated into fresh LB medium. To assess the effect ofiron, either 25 �M FeSO4 or 100 �M 2,2=-dipyridyl was added, and sam-ples were diluted 125-fold with LB broth. At various growth stages,0.006% (vol/vol) n-decylaldehyde (in 50% ethanol) was added and lumi-nescence was measured using a luminometer (Mithras LB 940; Berthold,Bad Wildbach, Germany) as previously described (28). Specific transcrip-tional level was expressed as the luminescence units normalized to celldensity (relative luminescence units [RLU]).

Western blot hybridization of SmcR. For the SmcR expressionanalysis, overnight cultures of V. vulnificus MO6-24/O(pRK415),HLM101(pRK415), or HLM101(pRK-fur) grown in LB were subculturedinto fresh LB medium and treated with either 100 �M 2,2=-dipyridyl or 25�M FeSO4 when the A600 value of the culture reached approximately 0.1.Cells at stationary phase (A600 of �1.5) were washed and resuspended inphosphate-buffered saline (PBS) containing either 100 �M chelator or 25�M FeSO4. Then, 60 �g of each lysate was subjected to SDS-PAGE andtransferred to a Hybond P membrane (GE Healthcare Life Sciences, Pis-cataway, NJ). The membrane was incubated with polyclonal rat antiseraagainst purified SmcR (28) (1:1,000 dilution in blocking solution) andsubsequently with goat anti-rat immunoglobulin G-horseradish peroxi-dase (HRP) (1:2,000) (Santa Cruz Biotechnology, Santa Cruz, CA). SmcRexpression was visualized using the Western blotting Luminol reagent(Santa Cruz Biotechnology, Santa Cruz, CA).

Cloning of fur and construction of vvpE-luxAB and smcR-luxABtranscriptional fusions. The 673-bp DNA fragment comprising the pro-moter region and the coding region of fur was amplified by PCR using theprimers fur_comF and fur_comB (Table 2). The resulting product was

TABLE 1 Bacterial strains and plasmids used in this study

Strain or plasmid Genotype Source or reference

StrainsE. coli

DH5� �� �80dlacZ �M15 �(lacZYA-argF)U169 recA1 endA1 hsdR17(rK� mK

�) supE44 thi-1 gyrA relA1 Our collectionBL21(DE3) F� ompT hsdSB (rB

� mB�) gal dcm (DE3) Novagen

V. vulnificusMO6-24/O Pathogenic clinical isolate 41HLM101 Derivative of MO6-24/O with a deletion in fur, Kmr 37HS031 Derivative of MO6-24/O with a deletion in smcR, Kmr 12

PlasmidspASK-IBA7 Expression vector for recombinant proteins with N-terminal Strep tag, Apr IBApASK-IBA7-Fur pASK-IBA7 containing V. vulnificus fur operon This studypGEM-T Easy TA cloning vector, lacZ, f1 origin, Apr PromegapGEM-SmcR pGEM-T Easy vector containing smcR upstream region (�284 to �114)a This studypGEM-Sm1 pGEM-T Easy vector with the mutated region I of the smcR promoter region This studypGEM-Sm2 pGEM-T Easy vector with mutated region II of smcR promoter region This studypGEM-Sm1/2 pGEM-T Easy vector with mutated regions I and II of smcR promoter region This studypHK0011 pRK415 with a promoterless luxAB, Tcr 30pHSmcR pHK0011 with smcR promoter region fused to luxAB (�347 to �114) This studypHSm1 pHK0011 with mutated region I of smcR promoter region fused to luxAB This studypHSm2 pHK0011 with mutated region II of smcR promoter region fused to luxAB This studypHSm1/2 pHK0011 with double mutations in regions I and II of smcR promoter region fused to luxAB This studypHvvpE pHK0011 with vvpE This studypRK415 IncP ori, broad-host-range vector; oriT of RP4, Tcr 42pRK-fur pRK415 with V. vulnificus fur This studypRK-smcR pRK415 with V. vulnificus smcR 28pDM4 Suicide vector for allelic exchange, sacB, Cmr 31pDM4-smcRlux pDM4 with smcR promoter region fused to luxAB This study

a Numbers indicate nucleotide positions relative to the translational start site.

Iron Represses Quorum-Sensing Regulator SmcR

August 2013 Volume 81 Number 8 iai.asm.org 2889

on May 17, 2020 by guest

http://iai.asm.org/

Dow

nloaded from

cloned into pRK415 to construct pRK-fur. The 416-bp upstream region(�358 to �58 with respect to the translation start site) of vvpE and the461-bp upstream region (�347 to �114 relative to the translation startsite) of smcR were amplified by PCR using the primers vvpE_tcF andvvpE_tcB and primers smcR_tcF and smcR_tcB (Table 2), respectively,and cloned into the pGEM-T Easy vector (Promega, Madison, WI). Theresulting plasmids were digested with KpnI and XbaI and cloned intopHK0011 (30) to generate pHvvpE and pHsmcR. To construct singlecrossovers of smcR-luxAB fusions into V. vulnificus, each lux fusion wasamplified by PCR using the primers smcRscF and luxscB (Table 2) andcloned into the SphI- and SalI-digested pDM4 plasmid (31) using theIn-fusion HD cloning kit (Clontech Laboratories, TaKaRa Bio Inc., Shiga,Japan) to generate pDM4-smcRlux. Each plasmid was conjugated into V.vulnificus MO6-24/O wild type, HLM101, and HS031.

Expression and purification of Fur. A DNA fragment encoding 149amino acids of Fur was amplified by PCR using the primers furOEF and

furOEB (Table 2) and subcloned into the pASK-IBA7 vector, resulting inexpression of Fur fused to a Strep-tag at the N terminus. The resultingvector, named pASK-IBA7-Fur, was transformed into E. coli BL21(DE3),and expression of the Strep-tagged Fur was induced with 0.2 �g/ml anhy-drotetracycline. After centrifugation, bacterial pellets were suspended inbuffer W (100 mM Tris-Cl, 150 mM NaCl, and 1 mM EDTA), sonicated,and centrifuged at 7,000 rpm for 10 min. The resulting supernatant waspurified using Strep-Tactin affinity resin (IBA BioTAGnology, Göttingen,Germany), and specifically bound protein was eluted with buffer E (100mM Tris-Cl, 150 mM NaCl, 1 mM EDTA, and 2.5 mM desthiobiotin)according to the manufacturer’s protocol. The eluted protein was sepa-rated on a 12% sodium dodecyl sulfate polyacrylamide gel (SDS-PAGE)to assess purity. The purified Fur protein was dialyzed using Spectra/Pormolecular porous membrane tubing (molecular weight cutoff [MWCO]of 10,000; Spectrum Laboratories Inc., Rancho Dominguez, CA) withbuffer A (50 mM Tris-Cl [pH 8.0], 100 mM NaCl, 1 mM MgCl2, and 2mM dithiothreitol) and concentrated using the Vivaspin 6 instrument(Vivagen, Seoul, South Korea). The protein concentration was deter-mined by the Lowry method (32).

Site-directed mutagenesis of Fur boxes in the upstream region ofsmcR. The 398-bp DNA fragment of the smcR upstream region (�284 to�114 with respect to the translation start site) was amplified by PCR usingthe primers smcR_F and smcR_tcB (Table 2). The resulting product wasligated to the pGEM-T easy vector, resulting in pGEM-SmcR. Each of theregions (I and II) containing Fur boxes was mutagenized using the primerset smcR_smIF and smcR_smIB and the primer set smcR_smIIF andsmcR_smIIB (Table 2), respectively, and both of the regions were mu-tagenized using both sets of primers and the QuickChangeII site-directedmutagenesis kit (Agilent Technologies, Santa Clara, CA). The resultingplasmids were named pGEM-Sm1, pGEM-Sm2, and pGEM-Sm1/2, re-spectively. Using each of these constructs as templates, the 461-bp up-stream region (�347 to �114 with respect to the translation start site) wasamplified by PCR using the primers smcR_tcF and smcR_tcB (Table 2).The resulting products were digested with KpnI and XbaI and cloned intopHK0011 to generate pHSm1, pHSm2, and pHSm1/2.

Gel shift assay. A 319-bp DNA fragment of the region upstream ofsmcR (�284 to �35 with respect to the translation start site) was amplifiedby PCR using the primers smcR_F and 32P-labeled smcR_B (Table 2). Forgel shift assays, 10 ng of the labeled probe was incubated with increasingamounts of purified Fur protein (0 to 30 nM) in a 20-�l reaction mixturein binding buffer (33) containing 10 mM Tris-borate (pH 7.5), 100 �g/mlbovine serum albumin, 5% (vol/vol) glycerol, 40 mM KCl, 1 mM MgCl2,and 1 �g poly(dI-dC) and supplemented with either 100 �M MnCl2 or100 �M EDTA for 30 min at 30°C. The binding reaction was terminatedby the addition of 3 �l loading buffer, and samples were resolved on a 6%neutral polyacrylamide gel. To measure the affinity of Fur for smcR, sm1,sm2, and sm1/2, the 319-bp regions (�284 to �35 with respect to thetranslation start site) were amplified by PCR using the primers smcR_Fand 32P-labeled smcR_B (Table 2) and pGEM-SmcR, pGEM-Sm1,pGEM-Sm2, and pGEM-Sm1/2 as templates. Each of the labeled probes(10 ng) was incubated with increasing amounts of purified Fur protein (0,3, 4.5, 6, 12, 24, and 30 nM), and gel shift assays were performed asdescribed above. Gels were exposed to a BAS-MP 2040s imaging plate(Fujifilm, Tokyo, Japan), and scanned by using a BAS-1500 instrument(Fujifilm, Tokyo, Japan). The intensities of the bands were measured us-ing the Multi Gauge software program, version 3.0 (Fujifilm, Tokyo, Ja-pan). The percentage of probe bound to Fur relative to unbound probewas calculated at each Fur concentration. The Kd value was obtained usingthe Prism program (Graphpad Software Inc., San Diego, CA).

DNase I footprinting analysis. An end-labeled, 319-bp DNA frag-ment of the smcR upstream region (�284 to �35 with respect to thetranslation start site) was amplified using the primers smcR_F and 32P-labeled smcR_B (Table 2). To determine the Fur binding site, 200 ng of theamplified smcR upstream region was incubated with increasing amountsof purified Fur (0 to 1 �M) in 20 �l of binding buffer (10 mM Tris-borate

TABLE 2 Primers used in this study

Function and name Nucleotide sequence (5= to 3=)a

Cloning of V. vulnificus furfur_OEF GAATTCATGTCAGACAATAACCAAfur_OEB CTGCAGTTAGTTCTTACGTTTATGTGfur_comF GGATCCTAGCTCTCTTTGCAAATTGTfur_comB GCATGCTGGCTTTTAAGATCTATC

Gel shift assay and DNase Ifootprinting

smcR_F ACTCCGCAAAGCAATCTTTAACsmcR_B AAGCGAGTTCGCGGTCTCTT

Site-directed mutagenesissmcR_smIF GTCAGCGTCGCCGTCTGCCTATTCAC

ATAAGTTATTGACsmcR_smIB GGCAGACGGCGACGCTGACATTGATA

TCTATTTGAGCAAsmcR_smIIF GGCTGTTGAAGCAACTGATAGGAACA

GCTAAGCCGTTCCAsmcR_smIIB CAGTTGCTTCAACAGCCGCTTTTAGCT

CATGAGTGTAAT

Construction of a luxAB fusionvvpE_tcF GGTACCATGCATGTAACATTAATAAATCvvpE_tcB TCTAGAGAACACATGACTGCGGCAATCsmcR_tcF AAGGTACCCGAGCAAAGTGTCACTTAGsmcR_tcB TCTAGACCACCACGGCCAATGCCACGACsmcRscF CTCAGGTTACCCGCATGCCGAGCAA

AGTGTCACTTAGluxscB TATCGATACCGTCGACCTTCAGCATC

AGTTAAACGT T

Cloning of V. cholerae furVcfur_comF GACGGCCAGTGAATTCGTGTAAGGC

AGCAGTAATCVcfur_comB TACCGAGCTCGAATTCGGTTTACAGA

GCGTAAAGCC

Construction of a V. choleraefur deletion

vcfur _F TGTCGACAATAAATTCAGGGAAGCATvcfur _B TGAATTCCTTTAGCGCTTGGTTATTGTCvcfur _F1 TGAATTCAAGCCGAAGAAATAACCATAvcfur _B1 GCATGCGCTAAAGCCGATTTACGATG

Real-time PCRyegD_RTF TGGAACAGCGAATTGTTCAGTGGCGyegD_RTB TATCTAGTGGCTTGATATCTCGATGHlyU_RTF ATGAAAGACGCCTGCAAATCHlyU_RTB CCGTTTGTGCTTCTTTACGCgapNAD_RTF TTGATTGGCCAGAATTGGAGTTTGgapNAD_RTB TGGTTTCAATCACGTGACCATTGAvchap_RTF CGATGTGCTGAATTTTGTGGvchap_RTB CGCCAATTTCACCATCTCTTvcgap_RTF TTTAAGAGCTTCGTTTGATTGGCCvcgap_RTB TTTTTCTTGTGTTGTGCGAATGCG

a Nucleotides modified for the generation of restriction sites or for site-directedmutagenesis are underlined.

Kim et al.

2890 iai.asm.org Infection and Immunity

on May 17, 2020 by guest

http://iai.asm.org/

Dow

nloaded from

[pH 7.5], 100 �g/ml bovine serum albumin, 5% [vol/vol] glycerol, 40 mMKCl, 1 mM MgCl2, 1 �g poly[dI-dC]) with either 100 �M MnCl2 or 100�M EDTA as a chelator for 1 h at 30°C. After 1 h, 0.4 unit of DNase I(Promega, Madison, WI) was added, and the reaction mixture was incu-bated at 30°C for 2 min. The reaction was terminated by the addition of 25�l of stop buffer (20 mM EDTA), and 150 �l of deionized water wasadded. After the addition of 500 �l ethanol, samples were precipitated at�80°C for more than 2 h and then centrifuged. DNA pellets were washedwith 70% ethanol and resuspended in 10 �l loading buffer (0.1 M NaOH-formamide [1:2], 0.1% xylene cyanol, 0.1% bromophenol blue). The sam-ples and the sequencing ladder generated with 32P-labeled SmcR_B weredenatured for 5 min at 95°C, chilled on ice, and separated on a 6% poly-acrylamide sequencing gel. The sequencing ladders were prepared usingan AccuPower DNA sequencing kit (Bioneer, Daejeon, South Korea).

Quantitative RT-PCR (qRT-PCR) analysis. RNA was isolated fromV. vulnificus or V. cholerae using the RNeasy minikit (Qiagen, California,USA) and the RNase-free DNase set (Qiagen, California, USA). Afterquantification of purified RNA using a biophotometer (Eppendorf, Ham-burg, Germany), cDNA was synthesized from 1 �g of RNA using the

PrimeScript RT reagent kit (TaKaRa Bio Inc., Shiga, Japan), following themanufacturer’s directions. cDNA (2 �l) was analyzed by reverse trans-criptase PCR (RT-PCR) on a Light Cycler 480 II real-time PCR system(Roche Applied Science, Penzberg, Upper Bavaria, Germany) using Light-Cycler 480 DNA SYBR green I master (Roche Applied Science). RT-PCRwas carried out in triplicate in a 96-well plate (Roche Applied Science)using the primers shown in Table 2. The gene encoding NAD-dependentglyceraldehyde-3-phosphatase of V. vulnificus was used as an endogenousloading control for the reactions. Quantification was carried out using theLight Cycler 480 II real-time PCR system software program.

RESULTSUnder iron-rich conditions, transcription of vvpE is repressed.Our previous study concluded that the Fur-iron complex regu-lates the expression of vvsAB, an operon encoding a siderophoreimportant for virulence in V. vulnificus (28). From this observa-tion, we predicted that iron may also affect the expression of othervirulence factors in this pathogen; therefore, we examined the

FIG 1 Expression of vvpE is repressed by iron. (A) VvpE activity in wild-type MO6-24/O(pRK415) (circles), HLM101 (a fur deletion isotype) (triangles), orHLM101(pRK-fur) (squares) under iron-limiting or iron-rich conditions. Relative protease activity is expressed as protease activity normalized to cell density.Open symbols represent protease activities under iron-limiting conditions. Solid symbols represent activities under iron-rich conditions. (B) Luciferase activitiesof V. vulnificus wild type MO6-24/O (circles) and HLM101 (triangles) harboring vvpE-luxAB fusions under iron-limiting or iron-rich conditions. Relativeluminescence units (RLU) represent the luminescence values normalized to cell density (optical density at 600 nm [OD600]). Open symbols represent luciferaseactivities under iron-limiting conditions. Solid symbols represent the activities under iron-rich conditions. Data are the average values from three independentexperiments, and error bars denote standard deviations.

Iron Represses Quorum-Sensing Regulator SmcR

August 2013 Volume 81 Number 8 iai.asm.org 2891

on May 17, 2020 by guest

http://iai.asm.org/

Dow

nloaded from

effect of iron on the expression of another known virulence factor,elastase, encoded by vvpE (30). In the absence of iron, elastaseactivity in a wild-type strain (MO6-24/O) increased when cellsentered stationary phase (at A600 2.2) (Fig. 1A), demonstratingthat expression of this protein is controlled by quorum sensing, aspreviously reported (13). When we measured elastase activity un-der iron-limiting conditions in a fur deletion strain with or with-out complementation by wild-type fur on a plasmid, there was nosignificant difference from that of a wild-type strain. However,when cells were grown under iron-rich conditions, the timing ofthe increase in elastase activity differed between the wild type anda fur mutant. In the wild-type strain, activity increased later instationary phase (A600 2.7) than in the fur deletion mutant (A600

of 2.2). In the fur mutant strain complemented with wild-typefur on a multicopy plasmid, induction of activity was delayed evenfurther (A600 of 3.0). To follow up on these results, we assessedthe transcription of vvpE using a lux fusion (Fig. 1B). Consistentwith what we observed for enzyme activity, the enhancement oftranscription of vvpE in wild-type V. vulnificus in stationary phase(A600 of 2 to 2.7) was significantly delayed under iron-rich con-ditions compared to that under iron-limiting conditions. In thefur deletion mutant, transcription was induced much earlier re-gardless of iron availability. Together, these results suggest that theexpression of vvpE, which is regulated by quorum sensing, is alsoaffected by the presence of iron through repression by Fur.

The Fur-iron complex represses the expression of SmcR. It iswell known that the transcription of vvpE is positively regulated bythe quorum-sensing master regulator, SmcR (13). We hypothe-sized that iron, together with Fur, affects the expression of vvpEindirectly by regulating the expression of smcR. To verify this hy-pothesis, we assessed the effect of iron on the expression of smcRusing an smcR-luxAB transcriptional reporter fusion in cellsgrown for varied cell densities (Fig. 2). At early exponential phase,the transcription of smcR in a wild-type strain was barely detect-able, irrespective of the iron concentration. At stationary phase(A600 of 2.0), smcR was fully expressed in the absence of iron butwas expressed at only about half that level under iron-rich condi-tions. When cells reached late stationary phase, the repression wasalmost completely relieved (Fig. 2A). In contrast, in a fur deletionmutant, the transcription of smcR under iron-rich conditions isderepressed regardless of growth phase. Complementation of thefur deletion mutant with a fur gene on a plasmid restored theiron-dependent repression of smcR.

Repression of smcR expression at low cell density is achieved bydegradation of smcR mRNA through the action of small RNAmolecules called Qrrs, which are activated by phosphorylatedLuxO (6, 34). For this reason, measurements of smcR transcrip-tion using a reporter fusion may not accurately represent the levelsof the active SmcR protein; therefore, we measured the levels ofthe SmcR protein directly to assess the effect of iron (Fig. 2B).

FIG 2 The Fur-iron complex represses transcription and translation of smcR. (A) Luciferase activities of V. vulnificus MO6-24/O(pRK415) (circles),HLM101(pRK415) (triangles), and HLM101(pRK-fur) (squares) harboring smcR-luxAB fusions under iron-limiting (open symbols) or iron-rich (closedsymbols) conditions. Relative luminescence units (RLU) represent the luminescence values normalized to cell density (OD600). Data are the average values fromthree independent experiments, and error bars denote standard deviations. (B) Western hybridization of total protein extracts from V. vulnificus MO6-24/O(pRK415), HLM101(pRK415), and HLM101(pRK-fur) using polyclonal antisera against SmcR. Lanes 1 and 2, V. vulnificus MO6-24/O(pRK415); lanes 3 and4, HLM101(pRK415); lanes 5 and 6, HLM101(pRK-fur). Lanes 1, 3, and 5 represent cells grown under iron-limiting conditions (100 �M 2,2=-dipyridyl), andlanes 2, 4, and 6 represent cells grown under iron-rich conditions (25 �M FeSO4). Total protein was extracted from cells at an OD600 of 2.0, and 60 �g of thisprotein was loaded into each lane. Relative intensities of bands measured by a densitometer are indicated.

Kim et al.

2892 iai.asm.org Infection and Immunity

on May 17, 2020 by guest

http://iai.asm.org/

Dow

nloaded from

Western hybridization using polyclonal rat antisera against SmcRshowed that the levels of SmcR are lower in the presence of ironand that a mutation in fur reversed this effect. Complementationof the mutant with fur on a plasmid again led to decreased levels ofSmcR in the presence of iron (Fig. 2B). These results suggest thatFur, in the presence of iron, represses the expression of the quo-rum-sensing master regulator SmcR, which consequently re-presses the expression of vvpE, and the effect was relieved at latestationary phase.

Fur binds directly to the promoter region of smcR underiron-rich conditions. It is well known that the Fur-iron complexacts as a negative regulator (25), and we assumed that this complexwould repress transcription of smcR by binding to a cis-actingelement of smcR. To test this possibility, gel shift assays and DNaseI footprinting analyses were carried out. A gel shift assay was per-formed using a 32P-labeled 319-bp fragment of DNA from theregion upstream of smcR to determine whether the Fur-iron com-plex binds directly to the promoter region (Fig. 3A). In the pres-ence of 100 �M manganese (Mn), which is a typical substitute forferrous iron in in vitro binding reactions (35–37), Fur binds to this

sequence (Fig. 3A); however, in the presence of the chelatorEDTA, Fur was unable to bind (Fig. 3B). To identify the exactlocation within this region where Fur binds, a DNase I footprint-ing analysis was carried out using purified Fur. In the presence ofMn, two distinct regions within this sequence were protected byFur, while no protection was observed when EDTA was added.One region (region I) includes nucleotides �82 and �36 withrespect to the transcriptional start site and therefore is located justupstream of the �35 promoter region (Fig. 3C). The second re-gion (region II) includes nucleotides �2 and �27 and thereforeoverlaps with the transcriptional start site and spans the start ofthe transcript (Fig. 3C). The nucleotide sequences of these twoprotected regions are similar to the typical consensus sequencerecognized by Fur and possibly form hairpin structures to accom-modate homodimers of Fur (25) (Fig. 4).

This footprinting analysis suggested that two regions upstreamof smcR, regions I and II, are protected by Fur and that Fur bindsregion I with a higher affinity than region II. To confirm that Furbinds in this location, we mutagenized bases in one or both of thetwo regions such that the hairpin structures were disrupted

FIG 3 Binding of Fur to the region upstream of smcR. Shown here are the results of gel shift assays using a radiolabeled 319-bp fragment from upstream of smcRand purified Fur with either 100 �M MnCl2 (A) or EDTA as a chelator (B) added to the medium. Lanes 1 to 5, Fur concentrations of 0 nM, 3 nM, 6 nM, 12 nM,and 30 nM, respectively; lanes 6 to 8, 30 nM Fur with unlabeled probe as a competitor at 1 ng, 10 ng, and 100 ng, respectively. (C) DNase I protection of theupstream region of smcR by Fur. Lanes 1 to 5, 0 nM, 131 nM, 265 nM, 533 nM, and 1 �M Fur, respectively, incubated with 200 ng of 3=-labeled DNA with either100 �M MnCl2 or 100 �M EDTA; lanes G, A, T, and C represent the corresponding sequencing ladder. Regions I and II denote regions protected from DNaseI digestion (�1 represents the transcriptional start point).

Iron Represses Quorum-Sensing Regulator SmcR

August 2013 Volume 81 Number 8 iai.asm.org 2893

on May 17, 2020 by guest

http://iai.asm.org/

Dow

nloaded from

(Fig. 4) and measured the binding of purified Fur to these mutatedsequences. As shown in Fig. 5A, the Kd of Fur for the wild-typesequence was 8.2 nM in the presence of iron. Mutations in eitherregion led to higher Kd values for Fur, with12.6 nM for region I(Sm2) and 38.0 nM for region II (Sm1). Mutations in both ofthe regions combined (Sm1/2) completely abolished Fur binding.In the absence of iron, binding of Fur to either region was notdetected (data not shown). These results suggest that regions I andII are both bound by the Fur-iron complex but that binding oc-curs with a much higher affinity at region I than at region II.

Transcriptional fusions were constructed between the reportergenes luxAB and the wild type smcR upstream region (pHSmcR),each of the mutated regions (pHSm1 and pHSm2), or the doublemutant (pHSm1/2). Expression of the reporter genes in each ofthese constructs was quantitatively measured in the presence orabsence of iron. When regions I and II were both wild type, thepresence of iron resulted in half as much expression of the reporterthan was observed in the absence of iron (Fig. 5B). Mutations ineither of the two Fur binding regions lessened the repressive effect,and mutations in both of the Fur binding regions resulted in ex-pression equivalent to that of the wild-type sequence in the ab-sence of iron, suggesting that Fur was unable to bind in this case.There was more expression of the reporter gene when region IIwas mutated than when region I was mutated, suggesting thatregion II is more important for Fur repression of smcR.

The Fur-iron complex affects the expression of yegD andhlyU by repressing smcR. In the study described above, weshowed that the expression of vvpE is decreased in the presence ofiron due to the regulation of smcR expression. Our finding that theFur-iron complex repressed the expression of smcR, the primaryquorum-sensing regulator gene, led us to examine the effect ofiron on the expression of other genes previously reported to beunder the regulation of SmcR. Two of these genes, yegD, encodinga molecular chaperone, and hlyU, encoding an activator, are neg-atively regulated at the transcriptional level by SmcR (14, 16). Wemeasured the expression of these genes in cells at stationary phasefor the wild type (MO6-24/O), a fur deletion mutant (HLM101),and an smcR deletion mutant (HS031) in the presence or absenceof iron using quantitative RT-PCR. Under iron-rich conditions,the expression of each of these genes was enhanced in wild-type

cells (Fig. 6A and B). However, in a fur deletion mutant, expres-sion levels did not increase upon the addition of iron, but in transcomplementation of fur on a plasmid restored the response ofthese genes to iron. In an smcR deletion strain, the expression ofthese two genes was higher. Again, in trans complementationof smcR into this mutant reduced expression levels to those of thewild type. In summary, these results demonstrate that iron, incooperation with Fur, led to the increased expression of yegD andhlyU by repressing smcR. Together, our results indicate that mem-bers of the quorum-sensing regulon are regulated by the Fur-ironcomplex and that this regulation is accomplished by the modula-tion of SmcR levels.

DISCUSSION

Cell density and iron availability are important environmentalvariables affecting the physiology of cells and are particularly im-portant for the pathogenicity of virulent bacteria. Each of thesetwo environmental factors elicits its own cognate signal transduc-tion pathway and presumably affects the pathway of the other.Iron may influence the quorum-sensing pathway by affecting thegrowth rate of cells. Iron-poor conditions limit the growth of cellsand result in a low cell density, whereas excessive amounts of ironmay limit growth by generating toxic radicals (17, 24). When apathogen enters a host where available iron is scarce, iron influ-ences the growth of the pathogen and likely affects quorum sens-ing. On the other hand, cell density may directly affect the avail-ability of iron. Cells at high density compete for available ironsources, leading to iron-limiting conditions and the subsequentconstraint of growth. Therefore, pathogenic bacteria need to sensethose two environmental conditions both temporally and spatiallyand must orchestrate the appropriate signal pathways to controlgene expression accordingly in order to optimize physiologicalconditions and promote survival in the host.

Among Pseudomonas species, in which a quorum-sensing reg-ulatory pathway similar to that from V. fischeri is employed, thereare examples for which the Fur-iron complex affects the quorum-sensing regulatory pathway. In Pseudomonas syringe, a mutationin Fur reduces the production of the autoinducer N-acyl homo-serine lactone (N-AHL) and reduces the expression of severalquorum-sensing-associated genes, and conversely, N-AHL influ-

FIG 4 Comparison of regions I and II within the sequence upstream of smcR containing the consensus Fur box and the mutagenized bases. Nucleotides in boldwere protected by the Fur-iron complex in the footprinting analysis, and dots denote putative hairpin-forming nucleotides. Putative �35 and �10 regions andthe translational start site are indicated. Mutagenized sequences, Sm1 and Sm2, are also indicated.

Kim et al.

2894 iai.asm.org Infection and Immunity

on May 17, 2020 by guest

http://iai.asm.org/

Dow

nloaded from

ences expression of fur (38). In Pseudomonas aeruginosa, Fur af-fects the production of Pseudomonas quinolone signal (PQS),which controls the synthesis of secondary metabolites, extracellu-lar enzymes, and virulence factors. In this bacterium, iron alsoaffects the expression of the quorum-sensing regulator LasR (39).However, the molecular mechanism for a relationship betweenthe iron-associated signaling pathway and the quorum-sensingpathway in these Pseudomonas species has not yet been inves-tigated. In fact, for most bacteria in which a quorum-sensingregulatory pathway similar to that of V. harveyi is employed,interactions between quorum sensing and Fur-mediated iron

regulation have yet to be elucidated. Previously, we showedthat the expression of vvsA, a gene encoding vulnibactin, ismodulated cooperatively by SmcR and the Fur-iron complex.This result led us to extend our study to the effect of iron oncomponents associated with quorum sensing. In this work, weshowed that in V. vulnificus, cell density and iron availabilityare monitored, and those two signals converge on smcR, a mas-ter regulator for the quorum-sensing pathway with similarityto V. harveyi luxR, to orchestrate the expression of virulencegenes. The iron-dependent regulation of smcR is achievedthrough binding of the Fur-iron complex to the upstream re-

FIG 5 Regions I and II are important for repression of smcR by the Fur-iron complex. (A) Affinity of the Fur-iron complex to either wild-type or mutagenizedFur-binding regions in the upstream region of smcR. Binding of the Fur-iron complex to the wild-type sequence, Sm1, Sm2, and Sm1/2 was quantitativelymeasured as described in Materials and Methods. The y axis represents the percentage of Fur-iron binding relative to binding of the wild-type sequence, and thex axis represents the concentration of Fur. (B) Expression of the luxAB fusion driven by the wild-type or mutagenized region upstream of smcR. Cells were grownin the presence (25 �M FeSO4) or absence (100 �M 2,2=-dipyridyl) of iron, and the resulting luciferase activity was measured. RLU (relative luminescence units)indicates luciferase activity normalized to cell density (OD600). “X” indicates a mutated Fur binding region. Data are average values from three independentexperiments, and error bars denote the standard deviations (�, P 0.005; ��, P 0.05).

Iron Represses Quorum-Sensing Regulator SmcR

August 2013 Volume 81 Number 8 iai.asm.org 2895

on May 17, 2020 by guest

http://iai.asm.org/

Dow

nloaded from

gions of the regulator gene, as demonstrated by both gel shiftand footprinting experiments.

The Fur-iron complex binds to two distinct regions (regions Iand II) upstream of smcR (Fig. 4), each of which has sequencesimilarity to the consensus Fur binding site and potentially formsthe hairpin structure that is a common feature of the Fur box(23–25). Both of these two regions are required for the full repres-sion of smcR by Fur, and the presence of two distinct bindingregions appears to be necessary for fine-tuning of smcR repressionin response to iron concentrations. Region I had a significantlyhigher affinity for Fur than region II, suggesting that the Fur-ironcomplex binds first to region I and then, as the intracellular con-centration of iron increases, binds to region II. Regardless of bind-ing affinity, region II appears to be more important for the regu-latory activity of Fur (Fig. 5), perhaps because this region includesthe transcriptional initiation site that would be blocked when theFur-iron complex is bound. Even though there are two Fur bind-

ing sites, the expression of smcR was not completely repressedupon the addition of iron but rather was about a half the levelobserved in the absence of iron (Fig. 5). Complete repression ofsmcR expression is achieved only through the action of quorum-sensing regulation responding to low cell density regardless ofiron, suggesting that the Fur-iron complex does not tightly represssmcR. The expression of both smcR and vvpE is low under iron-rich conditions through early stationary phase, but repression isrelieved by late stationary phase (Fig. 1 and 2A and Fig. 2). Toexplain this observation, we considered the possibility that intra-cellular iron is depleted by late stationary phase and that the re-pression of smcR may be relieved as well. However, supplementa-tion with excess iron to a culture in late stationary phase did notlead to complete repression of either smcR or vvpE (data notshown). Another possible hypothesis, in which SmcR repressesthe expression of fur in a culture at high cell density, was rejectedbased on findings of our previous study, which clearly showed that

FIG 6 Transcription of yegD and hlyU is affected by the Fur-iron complex through regulation of smcR. Comparisons of transcriptional levels of yegD (A) or hlyU(B) in wild-type V. vulnificus MO6-24/O(pRK415), HLM101(pRK415), HLM101(pRK-Fur), HS031(pRK415), and HS031(pRK-SmcR) at stationary phaseunder iron-limiting (empty bars) or iron-rich (solid bars) conditions by quantitative RT-PCR using the primers shown in Table 2. Overnight cultures werewashed and subcultured in LB medium supplemented with either 100 �M 2,2=-dipyridyl or 25 M ferrous sulfate and grown to log phase (A600 of 1.0). RNA levelswere quantified using the comparative threshold cycle (��CT) method, and RNA fold change was normalized to the value for MO6-24/O harboring pRK415 inthe absence of iron. The data are average values from three independent samples, and error bars denote the standard deviations.

Kim et al.

2896 iai.asm.org Infection and Immunity

on May 17, 2020 by guest

http://iai.asm.org/

Dow

nloaded from

SmcR does not affect the expression of fur (28). Likewise, we ruledout a role for RpoS, which may have participated because of itsrole in stationary-phase-dependent gene regulation (37), becausethe effect of Fur-iron on expression of smcR was the same in wild-type and rpoS mutant strains (data not shown). Taken together,these data suggest that the derepression of smcR in late stationaryphase is not due to any genetic or physiological effects. It is likelythat the repression of smcR by the Fur-iron complex is intrinsically“leaky.” Such weak repression may be advantageous for cells be-cause it allows the quorum-sensing regulation to be operativeeven under iron-rich conditions. If repression of smcR by the Fur-iron complex were strong, then quorum-sensing regulation wouldnot be possible in the presence of iron. By employing a weak in-hibitor of smcR, cells are able to sense both population density andiron concentrations simultaneously and coordinately control theexpression of virulence factors.

Previous studies using DNA microarrays to screen for genes ineither V. vulnificus or V. cholerae that are expressed differentiallyin various iron concentrations (33, 40) did not identify smcR,hapR of V. cholerae, which is homologous to V. harveyi luxR and isthe equivalent of smcR, or genes in the quorum-sensing regulon.However, in these studies, total gene expression was measured incells during the exponential phase of growth. During this phase,the mRNAs of smcR and hapR are degraded through the action ofthe small RNA Qrrs (6, 34), and therefore any effect of the Fur-iron complex would not be observed. In contrast, our studies were

carried out in cells at various growth stages. At high cell density,the mRNAs of smcR and hapR are not degraded, and the effect ofthe Fur-iron complex on each of these master regulators and ongenes influenced by these master regulators can be observed.

Orchestrated gene regulation via SmcR in response to both celldensity and iron availability would make it possible to vary theexpression of the virulence factors VvpE, RtxA, and VvhA spatiallyas well as temporally (Fig. 7). VvpE was expressed at the highestlevel under iron-limiting conditions at high cell densities, whereasRtxA and VvhA were expressed at the highest level at low celldensities regardless of iron concentrations. This result leads tospeculation about the possible roles these factors play during theinfection process. VvpE, an elastase, may be expressed within abiofilm, where cell density reaches the highest level and iron isdepleted due to the confined space. This enzyme may be employedto destroy human cells in order to acquire iron at the initial stageof infection following dispersal of pathogens from the biofilm.After elastase mediates iron scavenging, RtxA1 and VvhA may beemployed for subsequent attacks on host cells and further propa-gation. Monitoring the expression pattern of these genes in ananimal model, especially within biofilms, may be an effective wayto verify this hypothesis.

In summary, we demonstrated at a molecular level that intra-cellular signaling in response to two important environmentalfactors, population density and iron, converge to fine-tune thelevels of the V. harveyi LuxR-type master regulator SmcR in V.vulnificus. This pattern of regulation makes it possible to orches-trate the expression of virulence factors efficiently and promptlywhen changes in the environment are detected.

ACKNOWLEDGMENT

This work was supported by a National Research Foundation of Korea(NRF) grant funded by the Korea government (MEST) (grant number2012-0005731), Ministry of Education, Science & Technology, Republicof Korea.

REFERENCES1. Miller MB, Skorupski K, Lenz DH, Taylor RK, Bassler BL. 2002. Parallel

quorum sensing systems converge to regulate virulence in Vibrio cholerae.Cell 110:303–314.

2. Gulig PA, Bourdage KL, Starks AM. 2005. Molecular pathogenesis ofVibrio vulnificus. J. Microbiol. 43:118 –131.

3. Jones MK, Oliver JD. 2009. Vibrio vulnificus: disease and pathogenesis.Infect. Immun. 77:1723–1733.

4. Linkous DA, Oliver JD. 1999. Pathogenesis of Vibrio vulnificus. FEMSMicrobiol. Lett. 174:207–214.

5. Strom MS, Paranjpye RN. 2000. Epidemiology and pathogenesis ofVibrio vulnificus. Microbes Infect. 2:177–188.

6. Ng WL, Bassler BL. 2009. Bacterial quorum-sensing network architec-tures. Annu. Rev. Genet. 43:197–222.

7. Kim SY, Lee SE, Kim YR, Kim CM, Ryu PY, Choy HE, Chung SS, RheeJH. 2003. Regulation of Vibrio vulnificus virulence by the LuxS quorum-sensing system. Mol. Microbiol. 48:1647–1664.

8. Valiente E, Bruhn JB, Nielsen KF, Larsen JL, Roig FJ, Gram L, AmaroC. 2009. Vibrio vulnificus produces quorum sensing signals of the AHL-class. FEMS Microbiol. Ecol. 69:16 –26.

9. Chen CY, Wu KM, Chang YC, Chang CH, Tsai HC, Liao TL, Liu YM,Chen HJ, Shen AB, Li JC, Su TL, Shao CP, Lee CT, Hor LI, Tsai SF.2003. Comparative genome analysis of Vibrio vulnificus, a marine patho-gen. Genome Res. 13:2577–2587.

10. Kim YR, Lee SE, Kim CM, Kim SY, Shin EK, Shin DH, Chung SS, ChoyHE, Progulske-Fox A, Hillman JD, Handfield M, Rhee JH. 2003. Char-acterization and pathogenic significance of Vibrio vulnificus antigens pref-erentially expressed in septicemic patients. Infect. Immun. 71:5461–5471.

11. Park JH, Cho YJ, Chun J, Seok YJ, Lee JK, Kim KS, Lee KH, Park SJ,

FIG 7 Model for the orchestrated regulation of virulence genes by SmcR inresponse to iron and population density in V. vulnificus. At low cell densities(LCD), the smcR transcript is degraded through the action of both Hfq andsmall RNA molecules (Qrrs), which themselves are induced by phosphory-lated LuxO (34). Therefore, under these conditions, irrespective of iron, vvpEis not expressed but hlyU and yegD are expressed (13–15). Under iron-richconditions, vvsAB is directly repressed by the Fur-iron complex (28). At highcell densities (HCD) under iron-limiting conditions, Qrrs are not expressedand apo-Fur does not repress smcR; therefore, SmcR is fully expressed. As aconsequence, vvpE is fully induced and yegD, hlyU, and vvsAB are repressed.Under iron-rich conditions, the Fur-iron complex represses smcR but bindsweakly, and thus quorum-sensing regulation is still functional. As a result,vvpE is partially repressed, and yegD and hlyU are both partially enhanced. Theactivator encoded by hlyU then increases the expression of the virulence fac-tors RtxA and VvhA (15). Meanwhile, under these same conditions, the ex-pression of vvsAB is strongly repressed directly by the Fur-iron complex (28).

Iron Represses Quorum-Sensing Regulator SmcR

August 2013 Volume 81 Number 8 iai.asm.org 2897

on May 17, 2020 by guest

http://iai.asm.org/

Dow

nloaded from

Choi SH. 2011. Complete genome sequence of Vibrio vulnificus MO6-24/O. J. Bacteriol. 193:2062–2063.

12. Lee JH, Rhee JE, Park U, Ju HM, Lee BC, Kim TS, Jeong HS, Choi SH.2007. Identification and functional analysis of Vibrio vulnificus SmcR, anovel global regulator. J. Microbiol. Biotechnol. 17:325–334.

13. Jeong HS, Lee MH, Lee KH, Park SJ, Choi SH. 2003. SmcR and cyclicAMP receptor protein coactivate Vibrio vulnificus vvpE encoding elastasethrough the RpoS-dependent promoter in a synergistic manner. J. Biol.Chem. 278:45072– 45081.

14. Lee DH, Jeong HS, Jeong HG, Kim KM, Kim H, Choi SH. 2008. Aconsensus sequence for binding of SmcR, a Vibrio vulnificus LuxR homo-logue, and genome-wide identification of the SmcR regulon. J. Biol.Chem. 283:23610 –23618.

15. Shao CP, Lo HR, Lin JH, Hor LI. 2011. Regulation of cytotoxicity byquorum-sensing signaling in Vibrio vulnificus is mediated by SmcR, a re-pressor of hlyU. J. Bacteriol. 193:2557–2565.

16. Kwak JS, Jeong HG, Satchell KJ. 2011. Vibrio vulnificus rtxA1 generecombination generates toxin variants with altered potency during intes-tinal infection. Proc. Natl. Acad. Sci. U. S. A. 108:1645–1650.

17. Andrews SC, Robinson AK, Rodriguez-Quinones F. 2003. Bacterial ironhomeostasis. FEMS Microbiol. Rev. 27:215–237.

18. Masse E, Arguin M. 2005. Ironing out the problem: new mechanisms ofiron homeostasis. Trends Biochem. Sci. 30:462– 468.

19. Calderwood SB, Mekalanos JJ. 1987. Iron regulation of Shiga-like toxinexpression in Escherichia coli is mediated by the fur locus. J. Bacteriol.169:4759 – 4764.

20. Stoebner JA, Payne SM. 1988. Iron-regulated hemolysin production andutilization of heme and hemoglobin by Vibrio cholerae. Infect. Immun.56:2891–2895.

21. Tao X, Schiering N, Zeng HY, Ringe D, Murphy JR. 1994. Iron, DtxR,and the regulation of diphtheria toxin expression. Mol. Microbiol. 14:191–197.

22. Payne SM. 2003. Regulation of bacterial toxin synthesis by iron, p 25–38.In Burns LD, Barbieri JT, Iglewski BH, Rappuoli, R (ed), Bacterial proteintoxins. ASM Press, Washington, DC.

23. de Lorenzo V, Giovannini F, Herrero M, Neilands JB. 1988. Metal ionregulation of gene expression. Fur repressor-operator interaction at thepromoter region of the aerobactin system of pColV-K30. J. Mol. Biol.203:875– 884.

24. de Lorenzo V, Wee S, Herrero M, Neilands JB. 1987. Operator se-quences of the aerobactin operon of plasmid ColV-K30 binding the ferricuptake regulation (fur) repressor. J. Bacteriol. 169:2624 –2630.

25. Escolar L, Perez-Martin J, de Lorenzo V. 1999. Opening the iron box:transcriptional metalloregulation by the Fur protein. J. Bacteriol. 181:6223– 6229.

26. Frank DW, Storey DG, Hindahl MS, Iglewski BH. 1989. Differentialregulation by iron of regA and toxA transcript accumulation in Pseudomo-nas aeruginosa. J. Bacteriol. 171:5304 –5313.

27. Miyamoto K, Kosakai K, Ikebayashi S, Tsuchiya T, Yamamoto S,Tsujibo H. 2009. Proteomic analysis of Vibrio vulnificus M2799 grownunder iron-repleted and iron-depleted conditions. Microb. Pathog. 46:171–177.

28. Wen Y, Kim IH, Son JS, Lee BH, Kim KS. 2012. Iron and quorumsensing coordinately regulate the expression of vulnibactin biosynthesis inVibrio vulnificus. J. Biol. Chem. 287:26727–26739.

29. Sousa F, Jus S, Erbel A, Kokol V, Cavaco-Paulo A, Gubitz GM. 2007. Anovel metalloprotease from Bacillus cereus for protein fibre processing.Enzyme Microb. Technol. 40:1772–1781.

30. Jeong HS, Jeong KC, Choi HK, Park KJ, Lee KH, Rhee JH, Choi SH.2001. Differential expression of Vibrio vulnificus elastase gene in a growthphase-dependent manner by two different types of promoters. J. Biol.Chem. 276:13875–13880.

31. Milton DL, O’Toole R, Horstedt P, Wolf-Watz H. 1996. Flagellin A isessential for the virulence of Vibrio anguillarum. J. Bacteriol. 178:1310 –1319.

32. Lowry OH, Rosebrough NJ, Farr AL, Randall RJ. 1951. Protein mea-surement with the Folin phenol reagent. J. Biol. Chem. 193:265–275.

33. Alice AF, Naka H, Crosa JH. 2008. Global gene expression as a functionof the iron status of the bacterial cell: influence of differentially expressedgenes in the virulence of the human pathogen Vibrio vulnificus. Infect.Immun. 76:4019 – 4037.

34. Svenningsen SL, Tu KC, Bassler BL. 2009. Gene dosage compensationcalibrates four regulatory RNAs to control Vibrio cholerae quorum sens-ing. EMBO J. 28:429 – 439.

35. Adrait A, Jacquamet L, Le Pape L, Gonzalez de Peredo A, Aberdam D,Hazemann JL, Latour JM, Michaud-Soret I. 1999. Spectroscopic andsaturation magnetization properties of the manganese- and cobalt-substituted Fur (ferric uptake regulation) protein from Escherichia coli.Biochemistry 38:6248 – 6260.

36. Lee HJ, Bang SH, Lee KH, Park SJ. 2007. Positive regulation of fur geneexpression via direct interaction of fur in a pathogenic bacterium, Vibriovulnificus. J. Bacteriol. 189:2629 –2636.

37. Lee HJ, Park KJ, Lee AY, Park SG, Park BC, Lee KH, Park SJ. 2003.Regulation of fur expression by RpoS and fur in Vibrio vulnificus. J. Bacte-riol. 185:5891–5896.

38. Cha JY, Lee JS, Oh JI, Choi JW, Baik HS. 2008. Functional analysis of therole of Fur in the virulence of Pseudomonas syringae pv. tabaci 11528: Furcontrols expression of genes involved in quorum-sensing. Biochem. Bio-phys. Res. Commun. 366:281–287.

39. Oglesby AG, Farrow JM, III, Lee JH, Tomaras AP, Greenberg EP, PesciEC, Vasil ML. 2008. The influence of iron on Pseudomonas aeruginosaphysiology: a regulatory link between iron and quorum sensing. J. Biol.Chem. 283:15558 –15567.

40. Mey AR, Wyckoff EE, Kanukurthy V, Fisher CR, Payne SM. 2005. Ironand fur regulation in Vibrio cholerae and the role of fur in virulence. Infect.Immun. 73:8167– 8178.

41. Reddy GP, Hayat U, Abeygunawardana C, Fox C, Wright AC, ManevalDR, Jr, Bush CA, Morris JG, Jr. 1992. Purification and determination ofthe structure of capsular polysaccharide of Vibrio vulnificus M06-24. J.Bacteriol. 174:2620 –2630.

42. Keen NT, Tamaki S, Kobayashi D, Trollinger D. 1988. Improved broad-host-range plasmids for DNA cloning in gram-negative bacteria. Gene70:191–197.

Kim et al.

2898 iai.asm.org Infection and Immunity

on May 17, 2020 by guest

http://iai.asm.org/

Dow

nloaded from