The Eyethe-eye.eu/public/Books/BioMed/Hemoglobin Disorders... · 89. The Blood and Brain Barrier:...

Humana PressHumana Press

HemoglobinDisordersMolecular Methodsand Protocols

Edited by

Ronald L. Nagel, MD

M E T H O D S I N M O L E C U L A R M E D I C I N ETM

HemoglobinDisordersMolecular Methodsand Protocols

Edited by

Ronald L. Nagel, MD

Hemoglobin Disorders

89. The Blood and Brain Barrier: Biol-ogy and Research Protocols, edited bySukriti Nag, 2003

88. Cancer Cell Culture: Methods andProtocols, edited by Simon P.Langdon, 2003

87. Vaccine Protocols, Second Edition,edited by Andrew Robinson, Martin P.Cranage, and Michael Hudson, 2003

86. Renal Disease: Techniques and Proto-cols, edited by Michael S. Goligorsky,2003

85. Novel Anticancer Drug Protocols,edited by John K. Buolamwini andAlex A. Adjei, 2003

84. Opioid Research: Methods and Proto-cols, edited by Sabire Özcan, 2003

83. Diabetes Mellitus: Methods and Proto-cols, edited by Zhizhong Z. Pan, 2003

82. Hemoglobin Disorders: MolecularMethods and Protocols,, edited byRonald L. Nagel, 2003

81. Prostate Cancer Methods andProtocols, edited by Pamela J.Russell, Paul Jackson, and ElizabethA. Kingsley, 2003

80. Bone Research Protocols, edited byStuart H. Ralston and Miep H. Helfrich,2003

79. Drugs of Abuse: NeurologicalReviews and Protocols, edited byJohn Q. Wang, 2003

78. Wound Healing: Methods and Proto-cols, edited by Luisa A. DiPietro andAime L. Burns, 2003

77. Psychiatric Genetics: Methods andReviews, edited by Marion Leboyerand Frank Bellivier, 2003

76. Viral Vectors for Gene Therapy:Methods and Protocols, edited byCurtis A. Machida, 2003

75. Lung Cancer: Volume 2, Diagnosticand Therapeutic Methods and Reviews,edited by Barbara Driscoll, 2003

74. Lung Cancer: Volume 1, MolecularPathology Methods and Reviews,edited by Barbara Driscoll, 2003

73. E. coli: Shiga Toxin Methods and Pro-tocols, edited by Dana Philpottand Frank Ebel, 2003

72. Malaria Methods and Protocols,edited by Denise L. Doolan, 2002

71. Hemophilus influenzae Protocols,edited by Mark A. Herbert, Derek W.Hood, and E. Richard Moxon, 2002

70. Cystic Fibrosis Methods andProtocols, edited by William R.Skach, 2002

69. Gene Therapy Protocols, SecondEdition, edited by Jeffrey R. Morgan,2002

68. Molecular Analysis of Cancer, editedby Jacqueline Boultwood and CarrieFidler, 2002

67. Meningococcal Disease: Methods andProtocols, edited by Andrew J. Pollardand Martin C. J. Maiden, 2001

66. Meningococcal Vaccines: Methodsand Protocols, edited by Andrew J.Pollard and Martin C. J. Maiden, 2001

65. Nonviral Vectors for Gene Therapy:Methods and Protocols, edited by MarkA. Findeis, 2001

64. Dendritic Cell Protocols, edited byStephen P. Robinson and Andrew J.Stagg, 2001

63. Hematopoietic Stem Cell Protocols,edited by Christopher A. Klug andCraig T. Jordan, 2001

62. Parkinson’s Disease: Methods andProtocols, edited by M. MaralMouradian, 2001

61. Melanoma: Methods and Protocols,edited by Brian J. Nickoloff, 2001

60. Interleukin Protocols, edited by LukeA. J. O’Neill and Andrew Bowie, 2001

59. Molecular Pathology of the Prions,edited by Harry F. Baker, 2001

M E T H O D S I N M O L E C U L A R M E D I C I N E TM

John M. Walker, SERIES EDITOR

Humana Press

Hemoglobin DisordersMolecular Methods and Protocols

Edited by

Ronald L. Nagel, MDAlbert Einstein College of Medicine, Bronx, NY

Totowa, New Jersey


© 2003 Humana Press Inc.999 Riverview Drive, Suite 208Totowa, New Jersey 07512

www.humanapress.com

All rights reserved. No part of this book may be reproduced, stored in a retrieval system, or transmitted in any formor by any means, electronic, mechanical, photocopying, microfilming, recording, or otherwise without writtenpermission from the Publisher. Methods in Molecular Medicine™ is a trademark of The Humana Press Inc.

For additional copies, pricing for bulk purchases, and/or information about other Humana titles, contact Humana atthe above address or at any of the following numbers: Tel.: 973-256-1699; Fax: 973-256-8341; E-mail:[email protected]; Website: http://humanapress.com

The content and opinions expressed in this book are the sole work of the authors and editors, who have warranted due diligence in thecreation and issuance of their work. The publisher, editors, and authors are not responsible for errors or omissions or for anyconequences arising fom the information or opinions presented in this book and make no warranty, express or implied, with respectto its contents.

Cover illustration: Fig. 4A from Chapter 10, “Nucleation and Crystal Growth of Hemoglobins: The Case of HbC,”by Peter G. Vekilov, Angela Feeling-Taylor, and Rhoda Elison Hirsch.

Production Editor: Tracy CataneseCover design by Patricia F. Cleary.

Due diligence has been taken by the publishers, editors, and authors of this book to assure the accuracy of the information publishedand to describe generally accepted practices. The contributors herein have carefully checked to ensure that the drug selections anddosages set forth in this text are accurate and in accord with the standards accepted at the time of publication. Notwithstanding, as newresearch, changes in government regulations, and knowledge from clinical experience relating to drug therapy and drug reactionsconstantly occurs, the reader is advised to check the product information provided by the manufacturer of each drug for any changein dosages or for additional warnings and contraindications. This is of utmost importance when the recommended drug herein is anew or infrequently used drug. It is the responsibility of the treating physician to determine dosages and treatment strategies forindividual patients. Further it is the responsibility of the health care provider to ascertain the Food and Drug Administration status ofeach drug or device used in their clinical practice. The publisher, editors, and authors are not responsible for errors or omissions orfor any consequences from the application of the information presented in this book and make no warranty, express or implied, withrespect to the contents in this publication.

This publication is printed on acid-free paper. ∞ANSI Z39.48-1984 (American Standards Institute) Permanence of Paper for Printed Library Materials.

Photocopy Authorization Policy:Authorization to photocopy items for internal or personal use, or the internal or personal use of specific clients, isgranted by Humana Press Inc., provided that the base fee of US $20.00 is paid directly to the Copyright ClearanceCenter at 222 Rosewood Drive, Danvers, MA 01923. For those organizations that have been granted a photocopylicense from the CCC, a separate system of payment has been arranged and is acceptable to Humana Press Inc. Thefee code for users of the Transactional Reporting Service is [0-89603-962-5/03 $20.00].

Printed in the United States of America. 10 9 8 7 6 5 4 3 2 1

Library of Congress Cataloging in Publication Data

Main entry under title: Methods in molecular medicine™.

Hemoglobin disorders : methods and protocols / edited by Ronald L. Nagel. p. ; cm. -- (Methods in molecular medicine ; 82) Includes bibliographical references and index. ISBN 0-89603-962-5 (alk. paper); 1-59259-373-9 (e-book) 1. Hemoglobinopathy--Laboratory manuals. I. Nagel, R. L. (Ronald L.) II. Series. [DNLM: 1. Hemoglobinopathies--Laboratory Manuals. 2. Laboratory Techniques and Procedures--Laboratory Manuals. WH 25 H489 2003] RC641.7.H35H444 2003 616.1'51--dc21

2003040674

v

Preface

Hemoglobin and Hemoglobinologists

This volume, Hemoglobin Disorders: Molecular Methods and Protocols,will be introduced with a review of the great milestones in the field, and thescientists responsible for those achievements. The history of hemoglobin canbe divided into three periods: the Classical period, the Modern period, and thePost-Modern period.

I am inclined to include as the four major members of the classical periodFrancis Roughton, Quentin Gibson, Jeffries Wyman, and Linus Pauling, notonly because of their achievements, but also because of the superb scientiststhey trained and/or influenced.

Francis John Worsely Roughton (1899–1972) (Fig. 1), in his laboratory atTrinity College in Cambridge, England, made the first measurements of therapid reaction of oxygen with hemoglobin at the millisecond scale, at first byflow-mixing methods and later by flash photolysis. He not only opened an eraof molecular research of hemoglobin, but also invented the methodology forfast reactions through the use of laser technology, which was later improved byothers so that even faster reactions could be detected. Another contribution ofRoughton was the education of Quentin H. Gibson (Fig. 2), his favorite stu-dent, who, in his laboratory in Sheffield, continued to expand the horizon ofligand binding to hemoglobin, defining the oxygen binding constants for eachof the hemes of hemoglobin. Though this did not, as expected, solve the under-lying mechanism of ligand cooperativity as discussed below, it was nonethe-less an important milestone.

Roughton would later have a surprising influence in the Italian hemoglobingroup because he trained Luigi Rossi-Bernardi, and because Quentin Gibsonintroduced Jeffries Wyman to Eraldo Antonini, the hemoglobin man in Romein that period (1). In a meeting in Bellagio, Lake Como, Luigi regaled us withstories about this highly talented and very eccentric investigator. It was fortu-nate to science that eccentricity was perfectly acceptable in England, unlike inother places in the world.

Finally, Quentin continued his highly productive career after emigrating tothe United States in the early 1960s, working independently first in BrittonChance’s lab in Philadelphia and then at Cornell, where he trained John Olson,who brilliantly carried on the torch and is an author in this book. I considerQuentin my mentor, along with Helen Ranney. It was most exciting to solve themolecular basis of the hemoglobin/haptoglobin reaction together.

vi Preface

Quentin Gibson, who is an MD, wasfamous for having a lathe in the middle of thelab, useful for tinkering with homemadeinstrumentation. This wonderful “tinkering”habit of British scientists came in handy dur-ing World War II, to the benefit of the world.Gibson is still scientifically active, and hascontributed widely to the hemoglobin ligandbinding field (see Chapter 5). He also wrotehis recollections of the life and work ofFrancis J. Roughton in 1973, after Roughton’sdeath at the age of 73 years (2).

Jeffries Wyman (1901–1995) (Fig. 3) wasa Boston Brahmin and a remarkable Ameri-can biophysicist whose grandfather was one of the founders of the NationalAcademy of Science. A Harvard man, he developed an interest in proteins andin 1937 wrote his first hemoglobin paper on the pH titration curves, or oxy-deoxy-hemoglobin (3). He exhibited a unique understanding of thermodynamicsin his analysis of linked function reciprocal relations (1948). He later cameback to this subject with a landmark book, Binding and Linkage: Functional

Fig. 1. Francis John Worsely Roughton

Fig. 2. Quentin H. Gibson

Fig. 3. Jeffries Wyman

Preface vii

Chemistry of Biological Macromolecules, coau-thored with Stanley J. Gill, who derived greatcomfort from this enterprise in the last years ofhis life.

According to Edsall (4), Wyman, while visit-ing colleagues in Japan in 1950, had an insightbased on the work of Felix Haurowitz, a NewYork scientist who used to walk about with a vialof growing hemoglobin crystals in his vestpocket, so as to maintain the solution close to37°C. Haurowitz did a remarkable and simpleexperiment: he reduced a crystal of oxyhemo-globin with dithionite and observed its breakageand dissolution. He concluded that these twoligand states of hemoglobin had different crystalhabits. Wyman, in turn, concluded that the result was the consequence of hemo-globin in two different conformational states: in oxy (met in reality) and deoxy,a remarkable anticipation of Perutz’s work.

Wyman’s wanderlust took him to the four corners of the world. After thedeath of his first wife, he left Harvard and the United States for Paris, where hewas the first Cultural Attache to the American Embassy. After that, it was anInternational Organization job in Egypt, and then escapes to the Congo, Alaska,Papua, New Guinea, and so forth. But his most important visit by far was toRome, where he became part of the hemoglobin team lead by Eraldo Antonini(1). Italy became his home for most of his life, in spite of the fact that he neverobtained a permanent status, and needed to go to Switzerland every year torenew his visa. He never learned to speak Italian.

The Rome group, integrated by Maurizio Brunori, Emilia Chiancone, andothers, became a strong presence in the field, concentrating on the biophysicaland biochemical aspects of hemoglobin. Another participant in this interactivehemoglobin world was Quentin Gibson, who collaborated with Eraldo early onand had to carry instrumentation and glass artifacts through the corridors andyards of the University of Rome, because it was unseemly for an Italian profes-sor to do so. Maurizio, of course, became the leader of this highly productivegroup after the untimely death of Eraldo at the age of 52, keeping the highstandards set by its founder. During my first visit to Rome, Maurizio intro-duced me to Wyman, and like everybody else, I was in awe of the magneticfield of his mind and his ability to contribute brilliantly to any problem thatmight be presented to him.

Finally, the emergence of the Jacob-Monod-Changeux allosteric model fitWyman’s insight into the workings of hemoglobin and rapidly adopted its

nomenclature. On the other the hand, Eraldo Antonini resisted this concept,postulating an alternative dimer-based model. The demonstration that hapto-globin binds exclusively hemoglobin dimers—and does not bind deoxy-hemoglobin (5,6) because it does not dimerize—made this proposal untenable.

The final member of the Classical period was Linus Pauling (1901–1994) (Fig.4), a double Nobel Prize winner, and another eccentric and brilliant scientist. Heshould be considered a luminary in the field of hemoglobin for two reasons. First,he proposed (and demonstrated) that a hemoglobin abnormality had to be thereason for the sickling of red cells in sickle cell anemia. This disease had beendiscovered by Dr. James B. Herrick, a cardiologist, in Chicago in 1910 (7). Theconcept of sickle cell anemia as a “molecular disease” opened a new chapter inmedicine (8). Second, Pauling discovered the differential magnetic susceptibilityof oxy- and deoxy-hemoglobin, which is the basis of advanced methods of nuclearmagnetic resonance imaging, allowing detection of deoxy-hemoglobin in tissues(9) and recently applied to the study of sickle transgenic mice (10).

Fig. 4. Linus Pauling

viii Preface

The Modern period was inaugurated withthe discovery by Max Ferdinand Perutz(1914–2002) (11) (Fig. 5) that the isomorphicreplacement method was applicable to largemolecules, and that binding of mercury to theCys93 did not distort the molecule. Thissolved the phase problem and aided in thedescription of the tridimensional structure ofthe hemoglobin molecule. This effort wasstimulated by conversations with FelixHaurowitz and realized with the help of asmall grant from the Rockefeller Foundation,obtained through the good offices of SirLawrence Bragg, inventor of crystallography.

As a young investigator, I met Max Perutzin Cambridge shortly after he had publishedhis milestone work, and true to his modestyand bonhomie, he told me that he was happyto have finally published because doing so guaranteed him lab space at theCavendish, which he was previously at risk of losing for lack of publications.This publication’s followup, on deoxyhemoglobin, allowed us to understandthe molecular basis of cooperativity and was recognized with the Nobel Prize,which Perutz shared with Kendrew, who had worked on the less complex prob-lem of the crystallography of myoglobin. After the Nobel Prize, he worked evenharder. I saw him in Cambridge in the last few months before his death, and wediscussed the need to understand why HbC has a highly increased tendency tocrystallize. It was a fruitful exchange. We also talked about his leaving Viennain 1936 to work with J. D. Bernal in crystallography. At the beginning of thewar, Britain interned all immigrants born in enemy countries in mild detentioncamps, even if they were of Jewish origin. Fortunately, the authorities put himto work on plans to construct gigantic ice surfaces that could serve as airplanelanding sites in the North Sea. For this plan they needed a crystallographer’sknowledge to help them strengthen the crystallized water, at which Max even-tually succeeded through the use of wood pulp, although too late to be useful.

Vernon M. Ingram clearly deserves a place in the Modern period. Also inCambridge, using a sickle cell anemia patient's blood samples left behind by acolleague, he purified the hemoglobin, and ran a trypsin digestion and a combi-nation of electrophoresis and paper chromatography (to be known as “finger-printing”) on the sample, revealing that the mutation in sickle hemoglobin waslimited to a single amino acid change: glutamic acid replaced by valine. Thisproved a momentous finding and the launching of a technique that was used

Fig. 5. Max Ferdinand Perutz

Preface ix

widely for decades in the analysis of proteins. Vernon wrote a recollection ofthis discovery later (12).

Another feature of the Modern period is the highly compatible, yet unlikelypairing of Reinhold and Ruth Benesh, called by many R2B2. Reinhold was aPolish immigrant who went to England to study chemistry, and survived byperforming stand-up comedy in English vaudeville theaters. He eventuallyemigrated to the United States, met Ruth, and formed a powerful scientificteam. Preparing for a lecture to students of medicine, he realized that 2,3-DPGexisted in the red cell in almost identical quantities as hemoglobin. The nextday they mixed 2,3-DPG and hemoglobin and observed a right shift of theoxygen equilibrium curve. A new allosteric effector had been found. This find-ing had tremendous scientific and medical impact. To date, a PubMed searchfor 2,3-DPG yields 1793 results. Reinhold also contributed to, among otherthings, the definition of the contact sites in α-chains that contribute to the sta-bilization of the sickle polymer.

The Post-Modern period, being contemporary, cannot be judged in the sameway as the two previous periods. But important accomplishments need to berecognized in the field of hemoglobins. First, George Stamatoyannopoulosmerits special mention. Not only has he and his laboratory contributed enor-mously to the field and trained a slew of young scientists, but he has becomethe “cheerleader” of research in hemoglobin molecular biology. His “Switch-ing Meetings,” at first in collaboration with Art Nienhuis and George Dover,have become, with time, a classic “George’s show.” Everybody waits forGeorge’s phone call: “What have you done lately?” Stamatoyannopoulos hasalso been a constant and successful lobbyist to NIH for more money for globinresearch and for greater opportunities for young investigators to join the field.

The explosion of molecular biology is one of the most important eventscharacterizing this period. Too many important participants are worth men-tioning, so I will limit the list to a few that contributed to the field up to 1990(recent work is outlined in “late-breaking news”):

A. W. Nienhuis S. H. OrkinF. G. Grosveld Y. W. KanT. J. Ley S. L. TheinL. I. Zon J. M. Old (see Chapters 7 and 8)T. M. Towns (see Chapter 13) T. M. Ryan (see Chapter 13)J. B. Ligrel A. N. SchechterG. Felsenfeld E. J. BenzD. R. Higgs J. B. CleggS. A. Liebhaber S. M. WeissmanT. Papayannoupolous B. G. Forget

x Preface

H. H. Kazazian N. J. ProudfootR. Krishnamoorthy (see Chapter 12) D. Labie (see Chapter 12)A. Bank J. D. EngelN. P. Anagnou C. DriscollJ. L. Sleighton W. G. WoodK. Adachi (see Chapter 14) R. C. HardisonS. A. Acharya (see Chapter 11)and many others.

Sir David Weatherall also deserves special mention. He is responsible formajor developments in the understanding of thalasssemia in the last 40 years,including some all-encompassing and very readable textbooks on the subject(13). David Nathan is also a major figure in this field in America, contributingto both the scientific and clinical sides (14). Clinical advances can be creditedto Sergio Piomelli in the general management of this difficult disease (14) andto G. Lucarelli (16) for his contribution on bone marrow transplantation ofthalassemic patients in Italy and the world.

A major and groundbreaking contribution to sickle cell anemia was the dis-covery by William Eaton and his group that the polymerization of HbS was anucleation-driven reaction in its two forms: homogeneous and heterogeneous(17). In addition, they discovered that the delay time of polymerization wasdependent exclusively on the initial concentration of Hb with the potential ofmodifying the extent of the phenotype (18).

The next important discovery in the field, credited to Robert Hebbel andassociates (19), was the capacity of young sickle cells to adhere to culturedendothelial cells. This finding was confirmed by Dhananjay K. Kaul in ex vivoand in vivo microcirculatory beds, and was followed by the demonstration thatsickle vasocclusion occurred, not predominately in the capillaries as previouslythought, but in the small venules, in which the adhesion of young sickle cellspreceded obstruction by rigid sickle cells (20).

The structure of the sickle polymer was resolved by a combination of thefollowing discoveries: (1) the crystallography of sickle hemoglobin (21), (2)the study of the polymerization tendency of binary mixtures of sickle and otherhemoglobin mixtures to define residues in the area of contact of the polymer(22), and (3) electron microscopy of the polymer and modeling (23,24).

Another surprise was the linkage of the sickle mutation with severalhaplotypes of polymorphic sites in the globin gene cluster. This effort arosebased on early work by Y. W. Kan and Stuart Orkin, which was followed bygenetic epidemiological studies in Jamaica (25), Africa (26), and India (27,28).Besides demonstrating the multicentric origin of the sickle mutation, thiseffort revealed the linkage between severity and certain haplotypes and the

Preface xi

role of -158 Xmn I polymorphism in the expression of HbF (29,30), in additionto their power as instruments in anthropological and gene flow studies.

Alpha thalassemia was, after the ameliorating effect of HbF, the first modi-fier of sickle cell anemia found and most of the credit for this finding belongsto Steve Embury (31).

The discovery of Locus Control Region (LCR), 5' to the β-like gene cluster,by Dorothy Tuan and Irving London (32) had unexpected consequences.In addition to the involvement of LCR in the development of appropriateexpression of the β-like globins, it made possible the high and tissue-specificexpression of transgenes in mouse models as well as in vectors containing anti-hemoglobinopathies for gene therapy. Although much progress has been madeowing to the efforts of George Stamatoyannopoulos, Marc Groudine, and F. G.Grosveld, a definitive picture has not yet emerged.

The development of transgenic sickle and thalassemic mice, very useful inthe field despite unfriendly NIH committee reviews for many years, is a com-plicated history with many players, so I refer the interested reader to a recentreview (33) and Chapter 13.

The successful clinical trial, beyond any rational expectation, of hydroxyureaas a specific treatment for sickle cell anemia (34) is a great landmark in thehistory of sickle cell in America because it is the only drug approved by theFDA for the treatment of this disease. Investigations leading to this break-through involved Paul Heller, Joe DeSimone, George Stamatoyannopoulos,George Dover, and others. The leader of the clinical trial was Sam Charache,after years of frustrating rejections by unsympathetic and misguided reviewers,with the competent help of Martin Steinberg (35).

The pioneering work of Chien Ho (see Chapter 15) on NMR of hemoglobinand hemoglobin variants was highly successful and contributed to, among otherthings, the molecular localization of the Bohr protons.

Other less glamorous but equally important clinical advances can be cred-ited to Helen Ranney, who contributed all of her scientific life to hemoglobinresearch, with her pioneering work on HbA1c as a noted example. She alsocontributed by organizing what I believe to be the first hemoglobinopathies-dedicated clinic in America, at Jacobi Hospital, Bronx, NY.

The NIH Natural History initiative, under the leadership of Marilyn Gaston(36), saved many lives by demonstrating the effectiveness of penicillin pro-phylaxis in decreasing infections and modality in infants with sickle cell dis-ease. The Herculean effort of Graham Serjeant, who headed an MRC unit inJamaica dedicated to the care and study of sickle cell anemia patients, must berecognized. He produced considerable and reliable natural history clinical dataon sickle cell anemia with much less funding than the NIH effort (37).

xii Preface

The discovery of desferrioxamine and the use of chelation therapy to increasethe life expectancy of patients with thalassemia major and thalassemiaintermedia is also a major accomplishment. The compound is a natural productextracted for actinomycetes, and was reported to be an iron chelator useful inthe treatment of hemochromatosis by P. Imhof of Ciba Geigy at the joint annualmeeting of the 1962 Swiss Medical in Lugano. An annotation in Lancet (38)concludes that “it is unfortunate that in secondary hemochromatosis, usuallythe result of repeated transfusions in patients with aplastic anemia and otheranemias when repeated blood letting is not possible, the drug is apparently lessefficacious than in the idiopathic type.” Fortunately, this prediction did not cometo pass, and the drug is now the mainstay of the treatment of severe thalassemia.The quest for a clearly effective oral form seems to be close at hand.

Another aspect of research in hemoglobinopathies is the effort to character-ize hemoglobin mutants, useful in many of the studies referred to above. In thisrealm, three investigators have been particularly successful. The first is HermanLehmann (39,40), who emigrated to Britain early in life, worked in Cambridge,and spent World War II in the British Army in India, in which his training as ahematologist was welcome. He discovered HbS among the “tribals” of India,and contributed profusely to the works on hemoglobin , particularly in the iden-tification and characterization of Hb mutants. He also predicted the duplicationof the α-globin loci. The second great figure in this realm was Titus Huisman(41), who published 661 papers in his life, almost all on hemoglobin. He was arefined analytical biochemist and a highly focused and productive researcher.Finally, the successor in this field today is Henri Wajcman, editor of Hemoglo-bin, who runs a highly efficient reference laboratory in Paris for abnormalhemoglobins that has been enormously useful to all of us. Dr. Wajcman is anexpert on unstable hemoglobins.

Finally, in “late-breaking news,” the very recent correction of sickle cellanemia (42) and thalassemia (43) by transplantation of stem cells transductedwith a lentivirus construct containing human globin genes in mice transgenicmodels is an encouraging event, and bodes well for the future of gene therapyin hemoglobinopathies.

The remarkably successful adventures that have characterized research andclinical endeavors in hemoglobinopathies have been the product of the effortsof an army of highly qualified and imaginative investigators and clinicians,interested in diseases that affect not only Europe and North America, but mostof the third world.

In conclusion, the last century has been good to hemoglobin. Maybebecause hemoglobin is red, which helped in its isolation, maybe because it isabundant, or maybe because, as the third book of the Torah (and the Old Testa-

Preface xiii

ment) says, “the soul of the flesh is the blood,” hemoglobin has been an activeparticipant in the development of biochemistry, protein chemistry, molecularbiology, human genetics, and molecular medicine. It is also apparent thatbehind it all there was a real network of investigators, sometimes interactingcompetitively, some times cooperatively, but always in contact. The networkhas indeed produced a cascade of findings and valuable and unforgettablehuman interactions. Maybe the lure of this unique and beautiful moleculeattracted brilliant, eccentric, imaginative, and one-of-a-kind investigators whoblazed a brilliant trail of successes.

Ronald L. Nagel, MD

References1. Brunori, M. (1999) Hemoglobin is an honorary enzyme. Trends Biochem. Sci.

24, 158–161.2. Gibson, Q. H. (1973) Francis John Worsely Roughton, 1899–1972. Biogr. Mem.

Fellows R Soc. 19, 563–582.3. Wyman, J. and Allen, D. (1958) The problem of the heme interactions in hemo-

globin and the nature of the Bohr effect. J. Polymer Sci. 7, 499–518.4. Edsall, J. T. (1995) Jeffries Wyman, (1901–95) Nature 378, 556.5. Nagel, R. L. and Gibson, Q. H. (1966) Kinetics of the reaction of carbon monox-

ide with the hemoglobin-haptoglobin complex. J. Mol. Biol. 22, 249–255.6. Nagel, R. L., Rothman, M. C., Bradley, T. B., Jr., and Ranney, H. M. (1965)

Comparative haptoglobin binding properties of oxyhemoglobin and deoxy-hemoglobin. J. Biol. Chem. 240, 4543–2545.

7. Herrick, J. B. (1910) Peculiar elongated and sickle-shaped red blood corpusclesin a case of severe anemia. Arch. Intern. Med. 6, 517–521.

8. Pauling, L. (1977) Magnetic properties and structure of oxyhemoglobin. Proc.Natl. Acad. Sci. USA 74, 2612–2613.

9. Ogawa, S., Lee, T. M., Nayak, A. S., and Glynn, P. (1990) Oxygenation-sensi-tive contrast in magnetic resonance image of rodent brain at high magnetic fields.Magn. Reson. Med. 124, 68–78.

10. Fabry, M. E., Kennan, R. P., Paszty, C., et al. (1996) Magnetic resonance evi-dence of hypoxia in a homozygous α-knockout of a transgenic mouse model forsickle cell disease. J. Clin. Invest. 98, 2450–2455.

11. King, A. (2002) Restrospective: structural biology and biochemistry. Max Perutz(1914–2002). Science 295, 2382–2383.

12. Ingram, V. M. (1989) Abnormal human haemoglobins. I. The comparison ofnormal human and sickle-cell haemoglobins by “fingerprinting.” 1958. Biochim.Biophys. Acta. 1000, 151–157.

xiv Preface

13. Weatherall, D. and Clegg, J., eds. (2001) The Thalassemia Syndromes, FourthEdition. Blackwell Science, Boston, MA.

14. Nathan, D. G. (1998) Genes, Blood and Courage: A Boy Named Immortal Sword.Harvard University Press, Cambridge, MA.

15. Piomelli, S. (1989) Cooley’s Anemia Management: 25 years of progress. Prog.Clin. Biol. Res. 309, 23–26.

16. Lucarelli, G., Andreani, M., and Angelucci, E. (2002) The cure of thalassemia bybone marrow transplantation. Blood Rev. 16, 81–85.

17. Eaton, W. A. and Hofrichter, J. (1990) Sickle cell hemoglobin polymerization.Adv. Protein Chem. 40, 63–279.

18. Eaton, W. A., Hofrichter, J., and Ross, P. D. (1976) Editorial: Delay time of gela-tion: a possible determinant of clinical severity in sickle cell disease. Blood 47,621–627.

19. Hebbel, R. P., Yamada, O., Moldow, C. F., et al. (1980) Abnormal adherence ofsickle erythrocytes to cultured vascular endothelium: possible mechanism formicrovascular occlusion in sickle cell disease. J. Clin. Invest. 65, 154–160.

20. Kaul, D. K., Fabry, M. E., and Nagel, R. L. (1989) Microvascular sites andcharacteristics of sickle cell adhesion to vascular endothelium in shear flowconditions: pathophysiological implications. Proc. Natl. Acad. Sci. USA 86,3356–3360.

21. Wishner, B. C., Ward, K. B., Lattman, E. E., and Love, W. E. (1975) Crystal struc-ture of sickle-cell deoxyhemoglobin at 5 Å resolution. J. Mol. Biol. 98, 179–194.

22. Nagel, R. L., Johnson, J., Bookchin, R. M., et al. (1980) Beta-chain contact sitesin the haemoglobin S polymer. Nature 283, 832–834.

23. Edelstein, S. J. (1981) Structure of the fibers of hemoglobin S. Tex. Rep. Biol.Med. 40, 221–232.

24. Watowich, S. J., Gross, L. J., and Josephs, R. (1989) Intermolecular contactswithin sickle hemoglobin fibers. J. Mol. Biol. 209, 821–828.

25. Wainscoat, J. S., Bell, J. I., Thein, S. L., et al. (1983) Multiple origins of the sicklemutation: evidence from beta S globin gene cluster polymorphisms. Mol. Biol.Med. 1, 191–197.

26. Pagnier, J., Mears, J. G., Dunda-Belkhodja, O., et al. (1984) Evidence for themulticentric origin of the sickle cell hemoglobin gene in Africa. Proc. Natl. Acad.Sci. USA 8, 1771–1773.

27. Kulozik, A. E., Thein, S. L., Kar, B. C., et al. (1987) Raised Hb F levels in sicklecell disease are caused by a determinant linked to the beta globin gene cluster.Prog. Clin. Biol. Res. 251, 427–439.

28. Labie, D., Srinivas, R., Dunda, O., et al. (1989) Haplotypes in tribal Indians bear-ing the sickle gene: evidence for the unicentric origin of the beta S mutation andthe unicentric origin of the tribal populations of India. Hum. Biol. 61, 479–491.

29. Labie, D., Dunda-Belkhodja, O., Rouabhi, F., et al. (1985) The -158 site 5' to theG gamma gene and G gamma expression. Blood 66, 1463–1465.

Preface xv

30. Gilman, J. G. and Huisman, T. H. (1985) DNA sequence variation associated withelevated fetal G gamma globin production. Blood 66, 783–787.

31. Embury, S. H. (1989) Alpha thalassemia. A modifier of sickle cell disease. Ann.NY Acad. Sci. 565, 213–221.

32. Tuan, D. Y., Solomon, W. B., London, I. M., and Lee, D. P. (1989) An erythroid-specific, developmental-stage-independent enhancer far upstream of the human“beta-like globin” genes. Proc. Natl. Acad. Sci. USA 86, 2554–2558.

33 Nagel, R. L. and Fabry, M. E. (2001) The panoply of animal models for sickle cellanaemia. Br. J. Haematol. 112, 19–25,

34. Charache, S., Terrin, M. L., Moore, R. D., et al. (1995) Effect of hydroxyurea onthe frequency of painful crises in sickle cell anemia. Investigators of theMulticenter Study of Hydroxyurea in Sickle Cell Anemia. N. Engl. J. Med. 332,1317–1322.

35. Steinberg, M. H., Lu, Z. H., Barton, F. B., et al. (1997) Fetal hemoglobin in sicklecell anemia: determinants of response to hydroxyurea. Multicenter Study ofHydroxyurea. Blood 89, 1078–1088.

36. Gaston, M. H., Verterm, J. I., Woods, G., et al. (1986) Prophylaxis with oral peni-cillin in children with sickle cell anemia. A randomized trial. N. Engl. J. Med.314, 1593–1599.

37. Serjeant, G. R. (2001) The emerging understanding of sickle cell disease. Br. J.Haematol. 112, 3–18.

38. Annotation (1962) A new treatment for haemochromatosis? Lancet i, 1172.39. Lehmann, H. (1984) Sickle cell anemia 35 years ago: reminiscence of early Afri-

can studies. Am. J. Pediatr. Hematol. Oncol. 6, 72–76.40. Lehmann, H. (1984) The gradual understanding of thalassemia. Prog. Clin. Biol.

Res. 165, 121–136.41. Proceedings of the Titus H. J. Huisman Memorial Symposium (2001) Augusta,

Georgia, USA. June 9, 2000. Hemoglobin 25, 117–258.42. Pawliuk, R., Westerman, K. A., Fabry, M. E., et al. (2001) Correction of sickle cell

disease in transgenic mouse models by gene therapy. Science 294, 2368–2371.43. Imren, S., Payen, E., Westerman, K. A., et al. (2002) Permanent and panerythroid

correction of murine β-thalassemia by multiple lentivirus integration in hemato-poietic stem cells. Proc. Natl. Acad. Sci. USA 99, 14380–14385.

xvi Preface

Contents

Preface .............................................................................................................v

Contributors ................................................................................................... xix

1 X-ray Crystallography of HemoglobinsMartin K. Safo and Donald J. Abraham .............................................. 1

2 Analysis of Hemoglobins and Globin Chainsby High-Performance Liquid Chromatography

Henri Wajcman ..................................................................................... 21

3 Purification and Molecular Analysis of Hemoglobinby High-Performance Liquid Chromatograpy

Belur N. Manjula and Seetharama A. Acharya ................................. 31

4 Oxygen Equilibrium Measurements of Human Red Blood CellsJean Kister and Henri Wajcman ........................................................ 49

5 Measurement of Rate Constants for Reactions of O2, CO,

and NO with HemoglobinJohn S. Olson, Erin W. Foley, David H. Maillett,

and Eden V. Paster .......................................................................... 65

6 Electrophoretic Methods for Study of HemoglobinsHenri Wajcman ..................................................................................... 93

7 DNA Diagnosis of Hemoglobin MutationsJohn M. Old ........................................................................................ 101

8 Methods for Analysis of Prenatal DiagnosisJohn M. Old ........................................................................................ 117

9 Hemoglobin FluorescenceRhoda Elison Hirsch ......................................................................... 133

10 Nucleation and Crystal Growth of Hemoglobins:The Case of HbC

Peter G. Vekilov, Angela Feeling-Taylor,and Rhoda Elison Hirsch .............................................................. 155

11 Semisynthesis of HemoglobinSeetharama A. Acharya and Sonati Srinivasulu ........................... 177

12 β-Globin-like Gene Cluster Haplotypes in HemoglobinopathiesShanmugakonar Muralitharan, Rajagopal Krishnamoorthy,

and Ronald L. Nagel ...................................................................... 195

xvii

xviii Contents

13 Transgenic Mice and HemoglobinopathiesMary E. Fabry, Eric E. Bouhassira, Sandra M. Suzuka,


14 Recombinant Single Globin-Chain Expression and PurificationKazuhiko Adachi ................................................................................ 243

15 Nuclear Magnetic Resonance of HemoglobinsJonathan A. Lukin and Chien Ho ..................................................... 251

16 Solubility Measurement of the Sickle PolymerMary E. Fabry, Seetharama A. Acharya, Sandra M. Suzuka,


Index ............................................................................................................ 289

Contributors

DONALD J. ABRAHAM • Department of Medicinal Chemistry, School ofPharmacy, and the Institute for Structural Biology and Drug Discovery,Virginia Commonwealth University, Richmond, VA

SEETHARAMA A. ACHARYA • Department of Medicine and Department ofPhysiology and Biophysics, Albert Einstein College of Medicine, Bronx, NY

KAZUHIKO ADACHI • Division of Hematology, Children’s Hospital ofPhiladelphia, Philadelphia, PA

ERIC E. BOUHASSIRA • Department of Medicine, Albert Einstein College ofMedicine, Bronx, NY

MARY E. FABRY • Department of Medicine, Albert Einstein College ofMedicine, Bronx, NY

ANGELA FEELING-TAYLOR • Sue Golding Graduate Division, Department ofAnatomy and Structural Biology, and Medical Scientists TrainingProgram, Albert Einstein College of Medicine, Bronx, NY

ERIN W. FOLEY • Department of Biochemistry and Cell Biology, and the W.M. Keck Center for Computational Biology, Rice University, Houston, TX

RHODA ELISON HIRSCH • Division of Hematology, Department of Medicine,and Department of Anatomy and Structural Biology, Albert EinsteinCollege of Medicine, Bronx, NY

CHIEN HO • Department of Biological Sciences, Carnegie Mellon University,Pittsburgh, PA

JEAN KISTER • INSERM U473, Le Kremlin Bicetre, FranceRAJAGOPAL KRISHNAMOORTHY • INSERM U468, Hôpital Robert Debré, Paris,

FranceJONATHAN A. LUKIN • Department of Biological Sciences, Carnegie Mellon

University, Pittsburgh, PADAVID H. MAILLETT • Department of Biochemistry and Cell Biology, and

the W. M. Keck Center for Computational Biology, Rice University,Houston, TX

BELUR N. MANJULA • Department of Physiology and Biophysics, AlbertEinstein College of Medicine, Bronx, NY

SHANMUGAKONAR MURALITHARAN • Department of Medicine, Albert EinsteinCollege of Medicine, Bronx, NY

RONALD L. NAGEL • Division of Hematology, Department of Medicine, andDepartment of Physiology and Biophysics, Albert Einstein College ofMedicine, Bronx, NY

xix

JOHN M. OLD • John Radcliffe Hospital, Institute of Molecular Medicine,Oxford, UK

JOHN S. OLSON • Department of Biochemistry and Cell Biology, and the W. M.Keck Center for Computational Biology, Rice University, Houston, TX

EDEN V. PASTER • Department of Biochemistry and Cell Biology, and the W. M.Keck Center for Computational Biology, Rice University, Houston, TX

MARTIN K. SAFO • Department of Medicinal Chemistry, School of Pharmacy,and the Institute for Structural Biology and Drug Discovery, VirginiaCommonwealth University, Richmond, VA

SONATI SRINIVASULU • Department of Medicine, Albert Einstein College ofMedicine, Bronx, NY

SANDRA M. SUZUKA • Department of Medicine, Albert Einstein College ofMedicine, Bronx, NY

PETER G. VEKILOV • Department of Chemical Engineering, University ofHouston, Houston, TX

HENRI WAJCMAN • INSERM U468, Hôpital Henri Mondor, Creteil, France

Contributors xx

X-ray Crystallography of Hemoglobins 1

1

1

From: Methods in Molecular Medicine, vol. 82: Hemoglobin Disorders: Molecular Methods and ProtocolsEdited by: Ronald L. Nagel © Humana Press Inc., Totowa, NJ

X-ray Crystallography of Hemoglobins

Martin K. Safo and Donald J. Abraham

1. IntroductionX-ray crystallography has played a key role in understanding the relation-

ship between protein structure and physiological function. In particular, X-rayanalysis of hemoglobin (Hb) crystals has been pivotal in the formulation ofbasic theories concerning the behavior of allosteric proteins. Methemoglobin(MetHb) from horse was the first three-dimensional (3D) structure of ligandedHb to be solved (1–4). It was followed by crystallographic determination of theunliganded (deoxygenated) form nearly a decade later (5). The X-ray analysesprovided 3D atomic resolution structures and confirmed that Hb was tetrameric,containing two subunit types (α and β), and one oxygen-binding heme groupper subunit. John Kendrew (myoglobin) and Max Perutz (Hb) received theNobel Prize for their pioneering work, being the first to determine the 3D struc-tures of proteins, using X-ray crystallography. Since the crystallographic deter-mination of these structures, there has been an almost exponential increase inthe use of X-ray crystallography to determine the 3D structures of proteins,i.e., as evidenced by the history of structures deposited in the protein data bank.

Comparison of the quaternary structures of liganded and deoxygenated horseHb clearly showed significantly different conformational states. The Hb X-raystructures were the first to confirm the two-state allosteric theory put forwardby Monod et al. (6), which is referred to as the MWC model. The liganded Hbconformation conformed to the MWC relaxed (R) state, while unliganded Hbconformation conformed to the MWC tense (T) state. The source of the tensionin the T state was attributed to crosslinking salt bridges and hydrogen bondsbetween the subunits. The relaxed (R) state has only a few intersubunit hydro-gen bonds and salt bridges.

2 Safo and Abraham

Muirhead and Greer (7) published the first structure of human adult deoxy-genated hemoglobin (deoxyHbA). Several years later, Baldwin and Chothia(8,9) and Baldwin (9) published the structure of human adult carbonmonoxy-hemoglobin (HbCOA), and Shaanan (10) published the structure of humanadult oxyhemoglobin (oxyHbA). Interestingly, the structure of oxyHbA wasdelayed because of complications resulting from heme iron autoxidation. Sub-sequently, a new quaternary ligand-bound Hb structure known as R2 (11) or Y(12,13) provided another relaxed structure. R2 was proposed to be a low-energyintermediate in the T-to-R allosteric transition. However, further analysis hasrevealed that R2 is not an intermediate but, rather, another relaxed end-statestructure (14). Quite recently, our laboratory discovered two more novel HbCOA relaxed structures (R3 and RR2); RR2 has a structural conformation betweenthat of R and R2 (unpublished results). The quaternary structural differencebetween T and R3 is as large as that of T and R2. However, R2 and R3 havevery different conformations. The quaternary difference is determined bysuperimposing the α1β1 subunit interfaces and calculating the rotation anglebetween the nonsuperimposed α2β2 dimers (8,9).

The first 3D structures of horse Hb were solved using isomorphous replace-ment techniques (1–3,5). A number of published Hb structures also crystallizeisomorphously, thus making it possible to use phases from the known isomor-phous Hb structure for further structural analysis. The development of molecu-lar replacement methods (15,16) for the solution of protein structures enabledroutine structure solutions for nonisomorphous Hb crystals.

When the structure horse Hb was determined, no computer refinement pro-grams existed. Therefore, the atomic positions were refined visually against theelectron density map. With isomorphous mutant crystals (17) or isomorphouscrystals with bound allosteric effectors (18), simple electron density differencemap calculations have been shown to be powerful tools in analyzing structuraldifferences. Currently, all new protein structures are refined using modern, fastercomputing methods, such as CNS (19) and REFMAC (20).

The crystal structures of more than 250 Hbs have been solved and published,including mutants and Hb cocrystalized with allosteric effector molecules.Selected examples of native and mutant Hbs including quaternary states, crys-tallization conditions, and unit cell descriptions are given in Tables 1–3. Thestructures of mutant Hbs provided the first concrete correlation between struc-tural changes and disease states, while Hb cocrystallized with small effectormolecules has advanced our understanding of the fundamental atomic-levelinteractions that regulate allosteric function of an important protein.

The general methodologies for isolating, purifying, crystallizing and crystalmounting for data collection follow. The X-ray structure solution of Hb andvariants is routine and employs the techniques discussed above: isomorphous

X-ray C

rystallography of Hem

oglobins3

3

Table 1Crystallization Conditions and Structural Properties of Selected Human Hbs

Quater- Chemical ResolutionName nary state form Crystallization condition Unit cell characteristicsa (Å) Reference

DeoxyHbA T Normal 2.2–2.8 M NH4 phosph/sulfate, a = 63.2, b = 83.5, c = 53.8 Å, 1.7 25pH 6.5 β = 99.3°, SG = P21, AU = 1 tetramer

DeoxyHbA T Normal 10–10.5% PEG 6000, 100 mM a = 97.1, b = 99.3, c = 66.1 Å, 2.15 26KCl, 10 mM K phosph, pH 7.0 SG = P21212, AU = 1 tetramer

RSR13-deoxy T Normal 2.5–2.9 M NH4 phosph/sulfate, pH 6.5 a = 63.2, b = 83.6, c = 53.9 Å, 1.85 27 HbA complexb β = 99.2°, SG = P21, AU = 1 tetramerDeoxyHbFc T Fetal 2.2–2.8 M NH4 phosph/sulfate, pH 6.5 SG = P21, AU = 1 tetramer 2.5 28OxyHbA R Normal 2.25–2.75 M Na/K phosph, pH 6.7 a = 53.7, b = 53.7, c = 193.0 Å, 2.1 10

SG = P41212, AU = 1 dimerHbCO A R Normal 2.25–2.75 M Na/K phosph, pH 6.7 a = 53.7, b = 53.7, c = 193.8 Å, 2.7 8

SG = P41212, AU = 1 dimerHbCO A R2 Normal 16% PEG 6000, 100 mM, a = 97.5, b = 101.7, c = 61.1 Å, 1.7 11

Na cacodylate, pH 5.8 SG = P212121, AU = 1 tetramerCO Gower II R2 Embryonic 21% MME PEG 5000, a = 62.8, b = 62.8, c = 320.9 Å, 2.9 29 (α2ε2)d 0.2 M TAPS-KOH, pH 8.5 SG = P43212, AU = 1 tetramer

HbCO Ae R3 Normal 2.34–2.66 M Na/K phosph, pH 6.4–6.7 a = 61.5, b = 61.5, c = 176.3 Å, 2.65 UnpublishedSG = P4122, AU = 1 dimer data

HbCO Ae RR2 Normal 2.34–2.66 M Na/K phosph, pH 6.4–6.7 a = 65.5, b = 154.6, c = 55.3 Å, 2.18 UnpublishedSG = P21212, AU = 1 tetramer data

CNMetHbAf Y Normal 16–17% PEG 8000, 0.1 M Tris, a = 106.1, b = 86.2, c = 64.3 Å, 2.09 130.12% BOG SG = P212121, AU = 1 tetramer

a SG , space group; AU, and asymmetric unit.b RSR13 is an allosteric effector.c The authors of deoxyHbF did not provide the cell constants, however, the crystal is isomorphous to the high-salt deoxyHbA crystal (25).d The quaternary structure of carbonmonoxy embryonic Gower II Hb lies between that of R and R2 states, though closer to the R2 state.e Relaxed end-state structures (see text).f The quaternary structures of Y and R2 state Hbs are similar.

4S

afo and Abraham

4

Table 2Crystallization Conditions and Structural Properties of Selected Natural Mutant Human Hbs


DeoxyHbASickle cell T Glu6βVal 33% PEG 8000, 5.5 mM citrate, pH 4.0–5.0 a = 52.9, b = 185.7, c = 63.3 Å, 2.05 24

β = 92.6°, SG = P21, AU = 2 tetramersCatonsville T Pro37α-Glu- 2.2–2.8 M NH4 Phosph/sulfate pH 6.5 a = 63.2, b = 83.6, c = 53.8 Å, 1.7 30

Thr38α β = 99.4°, SG = P21, AU = 1 tetramerRothschild T Trp37βArg 10–10.5% PEG 6000, 100 mM KCl, a = 97.1, b = 99.3, c = 66.1 Å 2.0 26

10 mM K phosph, pH 7.0 SG = P21212, AU = 1 tetramerThionville T Val1αGlu 2.2–2.8 M NH4 phosph/sulfate, pH 6.5 a = 63.2, b = 83.6, c = 53.8 Å, 1.5 31

AcetMet(-1)1α β = 99.4°, SG = P21, AU = 1 tetramerCOYpsilanti Y Asp99βTyr 2.25–2.30 M Na/K phosph, pH 6.7 a = 93.1, b = 93.1, c = 144.6 Å 3.0 12

SG = P3221, AU = 1 tetramerCowtown R His146βLeu 2.25–2.75 M Na/K phosph, pH 6.7 a = 54.38, b = 54.38, c = 195.53 Å, 2.3 32

SG = P41212, AU = 1 dimerKnossosb T Ala27βSer 2.2–2.8 M NH4 phosph/sulfate, pH 6.5 SG = P21, AU = 1 tetramer 2.5 33Grange- T Ala27βVal 2.2–2.8 M NH4 phosph/sulfate, pH 6.5 SG = P21, AU = 1 tetramer 2.5 33 Blancheb

Brocktonb T Ala138βPro 2.2–2.8 M NH4 phosph/sulfate, pH 6.8 SG = P21, AU = 1 tetramer 3.0 34Suresnesb T Arg141αHis 2.2–2.8 M NH4 phosph/sulfate, pH 6.5 SG = P21, AU = 1 tetramer 3.5 35Kansas T Asn102βThr 2.2–2.8 M NH4 phosph/sulfate, pH 6.5 a = 63.4, b = 83.6, c = 53.9 Å, 3.4 36

β = 99.3 o, SG = P21, AU = 1 tetramer

a SG, space group and; AU, asymmetric unit.b The authors of Hb Knossos, Grange-Blanche, Brockton, and Suresnes did not provide the cell constants, however, the crystals are isomorphous

to the high-salt deoxyHbA crystal (25).

X-ray C

rystallography of Hem

oglobins5

5

Table 3Crystallization Conditions and Structural Properties of Selected Artificial Mutant Human Hbs


Yα42H T Tyr42αHis 2.2–2.8 M NH4 phosph/sulfate, pH 6.5 a = 62.4, b = 81.2, c = 53.3 Å, 1.8 38β = 99.65°, SG = P21, AU = 1 tetramer

rHb(α96Val→Trp) T Val96αTrp 2.2–2.8 M NH4 phosph/sulfate, pH 6.5 a = 63.3, b = 83.4, c = 53.8 Å, 1.9 39β = 99.5°, SG = P21, AU = 1 tetramer

rHb(α96Val→Trp) R Val96αTrp 2.25–2.75 M Na/K phosph, pH 6.7 a = 54.3, b = 54.3, c = 194.1 Å 2.5 39SG = P41212, AU = 1 dimer

Deoxy-Hbβ6W T Glu6βTrp 4–7 uL of 33 % PEG 8000, 5 uL a = 62.9, b = 81.3, c = 111.4 Å 2.0 40of Na citrate, pH 4.8 SG = P212121, AU = 1 tetramer

Deoxy-rHb1.1 T Asn108βLys 2.2–2.8 M NH4 phosph/sulfate, pH 6.5 a = 62.9, b = 82.0, c = 53.9 Å, 2.0 41α1-Gly-α2 β = 99.0°, SG = P21, AU = 1 tetramer

CNmet-rHb1.1 B Asn108βLys 13 % PEG 3350, 10 mM KCN, a = 102.5, b = 115.2, c = 56.7 Å 2.6 41α1-Gly-α2 150 mM NH4 acetate, pH 5.0 SG = P212121, AU = 1 tetramer

Deoxy-βV67T T Val67βThr 2.2–2.8 M NH4 phosph/sulfate, pH 6.5 a = 63.5, b = 83.2, c = 54.0 Å, 2.2 42β = 99.15°, SG = P21, AU = 1 tetramer

Des-Arg141αHbA T des-Arg141α 10–10.5 % PEG 6000, 100 mM a = 96.7, b = 98.7, c = 66.0 Å, 2.1 43KCl, 10 mM K phosph, pH 7.0 SG = P21212, AU = 1 tetramer

Bulltown T His146βGln 2.2–2.8 M NH4 phosph/sulfate, pH 6.5 a = 63.2, b = 83.4, c = 53.8 Å, 2.6 44β = 99.4°, SG = P21, AU = 1 tetramer

Deoxy-βV1M T Val1βMet 2.2–2.8 M NH4 phosph/sulfate, pH 6.5 a = 63.2, b = 83.7, c = 53.8 Å, 1.8 45β = 99.4°, SG = P21, AU = 1 tetramer

a SG, space group; AU, asymmetric unit.

6 Safo and Abraham

replacement, difference electron density calculations, molecular replacement,and structure refinement (for details, see references).

2. Materials2.1. Purification of Human Hb for Crystallization

1. HbA is purified from outdated human red blood cells (RBCs) unsuitable for trans-fusion (~500 mL). Sickle cell Hb (HbS) is purified from sickle cell blood, nor-mally obtained from homozygote sickle cell patients who receive blood-exchangetransfusions. To avoid clotting, blood samples are normally stored with about1/10 vol of an anticoagulant agent, such as EDTA, heparin, or potassium citrate.

2. Buffer stock solution (5–10 L) containing 50 mM Tris buffer (pH 8.6) withEDTA: The solution is made by mixing 50 vol of 0.1 M Trizma base, 12.4 vol of0.1 N Trizma hydrochloride, adjusting the volume to 100 mL with deionizedwater containing 4 g of EDTA (see Note 1).

3. Stock saline solutions (3 and 1 L) of 0.9% (9 g/L) and 1.0% NaCl (10 g/L),respectively.

4. DEAE sephacel and chromatography column equipment.5. Cellulose dialysis tubes (Fisher Pittsburgh, PA).6. Carbon monoxide gas cylinder (Matheson, Joliet, IL) (see Note 2).7. NaCl, Na dithionite, and K2HPO4.8. Three Erlenmeyers or side arm flasks (1 L).

2.2. Crystallization of Human Hb

1. Cyrstallization procedures will be described for deoxyHbA, deoxyHbS, and COHbA. These methods are also applicable to other HBs. HbA and HbS isolated andpurified as described in Subheading 3.1.2. are used for all crystallization setups.

2.2.1. High-Salt Crystallization of T-State deoxyHbA

1. HbA solution (12 mL) (60 mg/mL or 6g%): Dilute the protein with deionizedwater if necessary to obtain the above concentration.

2. 3.6 M precipitant solution (50 mL) (pH 6.5): This is made by mixing 8 vol of 4 M(NH4)2SO4, 1.5 vol of 2 M (NH4)2HPO4, and 0.5 vol of 2 M (NH4)H2PO4.

3. Deionized water (100 mL).4. Ten 8-mL sterile interior vacutainer tubes (Becton Dickinson, Franklin

Lakes, NJ).5. Stoppered glass jar (Aldrich, St. Louis, MO).6. Parafilm.7. Pipets and pipet tips (100 and 1000 mL).8. Three 15- to 25-mL beakers or volumetric flasks.9. Graduated cylinders (10- and 50-mL).

10. Mixture of FeSO4 (2 g) and Na citrate (1.5 g).11. A few grains of Na dithionite.12. Test tube rack.


2.2.2. High-Salt Crystallization of R-State HbCO A

1. HbA solution (12 mL) (40 mg/mL or 4g%) in a 50-mL round-bottomed flaskequipped with a stir bar and a greased stopcock adapter.

2. 3.4 M precipitant solution (40 mL) (pH 6.4): This is made by mixing 7 vol of 3.4 MNaH2PO4 and 5 vol of 3.4 M K2HPO4 (see Note 3).

3. Deionized water (100 mL).4. Toluene (50 µL).5. Ten 8-mL sterile interior vacutainer tubes (Becton Dickinson).6. Stoppered glass jar (Aldrich).7. Pipets and pipet tips (100 and 1000 mL).8. A few grains of Na dithionite.9. Carbon monoxide gas cylinder (Matheson) (see Note 2) and nitrogen gas

cylinder.10. Test tube rack.11. Vacuum pump and rubber tubing.

2.2.3. Low-Salt Crystallization of T-State deoxyHbS

1. HbS solution (1.2 mL) (120 mg/mL or 12g%).2. 50% (w/v) polyethylene glycol (PEG) 6000 (12 mL).3. 0.2 M citrate buffer (1 mL), pH 4.0–5.0 (Hampton Research, Laguna Hills, CA).4. Deionized water (10 mL).5. Ten 3-mL sterile interior vacutainer tubes (Becton Dickinson).6. Parafilm.7. Stoppered glass jar (Aldrich).8. Pipets and pipet tips (100 and 1000 mL).9. Two 15- to 25-mL beakers.

10. A few grains of Na dithionite.

2.3. Crystal Preparation and Mounting

The methods described here are for deoxyHbA and COHb A, and are alsoapplicable to other Hb cystals.

2.3.1. Room Temperature Data Collection

1. Vacutainer tube containing T- or R-state crystals.2. Capillary sealant, such as epoxy or paraffin wax or any wax with a low

melting point.3. Disposable pipets and pipet rubber bulb.4. Stainless steel blunt-end needles (Fisher).5. Disposable syringes (3–5 mL) (Fisher Scientific).6. Sterilized paper wicks (Hampton Research).7. Thin-walled quartz or borosilicate capillaries (Charles Supper, Natick, MA),

ranging in size from 0.1 to 1.2 mm.8. Soldering iron.9. Sharp tweezer.

8 Safo and Abraham

2.3.2. Cryogenic Temperature Data Collection

2.3.2.1. T-STATE DEOXYHBA CRYSTAL

1. Vacutainer tube containing T-state crystals.2. Glycerol (100 µL).3. Small Dewar flask with liquid nitrogen.4. Thin fiber loop with diameter slightly larger than longest crystal dimension

(Hampton Research).5. Cryovial and cryovial tong (Hampton Research).6. Disposable pipets and pipet rubber bulb.7. Glass slides.8. A few grains of Na Dithionite.

2.3.2.2. R-STATE COHB CRYSTAL

1. Vacutainer tube containing R-state crystals.2. Cryoprotectant solution made by mixing 60 µL of mother liquor and 5–8 µL of

glycerol.3. Thin fiber loop with diameter slightly larger than longest crystal dimension.4. Disposable pipets and pipet rubber bulb.5. Glass slides.

3. Methods3.1. Purification of Human Hb for Crystallization

About 90% of RBC content is made up of Hb, and in healthy human adults,HbA accounts for more than 90% of the human Hb protein, while other minorcomponents, such as fetal HbF (~1%) and hemoglobin HbA2 (2 to 3%), makeup the remainder. The method described here for isolating HbA and HbS fromblood or RBCs, and further purification by ion-exchange chromatography, is amodified version of Perutz’s (21) protocol. This procedure, using appropriatebuffer eluents, has also been used to separate other variant forms of human Hband Hb from other species.

3.1.1. Purification of HbA

1. Place three Erlenmeyer or side-arm flasks in a walk-in refrigerator and chill to 4°C.2. Centrifuge the RBCs at 600g for 20 min at 4°C.3. Gently aspirate the supernatant solution (debris, plasma, and excess serum) from

the centrifuge bottles and discard.4. Wash the RBCs three times with an excess volume of 0.9% NaCl, and then once

with 1.0% NaCl, each time centrifuging and discarding the supernatant solution.5. Pool the RBCs into a chilled flask and lyse the cells by adding 1 to 2 vol of 50 mM

Tris buffer, pH 8.6 (containing EDTA) (see Note 4).6. Allow the mixture to stand on ice for 30 min with occasional gentle stirring.7. Centrifuge the Hb solution at 10,000g for 2 h at 4°C.


8. Pool the supernatant Hb solution, which is free of cell debris, into a chilled flask,and slowly add NaCl (40–60 mg/mL of Hb solution) while stirring the solution.

9. Centrifuge the Hb solution at 10,000g for 1 to 2 h at 4°C to remove any remain-ing cell stroma.

10. Pool the clear supernatant Hb solution into a chilled flask and discard the “syr-upy” pellet.

11. Dialyze the Hb solution against 50 mM Tris buffer, pH 8.6 (containing EDTA),at 4°C to remove NaCl or other low molecular weight impurities (see Note 5).

12. Further purify the dialyzed Hb by ion-exchange chromatography using DEAEsephacel to separate the HbA from other Hb components (see Note 6):a. Equilibrate the resin with 50 mM Tris buffer, pH 8.6.b. Run the Hb solution through the column with 50 mM Tris buffer, pH 8.6

(containing EDTA), to allow the various Hb bands to separate. HbA2 (lightband color) elutes first, followed by HbA (dark band color). The HbA frac-tions can be examined for purity by electrophoresis and only pure fractions(dark band) pooled together.

13. Concentrate the pooled fractions (40–100 mg/mL) with an Amicon stirredcell (Model 402) to a final HbA concentration of about 80–120 mg/mL (seeNote 7).

14. Store the concentrated HbA, which is essentially the oxygenated form, at –80°Cor freeze in liquid nitrogen. Hb stored at this temperature can remain suitable forcrystal growth experiments for several years.

3.1.2. Purification of HbS

HbS from homozygous sickle cell blood is isolated and dialyzed as describedfor HbA in Subheading 3.1.1. (steps 1–11). The HbS solution is further puri-fied on a DEAE sephacel ion-exchange column using a buffer gradient of 50 mMTris buffer, pH 8.6 (containing EDTA), and 50 mM Tris buffer, pH 8.4 (con-taining EDTA) (see Note 1).

1. Elute first HbA2 Tris buffer at pH 8.6, then HbS at pH 8.4.2. Concentrate the pure HbS, identified by electrophoresis and store as indicated for

HbA in Subheading 3.1.1. (steps 13 and 14).

3.2. Crystallization of Human Hb

DeoxyHbA crystallizes from either high-salt or low-salt precipitants (7,21).The ligand-bound R-state Hbs, such as oxyHbA, HbCO A, and MetHbA; gen-erally crystallize under high-salt conditions (8–10,21), while the ligand-boundR2- or Y-state HbAs also crystallize mainly under low-salt conditions (11,13).The most common approach to crystallizing Hb is the Perutz’s (21) batchmethod. Alternatively, the vapor diffusion method of hanging or sitting drop(22) is used, especially when only a small amount of protein is available. Here,detailed crystallization is described for both T- and R-state human HbA and

10 Safo and Abraham

includes the high-salt crystallization of deoxyHbA and HbCO A and the low-salt crystallization of deoxyHbS. The crystallization methods described aremodified batch methods by Perutz (21) and Wishner et al. (23) and can also beapplied to Hb mutants and Hb from other species. See Notes 8 and 9 for impor-tant precautions regarding setting up T- and R-state crystals, respectively.

3.2.1. High-Salt Crystallization of T-State deoxyHbA

1. The materials in Subheading 2.2.1., with the exception of the stoppered glass jarand the parafilm, are put in an antechamber of a glove box. The vacutainer tubesshould be unstoppered, labeled as shown in Table 4, and arranged on a test tuberack. All containers, including those with solvents, should be left open.

2. Alternately evacuate and fill the antechamber with nitrogen while stirring theHbA solution for 10–20 min to obtain completely deoxyHbA, water, and precipi-tant solutions (see Note 10).

3. Purge the anaerobic chamber of the glove box with nitrogen to ensure a completeanaerobic condition.

4. Transfer all materials from the antechamber to the anaerobic chamber.5. Add 25 mL of deionized water to the FeSO4 and Na citrate mixture and shake for

about 30 s.6. Allow the solution to settle and decant. Use the supernatant (Fe citrate) solution

for all experiments (see Note 11).7. Measure the volume of precipitant solution with a graduated cylinder, and add

water to restore to the original volume of 50 mL (3.6 M), if necessary.8. Measure the volume of deoxyHbA solution with a graduated cylinder, and add

water to restore to the original volume of 12 mL (60 mg/mL), if necessary.9. Add a few grains of Na dithionite (or ~2 mM) to the deoxyHbA solution to reduce

any ferric heme that may be present.

Table 4High-Salt Crystallization of deoxyHbA

3.6 M NH4 phosph/ Deionized 0.5 M Fe 6g% deoxy- Final saltTube sulfate (mL) H2O (mL) citrate (mL) HbA (mL) conc. (M)

1 4.90 0.00 0.1 1 2.94 2 4.80 0.10 0.1 1 2.88 3 4.70 0.20 0.1 1 2.82 4 4.60 0.30 0.1 1 2.76 5 4.50 0.40 0.1 1 2.70 6 4.40 0.50 0.1 1 2.64 7 4.30 0.60 0.1 1 2.58 8 4.20 0.70 0.1 1 2.52 9 4.10 0.80 0.1 1 2.4610 4.00 0.90 0.1 1 2.40


10. Measure the precipitant solution and water and add to the vacutainer tubes asindicated in Table 4.

11. Measure 1- and 0.1-mL aliquots of deoxyHbA and Fe citrate, respectively, andadd to each vacutainer tube.

12. Stopper each vacutainer tube, and tilt at least twice to mix the solution.13. Remove all the materials from the glove box and wrap parafilm around the stop-

per of each vacutainer tube.14. Store the sealed vacutainer tubes in greased, stoppered glass jars filled with

nitrogen. Crystals normally appear within 3–10 d and vary in size from mi-croscopic to as large as 8 mm in any direction. The crystals belong to spacegroup P21 with approximate unit cell constants of a = 63 Å, b = 83 Å, c = 53 Å,and β = 99°.

3.2.2. High-Salt Crystallization of R-State HbCO A

1. Add a few grains of Na dithionite to 12 mL of HbA (40 mg/mL) in a round-bottomed flask (three to five times the size of the volume of the HbA solution)fitted with a stopcock adapter and connected to both a vacuum pump and a nitro-gen gas source with rubber tubing.

2. Alternately evacuate and flush with nitrogen for about 10 min.3. Connect a CO source to a disposable pipet with rubber tubing (see Note 2).4. Open the flask containing the deoxyHbA solution, and quickly bubble CO

through the solution to make the HbCO A derivative.5. Reconstitute the volume to 12 mL (40 mg/mL) with CO-purged deionized water.6. Bubble CO through the precipitant solution.7. Measure the precipitant solution and add to the vacutainer tubes as indicated in

Table 5.8. Measure 1-mL aliquots of HbCO A and add to each vacutainer tube.

Table 5High-Salt Crystallization of HbCO Aa

3.4 M Na/K 4g% HbCO A Final saltTube phosph (mL) (mL) conc. (M)

1 3.80 1.0 2.69 2 3.60 1.0 2.66 3 3.40 1.0 2.63 4 3.20 1.0 2.59 5 3.00 1.0 2.55 6 2.80 1.0 2.51 7 2.60 1.0 2.46 8 2.40 1.0 2.40 9 2.20 1.0 2.3410 2.00 1.0 2.27

a A drop or two of toluene is added to each tube.

12 Safo and Abraham

9. Add a drop or two of toluene to each vacutainer tube (see Note 12).10. Slowly bubble CO through each vacutainer tube, stopper, and tilt at least twice to

mix the solution.11. Seal the vacutainer tubes with rubber stoppers and store in greased, stoppered

glass jars filled with nitrogen to minimize formation of MetHbA. Crystals nor-mally appear within 3–10 d. The crystals are octahedral and belong to space groupP41212, with approximate unit cell constants of a = 53 Å, b = 53 Å, and c = 193 Å.The method described to crystallize HbCO A is applicable to both oxyHbA andMetHbA (see Note 13).

3.2.3. Low-Salt Crystallization of T-State deoxyHbS

1. Place all materials (except stoppered glass jar and parafilm) in the antechamberof the glove box. The vacutainers should be unstoppered and labeled as shown inTable 6. All containers, including those of solvents, should be left opened (seeNote 14).

2. Deoxygenate the HbS and other solutions (5–10 min) in the antechamber of theglove box.

3. Purge the anaerobic chamber and transfer all materials from the antechamberinto the anaerobic chamber.

4. Add deionized water to restore the volume of the HbS to 1.2 mL, if necessary.5. Add a few grains of Na dithionite (or ~2 mM) to the HbS solution.6. Add deionized water to restore the volume of the precipitant solution to 12 mL, if

necessary.7. Measure the precipitant solution and deionized water and add to the vacutainer

tubes as shown in Table 6.8. Measure 0.1 mL-aliquots of deoxyHbS and add to each vacutainer tube.9. Stopper each vacutainer tube and tilt at least twice to mix the solution.

Table 6Low-Salt Crystallization of deoxyHbS

50% PEG Deionize 0.2 M Citrate 12g% deoxyHbSTube 6000 (mL) water (mL) (mL) (mL)

1 1.5 0.15 0.05 0.1 2 1.4 0.25 0.05 0.1 3 1.3 0.35 0.05 0.1 4 1.2 0.45 0.05 0.1 5 1.1 0.55 0.05 0.1 6 1.0 0.65 0.05 0.1 7 0.9 0.75 0.05 0.1 8 0.8 0.85 0.05 0.1 9 0.7 0.95 0.05 0.110 0.6 1.05 0.05 0.1


10. Store the vacutainer tubes and contents as described in Subheading 3.2.1. (steps13 and 14). Crystals grown by this method are twinned (23,24) and must be sepa-rated before X-ray data can be obtained. Final crystals have the symmetry of themonoclinic space group P21, with approximate cell constants of a = 53 Å, b = 184Å, c = 63 Å, and β = 93° (see Note 15).

3.3. Crystal Preparation and Mounting

Hb crystals, like most other protein crystals, are fragile because of their highsolvent content and should be handled with care. For room temperature datacollection, Hb crystals are mounted and sealed in a thin-walled glass capillaryabout twice the size of the crystal. For cryogenic data collection, crystals aremounted in a thin fiber loop with a layer of suitable cryoprotectant aroundthe crystal.

3.3.1. Room Temperature Data Collection

T-state crystals are prepared and mounted in the glove box, while R-statecrystals are mounted outside the glove box. However, to minimize autoxida-tion, mount R-state oxyHbA crystals as described for T-state crystals.

1. Select at least two 8-cm-long capillaries, and, using a soldering iron, melt a ringof wax close to the middle of the capillary.

2. Use a sharp tweezer to cut the bottom part of the capillary, just below the ring ofwax. The top part of the capillary with the wide mouth is retained. Seal the cutbottom (with the ring of wax) with melted wax or epoxy (see Note 16).

3. Using a microscope, select a few good crystals by marking outside the vacutainertube where those crystals are.

4. For R-state crystals, proceed to step 9.5. For T-state crystals, place the materials in Subheading 2.3.1., in addition to the

prepared capillaries, in the antechamber of the glove box.6. Alternately evacuate and fill the antechamber with nitrogen for 5–10 min.7. Transfer all the materials to a nitrogen-purged anaerobic chamber (see Note 17).8. With a blunt-end needle, introduce a small amount of mother liquor from the

vacutainer tube into the upper third of the capillary (all the way to the top).9. Using a disposable pipet with a rubber bulb, suck a suitable marked crystal up

onto the solution in the capillary. Allow the crystal to flow down to the air space.If the crystal is less dense than the mother liquor, invert the capillary to allow thecrystal to flow to the air space.

10. Carefully push the crystal with a thin fiber or the blunt end of the needle into theair space.

11. Remove the solution from the capillary with a syringe and needle.12. Carefully dry excess liquid from the crystal with a filter paper strip, a smaller cut

capillary, or even the tip of the blunt-end needle. Leave a thin film of motherliquor between the crystal and the capillary wall (see Note 18).

14 Safo and Abraham

13. Reintroduce a small amount of mother liquor into the capillary, about 5 mm fromthe crystal (~5-mm-long liquid). Do not fill all the way to the top (see Note 19).

14. Close the capillary with melted wax or epoxy.

3.3.2. Cryogenic Temperature Data Collection

T-state crystals are prepared and mounted in the glove box, and R-state crys-tals are mounted outside the glove box. Slightly different procedures are used,so a protocol for each is given next.

3.3.2.1. T-STATE DEOXYHBA CRYSTAL

1. Place the materials in Subheading 2.3.2.1. in the anaerobic glove box as alreadydescribed in Subheading 3.3.1. (steps 5–7).

2. Submerge the cryovial in the Dewar liquid nitrogen using the cryovial tong.3. Prepare cryoprotectant solution by mixing 50 µL of mother liquor, 10–16 µL of

glycerol, and a few grains of Na dithionite (see Note 20).4. Pick up a crystal with the disposable pipet, and place it into 5 µL of cryoprotectant

solution on a glass slide for about 30 s.5. Transfer the crystal to another 5 µL of cryoprotectant solution for another 30 s.6. Use a fiber loop to scoop the crystal.7. Plunge the loop containing the crystal and the drop of cryoprotectant directly into the

cryovial which is submerged in the liquid nitrogen.8. Take the closed cryovial out of the glove box and mount the crystal on the goni-

ometer head in the cold nitrogen gas stream (see Note 21).

3.3.2.2. R-STATE COHB A CRYSTAL

1. Pick up a crystal with a disposable pipet, and introduce it into 5 µL of cryo-protectant solution on a glass slide for about 30 s.

2. Transfer the crystal to another 5 µL of cryoprotectant solution for another 30 s.3. Scoop up the crystal, which has a protective cover of cryoprotectant liquid, with

a fiber loop.4. Place the fiber loop on the goniometer head in the cold nitrogen gas stream.

4. Notes1. For HbS purification, prepare an additional 3–5 L of buffer stock solution con-

taining 50 mM Tris buffer (pH 8.4) with EDTA. The solution is made by mixing50 vol of 0.1 M Trizma base and 17.2 vol of 0.1 N Trizma hydrochloride, andadjusting the volume to 100 mL with deionized water containing 4 g of EDTA.

2. CO should be handled with great care; it is extremely toxic. All experimentsinvolving CO should be done in a fume hood in a well-ventilated room.

3. Alternatively, a precipitant solution consisting of equal volumes of 3.4 MNaH2PO4 and 3.4 M K2HPO4 (pH 6.7) may be used and 0.2 mL of distilled wateradded to each tube.

4. EDTA helps prevent oxidation of ferrous heme to ferric heme by chelating anyheavy metals that may act as catalysts for the autoxidation process. The final


concentration of the purified HbA will depend on the amount of buffer added tolyse the cell.

5. Strips of standard cellulose dialysis tubing that have been washed three or fourtimes and boiled for 10 min in deionized water are used for the dialysis. This isdone to remove traces of impure compounds that may contaminate the HbA. Thedialyzing buffer should be 50- to 200-fold of the HbA volume and should becontinuously stirred overnight. If possible, the buffer should be changed every 2to 3 h.

6. Alternatively, HbA is dialyzed with 10 mM phosphate buffer, pH 7.0. The sametype of buffer is then used to purify the HbA, as described in the text, using G25Sephadex (fine) column.

7. Alternatively, HbA is concentrated by ultrafiltration through an Mr 10,000pellicon cassette. The concentration of HbA can be determined using the Perutz(21) procedure. The concentration is measured by taking 1 mL of HbA solutionand diluting it with 19 mL of deionized water and 80 mL of 0.07 M K2HPO4. Nadithionite powder (0.2 g) is then added to the solution to generate the fullyreduced deoxyhemoglobin derivative. CO is then bubbled through the solution toproduce the COHb A derivative. The extinction coefficient is measured at 540 nm,and the concentration of HbA is calculated by dividing the optical density by 8.03.

8. All crystallization steps for deoxyHbA are performed under rigorous anaerobicconditions in a nitrogen atmosphere glove box. It is critical that all crystallizationsolvents be purged of oxygen and stored under nitrogen. These precautions arenecessary to prevent formation of oxyHbA or MetHbA.

9. Human R-state COHb A , oxyHbA, and MetHbA crystallize isomorphously, andthe corresponding structures are very similar. OxyHbA is very susceptible toautoxidation, which leads to formation of MetHbA during crystallization and datacollection. To slow autoxidation, EDTA (1 mM) is added to the precipitatingagents to chelate traces of heavy metals that catalyze the autoxidation process.Autoxidation of oxyHbA proceeds very rapidly when deoxyHbA is present in thesolution; therefore, oxygen should be bubbled through the HbA solution to com-pletely oxygenate all the HbA. In addition, crystallization should be performed ata low temperature, preferably 4°C, to slow down autoxidation. Even thoughHbCO A is fairly stable for a long period, the presence of oxygen leads to gradualoxidation of the ferrous heme. Therefore, crystallization of HbCO A should beunder a CO atmosphere to avoid possible oxidation of the heme. All solutions forHbCO A crystallization should be purged with CO before use.

10. A simple glove bag or Plexiglas box with gloves can be substituted for a moreexpensive glove box. If a glove bag or Plexiglas box is used, the HbA solutionhas to be deoxygenated outside the glove box. The HbA solution is put in a round-bottomed flask (three to five times the size of the volume of the HbA solution)and then connected by rubber tubing to both a vacuum pump and a nitrogen gassource with a glass stopcock adapter. The HbA is alternately evacuated andflushed with nitrogen for 30–60 min to obtain a deoxyHbA solution. (For smallervolume, the deoxygenation time is decreased.) A larger flask prevents boiling

16 Safo and Abraham

HbA solution from getting into the vacuum line during the evacuation cycle.Additionally, to avoid undue boiling and splashing of the HbA, the flask contain-ing the HbA solution may be cooled briefly in an ice bath before evacuation.Next, all materials are put into the glove bag or Plexiglas box. With the exceptionof the deoxyHbA solution, all other solution-containing flasks (precipitant, water,and buffer) should be left open. Once all the materials are put in the glove bag orPlexiglas box, it is then purged continuously with nitrogen for at least 40 minbefore the flask containing the HbA solution is opened. If the chamber is notairtight, it should be purged continuously with nitrogen during the crystallizationexperiments (Subheading 3.2.1., steps 5–14).

11. Fe Citrate solution is prepared in situ from FeSO4 and Na citrate in the glove boxand used fresh because the compound is unstable and easily oxidizes to ferriccitrate. Fe citrate is a mild reducing agent and helps prevent oxidation of the iron;it also acts as an antimicrobial agent to prevent growth of bacteria and fungi.

12. Toluene, like similar organic solvents, reduces the effective electrostatic shield-ing between the macromolecules by decreasing the electrostatic properties of theprecipitating solutions. This facilitates increased contact between the macromol-ecules and serves to induce crystallization. The presence of toluene is also effec-tive in preventing microbial growth.

13. Recently, we have discovered two new crystal forms of HbCO A (R3 and RR2;see Table 1) that grows under the same crystallization conditions. One crystalform is rectangular and needle-like and belongs to the space group P4122. Theother crystal form, which is also needle-like, belongs to the space group P212121.

14. Alternatively, the HbA is deoxygenated outside the glove box as indicated above.For a small quantity of solution, the deoxygenation time is reduced accordingly(see Note 10, and continue from Subheading 3.2.3., steps 4–10).

15. Crystals must be transferred to a stabilizing solution made of glutaraldehyde,which strengthens the crystals before cutting. Glutaraldehyde stabilizes the crys-tals by crosslinking the subunits. Soak the crystals for 1 d in a mixture of 35%(v/v) PEG stock solution, 20% (v/v) 0.2 M citrate buffer (pH 5.6), 45% (v/v) of2% Drabkin’s buffer, and 10 mM of Na dithionite. The temperature of the solu-tion is subsequently lowered to 3°C, and glutaraldehyde solution (50% [w/v]) isthen added. The mixture is allowed to stand overnight at 3°C.

16. Without the wax, the capillary may shatter when cut.17. If a glove bag or Plexiglas box is used, make sure that all necessary materials are

put in the chamber and then purged continuously with nitrogen for at least 40 minbefore the vacutainer tube containing the crystals is opened. If the chamber is notairtight, it should be purged continuously with nitrogen during the experiments.

18. A large amount of mother liquor around the crystal may decrease the resolutionand increase mosaicity and background noise. The crystal can also move freelyor slip. While making sure that as much liquid as possible is removed, do notcompletely dry the crystal. Excess drying will dehydrate the crystal, which mayresult in cracking, increased mosaicity, poor diffraction, disorder, and a largereduction in cell volume.


19. Mother liquor in the capillary ensures that the crystal is kept in the saturated vaporof the mother liquor during room temperature data collection to prevent drying.

20. Paraffin oil (Hampton Research) can also be used as a cryoprotectant. After put-ting the crystal in the paraffin oil, make sure that all excess mother liquor in theparaffin oil drop is removed by passing the crystal back and forth in the paraffinoil. The drop should form a perfectly clear glass under the cold stream. Whitepatches may lead to reduction in resolution and increase mosaicity.

21. Simple freezing of the crystal will result in the formation of ice in the interior ofthe crystal and will render it useless. The cryoprotectant forms a noncrystallineglass, which protects the crystal from freeze shock.

References1. Perutz, M. F., Rossmann, M. G., Cullis, A. F., Muirhead, H., Will, G., and North,

A. C. T. (1960) Structure of haemoglobin. A three-dimensional Fourier synthesisat 5.5Å resolution obtained by x-ray analysis. Nature 185, 416–422.

2. Perutz, M. F., Muirhead, H., Cox, J. M., Goaman, L. C., Mathews, F. S.,McGandy, E. L., and Webb, L. E. (1968) Three-dimensional Fourier synthesis ofhorse oxyhaemoglobin at 2.8 Å resolution: (1) x-ray analysis. Nature 219, 29–32.

3. Perutz, M. F., Muirhead, H., Cox, J. M., and Goaman, L. C. (1968) Three-dimen-sional Fourier synthesis of horse oxyhaemoglobin at 2.8 Å resolution: the atomicmodel. Nature 219, 131–139.

4. Ladner, R. C., Heidner, E. J., and Perutz, M. F. (1977) The structure of horsemethaemoglobin at 2.0 Å resolution. J. Mol. Biol. 114, 385–414.

5. Bolton, W. and Perutz, M. F. (1970) The three dimensional Fourier synthesis ofhorse deoxyhaemoglobin at 2.8 Å resolution. Nature 228, 551, 552.

6. Monod, J., Wyman J., and Changeux J.-P. (1965) On the nature of allosteric tran-sitions: a plausible model. J. Mol. Biol. 12, 88–118.

7. Muirhead, H. and Greer, J. (1970) Three-dimensional Fourier synthesis of humandeoxyhaemoglobin at 3.5 Angstrom units. Nature 228, 516–519.

8. Baldwin, J. and Chothia, C. (1979) Haemoglobin: the structural changes relatedto ligand binding and its allosteric mechanism. J. Mol. Biol. 129, 175–220.

9. Baldwin, J. (1980) The structure of human carbonmonoxy haemoglobin at 2.7 Åresolution. J. Mol. Biol. 136, 103–128.

10. Shaanan, B. (1993) Structure of oxyhaemoglobin at 2.1 Å resolution. J. Mol. Biol.171, 31–59.

11. Silva, M. M., Rogers, P. H., and Arnone, A. (1992) A third quaternary structure ofhuman Hb at 1.7 Å resolution. J. Biol. Chem. 267, 17248–17256.

12. Smith, F. R., Lattman, E. E., and Carter, C. W. Jr. (1991) The mutation β99 Asp-Tyr stabilizes a new composite quaternary state of human Hb. Proteins 10, 81–91.

13. Smith, F. R. and Simmons, K. C. (1994) Cyanomet human Hb crystallized underphysiological condition exhibits the Y quaternary structure. Proteins 18, 295–300.

14. Janin, J.,and Wodak, S. J. (1993) The quaternary structure of carbonmonoxy HbYpsilanti. Proteins 15, 1–4.

15. Rossmann, M. G. and Hodgkin, D. C. (1972) in The Molecular ReplacementMethod (Rossmann, M. G., ed.), Gordon & Breach, New York, pp. 36–38.

18 Safo and Abraham

16. Navaza J. (1994) AMoRe: an automated package for molecular replacement. ActaCrystallogr. D50, 157–163.

17. Luisi, B. F. and Nagai, K. (1986) Crystallographic analysis of mutant humanhaemoglobins made in Escherichia coli. Nature 320, 555, 556.

18. Wireko, F. C., Kellogg, G. E., and Abraham, D. J. (1992) Allosteric modifiers ofhemoglobin. 2. Crystallographic determined binding sites and hydrophobic bind-ing/interaction analysis of novel hemoglobin oxygen effectors. J. Med. Chem. 34,758–767.

19. Brunger, A. T., Adams, P. D., Clore, G. M., et al. (1998) Crystallography & NMRsystem: a new software suite for macromolecular structure determination. ActaCrystallogr. D54, 905–921.

20. Murshudov, G., Vagin, A., and Dodson, E. (1997) Application of maximum like-lihood methods for macromolecular refinement. Acta Crystallogr. D53, 240–255.

21. Perutz, M. F. (1968) Preparation of haemoglobin crystals. J. Crystal Growth 2,54–56.

22. McPherson, A. (1982) Preparation and Analysis of Protein Crystals (McPherson,A., ed.), John Wiley & Sons, New York.

23. Wishner, B. C., Ward, K. B., Lattman, E. E., and Love, W. E. (1975) Crystalstructure of sickle-cell deoxyHb at 5 Å resolution. J. Mol. Biol. 98, 179–194.

24. Harrington, D. J., Adachi, K., and Royer, W. E. Jr. (1997) The high resolutioncrystal structure of DeoxyHb S. J. Mol. Biol. 272, 398–407.

25. Fermi, G., Perutz, M. F., Shaanan, B., and Fourme, R. (1984) The crystal struc-ture of human deoxyHb at 1.7 Å resolution. J. Mol. Biol. 175, 159–174.

26. Kavanaugh, J. S., Rogers, P. H., Case, D. A., and Arnone, A. (1992) High-resolu-tion X-ray study of deoxyhemoglobin Rothschild 37β Trp ∏ Arg: a mutation thatcreates an intersubunit chloride-binding site. Biochemistry 31, 4111–4121.

27. Safo, M. K., Moure, C. M., Burnett, J., Joshi, G. S., and Abraham, D. J. (2001)High resolution crystal structure of deoxy T-state hemoglobin complexed with apotent allosteric effector. Protein Science 10, 951–957.

28. Frier, J. A., and Perutz, M. F. (1977) Structure of human foetal deoxyhaemoglobin.J. Mol. Biol. 112, 97–112.

29. Sutherland-Smith, A. J., Baker, H. M., Hofmann, O. M., Brittain, T., and Baker,E. D. (1998) Crystal structure of a human embryonic haemoglobin: the carbon-monoxy form of Gower II (α2ε2) haemoglobin at 2.9 Å resolution. J. Mol. Biol.280, 475–484.

30. Kavanaugh, J. S., Moo-Penn, W. F., and Arnone, A. (1993) Accommodation ofinsertions in helices: the mutation in hemoglobin Catonsville (Pro 37α-Glu-Thr38α) generates a 3(10) → α bulge. Biochemistry 32, 2509–2513.

31. Vasseur, C., Blouquit, Y., Kister, J., Prome, D., Kavanaugh, J. S., Rogers, P. H.,Guillemin, C., Arnone, A., Galacterose, F., Poyart, C., Rosa, J., and Wajcman, H.(1992) Hemoglobin Thionville: An alpha-chain variant with a substitution of aglutamate for valine at NA-1 and having an acetylated methionine NH2 terminus.J. Biol. Chem. 267, 12,682–12,691.


32. Derewenda, Z., Dodson, G., Emsley, P., Harris, D., Nagai, K., Perutz, M., andReynaud, J.-P. (1990) Stereochemistry of carbon monoxide binding to normaland Cowtown haemoglobins. J. Mol. Biol. 211, 515–519.

33. Huang, Y., Pagnier, J., Magne, P., Bakloute, F., Kister, J., Delaunay, J., Poyart,C., Fermi, G., and Perutz, M. F. (1990) Structure and function of hemoglobinvariants at an internal hydrophobic site: consequences of mutation at the beta 27(B9) position. Biochemistry 29, 7020–7023.

34. Moo-Penn, W. F., Jue, D. L., Johnson, M. H., Olsen, K. W., Shih, D., Jones, R. T.,Lux, S. E., Rodgers, P., and Arnone, A. (1988) Hemoglobin Brockton [β138(H16)Ala → Pro]: an unstable variant near the C-terminus of the b-subunits with normaloxygen-binding properties. Biochemistry 27, 7614–7619.

35. Poyart, C., Bursaux, E., Arnone, A., Bonaventura, J., and Bonaventura, C. (1980)Structural and functional studies of hemoglobin Suresnes (Arg 141α2 → His α2):consequences of disrupting an oxygen-linked anion-binding site. J. Biol. Chem.255, 9465–9473.

36. Anderson, N. L. (1975) Structures of deoxy and carbonmonoxy haemoglobinKansas in the deoxy quaternary conformation. J. Mol. Biol. 94, 33–49.

37. Tame, J. R. H. and Vallone, B. (2000) The structures of deoxy human haemoglo-bin and the mutant Hb Tyra42His at 120 K. Acta Crystallogr. D56, 805–811.

38. Puius, Y. A., Zou, M., Ho, N. T., Ho, C., and Almo, S. C. (1998) Novel water-mediated hydrogen bonds as the structural basis for the low oxygen affinity of theblood substitute candidate rHb(α96Val → Trp). Biochemistry 37, 9258–9265.

39. Harrington, D. J., Adachi, K., and Royer, W. E. Jr. (1997) Crystal structure ofdeoxy-human hemoglobin Gluβ6 → Trp. Implication for the structure and forma-tion of the sickle cell fiber. J. Biol. Chem. 273, 32,690–32,696.

40. Kroeger, K. S. and Kundrot, C. E. (1997) Structures of Hb-based blood substitute:Insights into the function of allosteric proteins. Structure 5, 227–237.

41. Pechik, I., Ji, C., Fidelis, K., Karavitis, M., Moult, J., Brinigar, W. S., Fronticelli,C., and Gilliland, G. L. (1996) Crystallographic, molecular modeling, and bio-physical characterization of the Valineβ67 (E11) → Threonine variant of hemoglo-bin. Biochemistry 35, 1935–1945.

42. Kavanaugh, J. S., Chafin, D. R., Arnone, A., Mozzarelli, A., Rivetti, C., Rossi, G.L., Kwiatkowski, L. D., and Noble, R. W. (1995) Structure and oxygen affinity ofcrystalline desArg141 alpha human hemoglobin A in the T state. J. Mol. Biol.248, 1136–1150.

43. Shih, D. T. B., Luisi, B. F., Miyazaki, G., Perutz, M. F., and Nagai, K. (1993). Amutagenic study of the allosteric linkage of His(HC3)146β in haemoglobin. J. Mol.Biol. 230, 1291–1296.

44. Kavanaugh, J. S., Rogers, P. H., and Arnone, A. (1992) High-resolution X-raystudy of deoxy recombinant human hemoglobins synthesized from β-globins hav-ing mutated amino termini. Biochemistry 31, 8640–8647.

20 Safo and Abraham

Analysis of Hbs by HPLC 21

2

21


Analysis of Hemoglobins and Globin Chainsby High-Performance Liquid Chromatography

Henri Wajcman

1. IntroductionIn recent years, high-performance liquid chromatography (HPLC) has

become a reference method for the study of hemoglobin (Hb) abnormalities.This technique is used in two distinct approaches. The first is quantitativeanalysis of the various Hb fractions by ion-exchange HPLC, which is nowdone in routine hospital laboratories mostly by using fully automated systems.The second is reverse-phase (RP)-HPLC, which is of interest for more special-ized studies (see Note 1).

2. Materials and Methods2.1. Ion-Exchange HPLC Separation of Hbs

Cation-exchange HPLC is the method of choice to quantify normal andabnormal Hb fractions (1–4). This is the method of reference for measuringglycated Hb for monitoring diabetes mellitus. It is also generally used for mea-suring of the levels of HbA2, HbF, and several abnormal Hbs.

According to some researchers, this method could even replace electro-phoretic techniques for primary screening of Hbs of clinical significance (3,5–7)or, at least, should be an additional tool for the identification of Hb variants(8). Automated apparatuses have been developed for large series measurement.I describe the Bio-Rad Variant Hemoglobin Testing System (Bio-Rad, Her-cules, CA), using the β Thalassemia Short program as an example of this typeof equipment.

22 Wajcman

2.1.1. Bio-Rad Variant Hb Testing System

The Bio-Rad apparatus is a fully automated HPLC system, using double wave-length detection (415 and 690 nm). The β Thalassemia Short program is the mostwidely used system for HbA2 and HbF measurements, but other elution meth-ods, including specific columns, buffers, and software, are available from themanufacturer according to the test to perform. This program has been designedto separate and determine, in 5 to 6 min, area percentage for HbA2 and HbFand to provide qualitative determinations of a few abnormal Hbs. Windows ofretention time have been established for presumptive identification of the mostcommonly occurring Hb variants. The β Thalassemia Short program uses a 3.0 ×0.46 cm nonporous cation-exchange column that is eluted at 32 ± 1°C, with aflow rate of 2 mL/min, by a gradient of pH and an ionic strength made of twophosphate buffers provided by the manufacturer. This material and procedurehave been used worldwide in many laboratories over the last several years. Sincerecommendations for experimental procedure are fully detailed by the manufac-turer, I describe only a few additional notes of practical import.

1. Blood is collected on adenine citrate dextrose (ACD).2. Samples for analysis (about 0.2% Hb) are obtained by hemolysis of 20 µL of

blood in 1 mL of a buffer containing 5 g/L of potassium hydrogenophthalate, 0.5 g/Lof potassium cyanide, 2 mL of a 1% solution of saponine, and distilled water.This procedure for sample preparation, which is currently used for HPLC deter-mination of HbA1c, avoids some of the Hb components present in low amounts(about 1%) eluted together with HbF in the HbF retention time window (8).

3. Twenty microliters of hemolysate is applied onto the column for analysis.

Under these experimental conditions an excellent agreement is found betweenchromatographic measurement of HbF, down to 0.2%, and resistance to alkalidenaturation, up to 15% (9). Presumptive identification of the most commonlyoccurring variants (Hb S, HbC, HbE, and HbD Punjab) is made using the reten-tion time windows named S-Window, D-Window, A2-Window, and C-Window,which have been specified by the manufacturer. Aged Hb specimens displaysome degraded products that are eluted in the P2 and P3 windows (e.g., glu-tathione-Hb) (Table 1).

Slight differences in the elution time of the various Hb components areobserved from column to column and from one reagent batch to another, whichshould be taken into account by a program supplied by the manufacturer. Theelution time of an Hb component varies also slightly according to its concen-tration in the sample. For a given column, a more accurate calibration than thatproposed by the manufacturer could be obtained using HbA2 as reference. Theconcentration of this Hb, which varies between narrow limits, prevents signifi-cant modification of its elution time.


Two methods are available for comparing data when the elution time ofHbA2 differs between two runs done with a different column or reagent batch.The first consists of slightly modifying the experimental procedure (tempera-ture or pH) to reproduce exactly the elution times of the previous runs. Thesecond method consists of establishing a normalized retention scale taking asreferences two Hbs eluted within a linear part of the gradient.

The elution patterns of more than 100 variants have been published, but, inmy opinion, these data should be used as a confirmatory test for characteriza-tion of a variant after a careful multiparameter electrophoretic study (8) ratherthan as a primary identification method.

2.1.2. Alternative Methods

When a dedicated machine is not available for Hb analysis, or when the chro-matographic separation is done for “preparative” purposes, alternative techniqueshave to be used. These procedures are suitable for conventional HPLC equip-ment. Several anion-exchange and cation-exchange HPLC columns may be usedfor Hb separation; some are silica based and others are synthetic polymers. Thesemethods have been well standardized for several years (10,11).

PolyCat A (Poly LC, Columbia, MD) is one of the more popular phases forHb separations (6). It consists of 5-µm porous (100-nm) spherical particles ofsilica coated with polyaspartic acid. For analytical purposes, a 5.0 × 0.40 cmcolumn is used; elution is obtained at 25°C with a flow rate of 1 mL/min, bydeveloping in 20 min at pH 6.58 a linear gradient of ionic strength from 0.03 to0.06 M NaCl in a 50 mM Bis-Tris, 5 mM KCN buffer. The presence of KCN isnecessary to convert methemoglobin into cyanmethemoglobin, which displaysion-exchange chromatographic properties similar to those of oxyhemoglobin(see Note 2).

Table 1Analyte Identification Windowa

Analyte name Retention time (min) Band (min) Window (min)

F 1.15 0.15 1.00 -1.30P2 1.45 0.15 1.30-1.60P3 1.75 0.15 1.50-1.90A0 2.60 0.40 2.20-3.30A2 3.83 0.15 3.68-3.98D-window 4.05 0.07 3.98-4.12S-window 4.27 0.15 4.12-4.42C-window 5.03 0.15 4.88-5.18

a Example provided by manufacturer.

24 Wajcman

2.2. HPLC Analysis of Globin Chains

2.2.1. Analysis of HbF Composition (see Note 3)

The solvent system, acetonitrile–trifluororoacetic acid (TFA), which is usedfor RP-HPLC, dissociates the Hb molecule into its subunits and removes theheme group. This method is therefore used to analyze or separate the globinchains. This kind of study may be useful in the investigation of many humanHb disorders. For instance, the determination of HbF composition (Gγ:Aγ ratio)is of interest in several genetic and acquired disorders.

A good separation is obtained between the Gγ and AγI, with most of the RPcolumns by using a very flat acetonitrile gradient. By contrast, it is often muchmore difficult to separate Gγ from AγT, a frequent allele of AγI. Among theprocedures that have been successfully proposed for this analysis, one of themost popular is the RP-HPLC method described by Shelton et al. (12). Theyused a Vydac C4 column (The Separation Group, Hesperia, CA) eluted at aflow rate of 1 mL/min by developing in 1 h a linear gradient from 38 to 42%acetonitrile in 0.1% TFA with detection at 214 nm. Under these conditions, thechains were eluted in the following order: β, α, AγT, Gγ, and AγI. In recent years,a modification introduced in the manufacturing process of this type of column(13) made necessary the use the higher acetonitrile concentrations to elute theγ-chains. Unfortunately, it also resulted in the low resolution of AγT.

2.2.1.1. RP PERFUSION CHROMATOGRAPHY

Perfusion chromatography involves a high-velocity flow of the mobile phasethrough a porous chromatographic particle (14–16). The Poros R1® media(Applied Biosystems, Foster City, CA) used in this technique consists of10-µm-diameter particles. These particles are made by interadhering under afractal geometry poly(styrene-divinylbenzene) leading to throughpores of6000- to 8000-Å-diameter microspheres with short, diffusive 500- to 1000-Å-diameter pores connected to them. As a result, relatively low pressures areobtained under high flow rates. The Poros R1® beads may be considered afimbriated stationary phase having retention properties somewhat similar tothose of a classic C4 support (15). The column (10 × 0.46 cm) is packed on aconventional HPLC machine at a flow rate of 8 mL/min using the Poros self-pack technology® according to the manufacturer’s protocol. More than a thou-sand runs may be performed without alteration of the resolution.

2.2.1.1.1. Sample Preparation

1. Samples containing about 0.1 mg of Hb/mL are obtained by lysis, in 1 mL water(or 5 mM KCN), of 2–5 µL of washed red blood cells (RBCs).

2. Membranes are removed by centrifuging at 6000g for 10 min.


3. According to the HbF level, 20–100 µL of these hemolysates are applied onto thecolumn. To avoid additional chromatographic peaks owing to glutathioneadducts, 10 µL of a 50 mM solution of dithiothreitol in water is added per 100 µLof sample. An in-line stainless steel filter (0.5-µm porosity) needs to be used toprotect the column.

2.2.1.1.2. Equipment. Any conventional HPLC machine can be used. In themethod described here, the analyses were performed on a Shimadzu LC-6HPLC machine equipped with an SCL-6B system controller, an SIL-6Bautoinjector, and a C-R5A integrator (Shimadzu, Kyoto, Japan). A flow rate of3.0–4.5 mL/min was convenient for synchronization of injection, integration,and column equilibration.

2.2.1.1.3. Experimental Procedure (see Note 4). Using a flow rate of 3 mL/min,the various γ-chains are isolated by developing in 9 min a linear gradient from37 to 42% acetonitrile in a 0.1% solution of TFA in water. In practice, this isdone by using two solvents (A: 35% acetonitrile, 0.1% TFA in water; B: 50%acetonitrile, 0.1% TFA in water) and a linear gradient from 15 to 45% B.Before injection, the column is equilibrated by a 10 column volume wash withthe starting solvent, thus allowing completion of a cycle of analysis every 14 min.Elution is followed at 214 nm (wavelength at which double bonds absorb), andthe recorder is set to 0.08 AUFS. Higher flow rates may be used, but the slopeof the gradient will need to be increased in proportion. Keeping the same initialand final acetonitrile concentrations as above, elution is achieved in 6 min at aflow rate of 4.5 mL/min and in 4 min at a flow rate of 6.0 mL/min.

2.2.2. RP-HPLC Analysis of Globin Chains (see Note 5)

Globin chain analysis is also important as an additional test that allows dis-crimination between Hb variants for the identification of structural abnormali-ties. Several RP-HPLC procedures have been proposed (10,14,17,18).

On a conventional HPLC apparatus, a 20 × 0.46 cm column packed withLichrospher 100 RP8 (Merck, Darmstadt, Germany) is used. Samples are pre-pared as described in Subheading 2.2.1.1.1. Elution is obtained at 45°C with aflow rate of 0.7 mL/min using a 90-minute linear gradient of acetonitrile,methanol, and NaCl made by a mixture of two solvents (18). Solvent A con-tains acetonitrile, methanol, and 0.143 M NaCl, pH 2.7 (adjusted by a fewdrops of 1 N HCl), in the proportion of 24, 38, and 36 L/L, respectively. Sol-vent B is made from the same reagents but in the proportion of 55, 6, and 39 L/L,respectively. The gradient starts with 10% B and ends with 70% B. The designof the gradient may be modified according to the machine, the geometry of thecolumn, and the separation to be achieved. Elution can be followed at 214 or280 nm. Globin chains are eluted in the same order as on the Vydac C4 column.

26 Wajcman

A kit for globin chain analysis with similar performance is also commer-cially available from Bio-Rad (ref. 270.0301).

2.2.3. Scaled Up Methods for Chain Separation

For biosynthetic or structural studies, milligram amounts of globin chainsneed to be separated. This can be achieved either by scaling up the RP-HPLCprocedure using semipreparative size columns or by cation-exchange -HPLCdone in the presence of dissociating concentrations of urea.

2.2.3.1. SEMIPREPARATIVE SIZE RP-HPLC COLUMNS

2.2.3.1.1. Samples. Globin solution rather than Hb solution is used. Globinis prepared from a 1% Hb solution obtained by hemolysing washed RBCs indistilled water. Stromas are removed by centrifuging at 6000g for 30 min, andthe globin is precipitated by the acid acetone method. Usually, the sample ismade from 1 to 2 mg of globin dissolved in 250 µL of 0.1% TFA, whichrequires the use of a 500-µL injection loop.

2.2.3.1.2. Chromotographic Procedure. A 240 × 10 mm Vydac C4 column(ref. 214TP510) is used. Elution is obtained by a gradient of acetonitrile in0.1% TFA made by two solvents (solvent A contains 35% acetonitrile andsolvent B 45%). A typical elution program, using a flow rate of 1.2 mL/min,consists of a 10-min equilibration at 35% B, 70 min of a linear gradient from35 to 55% B, 30 min of a linear gradient from 55 to 90% B, and 5 min of anisocratic step at 90% B for cleaning the column. Elution of the column is fol-lowed at 280 nm with a full scale of 0.16 absorbance units (AU).

2.2.3.2. CATION-EXCHANGE HPLC IN PRESENCE OF 6 M UREA

USING A POLYCAT COLUMN

Procedures that are modified from the classic CM cellulose chromatographydescribed by Clegg et al. (19) may be transposed to the HPLC technology (20).The retention capacity of this type of column is higher than that of RP sup-ports, allowing the handling of larger samples. I describe here a method usinga PolyCat 300-Å, 10-µm particle column (150 × 4 mm).

2.2.3.2.1. Reagents and Buffers. Two buffers are used. Buffer A consistsof 6 M urea, 0.1 M sodium acetate, and 0.4% β-mercaptoethanol, with thepH adjusted to 5.8 by acetic acid. Buffer B consists of 6 M urea, 0.25 M sodiumacetate, and 0.35% β-mercaptoethanol, with the pH adjusted to 5.8 by aceticacid. Both buffers need to be filtered through a membrane with 0.45-µmporosity before being used. In addition, an in-line stainless steel filter (0.5-µmporosity) is needed to protect the column.

2.2.3.2.2. Samples. Up to 5–10 mg of globin, prepared by the acid acetonemethod, is dissolved in 200–600 mL of buffer A.


2.2.3.2.3. Chromatographic Procedure. Elution is obtained by a gradient ofionic strength developed with the two buffers. A typical elution program, usinga flow rate of 1.0 mL/min, consists of a 10-min equilibration at 0% B, 5 min ofa linear gradient from 0 to 25% B, 50 min of a linear gradient from 25 to 100%B, and 5 min of an isocratic step at 100% B for cleaning the column. Elution ofthe column is followed at 280 nm with a full scale of 0.32 UA.

3. Notes1. Why should one method be preferred over another? The choice of a separation

method between RP or ion-exchange chromatography depends on the purpose ofthe separation. Ion-exchange is the only chromatographic method that allowspreparation of native Hb fractions. The presence of cyanide ions in the buffers(or during sample preparation) will nevertheless hinder any further oxygen-binding study. If the aim of the separation is to obtain Hbs suitable for functionalstudies, the technique will have to be modified accordingly by removing cyanidefrom all the steps. It may be of interest in some cases to work with carbonmonoxy-hemoglobin, since Hb is very stable under this form and procedures are availableto return to the oxyform. For several applications, salts in excess also need to beremoved. RP separation methods always lead to denatured proteins that cannotbe used for functional studies. Techniques involving an ionic strength gradientcan only be used for analytical purposes. By contrast, using fully volatile buffers,such as the acetonitrile-TFA system, the isolated globin fractions can be vacuumdried and readily used for further structural studies such as mass spectrometrymeasurements.

2. To isolate amounts of Hb in the milligram range, larger columns (15.0 × 0.46 cm)may be used. According to the separation to be achieved, the dimensions of thecolumn, and the apparatus used, slightly different experimental conditions mayhave to be designed. Elution is followed at 415 nm for analytical purposes or at540 nm in preparative runs. This buffer system is not suitable for ultraviolet (UV)detection. The use of an in-line stainless steel filter (0.5-µm porosity) is recom-mended to increase the column life expectancy. Reproducibility requires carefulpreparation of the buffers and temperature control. Since in these chromato-graphic methods the elution is recorded at one of the wavelengths of absorptionof the heme, any factor modifying the absorption spectrum of the Hb moleculewill hinder accurate quantitative measurement. For instance, unstable Hb vari-ants, which lose their heme groups or lead to hemichrome formation, will beunderestimated. HbMs, which are hardly converted into cyanmethemoglobin,display a much higher extinction coefficient than oxyhemoglobin at 415 nm anda lower one at 540 nm. As a consequence, HbMs will be overestimated whenmeasured at the first wavelength, and underestimated at the second one. A modi-fied experimental procedure allowing for a simultaneous measurement of HbF,glycated Hb, and several other Hb adducts has been proposed by using a combi-nation of pH and ionic gradients (11).

28 Wajcman

3. In my laboratory, for routine determination of the γ-chain composition, wereplaced this procedure with an RP perfusion chromatography using a Poros R1®

column (Applied Biosystems) (14).4. To obtain good reproducibility, we recommend using the same glassware for

preparing the solvents. Solvents may be kept refrigerated at 4°C for a few days.Accurate balance of the TFA between both solvents is important to avoid baselinedrift. Acetonitrile must be of HPLC grade with low UV absorbancy in the 210-nmregion. With this Poros R1 column, the α-chain is eluted before the β-chain.Resolution may be improved by modifying the geometry of the column or thedesign of the gradient. A 10 × 0.2 cm column may be used to improve separationbetween the various γ- or adult chains. In this case, with a flow rate of 1 mL/min,after 5 min of equilibration at 5% B, the column is eluted using a 15-min lineargradient between 5 and 25% B of the described solvents. This is followed by a 2-minisocratic elution at 25% B.

5. Several columns may be used, but I have found that a method adapted from thatdescribed in ref. 17 leads to a good resolution. Other columns or techniques maynevertheless be more appropriate for some specific separations. When chromato-graphic methods are used for globin chain quantification, it is important to con-sider the absorption coefficient of the various chains at the wavelength ofdetection. In some cases, it may be identical, such as when comparing the variousγ-chains. In other cases, the absorption may differ considerably; for example, at280 nm, γ-chains, because of their 3 Trp residues, have a higher ε coefficient thanβ-chains (2Trp) and α-chains (1 Trp). Abnormal Hbs containing a number ofaromatic residues different from the normal may also display modified absorp-tion coefficient.

References1. Wilson, J. B., Headlee, M. E., and Huisman, T. H. J. (1983) A new high-perfor-

mance liquid chromatographic procedure for the separation and quantitation ofvarious hemoglobin variants in adults and newborn babies. J. Lab. Clin. Med.102, 174–185.

2. Kutlar, A., Kutlar, F., Wilson, J. B., Headlee, M. E., and Huisman, T. H. J. (1984)Quantitation of hemoglobin components by high-performance cation-exchangeliquid chromatography: its use in diagnosis and in the assessment of cellular dis-tribution of hemoglobin variants. Am. J. Hematol. 17, 39–53.

3. Rogers, B. B., Wessels, R. A., Ou, C. N., and Buffone, G. J. (1985) High-performanceliquid chromatography in the diagnosis of hemoglobinopathies and thalassemias.Am. J. Clin. Pathol. 84, 671–674.

4. Samperi, P., Mancuso, G. R., Dibenedetto, S. P., Di Cataldo, A., Ragusa, R.,and Schiliro, G. (1990) High performance liquid chromatography (HPLC): asimple method to quantify HbC, O-Arab, Agenogi and F. Clin. Lab. Haematol.13, 169–175.

5. Shapira, E., Miller, V. L., Miller, J. B., and Qu, Y. (1989) Sickle cell screeningusing a rapid automated HPLC system. Clin. Chim. Acta 182, 301–308.


6. Ou, C. N. and Rognerud, C. L. (1993) Rapid analysis of hemoglobin variants bycation-exchange HPLC. Clin. Chem. 39, 820–824.

7. Papadea, C. and Cate, J. C. (1996) Identification and quantification of hemoglo-bins A, F, S, and C by automated chromatography. Clin. Chem. 42, 57–63.

8. Riou, J., Godart, C., Hurtrel, D., Mathis, M., Bimet, C., Bardakdjian-Michau, J.,Préhu, C., Wajcman, H., and Galactéros, F. (1997) Evaluation of cation-exchangehigh-performance liquid-chromatography for presumptive identification of hemo-globin variants. J. Clin. Chem. 43, 34–39.

9. Préhu,C., Ducrocq, R., Godart, C., Riou, J., and Galactéros, F. (1998) Determina-tion of HbF levels: the routine methods. Hemoglobin 22, 459–467.

10. Huisman, T. H. J. (1998) Separation of hemoglobins and hemoglobin chains byhigh performance liquid chromatography. J. Chromatogr. 418, 277–304.

11. Bisse, E. and Wieland, H. (1988) High-performance liquid chromatographic sepa-ration of human hemoglobins. Simultaneous quantitation of fetal and glycatedhemoglobins. J. Chromatogr. 434, 95–110.

12. Shelton, J. B., Shelton, J. R., and Schroeder, W. A. (1984) High-performanceliquid-chromatographic separation of globin chains on a large-pore C4 column.J. Liq. Chromatogr. 7, 1969–1977.

13. Vydac. (1994–1995) HPLC columns and separation materials, Technical Bulletin.14. Wajcman, H., Ducrocq, R., Riou, J., Mathis, M., Godart, C., Préhu, C., and

Galacteros, F. (1996) Perfusion chromatography on reversed-phase columnallows fast analysis of human globin chains. Anal. Biochem. 237, 80–87.

15. Afeyan, N. B., Gordon, N. F., Mazsaroff, I., Varady, L., Fulton, S. P., Yang, Y.B., and Regnier, F. E. (1990) Flow-through particles for the high-performanceliquid chromatographic separation of biomolecules: perfusion chromatography.J. Chromatogr. 519, 1–29.

16. Afeyan, N. B., Fulton, S. P., and Regnier, F. E. (1991) Perfusion chromatographymaterial for proteins and peptides. J. Chromatogr. 544, 267–279.

17. Leone, L., Monteleone, M., Gabutti, V., and Amione, C. (1985) Reversed-phasehigh performance liquid chromatography of human hemoglobin chains.J. Chromatogr. 321, 407–419.

18. Wajcman, H., Riou, J., and Yapo, A. P. (2002) Globin Chains Analysis by RP-HPLC:recent developments. Hemoglobin 26, 271–284.

19. Clegg, J. B., Naughton, M. A., and Weatherall, D. J. (1966) Abnormal humanhemoglobins: separation and characterization of the a and b chains by chromatog-raphy, and the detereminatioin of two new variants, Hb Chesapeake and Hb J(Bangkok) J. Mol. Biol. 19, 91–108.

20. Brennan, S. O. (1985) The separation of globin chains by high pressure cationexchange chromatography. Hemoglobin 9, 53–63.

30 Wajcman

Purification and Molecular Analysis of Hb by HPLC 31

3

31


Purification and Molecular Analysis of Hemoglobinby High-Performance Liquid Chromatography

Belur N. Manjula and Seetharama A. Acharya

1. IntroductionHemoglobin (Hb) is a tetrameric protein (mol wt = 64,500) and is the major

protein component of red blood cells (RBCs). In normal human erythrocytes,HbA composes about 90% of the total Hb. It is made up of two identical α-chainsand two identical β-chains. Besides HbA, human erythrocytes contain smallamounts of other forms of Hb as fetal hemoglobin (HbF, α2γ2) and HbA2 (α2δ2),and products of posttranslational modifications as HbA1c. HbS, the sickle cellHb, is a genetic variant of HbA and is the most widely studied pathologicalform of Hb (1).

Hb is a subject of active research not only for its molecular, genetic, andclinical aspects, but also as a prototype of allosteric proteins. Purification andcharacterization of Hbs has become easier and faster with the advent of high-pressure and high-performance instrumentation, high-sensitivity detectors, andthe availability of a wide variety of high-resolution column-packing materials.Methodological development using very small quantities of the protein is fea-sible, and the analytical methods are readily scalable. Here, we describe threedifferent modes of high-performance liquid chromatography (HPLC) that areused in our laboratory for the purification and characterization of Hb, and modi-fied or mutant Hb.

Hb is purified by ion-exchange chromatography (IE-HPLC), its size is ana-lyzed by size-exclusion chromatography (SEC-HPLC) (under native and dis-sociating conditions), its globin chain separation is accomplished by reversephase HPLC (RP-HPLC), and tryptic peptide mapping of globin chains is alsocarried out by RP-HPLC. Preparative runs are generally carried out on an

32 Manjula and Acharya

AKTA Protein Purification System (Amersham Pharmacia Biotech), which isalso used for analytical runs. Other instrumentation used for the analytical runsincludes a fast protein liquid chromatography (FPLC) system (AmershamPharmacia Biotech) for SEC and ion-exchange chromatography, and aShimadzu Liquid Chromatography System for RP-HPLC. Examples of ion-exchange chromatographic purifications are given for analytical-scale runs(100 µg to 1 mg), small-scale preparative runs (up to 50 mg), and large-scalepreparative runs (up to 3 g). The analytical-scale runs are useful not only formethodological development, but also for characterization purposes and formonitoring the progress of a chemical modification reaction. The SEC-HPLCruns are illustrated with analytical (1 mg) and semipreparative runs (100 mg).Examples of RP-HPLC are for analytical-scale runs (120 µg).

2. Materials2.1. Purification of Human Hb by Ion-Exchange Chromatography(see Notes 1 and 2)

2.1.1. Anion-Exchange Chromatography

2.1.1.1. PURIFICATION OF HB ON DEAE-SEPHAROSE FAST FLOW: SMALL-SCALE

PURIFICATION (SEE NOTES 1 AND 2)

1. XK 16/10 chromatographic: column (Amersham Pharmacia Biotech).2. DEAE-Sepharose Fast Flow anion exchanger: (Amersham Pharmacia Biotech).3. Buffer A: 50 mM Tris-Ac, pH 8.5.4. Buffer B: 50 mM Tris-Ac, pH 7.0.5. Amersham Pharmacia Biotech AKTA Protein Purification System.

2.1.1.2. PREPARATIVE-SCALE PURIFICATION OF HB ON Q-SEPHAROSE HIGH

PERFORMANCE CHROMATOGRAPHIC COLUMN

1. XK26/70 column (Amersham Pharmacia Biotech) (see Notes 1 and 2).2. Q-Sepharose High Performance column-packing material (Amersham Pharmacia Biotech).3. Buffer A: 50 mM Tris-Ac, pH 8.5.4. Buffer B: 50 mM Tris-Ac, pH 7.0.5. Amersham Pharmacia Biotech AKTA Protein Purification System.

2.1.1.3. CATION-EXCHANGE CHROMATOGRAPHY: RECHROMATOGRAPHY

OF Q-SEPHAROSE HIGH PERFORMANCE PURIFIED HBAON CM-SEPHAROSE FAST FLOW

1. XK26/70 chromatographic column (Amersham Pharmacia Biotech).2. CM-Sepharose Fast Flow cation exchanges (Amersham Pharmacia Biotech).3. Buffer A: 10 mM potassium phosphate, pH 6.35, 1 mM EDTA.4. Buffer B: 15 mM potassium phosphate, pH 8.5, 1 mM EDTA.5. Amersham Pharmacia Biotech AKTA Protein Purification System.


2.2. Ion-Exchange Chromatography as an Analytical Tool2.2.1. Characterization of Recombinant Hb by Cation-ExchangeChromatography on a Mono S Column

1. Mono S HR5/5 column (1 mL) (Amersham Pharmacia Biotech) (see Notes 3and 4).

2. Buffer A: 10 mM potassium phosphate, pH 6.5.3. Buffer B: 15 mM potassium phosphate, pH 8.5.4. Pharmacia FPLC protein purification system.5. Shimadzu UV-VIS detector at 540 nm.6. Shimadzu Chromatopac CR7A plus data processor.

2.2.2. Monitoring Progress of a Chemical Modification ReactionAnalysis of Amidated HbS by Analytical Anion-ExchangeChromatography on HiTrap Q Column

1. HiTrap Q, 1 mL column (Amersham Pharmacia Biotech) (see Note 3).2. Buffer A: 50 mM Tris-Ac, pH 8.5.3. Buffer B: 50 mM Tris-Ac, pH 7.0.4. Amersham Pharmacia Biotech AKTA Protein Purification System.

2.3. SEC of Hb2.3.1. Analytical SEC

1. Pharmacia Superose 12 HR 10/30, two columns in series (column volume [CV],47 mL) (see Note 4).

2. Buffer: 50 mM Bis-Tris (pH 7.4) or phosphate-buffered saline (PBS), pH 7.4, foranalysis of tetrameric and size-enhanced Hbs; 50 mM Bis-Tris and 0.9 M MgCl2(pH 7.4), for evaluating the stabilization of the tetrameric structure of Hb.

3. Pharmacia FPLC Protein Purification System.4. Detector: Shimadzu UV-VIS detector at 540 nm.5. Shimadzu CR7A plus data processor.

2.3.2. Semipreparative SEC

1. Pharmacia XK26/70 column.2. Superose 12 prep-grade packing material (Pharmacia).3. Buffer: PBS, pH 7.4.4. Pharmacia Biotech AKTA Protein Purification System.

2.4. Globin Chain Analysis of Hb by RP-HPLC Analysis1. Column: Vydac Protein C4 column (4.6 × 250 mm).2. Solvent A: H2O, 0.1% trifluoroacetic acid (TFA).3. Solvent B: acetonitrile, 0.1% TFA.4. Shimadzu Liquid Chromatography System consisting of two LC-6A pumps, an

SPD-6A UV detector, an SCL-6B System Controller, and Class VP chromatog-raphy software.


3. Methods3.1. Purification of Human HbA by Ion-Exchange Chromatography

HbA is purified from erythrocytes obtained from adult human blood. Theerythrocytes are gently washed with cold PBS, pH 7.4, and lysed with 4 vol-umes of water. The lysate containing the Hb is separated from the cell debrisby centrifugation. The lysate is dialyzed extensively against PBS, pH 7.4, tostrip the protein of 2,3-diphosphoglycerate.

Because Hb can exist as an anion or a cation, depending on buffer condi-tions, it can be purified by either anion- or cation-exchange chromatography,or a combination of the two. Routinely, the erythrocyte lysate is first purifiedon a Q-Sepharose High Performance column or on a DEAE-Sepharose FastFlow column followed by a second chromatography on a CM-Sepharose FastFlow column. All purifications are carried out at 4°C.

3.1.1. Anion-Exchange Chromatography

3.1.1.1. PURIFICATION OF HB ON DEAE-SEPHAROSE FAST FLOW: SMALL-SCALE

PURIFICATION

A typical elution profile of a human RBC lysate (25 mg of human RBClysate injected in 500 µL of buffer A) is shown in Fig. 1. This represents ananalytical-scale run of the same sample for which a preparative run is given inSubheading 3.1.1.2. on a Q-Sepharose High Performance column (Fig. 2).Runs like this are useful for the evaluation of the run conditions prior to pre-parative runs. The total run time is 5 h 6 min, the total volume is ~612 mL, andthe gradient time/volume is 2 h/240 mL.

1. Pack the column (1.6 cm × 6 cm, CV = 12 mL) according to the manufacturer’sdirections.

2. Wash the column with 1 CV each of water, buffer A, and buffer B.3. Equilibrate the column with 10–25 CV of buffer A at a flow rate of 2 mL/min.4. Inject the sample and wash the column with 1 CV of buffer A to elute unbound

protein.5. Elute the bound protein with a linear gradient of 0–100% buffer B in 20 CV.6. Monitor the column effluent at 540, 600, and 630 nm (see Note 5).7. Clean the column with 10 CV of buffer B.8. Reequilibrate with 20 CV of buffer A.

3.1.1.2. PURIFICATION OF HB ON Q-SEPHAROSE HIGH PERFORMANCE:PREPARATIVE RUN

A typical chromatographic profile of a human erythrocyte lysate (load: ~40 mLcontaining ~3 g of Hb) is shown in Fig. 2. The protein eluting at 1500 mL(~65% buffer B) corresponds to HbA. The fractions corresponding to this peak


are pooled, concentrated, and subjected to further purification by cation-exchange chromatography on a CM-Sepharose Fast Flow column (Subhead-ing 3.1.2.). The following run takes about 25 to 26 h.

1. Pack the Q-Sepharose High Performance ion-exchange column at 4°C in aPharmacia XK26/70 column according to the manufacturer’s directions. Typi-cally, a 2.6 × 58 cm column (~290-mL column volume) is used for the purifica-tion of 2.5–3 g of Hb.

2. Wash the column first with 1 CV of water, followed by 1 to 2 CV each of 20%buffer B and 100% buffer B.

3. Equilibrate the column with at least 10 CV of 20% buffer B, at a flow rate of1.5 mL/min.

4. Dialyze the red cell lysate extensively against 20% buffer B, and filter through a0.2-µm filter.

5. Load the lysate onto the column manually using line A18 of Pump A.6. Elute the protein with a linear gradient of decreasing pH consisting of 20–100%

buffer B in 8 column volumes (2320 mL).7. Monitor the column effluent simultaneously at three wavelengths; 540, 600, and

630 nm (see Note 5).

Fig. 1. Small-scale anion-exchange chromatography of human red cell lysate on aDEAE-Sepharose Fast Flow column (1.6 × 6 cm) at 4°C. Buffer A: 50 mM Tris-Ac,pH 8.5; buffer B: 50 mM Tris-Ac, pH 7.0. The column was equilibrated with buffer A,and a decreasing pH gradient of 0–100% buffer B over 20 CV was used for elution ofthe protein. Protein load: 25 mg.


3.1.2. Rechromatography of Q-Sepharose High Performance PurifiedHbA on a CM-Sepharose Fast Flow Column

A typical chromatographic profile is shown in Fig. 3. The protein eluting at1960 mL (~78% buffer B) corresponds to HbA. Pool the HbA-containing frac-tions, concentrate in an Amicon stirred cell to a concentration of 64–128 mg/mL,dialyze against the buffer of choice, and store either in liquid nitrogen or at –80°C.

1. Dialyze the HbA obtained from the Q-Sepharose High Performance column(~1.3 g in 60 mL) against 10 mM potassium phosphate buffer; 1 mM EDTA,pH 6.35 (see Note 6).

2. Load the dialyzed HbA on the CM-Sepharose Fast Flow column (2.6 cm × 59 cm),preequilibrated with the same buffer. The large sample volume is not a consider-ation, since the protein binds to the column at the initial conditions. Up to 3 g of Hbcan be purified on a 2.6 × 59 cm column.

3. Elute the protein with a linear gradient of increasing pH, consisting of 0–100%buffer B over 8 column volumes (~2500 mL).

Fig. 2. Preparative-scale anion-exchange chromatography of human red cell lysateon Q-Sepharose High Performance column (2.6 × 58 cm) at 4°C. Buffer A: 50 mMTris-Ac, pH 8.5; buffer B: 50 mM Tris-Ac, pH 7.0. The column was equilibrated with20% buffer B, and a decreasing pH gradient of 20–100% buffer B over 8 CV was usedfor elution of the protein. Protein load: 3.0 g; fraction size: 20 mL.


3.2. Ion-exchange Chromatography as an Analytical Tool

3.2.1. Characterization of HbA Expressed in Transgenic Swine byCation-Exchange Chromatography on a Mono S Column

The ion-exchange chromatographic procedures are also valuable as fast tech-niques for the analysis of Hb variants and recombinant hemoglobins. The elu-tion positions are dependent on the surface topology of the Hb. The Mono Scolumn (Amersham Pharmacia Biotech) distinguishes between the correctlyfolded and misfolded forms of recombinant HbA (rHbA) (2–4). Adachi et al.(2) have reported that the rHbA obtained from their yeast expression systemcontains a misfolded form of HbA in addition to the correctly folded form. Themisfolded and the correctly folded forms of rHbA exhibit distinct elution posi-tions on a Mono S column. Studies by Shen et al. (3,4) have shown that rHbAcontaining incorrectly inserted heme can be resolved from the species contain-ing the correctly inserted heme on a Mono S column. In our studies, the chro-matographic profile of the transgenic swine HbA on a Mono S column isidentical to that of wild-type HbA (Fig. 4), which, in conjunction with NMR

Fig. 3. Repurification of HbA purified on Q-Sepharose High Performance column(see Fig. 2) by cation-exchange chromatography on a CM-Sepharose Fast Flow col-umn (2.6 × 59 cm) at 4°C. Buffer A: 10 mM potassium phosphate, 1 mM EDTA, pH6.35; buffer B: 15 mM potassium phosphate, 1 mM EDTA, pH 8.5. The column wasequilibrated with buffer A and an increasing pH gradient of 0–100% buffer B over8 CV was used for elution of the protein. Protein load: ~1.3 g; fraction size: 12 mL. Theeffluent was monitored at 540, 600, and 630 nm. Elution profile for 540 nm is shown.


and functional studies (5), has established the absence of misfolded forms inthis preparation.

1. Equilibrate the Mono S column with 10 mM potassium phosphate, pH 6.5 (buffer A),at a flow rate of 1 mL/min.

2. Inject 1 mg of the HbA or TgHbA in 25 µL of buffer A.3. Wash the column with 2 CV of buffer A.4. Elute the protein with a linear increasing pH gradient consisting of 0–100% buffer

B over 45 CV.5. Monitor the column effluent at 540 nm.6. Regenerate the column in situ by washing first with ~5 CV of 100% buffer B

followed by reequilibration with 25 CV of buffer A (0% buffer B).

Fig. 4. Comparison of elution profiles of wild-type HbA and HbA expressed intransgenic swine, on a Mono S HR5/5 column. The flow rate was 1 mL/min. Proteinload: 1 mg. Buffer A: 10 mM potassium phosphate, pH 6.5; buffer B: 15 mM potas-sium phosphate, pH 8.5. After injection of the protein, the column was washed with2 CV of buffer A, and the bound protein was eluted with a linear gradient consisting of0–100% buffer B over 45 CV. The effluent was monitored at 540 nm.


3.2.2. Monitoring Progress of a Chemical Modificattion Reaction:Analysis of Amidated HbS by Analytical Anion-ExchangeChromatography on HiTrap Q

3.2.2.1. PREPARATION OF AMIDATED HBS

HbS was amidated with ethanolamine, through a carbodimide and sulfo-N-hydroxy-succinimide-mediated reaction, according to the previously describedprocedures (6,7).

3.2.2.2. CHROMATOGRAPHY OF AMIDATED HBS ON HITRAP Q COLUMN

The chromatographic profile of an HbS preparation amidated with ethanola-mine is illustrated in Fig. 5. As can be seen, the amidated HbS can be separatedwell from the unreacted HbS. Thus, this profile illustrates the feasibility ofestablishing conditions for the separation of modified and unmodified HbSusing small amounts of the protein and within a short period of time. Proteinloads as little as 100 µg are sufficient for such runs. Thus, these columns arehighly useful for methodological development as well as for monitoring thetime course of a protein modification reaction.

Fig. 5. Chromatography of amidated HbS on a 1-mL HiTrap Q column at roomtemperature. Buffer A: 50 mM Tris-Ac, pH 8.5; buffer B: 50 mM Tris-Ac, pH 7.0. Thecolumn was equilibrated with 10% buffer B. The column was washed with 5 CV of10% buffer B after injection of the sample, and a decreasing pH gradient of 0–100%buffer B over 20 CV was used for elution of the protein. Protein load: 1 mg. Theeffluent was monitored at 540 nm.


Total run time is 60 min, total volume is ~60 mL, and sample run time/volume is 25 min/25 mL.

1. Equilibrate the column with 10% buffer B, at a flow rate of 1 mL/min.2. Inject a sample of 1 mg of HbS amidated with ethanolamine, and wash the col-

umn with 5 CV of 10% buffer B.3. Elute the protein with a gradient of 10–100% buffer B in 20 CV.4. Monitor the column effluent at 540 nm.5. Regenerate the column in situ by washing first with 10 CV of 100% buffer B,

followed by reequilibration with 25 CV of 10% buffer B.

3.3. SEC of Hb

Three applications of SEC on Pharmacia Superose 12 are described; twoapplications are at an analytical level and the third is at a preparative level.

3.3.1. Analytical SEC

3.3.1.1. ESTABLISHING STABILIZATION OF TETRAMERIC STRUCTURE OF HB

BY INTERDIMERIC (I.E., INTRATETRAMERIC) CROSSLINKING

The samples are generally injected in a volume of 25 µL. Since the SEC runsare under isocratic conditions, unlike the ion-exchange columns, no columnregeneration step is necessary. Once the protein is eluted from the column andthe baseline is stable, the column is ready for the analysis of the next sample.The run time for HbA is approx 70 min. Thus, it is possible to analyze severalsamples during the course of a working day.

Under nondenaturing conditions, SEC analysis of Hb serves as a highly use-ful tool to establish the tetrameric structure and to analyze polymeric forms ofHb. In the presence of 0.9 M MgCl2, Hb dissociates into its constituent dimers(8). However, if the like chains are crosslinked, then the tetrameric structure isstabilized and the protein elutes as a tetramer. Thus, SEC analysis under disso-ciating conditions is a valuable tool to monitor the stabilization of the tetramericstructure of Hb by interdimeric (i.e., intratetrameric) crosslinking. These twomodes of the SEC analyses are illustrated in Fig. 6A and 6B, from an analysisof HbA reacted with the bifunctional maleimide, bis-maleidophenyl PEG2000(Bis-Mal-PEG2000) (9).

SEC analysis of Bis-Mal-PEG2000-reacted HbA in 50 mM Bis-Tris-Ac,pH 7.4, a low-ionic-strength buffer, revealed that >95% of the protein elutes inthe same position as the tetrameric HbA, and only a trace amount is present asan octameric species (Fig. 6A). By contrast, SEC analysis of the same Bis-Mal-PEG2000-reacted HbA preparation on the same Superose 12 column butin the presence of 0.9 M MgCl2 revealed that nearly all of the Bis-Mal-PEG2000-reacted HbA still elutes at the 64,000-Dalton position (Fig. 6B, upper


panel), whereas the control HbA is completely dissociated into its constituentαβ dimers (Fig. 6B, lower panel). Thus, SEC analyses establish the stabiliza-tion of the tetrameric structure of HbA by intramolecular crosslinking withBis-Mal-PEG2000.

3.3.1.1.1. SEC Analysis in 50 mM Bis-Tris-Ac, pH 7.4:Nondenaturing Conditions

1. Equilibrate the column with 50 mM Bis-Tris-Ac, pH 7.4, at a flow rate of0.5 mL/min.

2. Inject the sample.3. Elute the column with 50 mM Bis-Tris-Ac, pH 7.4.

Fig. 6. SEC of Bis-Mal-PEG2000-reacted HbA on Superose 12 at room tempera-ture. Two Superose 12 HR 10/30 columns connected in series were used. (A) the bufferused was 50 mM Bis-Tris-Ac, pH 7.4; (B) the buffer used was 50 mM Bis-Tris-Ac,0.9 M MgCl2, pH 7.4. For both (A) and (B) the flow rate was 0.5 mL/min, the proteinload was 800 µg and the effluent was monitored at 540 nm (see Note 7).


3.3.1.1.2. SEC Analysis in 50 mM Bis-Tris-Ac; 0.9 M MgCl2, pH 7.4:Denaturing Conditions

1. Equilibrate the column with 2 CV of 50 mM Bis-Tris-Ac, 0.9 M MgCl2 (pH 7.4)at a flow rate of 0.5 mL/min.

2. Inject the sample.3. Elute the column with 50 mM Bis-Tris-Ac, 0.9 M MgCl2, pH 7.4.

3.3.1.2. DETERMINING HYDRODYNAMIC VOLUME OF SIZE-ENHANCED HBS

Conjugation of large nonprotein molecules like PEG increases the hydrody-namic volume of the protein. SEC analysis serves as a useful tool to determinethe increase in the hydrodynamic volume of Hb as a function of the chain lengthof the conjugated PEG molecule, and as a function of the number of PEG chainsconjugated to the protein.

3.3.1.2.1. Preparation of PEGylated Hb

HbA in PBS, pH 7.4, is reacted with maleidophenyl derivatives of PEG5000, PEG 10000, and PEG 20000 (unpublished). This results in the surfacedecoration of HbA at its two β93 cysteines. Homogeneous preparations of Hbcarrying two copies of PEG 5K, 10K, and 20K were isolated by ion-exchangechromatography.

3.3.1.2.2. SEC Analysis

SEC analysis of the PEGylated Hbs is carried out on an analytical Superose12 column, equilibrated and eluted with PBS, pH 7.4, as described in Sub-heading 3.3.1.1. The results are shown in Fig. 7. The PEGylated HbAs eluteearlier than HbA on the Superose 12 column. The actual molecular mass ofthe three surface-decorated HbAs carrying two PEG chains of 5, 10, and 20 kDais 74, 84, and 104 kDa, respectively. Thus, no resolution among three sur-face-decorated HbAs can be expected on the Superose 12 column based onthe differences in their actual mass. Nevertheless, the three PEGylated HbAsare well resolved from each other, indicating an apparent increase in theirsize. The retention time of the PEGylated HbA decreases with the increase inthe length of the attached PEG chain, indicating a progressive increase in theapparent size of HbA on surface decoration with PEG molecule of increasingchain length. Intertetrameric crosslinking of HbA with Bis-Mal-PEG600results in the formation of defined oligomeric forms of HbA with molecularweights that are multiples of 64 kDa (see Subheading 3.3.2. for an exampleof a preparative run). Comparison of the retention times of surface-decoratedHbAs with those of oligomerized HbAs indicated that the size enhancementis a linear function of the mass of the PEG chains attached and is approx 8 to10 times that anticipated based on the actual molecular size of the attachedPEG chain.


3.3.2. Semi-Preparative SEC: Purification of Oligomeric Forms of Hb

SEC can also be used in a preparative mode for the purification of Hb basedon its size. In the example shown here, HbA, stabilized against dissociation byintratetrameric crosslinking, was oligomerized by intertetrameric crosslinkingwith Bis-Mal-PEG600, and the products of the reaction were separated by SECon a semipreparative Superose 12 column. A typical chromatographic profileis shown in Fig. 8. Reanalysis of the fractions from this run on an analyti-cal column confirmed that the fractions eluting at the peak positions of204, 182, and 169 mL represent tetrameric, octameric, and dodecamericHb, respectively. Fractions containing the respective oligomeric forms ofHb are pooled, concentrated, and further purified by rechromatography onthe same Superose column.

1. Equilibrate a semipreparative column of Superose 12 (2.6 × 65 cm, CV = 325 mL)with 2 to 3 CV of PBS, pH 7.4, at a flow rate of 1 mL/min.

2. Load ~100 mg of protein in 1 mL of PBS, pH 7.4.3. Elute the column with PBS, pH 7.4.

3.4. Globin Chain Analysis of Hb by RP-HPLC Analysis

The globin chains of Hb can be separated by RP-HPLC (10,11). Thus,RP-HPLC analysis is a useful technique for determining the purity of an HbA

Fig. 7. Comparison of hydrodynamic volumes of PEGylated HbAs by SEC onSuperose 12 at room temperature. Two Superose 12 HR 10/30 columns connected inseries were used. Elution buffer: PBS, pH 7.4; flow rate: 0.5 mL/min; protein load:800 µg in each case.


preparation; identifying of the chain modified after a chemical reaction; andisolating of the globin chains for peptide mapping, mass analysis, amino acidanalysis, and sequencing

A comparison of the RP-HPLC profiles of HbA and Bis-Mal-PEG2000-reacted HbA is shown in Fig. 9. This result shows that the β-chains of HbA arecompletely modified after reaction with Bis-Mal-PEG2000. The modifiedβ-globin eluted as a distinct peak, after the α-chain. Thus, RP-HPLC analysisis a useful tool to identify the globin chain modified after a chemical modifica-tion reaction.

The globin chains can be isolated for mass analysis and peptide mappingto identify the location of the modification on the polypeptide chain. Forsuch applications, a semipreparative C4 column (10 × 250 cm) is used. Oneto two milligrams of Hb can be applied on the semipreparative column. Aflow rate of 2 mL/min and the same gradient as for the analytical run can beemployed. The fractions containing the separated globin chains are collected,and the solvent is removed either in a Speedvac or by lyophilization. Peptide

Fig. 8. Purification of intertetramerically crosslinked HbA on a semipreparativeSuperose 12 column (2.6 × 65 cm) at 4°C. Elution buffer: PBS, pH 7.4; flow rate:1 mL/min; protein load: ~100 mg in 1 mL of PBS, pH 7.4; fraction size: 1.5 mL.The effluent was monitored at 540 nm.


mapping of the globin chains is carried out by RP-HPLC on a Vydac C18column (12).

1. Equilibrate a Vydac C4 column with 35% acetonitrile, 0.1% TFA at a flow rateof 1 mL/min.

2. Mix 10–100 µL of HbA (50–150 µg) with 1 mL of 0.3% TFA in a 1.5 mL microfugetube, vortex, and centrifuge at 12,000 rpm for 4 min to clarify the sample.

3. Inject the supernatant onto the column.4. Elute the globin chains with a linear gradient of 35–50% acetonitrile, 0.1% TFA

in 100 min.5. Monitor the effluent at 210 nm.6. Regenerate the column in situ by washing with 100% acetonitrile, 0.1% TFA for

15 min, followed by reequilibration with 35% acetonitrile, 0.1% TFA (about 30 min).

Fig. 9. RP-HPLC analysis of globin chains of Bis-Mal-PEG2000-reacted HbA ona Vydac C4 column (4.6 × 250 mm, 300 °A). Solvent A: water, 0.1% TFA; solventB: acetonitrile, 0.1% TFA. The column was equilibrated with 35% solvent B, and alinear gradient of 35–50% solvent B in 100 min was employed for the elution. Flowrate: 1 mL/min. The effluent was monitored at 210 nm.


4. Notes1. The DEAE-Sepharose Fast Flow, the Q-Sepharose High Performance, and the

CM-Sepharose Fast Flow columns described here were run using an AmershamPharmacia Biotech AKTA Protein Purification System. However, these runs canalso be carried out on other chromatography systems such as the Pharmacia FPLCsystem or even by conventional techniques using a peristaltic pump and a two-chamber gradient system.

2. The Fast Flow resins have greater mechanical strength than the cellulose-basedresins and thus permit higher flow rates. Hence, the run can be completed withina much shorter duration than the Whatman cellulose ion exchangers. In theexamples shown, the run time on the Q-Sepharose High Performance and theCM-Sepharose Fast Flow ion exchangers is approximately one-third that on cor-responding cellulose-based ion-exchange columns. The High Performance andthe Fast Flow ion exchangers can be regenerated and reequilibrated within thecolumn after each run, and the columns can be reused for several runs.

3. Typically, for the analytical- and small-scale ion-exchange columns, the columncleaning and reequilibration steps are programmed as part of the method. Depend-ing on the length of the gradient, the run time for a 1-mL column can vary from30 to 60 min. Thus, these procedures permit evaluation of several run conditionswithin a short period of time, utilizing only small quantities of protein (as little as100 µg of protein per run).

4. Care in the solvent and sample preparation is a crucial step especially for thehigh-pressure columns such as Mono S and Superose 12 HR 10/30. Routinely, allbuffers are freshly prepared and filtered through a 0.2-µm filter. Larger samplesare also filtered through a 0.2 µm-filter prior to loading on the column. Smaller-volume samples for the Mono S, HiTrap, and analytical Superose 12 are clarifiedby centrifuging in a microfuge at 12,000 rpm for 4 min.

5. The AKTA Protein Purification System permits simultaneous monitoring of theeffluent at three wavelengths. Routinely, all the Hb purifications are monitored at540, 600, and 630 nm. Monitoring at 600 nm is useful in cases in which theabsorbance at 540 nm is too high, and monitoring at 630 nm is useful for thedetermination of the relative amounts of met-Hb in the column fractions.

6. Since the starting pH for the CM-Sepharose Fast Flow column is <7.0, there is anincreased possibility of the formation of methemoglobin (MetHb). Therefore, 1 mMEDTA is included in all the buffers to minimize this formation.

7. For analytical SEC runs, 800 µg of Hb (25 µL of a 0.5 mM solution) is used. Atlower concentrations of Hb, attention should be paid to the tetramer-dimer equi-librium. In fact, Manning et al. (13) have described the utility of high-resolutionSEC for the determination of dimer-tetramer equilibrium.

AcknowledgmentsThis work was supported by National Institutes of Health Grants HL-38665,

HL-55435, HL-58512, and HL-58247 and a grant-in-aid from the AmericanHeart Association Heritage Affiliate.


References1. Bunn, F. H. and Forget, B. G. (1986) Hemoglobin: Molecular, Genetic and Clini-

cal Aspects, W. B. Saunders, Philadelphia, PA.2. Adachi, K., Konitzer, P., Lai, C. H., Kim, J., and Surrey, S. (1992) Oxygen bind-

ing and other physical properties of human hemoglobin made in yeast. Prot. Eng.5, 807–810.

3. Shen, T.-J., Ho, N. T., Simplaceanu, V., Zou, M., Green, B. M., Tam, B. F., andHo, C. (1993) Production of unmodified human adult hemoglobin in Escherchiacoli. Proc. Natl. Acad. Sci. USA 90, 8108–8112.

4. Shen T-J., Ho, N. T., Zou M, Sun D. P., Cottam, P. F., Simplaceanu V., Tam, M.F., Bell, J. D. A., and Ho, C. (1997) Production of human normal adult and fetalhemoglobins in Escherichia coli. Prot. Eng. 10, 1085–1097.

5. Manjula B. N., Kumar RA, Sun D.P, Ho, N. T., Ho, C., Rao, M. J., Malavalli, A.,and Acharya, A. S. (1997) Correct assembly of human normal adult hemoglobinwhen expressed in trangenic swine: chemical, conformational and functionalequivalence with the human-derived protein. Prot. Eng. 11, 583–588.

6. Rao, M. J. and Acharya, A. S. (1994) Amidation of basic carboxyl groups ofhemoglobin. Methods Enzymol. 231, 246–267.

7. Perumalsamy, K., Manjula, B. N., Bookchin, R. M., and Acharya, A. S. (1998)Chemistry of the microenvironment of Glu-43(β) of deoxyhemoglobin S probedby amidation. Blood 92, 11a.

8. Macleod, R. M. and Hill, R. J. Demonstration of the hybrid hemoglobin Z A A S.(1970) J. Biol. Chem. 245, 4875–4879.

9. Manjula, B. N., Malavalli, A., Smith P. K., Chan, N.-L., Arnone, A., Friedman, J.M., and Acharya, A. S. (2000) Cys-93-ββ-succinimidophenyl polyethylene gly-col 2000 hemoglobin A. J. Biol. Chem. 275, 5527–5534.

10. Schroeder, W. A., Shelton, J. B., Shelton, J. R., Huynh, V., and Teplov, D. B.(1985) Hemoglobin 9, 461–482.

11. Shelton, J. B., Shelton, J. R., and Schroeder, W. A. (1984) High performanceliquid chromatographic separation of globin chains on a large-pore C4 column.J. Liq. Chromatogr. 7, 1969–1977.

12. Rao, M. J., Schneider, K., Chait, B. C., Chao, T. L., Keller, H. L., Anderson, S.M., Manjula, B. N., Kumar, R. A., and Acharya, A. S. (1994) Recombinant hemo-globin A produced in transgenic swine: structure equivalence with human hemo-globin A. Artif. Cells, Blood Substitutes Immobil. Biotechnol. 22, 695–700.

13. Manning, L. R., Jenkins, W. T., Hess, J. R., Vandegriff, K. D., Winslow, R. M.,and Manning J. M. (1996) Subunit dissociations in natural and recombinant hemo-globins. Protein Sci. 5, 775–781.

O2 Equilibrium Measurements of RBCs 49

4

49


Oxygen Equilibrium Measurementsof Human Red Blood Cells

Jean Kister and Henri Wajcman

1. Introduction1.1. When and Why Blood Oxygen Affinity Should be Measured

From a medical viewpoint, the aim of blood oxygen affinity measurement isto determine whether the oxygen binding properties of red blood cells (RBCs)are normal or not. If abnormal, there may be several reasons. One is an abnor-mality of the hemoglobin (Hb) itself. A second, more frequent reason, is ametabolic defect (or status) leading to change in the intraerythrocytic concen-tration of 2,3-diphosphoglycerate (DPG). Some toxic mechanisms may alsolead to compounds with modified oxygen-binding properties such as meth-emoglobin (MetHb) or carbonmonoxyhemoglobin. Interpretation of the resultstherefore requires one to measure the DPG content of the RBCs at the time ofthe test, as well as the MetHb percentage in a fresh lysate. It is also importantto have information concerning the smoking habits of the patient.

Only 10–15% of the 800 Hb variants that have been identified to date (http://globin.cse.psu.edu/cgi-bin/hbvar/counter) display altered oxygen-bindingproperties. Variants with a clear increase in oxygen affinity lead to poly-cythemia, while those with a clear decrease to cyanosis and anemia. When, inaddition, they are unstable, they lead to chronic hemolytic anemia.

Several methods have been proposed to measure the oxygen affinity ofRBCs. They are all based on the determination of the fraction of Hb saturatedin oxygen, which is measured spectrophotometrically, at various oxygen par-tial pressures (PO2). In tonometric methods, the RBCs are first deoxygenated(usually by vacuum) and then equilibrated under known PO2; this procedureleads to point-by-point measurements, going from deoxy to oxy state. In the

50 Kister and Wajcman

continuous methods, usually the RBC suspension (or blood) is fully oxygen-ated first and then slowly deoxygenated. Continuous methods are of obviousinterest for obtaining precise oxygen equilibrium curves (OECs) covering thefull PO2 range.

From a basic scientific viewpoint, the measurement of oxygen binding inRBC suspensions is the easiest way to evaluate the functional properties of Hbin a physiological range of concentration. Under these conditions, Hb occursalmost only as tetramers, the proportion of the various hybrid molecules presentin the cells is not modified, and for some fragile variants the reducing enzy-matic systems prevent MetHb formation.

1.2. Discontinuous vs Continuous Methods

Measuring the oxygen-binding properties of RBCs requires one to obtainsimultaneously an accurate measurement of the PO2 to which the cells are ex-posed and of their content in oxyhemoglobin (HbO2). When the variation inoxygen pressure is discontinuous, as achieved in a tonometer equipped with anoptical cell, the PO2 of the gas mixture in which the RBC suspension is equili-brated is perfectly known, being determined by the proportion of the differentgases used. The percentage of HbO2 is measured by comparing, at each pointof PO2, the optical spectrum of the suspension with that of the same sample,fully deoxygenated and fully oxygenated. Isobestic points are checked to con-trol the stability of the sample during the assay. The RBC solution needs to bediluted enough to be kept within the range of sensitivity of the spectrophotom-eter. In addition, the spectrophotometer should be modified to solve the prob-lem of turbidity and light scattering. Studies done by such a point-by-pointprocedure are time-consuming and may cause alteration of the sample duringthe assay. Historically, methods of this type were used first.

The ancient gasometric method using the Van Slyke and Neill (1) apparatuswas a classic way to determine OECs. However, this procedure was so labori-ous and time-consuming that only a few points could be obtained in one day.Static methods using tonometry and spectrophotometry (2) were the mostwidely used in many laboratories before the use of oxygen electrodes. Theseprocedures were simple and only a small amount of sample was needed.

A variety of other techniques have been used for determination of the OECof red cell suspensions, following many methods: gasometric, spectrophoto-metric, polarographic and spectrophotometric-polarographic combinations.

Today, automatic methods are available in which the variation in PO2 andHbO2 are simultaneously and continuously recorded. Two different strategiesare proposed. In the first one, which is used for the HEM-O-SCAN (Aminco)apparatus, measurements are done on thin layers of blood with experimentalparameters designed to be close to “physiological” conditions. In the second


strategy, which has been chosen for the HEMOX ANALYSER (TCS, South-hampton, PA) (3), blood, or washed RBCs, is suspended in a buffer, containedin the optical cell, which is bubbled by the gas mixture to change progressivelythe PO2. This second technique is more suitable for biological studies, becauseenvironmental conditions (e.g., pH, ionic strength, drugs) can be easily modified.

1.3. Oxygen-Binding Parameters That Can Be Determined in RBC

Oxygen affinity is characterized by the P50. This parameter corresponds tothe PO2 at which the Hb is half saturated. It depends on several factors, includ-ing type of Hb, temperature, pH (Bohr effect), and intracellular DPG concen-tration. From the experimental plot of the HbO2 percentage vs PO2, theinteraction between heme groups, known as the Hill coefficient, or n50, may beobtained. The Bohr effect can be calculated by comparing the log P50 values ofOECs determined at various pH values. A rough estimation of the DPG effectcan be obtained by comparing the P50 of fully DPG-depleted RBCs with that ofthe same sample at a known DPG content.

OECs obtained from RBCs may be fitted to allosteric parameters, but in thehighly complex environment of Hb in the RBCs their meaning is doubtful.

2. Continuous Methods2.1. Thin-Layer Method: HEM-O-SCAN

2.1.1. Principle

In the thin-layer method, a few microliters of blood is applied on a circularmicroscope slide and covered with a gas-permeable membrane. This sample isintroduced into a chamber where, at 37°C, it is submitted to a gas stream, whichmodifies the PO2, and thus the level of HbO2. A Clark electrode monitors thePO2 in this chamber, while a photomultiplicator determines the percentage ofHbO2 by measuring the variations in absorption of a monochromatic light.Curves showing the percentage of HbO2 vs PO2 are drawn on an X-Y recorder.Both axes need to be calibrated before the run: PO2 by air (or gas mixtures) andnitrogen, and HbO2 by the sample fully deoxygenated and oxygenated. Gasmixtures containing CO2 are used to buffer the sample, thus mimicking physi-ological conditions. This method gives satisfactory results for routine mea-surements of P50.

2.1.2. Preparation of Sample

Blood samples are collected under EDTA-glucose medium and kept at 4°C un-til assayed, ideally within less than 24 h after venipuncture. If necessary, the bloodsample can be shipped by express mail in wet ice, but it should never be frozen. Forthese samples, it is compulsory to have a normal control sent with them.


2.1.3. Experimental Procedure

The sample is transferred to a cover glass and a gas-permeable membrane isplaced over the sample. The resulting thin film minimizes the time required foroxygen to be diffused effectively throughout the sample. The sample is placedon a holder at the sample compartment. The holder allows the sample to beloaded, tested, and removed without opening the sample compartment. Initialdeoxygenation is accomplished by purging the sample compartment with ni-trogen (N2). The oxygen equilibrium curve of Hb is then plotted by exposingthe sample to varying PO2s and measuring the response of the sample. Theresulting graph of fraction HbO2 as a function of PO2 is a fundamental descrip-tion of the oxygen transporting capacity of Hb.

The N2 purge and PO2 are controlled by a gas delivery system that uses twocompressed gas cylinders with regulators, solenoid valves, and calibrated flowrestrictors. Both gas cylinders contain 5.6% CO2 in order to maintain the car-bon dioxide partial pressure (PCO2) at 40 mmHg. Uniform PO2 is maintained inthe sample compartment by a stirring device.

The sample compartment contains a water jacket that must be connected toan external constant-temperature bath to obtain the required temperatures.Humidity control is obtained with two gas-conditioning wells and a wick res-ervoir built into the sample compartment block. The wells contain foam diskssaturated with distilled water that condition the incoming N2 and O2 gases tothe proper humidity levels. The wick reservoir provides distilled water to awick located near the sample holder, which ensures that the sample is main-tained near 100% humidity during a test run.

The PO2 of the sample compartment is monitored by a Clark O2 electrode,and the fraction HbO2 of the sample is monitored by a dual-wavelength spec-trophotometric system. The O2 electrode system consists of an O2 electrodeand an amplifier that is connected to the X-axis of the recorder. The gain andoffset of the amplifier are controlled by the oxygen electrode controls on thetop panel.

The oxygen electrode calibrate control is adjusted while the sample com-partment is completely filled with humidified, thermostated gas from the oxy-gen cylinder, which has a PO2 of 178.2 mmHg at 760 mmHg atmosphericpressure (37°C, water saturated). The oxygen electrode zero control is adjustedwhile the sample compartment is completely filled with N2. The use of a trueN2 zero instead of an electrical zero cancels out nonspecific electrode current,which would otherwise limit the accuracy of measurements at low PO2.

The spectrophotometric system monitors the sample with a light beam froma tungsten-halogen lamp. This light beam passes through the sample to a beamsplitter, where it is directed to two separate photodetectors. Each photodetector


has a different interference filter in front of it. One filter transmits a wave-length of 560 nm; the other, 576 nm. The difference in absorbance between thetwo wavelengths changes substantially when Hb undergoes an oxy-deoxy tran-sition. The two wavelengths are chosen close together to minimize error owingto light-scattering changes. The photodetector outputs are processed by a logratio amplifier that generates a signal proportional to the difference in sampleabsorbance at the two wavelengths. This signal is applied to an amplifier whosegain and offset are controlled by the HbO2 controls on the top panel. The out-put of this amplifier is applied to the Y-axis input of the X-Y recorder.

2.1.4. Limits of the Method

The main difficulties encountered with the HEM-O-SCAN are some inac-curacy in the assessment of the percentage of HbO2 for the fully saturatedsample and a slight variation in the intraerythrocytic pH during the oxygen-ation procedure. It is commonly assumed that Hb is completely oxygen satu-rated by air under normal atmospheric pressure (PO2 = 160 mmHg) at 37°C,but because of the oxygen-binding reaction, Hb within the RBCs is not com-pletely saturated. This means that a slight but systematic error is made assum-ing that the 100% oxygen saturation level is reached under air pressure. Thiserror resulting from incomplete saturation can be quite large in the case of low-oxygen-affinity samples (4). Another problem is the pH change accompanyingoxygenation when CO2-containing gases are used, as for experimental condi-tions of human blood “standards” (such as PCO2 of 40 mmHg, pH 7.4, 37°C).

2.2. Cell Suspension Method: HEMOX ANALYSER

2.2.1. Principles

The cell suspension method is suitable for biological and clinical purposes(3). It consists of the simultaneous recording of PO2 changes during slow deoxy-genation using a Clark-type oxygen electrode (polarographic method) and thechanges in absorbance of the Hb solution with a double-wavelength sprectro-photometer (sprectrophotometric method) (Fig. 1).

In principle, this technique is similar to that described by Imai et al. (5) forthe study of Hb solution. The advantage of the HEMOX ANALYSER is thesimultaneous measurement of the optical densities at two different wave-lengths, which eliminates the light-scattering problem. The OEC is measuredin a buffered solution, which maintains the pH constant. Under such experi-mental conditions, the OEC represents the true oxygen-binding graph. Dataobtained by this procedure may be treated in the framework of the generalbinding polynomial model described by Wyman (6). Therefore, this techniqueis more appropriate for precise biochemical studies.


The HEMOX ANALYSER may be interfaced to a microcomputer to saveeach run by sampling 300–500 data points of HbO2 and PO2 values. These datamay be further used for automatic calculation of the other parameters for oxy-gen binding.

Since the measurement of OEC by the HEMOX ANALYSER is now themost widely used technique, we present here this method in more detail.

2.2.2. Preparation of Sample

Blood samples should be collected and shipped as described in Subheading2.1.2. After collection, the blood is centrifuged for 5 min at 350g at 4°C toremove the plasma and buffy coat. The packed erythrocytes are washed threetimes in cold 50 mM Bis-Tris isotonic buffer, pH 7.4. An aliquot of the packedcells (30–50 µL) is suspended in 4 mL of the working buffer solution in theHEMOX cuvet.

Theoretically, measurements can be directly done on blood, but in this case,errors may result from hemolytic samples or from samples in which aggre-gated RBCs cause irregular turbidity.

2.2.3. Experimental Procedure for Determination of OEC

Standard oxygen affinity measurement of an RBC suspension is performedin 50 mM Bis-Tris, 140 mM NaCl, pH 7.4, buffer contained in an optical cell.The cell also contains the Clark electrode and a magnetic bar for rapid andeven stirring of the sample suspension during measurement. Because of thisrapid stirring, the HbO2 content (optical signal) and the PO2 are measuredsimultaneously at the same location. A special cuvet stopper contains the gasexchange tubing system through which the gas exchange takes place. Tem-perature is maintained at 37 ± 0.01°C using a water jacket connected to a largetemperature-controlled water bath.

Fig. 1. Schematic representation of HEMOX ANALYSER.


Usually, the analysis consists only of performing a deoxygenation curve.Nevertheless, when required, it is possible to do a reoxygenation curve onthe same sample; in a normal sample these two curves should be super-imposed.

Before recording a deoxygenation curve, the red cell suspension is equili-brated for 10–20 min under oxygen (about 600–700 mmHg of PO2) in the opti-cal cuvet of the HEMOX ANALYSER. This procedure ensures that full oxygensaturation of the sample is achieved, and allows the corresponding absorbancevalue to be memorized by the machine. This value is used by the software todetermine the HbO2 scale. The deoxygenation process is initiated with a gasmixture made of 20% O2 in N2, which is similar to the air pressure conditions.When the PO2 value decreases to about 300 mmHg, the deoxygenation is con-tinued with pure nitrogen to obtain a PO2 value near zero. Each deoxygenationrecording usually takes about 40–45 min (7). To avoid sample concentrationvia dehydration, the gas mixtures are water saturated by bubbling through asmall bottle of distillated water.

Using the reverse procedure, a reoxygenation curve can be recorded fol-lowing the deoxygenation curve. After 10–20 min of equilibration underpure N2, the 20% oxygen gas mixture is very slowly introduced to reach aPO2 value of about 70 mmHg. Pure oxygen is then used to complete oxy-genation to the maximum PO2 value desired (monitored by computer soft-ware). The reoxygenation procedure is usually faster than deoxygenation,requiring 25–30 min.

The HEMOX ANALYSER uses the principle of differential absorbancemeasurement using a dual-wavelength spectrophotometer that requires onlyone cell. Through this cuvet, the light of two different wavelengths is passed: a“measuring” wavelength of 560 nm for the maximum absorbance of thedeoxyhemoglobin; and a “reference” wavelength of 569 nm for the isobesticpoint between oxy and deoxyhemoglobin spectra, which remains practicallyunchanged during the deoxygenation process. Thus, the change in the opticalproperty of Hb during deoxygenation is detected by the electronic circuitry asthe differential optical change between these two wavelengths. A special, bal-anced amplifier circuit provides a very high signal-to-noise ratio for recordingextremely small changes. Since the differential extinction coefficient of oxy-genated and deoxygenated blood is known, it is also possible to determine theHb concentration of the sample.

2.2.4. Representations and Interpretation of Data

Oxygen-binding curves may be represented in different ways. The same dataare displayed according to the linear representation in Fig. 2, as the Hill plot inFig. 3, and as the cooperativity curve in Fig. 4.


Fig. 2. Linear representation of normal fresh red cell suspension OEC with P50

value of 26 mmHg and arteriovenous difference in oxygen saturation (∆Y) of 20%.Other conditions: pH 7.4, 0.05 M bis-Tris, 0.14 M NaCl, 37°C.

Fig. 3. Hill plot representation of deoxygenation and reoxygenation OEC from nor-mal RBC suspension. The two curves are superimposable. Other conditions: pH 7.4,bis-Tris 0.05 M, NaCl 0.14 M, 37°C.


2.2.4.1. LINEAR REPRESENTATION

From the PO2 and absorbance values stored in the computer, the fractionaloxygen saturation (Y) vs PO2 curve (linear representation) is directly drawn(Fig. 2). The P50 and n50 values are calculated by linear regression analysisfrom the experimental points obtained between 40 and 60% oxygen satura-tion (7). The P50 value represents the oxygen affinity of the RBC suspensionin the experimental conditions used. In “standard” conditions (i.e., pH 7.4,50 mM Bis-Tris, 140 mM NaCl, 37°C), the P50 value from a normal control is27 ± 0.1 mmHg and the n50 value is 2.6 ± 0.1. A lower P50 means that theoxygen affinity is increased while a higher P50 corresponds to a decreasedoxygen affinity.

This plot also allows determination of the oxygen-carrying capacity of theblood. This is done by measuring under the standard conditions the differencebetween the arterial (SAO2) and the mixed venous (SVO2) oxygen saturation,which, on the OEC, corresponds to the saturation level at 90 and 40 mmHg ofPO2, respectively. In a normal RBC suspension, the arteriovenous difference inoxygen saturation is about 20–25%. From this value, it is possible to obtain thecardiac output parameter (Q) using the Fick equation:

VO2 = 0.136 × Q × Hb × (SAO2 – SVO2)

in which VO2 is the amount of oxygen released per minute (L/min), Q isthe blood flow (L/min), Hb is the patient’s hemoglobin concentration,and (SAO2 – SVO2) is the arteriovenous difference of oxygen saturation asalready indicated.

Fig. 4. Oxygen cooperativity representation for normal fresh red cell suspension.Other conditions: pH 7.4, 0.05 M bis-Tris, 0.14 M NaCl, 37°C.


2.2.4.2. HILL PLOT REPRESENTATION AND INTERPRETATION

As an alternative, from the data stored in the computer, the OEC may berepresented according to the empirical Hill equation as log[Y/(1 – Y)] vslog(PO2) (8). According to this representation, known as the Hill plot, the OECis a sigmoid. This curve has two asymptotes with slopes equal to unity: thelower one corresponds to the deoxygenated structure (T state in the Monod-Wyman-Changeux model) (9), and the upper one to the fully oxygenated struc-ture (R state) (Fig. 3). This representation may be clearer than the decimal oneto visualize the presence of an abnormal Hb component in the RBCs, as shownin a few typical examples (Fig. 6).

2.2.4.3. COOPERATIVITY REPRESENTATION AND INTERPRETATION

A very powerful method to analyze the cooperative properties of Hb is torepresent the variations in the Hill coefficient, nH, vs oxygen saturation, expressedas log[Y/(1 – Y)] (7). This is done by calculating the first derivative of the Hillplot as d log[Y/(1 – Y)]/d log (PO2) by linear regression analysis of the i + 3/i – 3values for each point of the OEC curve (Fig. 4). The resulting plot, called thecooperativity curve, is classically bell shaped. It starts from an nH of 1, at verylow PO2, reaches a maximum nH (nmax) around the half-saturation level (nmax

similar to the n50 for a “symmetrical” OEC), and ends with an nH near 1 at highPO2. This representation may also be quite useful to visualize the presence ofan abnormal Hb component with altered cooperativity.

A normal fresh RBC suspension “cooperativity” curve is shown in Fig. 4. Thiscurve exhibits a large asymmetrical aspect with the nmax (2.8) obtained at a highoxygen level (about 90%) and with a lower n50 value near P50 (2.5). This behaviormay be explained by variations in the activity of free DPG during the oxygenationprocess that are owing to the equimolar concentration of DPG and tetrameric Hbwithin the normal fresh red cells (7). The fact that the apparent heme-heme interac-tion (Hill coefficient) is increasing in the physiologically important portion of thered cell OEC (between 90 and 95% oxygen saturation level) may improve oxygendelivery to the tissues. This cooperativity curve could present dramatic perturba-tions when the DPG concentration is below the normal value; under suchnonsaturating concentrations of DPG in red cells, the OEC exhibits a clear biphasicshape with a low value of n50 (7). This is observed during blood storage with agingof erythrocytes and acidosis or in vivo in some pathological conditions.

2.3. Bohr Effect in Case of Red Cell Suspensions

The Bohr effect is an important functional property of human Hb. Its physi-ological role can be described either as the pH dependence of the oxygen affin-ity or as the pH of the solvent on oxygenation of deoxyhemoglobin.


The Bohr effect parameters are calculated from the variation in the log P50,or log Pm, vs pH (“Bohr curve,” Fig. 5) using the thermodynamic frameworkof the linked-function theory of Wyman (6): This theory states that the bind-ing of oxygen to tetrameric Hb and the binding of protons are reciprocal so that

∆log P50/∆pH = – ∆H+ / mole heme

in which P50 is the PO2 at half saturation, similar to the theoretical parameter ofPm, median PO2, if the OEC is not too far from the conditions of symmetry:∆H+ difference in the number of bound protons released per heme. Thus, theBohr effect can be studied by the measurements of OEC at different pH valuesbetween 5.5 and 8.5. Measurements are done in 140 mM NaCl, 50 mM bis-Trisbuffer for pH values <7.5 and in Tris buffer for values >7.5. For normal freshred cell suspensions at 37°C, the alkaline Bohr effect coefficient (–∆H+

max) isabout 0.66 per heme (10).

2.4. Variation in Erythrocytic DPG Content

A red cell OEC has no meaning without the knowledge of the intraerythro-cytic DPG content. It can be measured using a commercial kit from BoehringerMannheim.

It is possible to study the effect of varying concentrations of DPG on theOEC. To obtain a complete DPG depletion, washed red cells are incubated at37°C in an isotonic buffer in the absence of glucose for about 20–24 h. Thetotal absence of DPG results in a twofold increased oxygen affinity and a highvalue of the Hill coefficient (n50 = 2.8). This procedure may be used to verifywhether an increased oxygen affinity observed in the case of a sample withunknown DPG content is owing to an abnormal Hb.

Fig. 5. Variation in log P50 vs pH: The alkaline Bohr coefficient (–∆H+max) is the

maximal slope of this curve.


Conversely, a two- to four-fold enrichment of the intracellular DPG contentcan be obtained by a 2- to 6-h incubation of the RBCs in a Krebs-Ringer(pH 7.8) buffer containing 5 mM phosphate (dihydrogeno-Na), 5 mM inosine,10 mM glucose, 5 mM pyruvate, and 0.5 mM adenine (PIGPA buffer) (11). InRBCs containing a [DPG/Hb4] ratio of about 2, the oxygen affinity is halvedand the Hill coefficient is high (n50 = 2.8).

In both of these conditions, the cooperativity curve is symmetrical with themaximum Hill coefficient close to the n50 value (Table 1). This results fromthe fact that there is only one functional Hb species (Hb alone for DPG-depletedRBCs or DPG-bound Hb for RBCs with a large DPG excess relative to Hb) inopposition to fresh red cells where the two functional Hb populations arepresent (7).

2.5. Allosteric Modifiers of RBC Oxygen Affinity

Regulating the allosteric equilibrium of Hb has been of interest in medicine.Pharmaceutical agents that produce a high-affinity Hb have been clinicallyevaluated as antisickling agents, while those that produce a low-affinity Hbmay be useful for the treatment of thalassemia and ischemic problems arisingfrom stroke and cardiovascular diseases (12).

It has been demonstrated that bezafibrate, an antilipidemic drug, lowers theoxygen affinity of red cells and Hb solutions (13,14). Later, it was reportedthat a bezafibrate derivative, RSR-4 or [2-[4-[[(3,5-dimethylalanilino)carbonyl]methyl]-phenoxy]-2-methylpropionic acid], was much more effec-tive in lowering the oxygen affinity of suspensions of fresh intact cells (15).This compound is the most potent allosteric modifier discovered to date thatshifts the oxygen equilibrium curve to the right in whole blood and in vivo.These compounds cross the red cell membrane and bind mostly the α-chains of

Table 1Oxygen-Binding Properties of DPG-Depleted and Normal Fresh RBCsa

Experimental P50P50 normal RBCs

condition (torr) n50 P50 DPG-depleted RBCs

Fresh red cells 26.6 2.5 —([DPG/Hb4] ~ 1)DPG-depleted red cells 13.5 2.8 2.0([DPG/Hb4] ~ 0)Increased DPG red cells 39.0 2.8 0.7([DPG/Hb4] ~ 2)b

a Other conditions: pH 7.4, 0.05 M bis-Tris, 0.14 M NaCl, 37°C.b Incubated in PIGPA buffer (2 h at 37°C, pH 7.8).


deoxy-Hb, thus stabilizing the T deoxy state. Since DPG binds to a differentsite, it acts in a synergetic way when combined with these allosteric effectors.

3. A Few ExamplesThe following sections discuss some typical OEC found in various clinical

situations.

3.1. Patient with High-Oxygen-Affinity Hb (Polycythemia)

For patients heterozygous for a high-oxygen-affinity Hb variant, the red cellsuspension OEC (curve 3) is displaced toward the left in comparison with thenormal OEC (curve 1), as illustrated in Fig. 6. In some cases, the Hill plot ofthis OEC can be biphasic. The lower portion with a low n value (low or nonco-operative Hb) corresponds to the high-oxygen-affinity Hb while the upper por-tion that approaches the normal curve reflects the oxygenation of the normalHbA that coexists in the RBCs. It results in a marked defect in oxygen extrac-tion with erythrocytosis (16).

The biphasic aspect of the Hill plot can be more or less difficult to recognizewhen the abnormal Hb displays only a moderate increase in oxygen affinityand remains cooperative.

Fig. 6. Hill plot representation of OECs of RBC suspensions from a normal patient(curve 1), a heterozygous patient with a high-oxygen-affinity Hb variant (curve 3),and a heterozygous patient with a low-oxygen-affinity Hb variant (curve 2). Otherconditions: pH 7.4, 0.05 M bis-Tris, 0.14 M NaCl, 37°C.


3.2. Patient with Low-Oxygen-Affinity Hb (Cyanosis)

For patients heterozygous for a low-oxygen-affinity Hb variant, the red cellsuspension OEC (curve 2) is displaced toward the right in comparison with thenormal OEC (curve 1), as illustrated in Fig. 6. It results in a marked defect inoxygen saturation with cyanosis (17).

3.3. Case of Patient with Sickle Cell Hb (Sickle Cell Disease)

In homozygous sickle cells red cell suspensions, evidence for HbS polymer-ization can be provided by the hysteresis of the OEC between the deoxygen-ation and reoxygenation curves (Fig. 7A). In the reoxygenation experiment,the amount of polymerized Hb at the beginning of the recording is larger thanin the deoxygenation curve, which results in a further shift to the right of thecurve (18,19).

Additional evidence for the presence of these polymers can be observed inthe cooperativity profiles (Fig. 7B). For homozygous SS red cells, an increasednmax is observed, which can be higher than the theoretical limit for normal Hbcooperative behavior (nmax = 3), indicating that an aggregation process ispresent during the oxygenation. (18,19).

References1. Van Slyke, D. D. and Neill, J. M. (1924) The determination of gases in blood and

other solutions by vacuum extraction and manometric measurement. J. Biol.Chem. 61, 523–573.

2. Benesch, R., Macduff, G., and Benesch, R. E. (1965) Determination of oxygenequilibria with a versatile new tonometer. Anal. Biochem. 11, 81–87.

3. Asakura, T. (1979) Automated method for determination of oxygen equilibriumcurves of red cell suspensions under controlled buffer conditions and its clinicalapplications. Crit. Care Med. 7, 391–395.

4. Marden, M. C., Kister, J., Poyart, C., and Edelstein, S. J. (1989) Analysis ofhemoglobin oxygen equilibrium curves: are unique solutions possible? J. Mol.Biol. 208, 341–345.

5. Imai, K., Morimoto, H., Kotani, M., Watari, H., Hirata, W., and Kuroda, M. (1970)Studies on the function of adnormal hemoglobins. I. An improved method forautomatic measurement of the oxygen equilibrium curves of hemoglobin.Biochim. Biophys. Acta 200, 189–196.

6. Wyman, J. (1964) Linked functions and reciprocal effects in hemoglobin: a sec-ond look. Adv. Prot. Chem. 19, 223–286.

7. Kister, J., Poyart, C., and Edelstein, S. J. (1987) An expanded two-state allostericmodel for interaction of human hemoglobin A with non saturating concentrationsof 2,3 diphosphoglycerate. J. Biol. Chem. 262, 12,085–12,091.

8. Hill, A. V. (1910) The possible effects of the aggregation of the molecules ofhemoglobin on the dissociation curves. J. Physiol. (Lond.) 40, iv–vii.


Fig. 7. (A) Linear representation of fresh homozygous sickle red cell suspensionOECs: deoxygenation (curve 1) and reoxygenation (curve 2) OECs. Other conditions:pH 7.4, 0.05 M bis-Tris, 0.14 M NaCl, 37°C. (B) Oxygen cooperativity representationof fresh homozygous sickle red cell suspension OECs: deoxygenation (curve 1) andreoxygenation (curve 2) OECs. Other conditions: pH 7.4, 0.05 M bis-Tris, 0.14 MNaCl, 37°C.

9. Monod, J., Wyman, J., and Changeux, J. P. (1965) On the nature of the allosterictransitions: a plausible model. J. Mol. Biol. 12, 88–118.

10. Kister, J., Marden, M. C., Bohn, B., and Poyart, C. (1988) Functional propertiesof hemoglobin in human red cells: II. Determination of the Bohr effect. Respir.Physiol. 73, 363–378.

11. Lian, C. Y., Roth, S., and Harkness, D. R. (1971) The effect of alteration of intra-cellular 2,3-DPG concentration upon oxygen binding of intact erythrocytes


containing normal or mutant hemoglobins. Biochem. Biophys. Res. Commun. 45,151–158.

12. Poyart, C., Marden, M. C., and Kister, J. (1994) Bezafibrate derivatives as potenteffectors of hemoglobin, in Methods in Enzymology, vol. 232, Hemoglobins. PartC: Biophysical Methods (Everse, J., Vandegriff, K. D., and Winslow, R. M., eds.),Academic, San Diego, pp. 496–513.

13. Perutz, M. F. and Poyart, C. (1983) Bezafibrate lowers oxygen affinity of haemo-globin. Lancet 2, 881, 882.

14. Perutz, M. F., Fermi, G., Abraham, D. J., Poyart, C., and Bursaux, E. (1986)Hemoglobin as a receptor of drugs and peptides: X-ray studies of the stereochem-istry of binding. J. Am. Chem. Soc. 108, 1064–1078.

15. Abraham, D. J., Wireko, F. C., Randad, R. S., Poyart, C., Kister, J., Bohn, B.,Liard, J. F., and Kunert, M. P. (1992) Allosteric modifiers of hemoglobin: 2-[4-[[(3,5-disubstitutedanilino)carbonyl]methyl]phenoxyl]-2-methylpropionic acidderivatives that lower the oxygen affinity of hemoglobin in red cell suspensions,in whole blood, and in vivo in rats. Biochemistry 31, 9141–9149.

16. Wajcman, H. and Galacteros, F. (1996) Abnormal hemoglobins with high oxygenaffinity and erythrocytosis. Hematol. Cell Ther. 38, 305–312.

17. Griffon, N., Badens, C., Lena-Russo, D., Kister, J., Bardakdjian, J., Wajcman, H.,Marden, M. C., and Poyart, C. (1996) Hb Bruxelles, deletion of Pheβ42, shows alow oxygen affinity and low cooperativity of ligand binding. J. Biol. Chem. 271,25,916–25,920.

18. Poyart, C., Edelstein, S., Kister, J. and Bohn, B. (1986) Oxygen binding by sicklered cells, in Approaches to the Therapy of Sickle Cell Anaemia, ColloqueINSERM, vol. 141 (Beuzard, Y., Charache, S., and Galacteros, F., eds.), Les Edi-tions INSERM, Paris, pp. 67–87.

19. Cohen-Solal, M., Préhu, C., Wajcman, H., Poyart, C., Bardakdjian-Michau, J.,Kister, J., Promé, D., Valentin, C., Bachir, D., and Galacteros, F. (1998) A newsickle cell disease phenotype associating Hb S trait, severe pyruvate kinase defi-ciency (PK Conakry), and an α2 globin gene variant (Hb Conakry). Br. J.Haematol. 103, 950–956.

Rate Constant Measurement for Reactions with Hb 65

5

65


Measurement of Rate Constantsfor Reactions of O2, CO, and NO with Hemoglobin

John S. Olson, Erin W. Foley,David H. Maillett, and Eden V. Paster

1. IntroductionThe kinetics of O2, CO, and NO binding to mammalian hemoglobins (Hbs)

have been studied for 75 yr, starting with the original rapid mixing experi-ments of Hartridge and Roughton (1). Over the last 20 yr, these measurementshave been extended to time scales ranging from hours to picoseconds. Numer-ous articles have been written about rapid mixing and photolysis instruments,methods for defining specific association and dissociation rate constants, andalgorithms for analyzing the results in terms of specific models for cooperativeligand binding (2–10). A comprehensive review of these techniques and meth-ods, however, is beyond the scope of this book. Instead, a practical guide todetermining rate constants for O2, CO, and NO binding to native and recombi-nant Hbs is presented, with a special emphasis on tetrameric adult human Hb(HbA).

First, the basic kinetic expressions for reversible ligand binding to heme-containing subunits are presented. Second, the differences in reactivity of O2,CO, and NO with heme iron are discussed in terms of the time resolution re-quired for direct measurements of association and dissociation. Third, typicalrapid mixing and flash photolysis experiments for O2, CO, and NO binding tohuman Hb are described. The complications caused by cooperative ligand bind-ing are discussed for each ligand, and approaches to assigning rate parametersfor the R and T quaternary states are summarized. Fourth, techniques for mea-suring the oxidative reaction of NO with oxyhemoglobin (HbO2) are describedin view of the importance of this reaction for in vivo NO detoxification andvasoregulation.

66 Olson et al.

2. Methods2.1. Simple Kinetic Analysis

For simple monomeric proteins, the basic ligand binding mechanism andrate equations are as follows:

in which Hb represents a heme-containing monomer; k'X and kX are bimolecu-lar association and unimolecular dissociation rate constants; and [X] and [HbX]are the concentrations of free and bound ligand, respectively.

To simplify data analysis, the ratio of the initial concentrations of ligand,Xtotal, and heme, Hbtotal, is usually manipulated to maintain pseudo first-orderconditions in one of the reactants. Normally, Xtotal is kept ≥10 Hbtotal so that simpleexponential time courses are obtained: that is, [Hb]t = [Hb]total exp(–kobst). Underthese conditions, the pseudo first-order rate constant, kobs, is given by the sumof the forward and backward rates: kobs = k'XX0 + kX. The values of the associa-tion (k'X) and dissociation (kX) rate constants are determined as the slope andy-axis intercept, respectively, from a plot of kobs vs ligand concentration (seeFig. 1). Under some circumstances, it is necessary to keep the protein in excess.If Hbtotal > 10Xtotal, then the observed pseudo first-order rate is given by kobs =k'X[Hb]total + kX. If the concentration of heme groups approaches that of theligand, then nonexponential, second-order time courses will be observed andmore complex analyses are required (see refs. 5 and 6, and Fig. 6).

The ligand dissociation rate constant (kx) is usually determined more directlyin ligand replacement or consumption reactions. The general schemes for thesereactions are as follows:

In the replacement reactions, the original liganded complex, HbX, is mixedwith excess displacing ligand, Y. The displacing ligand is chosen to have muchhigher affinity for Hb than the bound ligand, X, and to have a much smallerdissociation rate constant (i.e., kY < kX). Under these conditions, the observedreplacement rate constant, robs, is given by

(3)robs =kXk'Y[Y]

(k'Y[Y] + k'X[X])

If the rate of association of Y is much greater than that for the rebinding of X(i.e., k'Y[Y] >> k'X[X]), the observed replacement rate becomes equal to kX. Thesame principle applies if a reagent is added to consume the dissociated ligand.

Hb + Xk'X HbX;

d[Hb] = –k'X[X][Hb] + kX[HbX]

kX dt(1)

HbX kX X + Hb + Y

k'Y HbY or HbX k'X Hb + X

k'X kY k'X(2)

Consume X withdithionite orother reagents


In ligand consumption experiments, an excess of consuming agent is usuallyadded so that the observed rate equals that for ligand dissociation.

The rate of oxygen dissociation, kO2, is normally measured by reacting HbO2(deoxygen complex with reduced hemoglobin) with either excess CO or high con-centrations of dithionite to consume free O2 (2,5,11). The rate of CO dissociation,kCO, is measured by reacting carbon monoxide hemoglobin (HbCO) with excessNO or a protein that scavenges CO (2,5,11,12). The rate of NO dissociation, kNO,

Fig. 1. Time course for CO binding to human deoxyHb in 0.1 M phosphate, pH 7.0,20°C. In a Gibson-Dionex stopped-flow apparatus equipped with a 2-cm path length,100 µM CO was mixed 1:1 with 10 µM deoxyHb. The reactant concentrations aftermixing were [CO]total = 50 µM and [Hb]total = 5 µM, and the time course was followedat 436 nm. (�) Observed data points; solid line —— a fit to single exponential expres-sion with an observed rate constant equal to 7.9 s–1. (Top) Plotted differences betweenobserved data and fitted line (residuals). (Inset) Dependence of fitted pseudo first-order observed rate constant on [CO]total after mixing.

68 Olson et al.

can be measured by reacting HbNO with both excess CO to displace the boundligand and excess dithionite to consume the newly released NO (13). The valueof kNO can also be determined by mixing HbNO with excess molecular oxygen,which both displaces the NO and, when bound to the heme group, consumesfree NO by dioxygenation (see Eq. 11; [14]).

2.2. Time Resolution: Rapid Mixing vs Flash Photolysis

In general, the association of carbon monoxide with heme proteins is mark-edly slower than that of dioxygen or nitric oxide (NO) and is the easiest ligand-binding reaction to measure (Table 1). The rate-limiting step for CO binding isinternal bond formation with the heme iron. CO enters and leaves the proteinhundreds of times before it finally forms a bond with the iron atom, and, as aresult, the overall bimolecular rate constant is normally small. By contrast, NO isso reactive that every ligand molecule that enters the protein combines with theiron atom before it has a chance to escape. Thus, NO binding is limited only bythe rate of ligand entry into the protein. Dioxygen shows intermediate behavior,

Table 1Typical Rate Constants for CO, O2, andNO Binding to Human Hb at pH 7.0, 20–25°Ca

T-state parameters R-state parameters

k'T kT KT k'R kR KRProtein (µM –1s–1) (s–1) (µM –1) (µM –1s–1) (s–1) (µM –1)

Hb (tetramer)CO 0.12 0.16 0.75 6.0 0.008 750O2 5–10 500–1000 ~0.01 66 20 3.2NO 25 (~0.001) (~25,000) 60 0.00003 2,000,000

α-Subunit (tetramer)CO 0.14 0.15 0.9 5.0 0.008 620O2 7.1 2000 0.004 40 15 2.7

β-Subunit (tetramer)CO 0.10 0.17 0.6 7.0 0.007 1000O2 6.4 1500 0.004 90 31 2.9a The T-state parameters were derived from measurements of the first step in ligand binding

(i.e., k'1 = 4k'T and k1 = kT). The R-state parameters were derived from measurements of the laststep in ligand binding (i.e., k'4 = k'R and k4 = 4kR). The values for O2 and CO in the first two rowswere taken from analyses of the data in Figs. 1–5, Sawicki and Gibson (31), and Mathews andOlson (8). The values for NO were taken from Cassoly and Gibson (17), Moore and Gibson (13),and Eich et al. (41). The O2 and CO parameters for the individual α- and β-subunits in T- and R-state Hb were taken from Unzai et al. (38) and the references therein. In the case of metal hybridHbs, the T state was often defined as in the presence of inositol hexaphosphate at pH 6.5, whichcan give abnormally high dissociation rate constants (see ref. 38).


being limited in part by the rate of movement into Hb and by the the rate of Fe-O2bond formation (for a more complete discussion and references see ref. 15).

The association rate constant for CO binding to Hb is usually small enough(0.1 to 5 µM–1s–1; Table 1) to allow measurement in simple rapid mixing,stopped-flow instruments with dead times of 2 to 3 ms. For example, at 100 µMfree CO, the observed pseudo first rate for CO binding to low concentrations(≤20 µM) of human deoxyhemoglobin A (deoxyHbA) is 100 µM · ~0.1 µM–1s–1 =10 s–1, which prescribes a half-time of ~70 ms. If the Hb is in the high-affinity,rapidly reacting conformation, the observed rate increases ~50-fold, yielding ahalf-time of ~1.5 ms. However, lower concentrations of CO can be used toincrease the half-time of the reaction to ≥3 ms to allow measurements in rapidmixing devices. Alternatively, these more rapid CO reactions can be measuredby the photolysis techniques described in Fig. 2.

The association rate constants for NO and O2 binding to Hb are quitelarge (5–100 µM–1s–1) and normally can only be measured using laser pho-tolysis techniques (7). For example, at 100 µM ligand, the observed rates ofO2 and NO binding to high-affinity forms (R state) of human deoxyHbAare 100 µM · ~50 µM–1s–1 = 5000 s–1, yielding half-times of ~0.1 ms. Thesereactions are too rapid to be detected in rapid mixing experiments but are readilymeasured using laser photolysis techniques with excitation pulses ≤0.5 µs.

In the case of O2 binding to the low-affinity, slowly reacting forms of Hb,the value of k'O2

is much smaller, ~5 µM–1s–1, which would lower the associa-tion rate to ~500 s–1 at 100 µM free ligand. Unfortunately, the dissociation rateconstant for the low-affinity form of human Hb is on the order of 1000 s–1 (seeTable 1). Since the observed pseudo first-order rate constant is the sum of theforward and backward rates (Eq. 1), the value of kobs is ≥1500 s–1, and t1/2 forthe reaction is ≤0.5 ms, which precludes rapid mixing experiments. As result,there is no simple way of measuring O2 binding to deoxyHb by rapid mixing,and photolysis techniques with short excitation pulses are required.

In the case of NO binding, the dissociation rate constants for either the low-or high-affinity forms of human hemoglobin are very small, 0.001–0.00001 s–1

(Table 1). Thus, NO binding to either the R or T states of deoxyHb can bemeasured by stopped flow, rapid mixing techniques. However, very low Hb(1–5 µM) and NO (1–10 µM) concentrations must be used to keep the observedrates in the range of 50–500 s–1 (16,17).

3. Results3.1. CO Binding

The association rate constant for CO binding can be measured by mixing asolution of deoxyHb with anaerobic buffer solutions containing various

70 Olson et al.

amounts of dissolved ligand and measuring the disappearance of the deoxyHbabsorption peak at 430 nm or appearance of the HbCO peak at 420 nm. In theseexperiments, small amounts of sodium dithionite are often added to ensureremoval of all oxygen from both reactant solutions. A sample time course forCO binding to human deoxyHbA at pH 7.0 is shown in Fig. 1. The dependenceof the apparent pseudo first-order rate constant on ligand concentration isshown in the inset. There is a linear dependence of the overall pseudo first-order rate constant on [CO] after mixing. The slope of the curve is 0.15 µM–1s–

1 for HbA in 0.1 M phosphate buffer, pH 7.0, 20°C. The intercept of the kobs vs[CO] plot is effectively 0 since the values for CO dissociation are very small(from 0.1 to 0.005 s–1; Table 1).

As noted by Gibson and Roughton 45 yr ago (reviewed in ref. 2), the timecourse for CO binding to deoxyHbA shows complex accelerating behavior. Afit to a single exponential decay expression shows systematic deviations fromthe observed data (Fig. 1, top). It is clear that the observed rate is increasing as

Fig. 2. Time courses for CO rebinding to human deoxyHb after photolysis with a1-ms excitation pulse from a photographic flash lamp. The conditions are the same asthose in Fig. 1, and the reactions were followed at 436 nm. Photolysis was carried outwith two Sunpack 540 Strobes as described in Mathews and Olson (8). (A) Photolysisof 150 µM HbCO at four different excitation intensities. (Inset) A rapid, monophasictime course is observed when the extent of photolysis is ≤10%. (B) Complete photoly-sis at lower concentrations of HbCO.


Under most circumstances, the back reactions for CO binding can be neglectedsince the absolute value of the dissociation rate constants, k1 to k4, are verysmall compared to the rates of association (i.e., k'1[CO] >> k1; k'2[CO] >> k2;and so on). In effect, CO binding can be described by four consecutive irre-versible reactions, whose analytical solutions under pseudo first-order condi-tions can be represented by sums of exponentials (see refs. 2 and 6).

Assignment of rate constants to all four steps in CO binding is extremelydifficult because the observed time course for CO binding is not very differentfrom a simple exponential decay (Fig. 1). An independent experimental deter-mination of the rate constant for the last step, k'4, is required. Gibson was thefirst to solve this problem by using partial photolysis techniques to measure thisrate constant directly (reviewed in refs. 2 and 4). He constructed a Xe flashlamp (pulse length of ~10 µs) that could be used to flash photolyze the Fe-CObond and drive the ligand out into the solvent. After the flash, CO rebinds tothe newly produced Hb4(CO)3, Hb4(CO)2, Hb4(CO), and Hb4 intermediates,depending on the extent of photolysis. At 100% photolysis, fully deoxygen-ated Hb tetramers are generated; at ≤10% photolysis, the only reactive speciesis Hb4(CO)3, and the last step in ligand binding can be followed directly.

Over the last 20 yr, these photolysis experiments have been extended tonanosecond and picosecond time regimes using ultrafast lasers. On these veryshort time scales, first-order, internal ligand rebinding is observed. Theseultrafast processes are called geminate rebinding because the same iron/ligandpair is involved in bond reformation. Geminate recombination provides detailedinformation on the factors governing iron-ligand bond formation (15) andallows mapping of ligand movement into and out of the protein (18). In all ofthe following discussion, however, only long laser (~1-µs) or photographicflash (~1-ms) pulses are considered. In these experiments, only ligand rebind-ing from the solvent is being measured, all the processes are bimolecular, and theobserved rates depend on the first power of the external ligand concentration.

Sample time courses for CO rebinding to deoxyHbA after photolysis by a 1-mspulse from photographic Xe flash lamps are shown in Fig. 2. When the totalprotein concentration is kept high ([Hb]total ≈ 150 µM; Fig. 2A), the time coursefor CO rebinding to human HbA after complete photolysis resembles that seen inrapid-mixing experiments (Fig. 1). Acceleration is seen in both cases. Decreas-ing the excitation light intensity with neutral-density filters leads to biphasic timecourses (Fig. 2A, lower curves). The first phase represents rebinding to a rapidly

the reaction proceeds. A quantitative analysis of CO binding to humandeoxyHb requires analysis in terms of the four-step Adair scheme:

(4)Hb4 + X k'1 Hb4X + X

k'2 Hb4X2 + X k'3 Hb4X3 + X

k'4 Hb4X4k1 k2 k3 k4

72 Olson et al.

reacting form of Hb, with an apparent bimolecular rate constant of ~6 µM–1s–1.At 5–10% photolysis, only the rapid phase is observed. This time course isassumed to represent the binding of the last CO molecule to hemoglobin (i.e.Hb4X3 + X → Hb4X4 in Eq. 4), and the observed bimolecular rate constantrepresents k'4 in the Adair scheme.

3.2. Analysis in Terms of Two States

The deoxyheme group in the Hb4X3 intermediate was originally designatedas Hb*, owing to its rapid reaction with CO (2). In the early 1970s, the two-state model of Monod, Wyman, and Changeux (19) was adopted as the stan-dard for interpreting cooperative ligand binding. It is still the best firstapproximation for comparing mutant and naturally occurring Hbs. In thismodel, deoxyHb starts out in the low-affinity T state where the reactivity to-ward ligands is low. As ligands successively bind, the tetramer switches to thehigh-affinity R state so that the reactivities of the remaining deoxyheme groupin Hb4X3 toward O2 and CO are ~300 to 1000 times greater, respectively, thanany of the groups in Hb4 (Table 1). In the simple two-state model, the equilib-rium constant for T-to-R isomerization in the completely unliganded Hb4 spe-cies is defined as L = [T]/[R] and is on the order of 1,000,000 for native HbA atpH 7.0 (20,21). The ratio of the ligand association equilibrium constants forbinding to the T vs the R states is KT/KR ≈ 0.002–0.005. As the reaction pro-ceeds, the tetramer isomerization constant decreases by L(KT/KR)n in which nis the number of ligands bound. For example, the binding of three ligandscauses the isomerization constant to decrease from 106 to 10–2, and Hb4X3 ispredominantly in the R state. Thus, under physiological conditions, measure-ment of the kinetics of the first step in the Adair scheme (Eq. 4) provides anestimate of the rate parameters for the T quaternary state, and time courses forthe last step provide estimates of the corresponding R-state rate constants.Using these definitions, the Hb* species can be equated with the rapidly react-ing R-state conformation (5,8,11).

3.3. Dimers and Monomers Are Rapidly Reacting

In the late 1950s, Gibson (22) reported that the rapidly reacting form of Hbcould also be seen after complete photolysis when the protein concentrationwas low (≤100 µM for human Hb, Fig. 2B). This apparent anomaly was resolvedwhen Antonini and coworkers (11) were able to show that tetrameric, fullyliganded Hb dissociates into dimers with an equilibrium dissociation constantK4,2 = 2–10 µM (for a review see ref. 11).

In flash photolysis experiments with dilute HbCO (≤10 µM), a large fractionof the heme groups is present as dimers since the equilibrium dissociation con-stant for Hb4(CO)4 is ~1–5 µM under physiological conditions (11,21,23). By


contrast, native deoxyHb has an equilibrium dissociation constant ≤10–10 µMat neutral pH and is completely tetrameric at micromoar heme concentrations(21). After photodissociation of Hb2(CO)2, the newly formed deoxy dimersremain in the rapidly reacting or Hb* conformation and have to reaggregate totetramers before switching back to the slowly reacting, T-state form (23).Dimer aggregation (k'2,4 ≈ 0.1 µM–1s–1) is relatively slow compared to COrebinding at high ligand concentrations (11,24,25). The mechanism for inter-preting time courses at low Hb concentrations and after complete photolysis isas follows:

(5)

The fraction of rapidly reacting Hb after complete photolysis is a measure ofthe amount of Hb2(CO)2 dimers present in the original solution. The fraction ofheme groups that is present as dimers is given by Eq. 6:

(6)

Edelstein et al. (23) have measured the fraction of rapidly reacting species as afunction of total heme concentration and shown that the K4,2 value determinedfrom these kinetic analyses is identical to that determined by molecular weightmeasurements using ultracentrifugation. At roughly the same time, Antonini,Brunori, and coworkers (11) showed that isolated α- and β-chains are alsorapidly reacting, and that all three species—triliganded tetramers, dimers, andmonomers—show roughly the same R-state ligand-binding parameters (fornewer reviews, see refs. 5,8).

3.4. CO Dissociation

Rate constants for CO dissociation from Hb are measured by mixing HbCOcomplexes with a high concentration of NO. In general, the rate constant forNO binding to Hb is ≥10 times that for CO binding. As a result, the observedreplacement rate is a direct measure of kCO (see Eq. 3, where k'CO[CO]/k'NO[NO] is ~0 as long as [CO] ≤ [NO]). For these types of replacement reac-

74 Olson et al.

tions, the intermediates containing unliganded heme groups are Hb4(CO)3,Hb4(CO)2(NO), Hb4(CO)(NO)2, and Hb4(NO)3. All these species contain threebound ligands. Consequently, the ligand replacement reaction measures onlythe first step in dissociation and, in general, shows simple behavior.

Sharma et al. (12,26) have used microperoxidase (a small heme-containingdegradation product of cytochrome-c) to scavenge CO from fully ligandedHb and attempted to determine all four rate constants for CO dissociationfrom Hb4(CO)4. Although it is difficult to analyze these data quantitativelyowing to complex side reactions of microperoxidase, Sharma et al.’s (26)work has defined the value of k1 for CO dissociation from Hb4CO to be ~0.1 s–1.

3.5. O2 Binding

As described previously, O2 reacts too rapidly with both the high- and low-affinity states of Hb to allow direct measurement of the association rate con-stant by rapid-mixing methods. Instead, laser photolysis techniques must beemployed. The quantum yield for complete O2 dissociation is ~0.05, comparedwith ~0.7 for photodissociation of CO (27,28). As result, complete photolysiscannot be achieved by conventional photographic flash lamps. The best choiceis a flash lamp–driven dye laser with a pulse length on the order of 500 ns andan energy output of 1–3 J (see ref. 7). Although easier to use, YAG lasers havea pulse length of ≤10 ns, after which substantial internal geminate recombina-tion can occur. In the case of HbO2, the extent of internal recombination is≥50%. Consequently, complete photolysis of O2 cannot be achieved with a 9-nspulse regardless of the energy output of the laser. By contrast, a dye laser pulseof ~0.5 µs is long enough to pump all the O2 out of the protein if sufficientenergy is available in the excitation pulse.

Sample time courses for O2 rebinding to human HbA at low and high free [O2]are shown in Figs. 3A and 3B, respectively. Even at high protein concentration, theobserved time courses are biphasic at all levels of photolysis. The fastest processrepresents O2 association with rapidly reacting Hb* or R-state forms of Hb. Theslower processes represent rebinding to low-affinity T-state forms. At low [O2],the rapid phase comprises about 30% of the absorbance change after completephotolysis. This result for O2 rebinding contrasts with that seen for CO rebindingafter complete photolysis using a longer pulse. In the latter case, only one slowphase is observed at high protein concentration (100% photolysis; Fig. 3A).

The persistence of rapid O2 rebinding occurs because the switch from the rap-idly reacting R-state conformation to the slowly reacting T-state tetrameric form isnot instantaneous (29–31). The rates for the R-to-T switch are between 1000 and10,000 s–1 and on the same order as the apparent rates of rebinding at 100 µM O2(~1000 s–1 to the T state and ~10,000 s–1 to the R state; see Table 1). This interpre-tation is shown schematically in Eq. 7:


(7)

After the excitation pulse, there is competition between rapid O2 rebinding to theHb* form of the newly formed deoxy tetramers and the conformational transitionto the more slowly reacting T-state tetramer (Eq. 7). If the rate of O2 association isincreased by raising its concentration, the percentage of slowly reacting formdecreases because more of the O2 molecules rebind to the R-state form before it

Fig. 3. Photolysis of human HbO2 at low and high [O2] in 0.1 M phosphate, pH 7.0,20°C. A Phase-R 2100B dye laser was used to produce a 0.5-µs excitation pulse at 577nm, and the extent of photolysis was attenuated with neutral-density filters (8). O2

rebinding was monitored at 436 nm. (A) Time courses at 100 µM free O2. Under theseconditions, the majority of the rebinding reaction is slow at 100% photolyis. (B) Timecourses at 1260 µM O2. Under these conditions, most of the reaction is fast. (Insets)At ≤10% photolysis, the reaction is monophasic and very rapid.

76 Olson et al.

can switch to the slowly reacting T-state conformation. Thus, at 1250 µM free O2(1 atm), the percentage of rapid rebinding increases to ~65% at full photolyis (Fig. 3B).

Complete analyses of O2 rebinding time courses are very complex andrequire, in addition to the normal ligand-binding parameters, the assignment ofmultiple R-to-T conformational change rate constants for all the various Adairintermediates in Eq. 4 plus consideration of dimerization (see refs. 9 and 10).However, the results in Fig. 3 do allow a qualitative estimation of O2 associa-tion rate constants. The time courses can be fitted to two exponential expres-sions, and the observed fast and slow rate parameters can be assigned to the Rand T forms. Plots of kobs (fast and slow) vs [O2] are roughly linear at highligand concentrations, and the apparent rate constants are k'TO2

≈ 9 µM–1s–1 andk'RO2

≈ 60 µM–1s–1. The rate of the slower phase does show a complex depen-dence on [O2] at low levels of ligand and incomplete saturation, making itdifficult to assign exact values for k'1 in the Adair scheme (10,30,31). By con-trast, at high [O2] and ≤10% photolysis, the value of k'4 is readily obtainedsince only the rapid phase of rebinding is observed (Fig. 3B, inset).

3.6. O2 Dissociation

Time courses for oxygen dissociation from Hb can be measured in stoppedflow, rapid-mixing experiments using the ligand replacement and consumptionreactions described in Eq. 2. When HbO2 is reacted with anaerobic buffer con-taining very high concentrations of sodium dithionite, a single phase is observedwith an overall apparent rate constant of ~60–100 s–1 at pH 7.0, 20°C (Fig. 4,lower curve). If the reaction is carried out again with CO in the dithionite solu-tion, the observed rate is two- to threefold smaller, ~30 s–1 (Fig. 4, upper curve).This difference is a reflection of the cooperative nature of O2 release in theabsence of replacing ligands. This situation is shown schematically in Eq. 8.

(8)


When O2 is consumed by dithionite in the absence of other ligands, the rateof dissociation increases as the protein switches from the R to the T conforma-tion. This switch occurs after ~2 ligands are lost. As a result, the first O2 disso-ciates at the R-state rate, which is ~30 s–1. When the second ligand dissociates,the remaining sites lose O2 immediately because their rates of dissociation are20- to 50-fold higher. Thus, the second rate is two to three times that of the firstrate, and the time course shows acceleration. Consequently, the overall first-order rate constant is two to three times greater than that for R-state Hb. WhenCO is present, the protein remains fully liganded, except for the transient for-mation of triliganded intermediate with one empty site. Under these condi-tions, only O2 dissociation from fully liganded tetramers is being measured(see Eq. 4).

The reaction of dithionite with free O2 leads to the formation of hydrogenperoxide, which can cause secondary oxidative reactions. In addition, dithionitecan also reduce methemoglobin (MetHb) impurities and degradation products.Both of these side reactions can cause large spectral changes that can interfere

Fig. 4. Time courses for O2 dissociation from human Hb in 0.1 M phosphate, pH7.0, 20°C. HbO2 (10 µM) in air-equilibrated buffer was mixed with anaerobic buffercontaining excess sodium dithionite (lower curve) and with buffer equilibrated with1 atm of CO containing excess dithionite (upper curve). The reaction was monitoredby absorbance increases at 424 nm.

78 Olson et al.

with measurement of the “true” O2 dissociation reaction. In our view, the bestmethod for measuring the value of k4 for O2 dissociation is to mix HbO2 withbuffer equilibrated with 1 atm of CO and then to vary the free [O2] in the Hbsample. The observed replacement rate should be given by the expression inEq. 3, in which X = O2 and Y = CO.

A sample time course for the reaction of human HbO2 with CO is shown inFig. 5A. The dependence of robs on [CO]/[O2] is shown in the inset. The expres-sion used to fit these data comes from rearranging Eq. 3:

(9)

kRO2 is defined as the intrinsic rate constant for O2 dissociation from a heme

group in fully liganded Hb. The value of k4 in the Adair scheme (Eq. 4) wouldbe 4kRO2

since there are four possible sites from which the O2 can be dissoci-ated in Hb4(O2)4 (for more complete discussion of statistical factors see refs. 2,5, and 6)

The fitted value for the limiting rate in the inset to Fig. 5A is 29 s–1 in 0.1 Mphosphate, pH 7.0, 20°C. This value of kRO2

is equal to the observed rateobtained when HbO2 was mixed with buffer containing both CO and high con-centrations of sodium dithionite (Fig. 4, upper curve). This analysis also allowsa quantitative determination of the ratio k'RO2/k'RCO, which can be used to con-firm assignments made in partial photolysis measurements with the correspond-ing Hb4(O2)4 and Hb4(CO)4 complexes. Thus, analysis of the CO replacementreaction can also be used to obtain values for k'RO2 if the rate of CO binding toR-state Hb has already been measured.

3.7. Differences Between α- and β-Subunits

Close examination of time courses for both O2 replacement and rebindingafter ≤10% photolysis shows systematic deviations from simple exponentialbehavior (Fig. 5A, B, top). The pattern of residuals indicates two components,one reacting ~2 times faster than the other. This systematic deviation fromsimple monophasic behavior was first noted for the replacement reaction byOlson and Gibson in 1971 (32) and attributed to differences between theα- and β-subunits within tetrameric Hb. Their interpretation has been confirmedby four different sets of experiments over the past 30 yr. Large ligands such asalkyl isocyanides enhance subunit differences (33–35). Chemical modificationof the β Cys93 with either mercurials or alkylating agents selectively increasesthe rate of O2 dissociation from β-subunits (32). Hybrid recombinant Hbs have


been constructed in which one type of subunit is mutated to be either more orless reactive toward ligands, and the other is kept as the wild-type chain (36,37).These mutant hybrids have been used to define the ligand-binding parametersof the “normal” α- and β-subunits (8). Metal hybrid Hbs have been constructedto examine the individual subunits in both the high- and low-affinity quater-nary states.

The most definitive hybrids contain Cr- and Ni-porphyrin substitutions in onetype of subunit and Fe-porphyrin in the other (see ref. 38 and references therein).The Cr(III)-porphyrin groups are inert to ligands but remain 6-coordinated owingto covalently bound water that promotes the high-affinity R state. Ni(II)-porphyrinis also inert but remains 5- or 4-coordinated, biasing the tetramer toward the T

Fig. 5. Time courses for O2 displacement by CO and O2 rebinding after partialphotolysis (≤10%) of HbO2 at pH 7.0, 20°C. (A) HbO2 in air was mixed with bufferequilibrated with 1 atm of CO. The concentrations after mixing were [HbO2] = 5 µM,[O2] = 131 µM, and [CO] = 500 µM. (�) Observed data; solid line —— a fit to a singleexponential expression with kobs = 9.5 s–1. (Top) Differences between observed dataand fitted line (residuals). (Inset) Dependence of apparent pseudo first-order rate con-stant on [CO]/[O2]. The circles represent the observed rate constants and the line a fitto Eq. 9. (B) Time courses for O2 rebinding after 10% photolysis of 100 µM HbO2

taken from the inset in Fig. 3B. (Inset) The circles represent observed data and the linea fit to a single exponential expression with kobs = 76,000 s–1.

80 Olson et al.

quaternary structure. Unzai et al. (38) have used (α(Fe)β(Cr))2 and (α(Cr)β(Fe))2to assign rate constants to the individual subunits in the R conformation and(α(Fe)β(Ni))2 and (α(Ni)β(Fe))2 to assign T-state rate parameters.

Quantitative analyses of time courses for ligand binding to Hb become diffi-cult if subunit differences are taken into account. Twenty different intermedi-ates must be considered if the two quaternary states and their rates ofinterconversion are considered explicitly. This situation is made even moredifficult if low concentrations of heme are used and dissociation into dimersoccurs. However, this complexity should not inhibit investigators from makingthe kinetic measurements shown in Figs. 1–5, particularly if the goal is to sur-vey mutant or species differences. Simple experiments that are readily carriedout are provided in Table 2. Rate constants for the ligand binding to the R state(defined here as the last step in the Adair scheme in Eq. 4) are readily deter-mined from simple exponential analysis of ligand replacement time coursesand rebinding time courses after ≤10% photolysis. The rate constant for COassociation to T-state deoxyHb can be estimated by simple mixing experiments.The rate constant for O2 association to the T state can be obtained from analy-sis of the slow phases observed after total photolysis of HbO2 at high ligandconcentrations. The dissociation rate constants for the first step in ligand bind-ing to the T state are much more difficult to measure for native tetrameric Hb.

Table 2Simple Methods for Assigning Rate Constants toT (Initial Step) and R (Final Step) Forms of Human Hb

Ligand Rate parameter Technique Reaction

CO k'T (association) Stopped flow Hb4 + CO – simple bindingk'R (association) Conventional Hb4(CO)4 – partial (≤10%) photolysis

flashkR (dissociaton) Stopped flow Hb4(CO)4 + NO – ligand replacement

O2 k'T (association) Laser photolysis Hb4(O2)4 – slow phase after 100%photolysis

k'R (association) Laser photolysis Hb4(O2)4 – partial (≤10%) photolysiskR (dissociation) Stopped flow Hb4(O2)4 + CO – ligand replacement

NO k'T (association) Stopped flow Hb4 + NO – simple binding at verylow [Hb],[NO]

k'R (association) Laser photolysis Hb4(NO)4 – partial (≤10%) photolysiskR (dissociation) Conventional Hb4(NO)4 + CO(excess DT) or

mixing Hb4(NO)4 + O2 – ligand replacementand NO scavenging (very slow)

k'NO,ox Stopped flow Hb4(O2)4 + NO – NO dioxygenation,Hb oxidation at very low [HbO2], [NO]


In the case of O2, the T-state dissociation rate constant is often estimated byanalyzing oxygen equilibrium curves, fixing the R-state parameters and theT-state association rate constants from direct kinetic measurements, and thenfitting for the allosteric constant (L = [Hb4(T)]/[Hb4(R)]) and kT.

In general, simple analyses that assume subunit equivalence and only twostates are inadequate for understanding the detailed structural mechanismsunderlying cooperative ligand binding. However, the results in Table 1 showthat the differences between the subunit rate constants are less than a factor of2 for native human HbA. Unzai et al. (38) have argued that even though thestructural mechanism for the change in ligand affinity differs significantlybetween the α- and β-subunits, the two subunits have evolved similar rate andequilibrium constants for O2 binding in order to maximize the amount ofobserved cooperativity.

Thus, the parameters for a simple two-step scheme do provide a usefulframework for understanding O2 transport (first three rows in Table 1). Theefficiency of O2 delivery depends primarily on the extent and rate of changesin fractional saturation of Hb at different oxygen tensions. As a result, thesimple set of parameters, which assumes subunit equivalence, is primarily suf-ficient to simulate the O2 transport properties of native Hb in capillary experi-ments (39,40).

3.8. Reversible NO Binding

The reactions of NO with Hb are important for detoxifying NO and prevent-ing its transport. The two key reactions are the reversible binding of NO to theferrous iron atom in deoxyHb and the oxidative reaction of NO with bound O2to produce nitrate and metHb. In both cases, the rate-limiting step is the cap-ture of NO in the distal pocket of Hb subunits (41). Once inside the protein,NO reacts extremely rapidly, presumably on picosecond time scales, with eitherthe heme iron atom or bound O2 atoms. As a result, both reactions are veryrapid: k'NO and k'NO,ox ≈ 60 µM–1s–1 at pH 7.0, 20°C (41).

The reaction of NO with deoxyHb is very rapid even when the protein is fullyunliganded and in the T quaternary state. In 1975, Cassoly and Gibson (17)reported that the bimolecular rate constant, k'NO, is ~40 µM–1s–1 for both the firstand last steps in ligand binding. More recent measurements suggest that k'1 forNO may be twofold less than k'4 (unpublished data), and there may also be smallsubunit differences (see ref. 41). However, to first approximation, Cassoly andGibson (17) were correct. The rate of NO binding to deoxyHb is governed exclu-sively by the rate of ligand entry into the protein and not the R-to-T transition,which affects primarily reactivity at the iron atom.

Since the NO dissociation rate constants are very small, 0.001–0.00003 s–1

(13,42), it is possible to measure the rate of the overall binding reaction in rapid-

82 Olson et al.

mixing experiments. However, very low protein and ligand concentrations mustbe used, and only small, very rapid absorbance changes can be observed. Thehalf-time of the reaction at 1 µM deoxyHb and 1 µM NO is 1/(~40 µM–1s–1 · 1 µM)≈ 0.025 s. If the NO concentration is raised to 10 µM, the rate becomes ~400 s–1,the half time is ~1.6 ms, and >70% of the absorbance change occurs in the deadtime of the apparatus (for equivalent time courses, see Figs. 6 and 7). In addi-tion, great care must be taken to maintain anaerobic conditions in the absenceof any added dithionite since both O2 and dithionite will consume the smallamounts of NO required for the experiments.

NO rebinding can be measured at high ligand concentrations using laserphotolysis techniques. The problem in this case is that the quantum yield forcomplete photodissociation of NO into the solvent phase is ~0.001 at room

Fig. 6. Time courses for the reactions of human HbO2 and sperm whale MbO2 withequimolar amount of NO in 0.1 M phosphate, pH 7.0, 20°C. The concentrations ofreactants after mixing were 1 µM. If the reaction is second order and irreversible, plotsof 1/[HbO2] vs time should be linear, and the slope determines the bimolecular rate ofNO dioxygenation, k'NO,ox. (Inset) Plots for all three proteins.


temperature. The practical consequence is that no more than 20–30% photoly-sis can be achieved, even with a 0.5-µs excitation pulse of ~2 to 3 J (28). Thus,only partial photolysis time courses can be measured. The observed rates underthese R-state conditions are ~60 µM–1s–1 at pH 7.0, 20°C (41), which is about1.5- to 2-fold greater than the association rate constant measured by mixingfully deoxygenated Hb with NO at very low heme concentrations (17).

Fig. 7. Reactions of HbO2 and MbO2 with excess NO. The conditions are the sameas those in Fig. 6. (Top panel) Observed time courses for reaction of 10 µM NO withhuman HbO2 and sperm whale MbO2. The secondary phases represent binding of NOto newly formed ferric forms of the proteins. (Bottom panel) Dependence of observedpseudo first-order rate constants for the fast phases on [NO] after mixing. The reactionwith the V68F MbO2 mutant is included to show that the linearity is observed over awide range of NO concentrations (see ref. 41).

84 Olson et al.

NO dissociation from fully liganded Hb can be measured in three ways.First, Moore and Gibson (13) showed that kRNO can be measured directly bymixing HbNO with a concentrated solution of dithionite containing 1000 µM(1 atm) CO. As shown in Eq. 10, the added CO will occupy the deoxy sitesformed by NO dissociation long enough for the NO to be consumed bydithionite:

(10)

In the absence of CO, the reaction of released NO with the newly formeddeoxyHb site will compete effectively with the reaction with dithionite, and theobserved rate will be much smaller than the true value of kNO. Second, Sharmaand Ranney (42) used excess deoxyMb to scavenge NO from nitrosylHb; how-ever, this method is complex owing to the need for very high concentrations ofdeoxyMb, which makes simple absorbance measurements difficult.

Third, an equally valid method is to expose HbNO to high concentrations ofO2 and measure the rate of autoxidation to MetHb. The mechanism of thisreaction is as follows:

(11)

In this case, the newly formed deoxyHb site reacts rapidly with O2 since theratio k'O2[O2]/k'NO[NO] is always kept ≥100 (note that in Table 1, k'O2 ≈ k'NOfor R-state Hb). The newly dissociated NO will react rapidly with bound O2 toform metHb and nitrate. NO can also react with free O2 to produce nitrite. Thelatter reaction is very slow at low NO concentrations (t1/2 ≈ minutes at 1 µMNO (43)) when compared with the reactions of NO with Hb and HbO2 (t1/2 ≈0.1–10 ms at 1–10 µM heme (41)).

Foley et al. (unpublished observation) and Eich (14) have shown that thereis a 1:1 correlation between the rates of autoxidation of ~30 different mutantnitrosylmyoglobins and the corresponding rate constants for NO dissociation


measured using the CO/dithionite method of Moore and Gibson (13). The samecorrelation holds for nitrosylHb.

NO binding at low levels of Hb saturation is complicated by the formationof pentacoordinate NO-heme complexes in α-subunits, particularly at low pHand in the presence of organic phosphates (44,45). The formation of thepentacoordinate complex is slow (t1/2 ≈ 1 s) compared to ligand binding (47).Its formation also causes ligand reequilibration from an equal mixture of αNOand βNO to predominately αNO complexes in the first Adair intermediate,Hb4NO (46). These complications are manifested as slow, small absorbancechanges when deoxyHb is mixed with subsaturating levels of NO. Fortunately,these secondary changes have little effect on the measured rate constants aslong as NO is in excess in the mixing or photolysis experiments.

3.9. NO Dioxygenation by HbO2

It has been known for a long time that the addition of NO to either HbO2 oroxymyoglobin causes a very rapid and stoichiometric oxidation of the hemegroup and formation of nitrate (see references in refs. 47 and 48). This reactionhas been used for more than 20 yr as a simple assay for NO synthase activity(for a review, see ref. 49). However, the physiological importance of this pro-cess has become clear only within the last 10 yr. HbO2 in red cells and oxy-myoglobin in muscle tissue detoxify NO by converting it to NO3

–. Thisscavenging function prevents NO from being transported into actively respir-ing tissue, where it would inhibit both aconitase and cytocrome oxidase andshut down oxidative phosphorylation (50–53). Gardner (54–56) has called thisactivity NO dioxygenation and has shown that it is catalyzed efficiently byflavohemoglobins from various microorganisms, in which the expression ofthe gene is turned on by the addition of toxic levels of NO. Extracellular Hbscavenges NO much more rapidly than Hb packaged in red cells owing to itscloser proximity to the endothelium and extravasation into the vessel walls(57,58). The net results are loss of NO signal molecules, little activation ofguanylyl cyclase, sustained smooth muscle contraction, and elevated of bloodpressure. Thus, we and others have looked for ways to reduce the reactivity ofHbO2 with NO in order to design safer and more effective Hb-based bloodsubstitutes (58–61).

Time courses for the reaction of 1 µM NO with 1 µM HbO2, oxymyoglobin,and a slowly reacting mutant of myoglobin (V68F, Val68[E11] to Phe) areshown in Fig. 6. Plots of 1/[HbO2]remaining or 1/[MbO2]remaining vs time are lin-ear, indicating simple, irreversible reactions. The bimolecular rate constantsfor HbO2, wild-type MbO2, and V68F MbO2 are 65, 35, and 10 µM–1s–1, respec-tively. Further proof that the reaction is bimolecular and depends directly onthe first power of [NO] is shown in Fig. 7B. When the reactions are carried out

86 Olson et al.

under pseudo first-order conditions, [NO] ≥ 5 · [HbO2], there is a linear depen-dence of kobs on [NO], and the slopes of these plots give rate constants equal tothose determined in the equimolar-mixing experiments.

The problems associated with the NO dioxygenation reaction are shown inFig. 7. First, the reactions are very fast and difficult to measure, and it is hardto get more than 2 or 3 points for kobs vs [NO] plots. At 10 µM NO, well overhalf the reaction with HbO2 is “lost” in the dead time of the apparatus (Fig. 7A).Second, excess free NO can react with newly formed MetHb and MetMb spe-cies, causing slow absorbance changes that often occur in the opposite direc-tion of the oxidation reaction (Fig. 7A, right). Third, care must be taken tokeep O2 out of the NO solutions and the plastic portions of the mixing device.Otherwise, NO will react slowly with free O2 to produce nitrite in a reactionthat consumes 4 NO mol/O2. The resultant nitrite will eventually oxidize HbO2but at a much slower rate.

Fourth, at high pH (≥8.5), a spectral intermediate can be observed and hasbeen assigned to an Fe3+-peroxynitrite complex by Herold and coworkers(63,64) (Fig. 8). Thus, the kinetic scheme for NO dioxygenation reactionsneeds at least two steps at alkaline pH:

(12)

The peroxynitrite intermediate, Hb(Fe3+OONO–), is formed by a bimolecularprocess with a rate constant similar to that observed for the overall reaction atpH 7.0, ~50–70 µM–1s–1 (62). This intermediate decays by a first-order processinto MetHb and nitrate with no release of peroxynitrite or any ferryl hemeformation (63). The rate of decay of the intermediate for both HbO2 and MbO2increases with decreasing pH. At pH 7.0, it decays too rapidly to be observed.The overall reaction is limited by the bimolecular capture of NO, and simplemonophasic kinetic behavior is observed (Fig. 6). In the case of Hb at high pH,the time course of the intermediate decay is biphasic, and Herold (63) has sug-gested that this is owing to subunit differences.

Although difficult to measure, the physiological importance of the NOdioxygenation reaction requires that it be examined routinely in studies of bothnative and recombinant Hbs. The simplest approach is that shown in Figs. 6and 7. For example, Eich et al. (41) used these types of experiments to show


that Val(E11) to Phe or Trp substitutions in β-subunits and Leu(B10) to Phe orTrp substitutions in α-subunits reduce the rate of NO dioxygenation by HbO2markedly, up to 10- to 30-fold. Herold et al. (63) used similar methods to char-acterize the chemistry of the NO dioxygenation reaction with both oxymyoglo-bin and HbO2.

AcknowledgmentsThis research was supported by United States Public Health Service

grants GM 35649 and HL 47020 and grant C-612 from the Robert A. WelchFoundation. DHM and EWF were recipients of predoctoral fellowships fromNIH Biotechnology Training Grant GM 08362.

Fig. 8. Reaction of HbO2 with NO in 0.1 M borate, pH 9.0, 20°C. HbO2 (50 µMafter mixing) was reacted with an equimolar amount of NO in an OLIS RSM stopped-flow apparatus, and spectra were collected as rapidly as possible (one spectrum every1 millisecond) in the visible wavelength region (470–670 nm). As shown originally byHerold et al. (64), a spectral species (– – –) resembling the complex of nitrite withMetHb is formed in the dead time of the apparatus. This intermediate decays in a first-order process to the final hydroxymethemoglobin product (· · ·) with an overall half-time of ~0.020 s.

88 Olson et al.

References1. Hartridge, H. and Roughton, F. J. W. (1923) A method of measuring the velocity

of very rapid chemical reactions. Proc. Roy. Soc. A 104, 376–394.2. Gibson, Q. H. (1959) The kinetics of reactions between haemoglobins and gases,

in Progress in Biophysical Chemistry, vol. 9 (Butler, J. A. and Katz, B., eds.),Pergamon, New York, pp. 1–53.

3. Gibson, Q. H. and Milnes, L. (1964) Apparatus for rapid and sensitive spectro-photometry. Biochem. J. 91(1), 161–171.

4. Gibson, Q. (1978) Flash photolysis techniques. Methods Enzymol. 54, 93–101.5. Olson, J. S. (1981) Stopped-flow, rapid mixing measurements of ligand binding

to hemoglobin and red cells. Methods Enzymol. 76, 631–651.6. Olson, J. S. (1981) Numerical analysis of kinetic ligand binding data. Methods

Enzymol. 76, 652–667.7. Sawicki, C. A. and Morris, R. J. (1981) Flash photolysis of hemoglobin. Methods

Enzymol. 76, 667–681.8. Mathews, A. J. and Olson, J. S. (1994) Assignment of rate constants for O2 and

CO binding to alpha and beta subunits within R- and T-state human hemoglobin.Methods Enzymol. 232, 363–386.

9. Henry, E. R., Jones, C. M., Hofrichter, J., and Eaton, W. A. (1997) Can a two-state MWC allosteric model explain hemoglobin kinetics? Biochemistry 36(21),6511–6528.

10. Gibson, Q. H. (1999) Kinetics of oxygen binding to hemoglobin A. Biochemistry38(16), 5191–5199.

11. Antonini, E., and Brunori, M. (1971) Hemoglobin and myoglobin in their reac-tions with ligands, in Frontiers in Biology (Neuberger, A. and Tatum, E. L., eds.),North-Holland, Amsterdam.

12. Sharma, V. S., Ranney, H. M., Geibel, J. F., and Traylor, T. G. (1975) A newmethod for the determination of ligand dissociation rate constant of carboxyhe-moglobin. Biochem. Biophys. Res. Commun. 66(4), 1301–1306.

13. Moore, E. and Gibson, Q. (1976) Cooperativity in the dissociation of nitric oxidefrom hemoglobin. J. Biol. Chem. 251, 2788–2794.

14. Eich, R. F. (1997), Reactions of nitric oxide with myoglobin, PhD thesis, RiceUniversity, Houston, TX.

15. Olson, J. S., and Phillips, G. N. Jr. (1996) Kinetic pathways and barriers for ligandbinding to myoglobin. J. Biol. Chem. 271(30), 17,593–17,596.

16. Gibson, Q. H. and Roughton, F. J. (1965) Further studies on the kinetics and equi-libria of the reaction of nitric oxide with haemoproteins. Proc. R. Soc. Lond. B.Biol. Sci. 163(991), 197–205.

17. Cassoly, R. and Gibson, Q. (1975) Conformation, co-operativity and ligand bind-ing in human hemoglobin. J. Mol. Biol. 91(3), 301–313.

18. Scott, E. E., Gibson, Q. H., and Olson, J. S. (2001) Mapping the pathways for O2

entry into and exit from myoglobin. J. Biol. Chem. 276(7), 5177–5188.19. Monod, J., Wyman, J., and Changeux, J.-P. (1965) On the nature of allosteric

transitions: a plausible model. J. Mol. Biol. 12, 88–118.


20. Gibson, Q. H. and Edelstein, S. J. (1987) Oxygen binding and subunit interactionof hemoglobin in relation to the two-state model. J. Biol. Chem. 262(2), 516–519.

21. Ackers, G. K. (1998) Deciphering the molecular code of hemoglobin allostery.Adv. Protein Chem. 51, 185–253.

22. Gibson, Q. H. (1959) The Photochemical formation of a quickly reacting form ofhemoglobin. Biochem. J. 71, 293–303.

23. Edelstein, S. J., Rehmar, M. J., Olson, J. S., and Gibson, Q. H. (1970) Functionalaspects of the subunit association-dissociation equilibria of hemoglobin. J. Biol.Chem. 245(17), 4372–4381.

24. Andersen, M. E., Moffat, J. K., and Gibson, Q. H. (1971) The kinetics of ligandbinding and of the association-dissociation reactions of human hemoglobin: prop-erties of deoxyhemoglobin dimers. J. Biol. Chem. 246(9), 2796–807.

25. McGovern, P., Reisberg, P., and Olson, J. S. (1976) Aggregation of deoxyhemo-globin subunits. J. Biol. Chem. 251(24), 7871–7879.

26. Sharma, V. S., Schmidt, M. R., and Ranney, H. M. (1976) Dissociation of COfrom carboxyhemoglobin. J. Biol. Chem. 251(14), 4267–4272.

27. Gibson, Q. H., Olson, J. S., McKinnie, R. E., and Rohlfs, R. J. (1986) A kineticdescription of ligand binding to sperm whale myoglobin. J. Biol. Chem. 261(22),10,228–10,239.

28. Olson, J. S., Rohlfs, R. J., and Gibson, Q. H. (1987) Ligand recombination to the alphaand beta subunits of human hemoglobin. J. Biol. Chem. 262(27), 12,930–12,938.

29. Sawicki, C. A. and Gibson, Q. H. (1976) Quaternary conformational changes inhuman hemoglobin studied by laser photolysis of carboxyhemoglobin. J. Biol.Chem. 251(6), 1533–1542.

30. Sawicki, C. A. and Gibson, Q. H. (1977) Properties of the T state of human oxy-hemoglobin studies by laser photolysis. J. Biol. Chem. 252(21), 7538–7547.

31. Sawicki, C. A. and Gibson, Q. H. (1977) Quaternary conformational changes inhuman oxyhemoglobin studied by laser photolysis. J. Biol. Chem. 252(16),5783–5788.

32. Olson, J. S., Andersen, M. E., and Gibson, Q. H. (1971) The dissociation of thefirst oxygen molecule from some mammalian oxyhemoglobins. J. Biol. Chem.246(19), 5919–5923.

33. Reisberg, P. I. and Olson, J. S. (1980) Kinetic and cooperative mechanisms ofligand binding to hemoglobin. J. Biol. Chem. 255(9), 4159–4169.

34. Reisberg, P. I. and Olson, J. S. (1980) Rates of isonitrile binding to the isolatedalpha and beta subunits of human hemoglobin. J. Biol. Chem. 255(9), 4151–4158.

35. Reisberg, P. I. and Olson, J. S. (1980) Equilibrium binding of alkyl isocyanides tohuman hemoglobin. J. Biol. Chem. 255(9), 4144–4150.

36. Mathews, A. J., Olson, J. S., Renaud, J. P., Tame, J., and Nagai, K. (1991) Theassignment of carbon monoxide association rate constants to the alpha and betasubunits in native and mutant human deoxyhemoglobin tetramers. J. Biol. Chem.266(32), 21,631–21,639.

37. Mathews, A. J., Rohlfs, R. J., Olson, J. S., Tame, J., Renaud, J. P., and Nagai, K.(1989) The effects of E7 and E11 mutations on the kinetics of ligand binding to Rstate human hemoglobin. J. Biol. Chem. 264(28), 16,573–16,583.

90 Olson et al.

38. Unzai, S., Eich, R., Shibayama, N., Olson, J. S., and Morimoto, H. (1998) Rateconstants for O2 and CO binding to the alpha and beta subunits within the R andT states of human hemoglobin [in process citation]. J. Biol. Chem. 273(36),23,150–23, 159.

39. Lemon, D. D., Nair, P. K., Boland, E. J., Olson, J. S., and Hellums, J. D. (1987)Physiological factors affecting O2 transport by hemoglobin in an in vitro capillarysystem. J. Appl. Physiol. 62(2), 798–806.

40. Page, T. C., Light, W. R., and Hellums, J. D. (1998) Prediction of microcircula-tory oxygen transport by erythrocyte/hemoglobin solution mixtures. Microvasc.Res. 56(2), 113–126.

41. Eich, R. F., Li, T., Lemon, D. D., Doherty, D. H., Curry, S. R., Aitken, J. F.,Mathews, A. J., Johnson, K. A., Smith, R. D., Phillips, G. N. Jr., and Olson, J. S.(1996) Mechanism of NO-induced oxidation of myoglobin and hemoglobin. Bio-chemistry 35(22), 6976–6983.

42. Sharma, V. S. and Ranney, H. M. (1978) The dissociation of NO from nitrosyl-hemoglobin. J. Biol. Chem. 253(18), 6467–6472.

43. Beckman, J. S. and Koppenol, W. H. (1996) Nitric oxide, superoxide, and peroxy-nitrite: the good, the bad, and ugly. Am. J. Physiol. 271(5 Pt. 1), C1424–C1437.

44. Perutz, M. F., Kilmartin, J. V., Nagai, K., Szabo, A., and Simon, S. R. (1976)Influence of globin structures on the state of the heme. Ferrous low spin deriva-tives. Biochemistry 15(2), 378–387.

45. Hille, R., Olson, J. S., and Palmer, G. (1979) Spectral transitions of nitrosyl hemesduring ligand binding to hemoglobin. J. Biol. Chem. 254(23), 12,110–12,120.

46. Hille, R., Palmer, G., and Olson, J. S. (1977) Chain equivalence in reaction ofnitric oxide with hemoglobin. J. Biol. Chem. 252(1), 403–405.

47. Doyle, M. P., Pickering, R. A., DeWeert, T. M., Hoekstra, J. W., and Pater, D.(1981) Kinetics and mechanism of the oxidation of human deoxyhemoglobin bynitrites. J. Biol. Chem. 256(23), 12,393–12,398.

48. Wade, R. S. and Castro, C. E. (1996) Reactions of oxymyoglobin with NO, NO2,and NO2- under argon and in air. Chem. Res. Toxicol. 9(8), 1382–1390.

49. Stuehr, D. J. (1997) Structure-function aspects in the nitric oxide synthases. Annu.Rev. Pharmacol. Toxicol. 37, 339–359.

50. Gladwin, M. T., Ognibene, F. P., Pannell, L. K., Nichols, J. S., Pease-Fye, M.E., Shelhamer, J. H., and Schechter, A. N. (2000) Relative role of hemenitrosylation and beta-cysteine 93 nitrosation in the transport and metabolismof nitric oxide by hemoglobin in the human circulation. Proc. Natl. Acad. Sci.USA 97(18), 9943–9948.

51. Brunori, M. (2001) Nitric oxide moves myoglobin centre stage. Trends Biochem.Sci. 26(4), 209–210.

52. Brunori, M. (2001) Nitric oxide, cytochrome-c oxidase and myoglobin. TrendsBiochem. Sci. 26(1), 21–23.

53. Thomas, D. D., Liu, X., Kantrow, S. P., and Lancaster, J. R. Jr. (2001) The bio-logical lifetime of nitric oxide: implications for the perivascular dynamics of NOand O2. Proc. Natl. Acad. Sci. USA 98(1), 355–360.


54. Gardner, P. R., Gardner, A. M., Martin, L. A., Dou, Y., Li, T., Olson, J. S., Zhu,H., and Riggs, A. F. (2000) Nitric-oxide dioxygenase activity and function offlavohemoglobins. sensitivity to nitric oxide and carbon monoxide inhibition.J. Biol. Chem. 275(41), 31,581–31,587.

55. Gardner, P. R., Gardner, A. M., Martin, L. A., and Salzman, A. L. (1998) Nitricoxide dioxygenase: an enzymic function for flavohemoglobin. Proc. Natl. Acad.Sci. USA 95(18), 10,378–10,383.

56. Gardner, A. M., Martin, L. A., Gardner, P. R., Dou, Y., and Olson, J. S. (2000)Steady-state and transient kinetics of Escherichia coli nitric-oxide dioxygenase(flavohemoglobin). The B10 tyrosine hydroxyl is essential for dioxygen bindingand catalysis. J. Biol. Chem. 275(17), 12,581–12,589.

57. Liu, X., Miller, M. J., Joshi, M. S., Sadowska-Krowicka, H., Clark, D. A., andLancaster, J. R. Jr. (1998) Diffusion-limited reaction of free nitric oxide witherythrocytes. J. Biol. Chem. 273(30), 18,709–18,713.

58. Doherty, D. H., Doyle, M. P., Curry, S. R., Vali, R. J., Fattor, T. J., Olson, J. S.,and Lemon, D. D. (1998) Rate of reaction with nitric oxide determines the hyper-tensive effect of cell-free hemoglobin [see comments]. Nat. Biotechnol. 16(7),672–676.

59. Olson, J. S. (1994) Genetic engineering of myoglobin as a simple prototype forhemoglobin- based blood substitutes. Artif Cells Blood Substit Immobil Biotechnol22(3), 429–441.

60. Olson, J. S., Eich, R. F., Smith, L. P., Warren, J. J., and Knowles, B. C. (1997)Protein engineering strategies for designing more stable hemoglobin-based bloodsubstitutes. Artif. Cells Blood Substit Immobil. Biotechnol. 25(1–2), 227–241.

61. Tsai, C. H., Fang, T. Y., Ho, N. T., and Ho, C. (2000) Novel recombinant hemo-globin, rHb (beta N108Q), with low oxygen affinity, high cooperativity, and sta-bility against autoxidation. Biochemistry 39(45), 13,719–13,729.

62. Herold, S. (1999) Kinetic and spectroscopic characterization of an intermediateperoxynitrite complex in the nitrogen monoxide induced oxidation of oxyhemo-globin. FEBS Lett. 443(1), 81–84.

63. Herold, S., Exner, M., and Nauser, T. (2001) Kinetic and mechanistic studies ofthe NO*-mediated oxidation of oxymyoglobin and oxyhemoglobin. Biochemistry40(11), 3385–3395.

64. Herold, S. (1999) Mechanistic studies of the oxidation of pyridoxalated hemoglo-bin polyoxyethylene conjugate by nitrogen monoxide. Arch. Biochem. Biophys.372(2), 393–398.

92 Olson et al.

Electrophoretic Methods for Study of Hbs 93

6

93


Electrophoretic Methods for Study of Hemoglobins

Henri Wajcman

1. IntroductionElectrophoresis, a technique consisting of the migration of electrically

charged molecules under an applied electric field, occupies one of the mostimportant places in the history of the study of hemoglobin (Hb). HbS, the firstabnormal Hb described, was discovered in 1949 by Pauling et al. (1), usingmoving boundary electrophoresis. Later, Hb variants were detected by zoneelectrophoresis on paper, starch gel, or cellulose acetate (2,3). With the excep-tion of cellulose acetate electrophoresis, which is still used in some laborato-ries, these procedures have been replaced by isoelectric focusing (IEF) (4). InIEF, a pH gradient is established by carrier ampholytes subjected to an electriccurrent. The Hb molecule migrates across this gradient until it reaches the posi-tion where its net charge is zero (isoelectric point [pI]). It then concentratesinto a sharp band.

The most traditional and largely used methods of identifying and studyingnormal and mutant Hbs are the panoply of electrophoretic methods. This chap-ter describes the strengths and weakness of the most commonly used electro-phoretic methods to separate Hbs. This electrophoretic approach needs to beassessed by other criteria, taking into accounts geographic and ethnic distribu-tion as well as hematological and clinical presentation. In some cases addi-tional tests such as biophysical or functional properties or mass spectrometrydeterminations may be required.

For the last 20 yr in the Hemoglobin laboratory of Henri Mondor Hospital(Créteil, France) we have taken a multicriteria approach to the study of Hb,leading to a presumptive diagnosis for most of the known Hb variants. Theelectrophoretic mobility of more than 400 Hb variants is stored in a data bankunder a format convenient for comparison based on an approach close to that

94 Wajcman

proposed some 20 yr ago by Barwick and Schneider (5). This strategy includestests done on native Hbs (IEF on polyacrylamide gel, electrophoresis on cellu-lose acetate at alkaline pH, and citrate agar electrophoresis), and tests on disso-ciated globins (electrophoreses of globin chains in 6 M urea at pH 6.0 and 9.0or in the presence of Triton X-100). The electrophoretic mobility of the vari-ants is measured according to a quantified method that is described next. In ourlaboratory, a wide collection of identified rare variants is stored in liquid nitro-gen and may be used, in a last step, as specific controls.

2. Materials and Methods2.1. Isoelectric Focusing

IEF studies of Hb may be done on polyacrylamide or agarose gels contain-ing free ampholytes. These gels can be homemade (6–7), but it is more conve-nient to use IEF plates polymerized on support films, which are commerciallyavailable from several manufacturers (e.g., Perkin-Elmer, Norwalk, CT;Wallac, Akron, OH; Amersham Pharmacia Biotech, Uppsala, Sweden; Serva,Heidelberg, Germany). Polyacrylamide gels were the first ones used (6). Aga-rose gels suitable for IEF became only available later, when chemical treat-ments were developed to remove or mask the charged agaropectin residuespresent in the raw material. Agarose gels exhibit stronger electroendosmosisthan polyacrylamide gels. Pores within this gel are also larger, making themmore suitable for large proteins. In addition, agarose gels are also selected forroutine work because they are not toxic and do not contain catalysts, whichcould interfere with the Hb molecule and thus lead to separation artifacts.

Later, procedures were developed to cast polyacrylamide gels with covalentlybound immobilized pH gradients. This technique allows the preparation of gelplates with pH ranges of <1 pH unit, thus leading to a much higher resolution(8,9). To increase the separation of some Hb fractions, such as HbF or glycatedHbs, some investigators have proposed that the pH gradient in the region wherethese Hbs migrate be flattened (10). This is achieved by adding, when prepar-ing the gel, separators such as ε-amino caproic acid, or β-alanine.

2.1.1. IEF on Agarose Gel

IEF on agarose gels is presently the screening method of choice for bothHbs in cord blood and adult blood samples. Together with cation-exchangehigh-performance liquid chromatography, it should be among the first tests tobe used when an Hb disorder is suspected.

IEF is usually performed using a commercially available agarose plate con-taining a mixture of ampholytes in the pH 6.0–8.0 range. IEF is run on aMultiphor II electrophoresis unit (Amersham Pharmacia Biotech), or on any


similar equipment. The gel is carefully placed on the cooling plate refrigeratedat 10°C. On each lane, 3–5 µL of hemolysate containing 10–15% Hb is applied,using a sample application template. This Hb sample may be either eluted froma blood spot collected on dry paper or obtained by hemolysis of whole blood orwashed erythrocytes. When the Hb concentration is higher than 15%, the vol-ume used needs to be reduced in proportion.

A wick properly wetted with an acid solution is positioned at the anode andanother one with a basic solution at the cathode. Couples of solutions generallyused are 1 M H3PO4/1 M NaOH or 0.5 M acetic acid/0.5 M ethanolamine. IEFis run with a voltage limited at 1600 V. To avoid formation of spurious bandsresulting from the oxidation of oxyHb into methemoglobin (MetHb), thesample may be prepared in a medium containing 0.1% KCN, which will con-vert the MetHb into cyanMetHb, which displays the same charge as oxyHb.Another possibility is to have the KCN included at a concentration of 0.1% inthe catholyte, which would avoid the formation of MetHb during the run.

Hb bands are visualized by using a staining system containing o-dianisidine,which is readily oxidized by heme in the presence of hydrogen peroxide. Thereaction also forms an insoluble precipitate that intensifies each band andavoids diffusion.

Manuals provided by the manufacturer of IEF gels usually detail all theexperimental procedures to follow.

2.1.2. IEF on Polyacrylamide Gels

A higher resolution of Hb fractions is obtained by using polyacrylamidegels instead of agarose gels, but this is only done as a further step in the inves-tigation of an Hb variant. This IEF procedure allows one to distinguish variantshaving pIs differing by 0.02 pH unit (11). With the advent of immobilized pHgradients, it became possible to separate Hb species differing by 0.001 pH unit.Variants with such small differences in their pIs usually result from structuralchanges consecutive to an exchange between amino acids identically chargedbut differing in their size. In some cases, this could lead to slight modificationsin the exposure of charged groups, which are totally or partially buried in thenative oxy structure.

In our laboratory, we prefer to use homemade polyacrylamide, which per-mits us to work with a specially designed pH gradient. The actual procedure isas follows:

1. For a 260 × 125 × 0.5 mm plate, in a 50-mL Erlenmeyer flask, add 4.5 mL of 2%acrylamide (19.4 g/dL of acrylamide, 0.6 g/dL of bis-acrylamide, prepared nomore than 2 wk earlier and stored in a dark bottle); 0.9 mL of ampholine, pH 6.0–8.0; and 1.05 mL of ampholine, pH 7.0–9.0, to 11.7 mL of distilled water.

96 Wajcman

2. To prevent formation of MetHb, add 12 mg of KCN to the gel.3. Degas the solution for 8 min under vacuum and add 5 to 6 µL of TEMED (Sigma

Aldrich, Saint Quentin Fallavier, France).4. Add 250 µL of a freshly prepared 3% ammonium persulfate (Merck, Darmstadt,

Germany) solution.5. Promptly pour this mixture with a 10-mL pipet into a cassette made from a 3-mm

glass plate on which is placed a 1-mm glass plate, a 0.5-mm-thick gasket, and aPlexiglas plate, all maintained by 12 LKB clamps. Polymerization takes 2 h atroom temperature (see Note 1). Conditions of migration in these gels are almostidentical to the previously described (1600 V, 2 h).

2.2. Citrate Agar Electrophoresis

In a second step of investigation, all the mutants found through IEF are sub-jected to citrate agar electrophoresis. This method was introduced for Hb studysome 40 yr ago and represents a combination of electrophoresis and chroma-tography. It is not primarily sensitive to the charge of the mutated residue butto structural modifications of positively charged regions of the Hb moleculeinteracting with the agaropectin matrix contained in the gel (12). These regionsof the molecule are usually those involved in Hb/ion interaction. Position β6,where the structural abnormality of HbS is located, is close to one of theseregions and therefore leads to highly specific profiles when modified.

The buffer used for this type of electrophoresis is made from 50 mM sodiumcitrate adjusted to pH 5.8 by a few drops of a 30% citric acid solution. Under acurrent of 60 mA and a voltage of about 60–100 V, electrophoresis is done at4°C for 45–60 min. Agar plates are available from several manufacturers (Hel-ena Laboratories, Beaumont, TX) or may be homemade. In the Paragon kit(Beckman), maleate buffer is used instead of citrate buffer. Migration ismeasured according to a normalized scale in which HbA = 0, HbF = –4.4, andHbC = 10 (see Note 2).

2.3. Cellulose Acetate Electrophoresis at Alkaline pH

Cellulose acetate of electrophoresis has a resolution clearly inferior to IEF,but because of its simplicity it remains among the more popular techniques forHb screening. Several kits are commercially available (among others, HelenaLaboratories). In this technique, Hbs are separated according to their charge atpH 8.5 and, to a lesser extent, according to the position of the modified residuein the molecule or to its molecular environment. At this pH, the Hb moleculecarries an overall negative charge. Hence, the Hb molecule migrates towardthe cathode. Nevertheless, two variants carrying the same amino acid exchangemay display large differences in their mobility according to the position of themodified residue toward the exterior of the molecule. Residues, involved in


internal contacts and buried inside the molecule, will affect to a lesser degreethe mobility of the protein than residues exposed toward the surrounding water.Electrophoresis is run in Tris (85 mM)-EDTA (2 mM)-borate (50 mM), pH8.5, buffer. Using a cellulose acetate plate (Titan II-H; Helena), the electro-phoresis is done in 20 min at room temperature under 420 V. Proteins arestained with amidoblack, and after being washed with a 5% acetic acid solu-tion, the plates may be dried in methanol or made transparent (see Note 3).

2.4. Electrophoresis of Globin Chains in 6 M Urea at pH 6.0 and 9.0

Treatment of the Hb molecule by high concentrations of urea and β-mer-captoethanol solubilizes the heme group and dissociates the globin chains.Analysis of the globin chains by electrophoresis on a cellulose acetate strip in6 M urea in Tris-EDTA buffer at pH 9.0 and 6.0 confirms an exchange betweenresidues with different charges. Some patterns of modifications in the electro-phoretic behavior of the globin between these two pHs suggest particular typesof substitutions such as those involving a histidine residue. This electrophoreticseparation may be achieved on cellulose acetate plates. Revelation is done byamidoblack staining (see Note 4). This solution is used for destaining. Migra-tion of the globin chains in urea is estimated from a scale in which α-chain is+10 and β-chain +20 (5). Known variants with mobility similar to that of theunknown sample should be selected as controls for accurate measurements (seeNote 5).

2.5. Electrophoresis of Globin in Presence of Triton X-100

This method reveals amino acid exchanges involving alkaline residues and,more interestingly, modifying the hydrophobicity of the polypeptide chain.Triton, a nonionic detergent, masks some charged residues. This is done by avertical polyacrylamide gel electrophoresis (PAGE) in the presence of 8 Murea with migration in a 5% acetic acid solution according to the technique ofAlter et al. (13). A 160 × 210 × 1.5 mm plate of polyacrylamide gel is used.

1. Make the gel as follows:a. Prepare 10 mL of a solution of 60% acrylamide and 0.4% bis-acrylamide.b. Add 37.5 mL of an 8 M urea solution (24.0 g/31.5 mL of water), 2.8 mL of

acetic acid, and 1 mL of Triton X-100.c. Degas the mixture for 10 min under vacuum.d. Add 250 µL of TEMED and 300 µL of ammonium persulfate.e. Pour the mixture between two glass plates and place a comb. Cover the top of

this with aluminum foil.f. Polymerize for 1 h at room temperature. When polymerized, remove the comb.

2. Fill both compartments of the electrophoresis tank are filled with 5% acetic acid,and conduct a 1-h prerun at 200 V.

98 Wajcman

3. Empty the sampling wells and refill with a 1 M cysteamine solution (227 mg ofcysteamine/2 mL of water). Conduct a second 1-h electrophoretic prerun in 5%acetic acid at 150 V.

4. Prepare the sample just before applying on the plate. It is made by adding 5 µL ofhemolysate (0.2–0.3 g% Hb) to 10 µL of a dissociating solution (5 mL of 8 Murea, 0.5 mL of β-mercaptoethanol, and 0.5 mL of concentrated acetic acid).

5. Carefully wash the sampling wells with 5% acetic acid and apply the sample(15 µL). Perform migration at room temperature for 18–20 h.

6. At the end of the migration, carefully remove the gel and stain with a solution ofCoomassie R-250 blue for 1 h (see Note 6). Then immerse the gel at room tem-perature in a destaining solution for several days (see Note 7).

7. Calculate chain mobility as proposed by Barwick and Schneider (5) assuming avalue of 10 for a normal α-chain and 20 for a normal β-chain.

2.6. Scaled-Up Electrophoretic Methods for Hb Separations

For structural or functional studies, milligram amounts of Hb need tobe separated. This can be conveniently done by flat-bed preparative IEFas described by Radola (14). We describe here a modified miniaturizedtechnique.

1. Make the gel by a suspension of 0.9 g Ultrodex (Pharmacia) in 24 mL of a 1.7%solution of ampholine, pH 6.0–8.0, (Pharmacia) in water.

2. Pout this mixture into a 26.0 × 2.5 × 0.4 cm homemade Plexiglas cassette andsubmit to an air stream to reduce the gel weight by 30%.

3. Apply the hemolysate (500 µL of a 4–6% Hb solution) on the gel at 8 cm from thecathode within a 1 × 1 cm metallic mold and carefully remove the mold when thesample has penetrated the gel.

4. Perform IF overnight at 4°C at 1300 V and 2 W.5. At the end of the focusing, collect the various Hb components with a spatula and

elute from the gel with water in small columns.

3. Notes1. It is difficult to determine with precision by this technique the pI of an Hb vari-

ant. It can’t, however, be done, with reasonable approximation, by considering asreference values the isoelectric point that have been experimentally measured fora few Hb markers such as HbA, HbF, MetHb, HbS (β6 [A3] Glu → Val), andHbC (β6[A3] Glu → Lys), which are 6.95, 7.15, 7.20, 7.25, and 7.40, respec-tively (11). Because the pH gradient is linear, it is possible to express the mobil-ity of any variant by its distance in millimeters from HbA according to somenormalized scale. Such a scale has been obtained in our laboratory by using a fewselected Hbs. The precision of the measurement is increased when the unknownsample migrates, in the same lane, together with a control sample having a mobilityclose to it. As an example, under these experimental conditions, values for HbA,HbD Punjab (β121 [GH4] Glu → Gln), HbS, HbE (β6 [B8] Glu → Lys), and


HbC are 0, –7.6, –8.5, –15.1, and –16 (with a confidence limit of ± 0.2), respec-tively. Further practical data concerning IEF and PAGE are detailed in ref. 15.

2. In this type of electrophoresis, good reproducibility may be difficult to obtainfrom one run to run. Several factors, such as slight differences in the ionic strengthor pH of the electrophoretic buffer, may be responsible. Lack of reproducibilitymay also result from storage conditions of the agar plate, or from variation in thevolume of the sample applied and its concentration in Hb. The amount ofagaropectin present in the gel may also vary from one batch to another; the high-est amount is found in crude agar, whereas all the agaropectin is removed fromthe agarose gels used for IEF.

3. In our laboratory, all mutants are analyzed by cellulose acetate electrophoresisat alkaline pH in addition to the other methods. Migration in cellulose acetateelectrophoresis is measured according to a comparative scale using as markersHbC = –10, HbA = 0, and HbI Texas (a16 [A14] Lys → Glu) = +10 (5). The mainlimitation of this technique is its low resolving power: it is impossible to dis-criminate variants that have almost the same mobility as, e.g., HbS, HbD Punjab,or HbG Ferrara [b57 [E1] Asn → Lys), which could be distinguished by IEF.

4. Staining is obtained by soaking the band in a 0.5g/100 mL solution of amidoblackmade up of 1000 mL of methanol, 250 mL of acetic acid, and 1250 mL of dis-tilled water. This solution is also used for destaining.

5. A scaled-up technique of chain separation on cellulose acetate electrophoresismay be used for biosynthetic studies after incubating the reticulocytes with3H-leucine (16).

6. Staining solution is obtained by dissolving 0.5 g of Coomassie Blue R-250 in 30 mLof methanol under magnetic stirring. Then 7 mL of acetic acid is added to thissolution, and its final volume is completed to 100 mL by adding distilled water.

7. Destaining solution is made from methanol/acetic acid/water in the proportion30/7/63 (v/v/v).

References1. Pauling, L., Itano, H. A., Singer, S. J., and Wells, I. C. (1949) Sickle cell anemia,

a molecular disease. Science 110, 543.2. Huisman, T. H. J. and Jonxis, J. H. P. (1977) The Hemoglobinopathies Tech-

niques of Identification, Clinical and Biochemical Analysis, vol. 6, Marcel Dekker,New York.

3. Huisman, T. H. J. (1986) Introduction and review of standard methodology forthe detection of hemoglobin abnormalities, in The Hemoglobinopathies, Methodsin Hematology, vol. 15 (Huisman, T. H. J., ed.), Churchill Livingstone, Edinburgh.

4. Righetti, P. G., Gianaza, E., Bianchi-Bosisio, A., and Cossu, G. (1986) Conven-tional isoelectric focusing and immobilized pH gradients for hemoglobin separa-tion and identification, in The Hemoglobinopathies, Methods in Hematology, vol. 15(Huisman, T. H. J., ed.), Churchill Livingstone, Edinburgh, p. 47.

5. Barwick, R. C. and Schneider, R. G. (1980–1981) The computer-assisted differen-tiation of hemoglobin variants, in Human Hemoglobins and Hemoglobinopathies:

100 Wajcman

A Review to 1981. Texas Reports on Biology and Medicine, vol 40. (Schneider, R.G., Charache, S., and Schroeder, W. A., eds.), University of Texas MedicalBranch, Galveston, TX, pp. 143–156.

6. Basset, P., Beuzard, Y., Garrel, M. C., and Rosa, J. (1978) Isoelectric focusing ofhuman hemoglobin: its application to screening, to the characterization of 70 vari-ants, and to the study of modified fractions of normal hemoglobins. Blood 51,971–982.

7. Righetti, P. G. (1983) Isoelectric Focusing: Theory, Methodology and Applica-tions, Elsevier, Amsterdam.

8. Bjellqvist, B., Ek, K., Righetti, P. G., Gianazza, E., Gorg, A., Westermeier, R., andPostel, W. (1982) Isoelectric focusing in immobilized pH gradients: principle, meth-odology and some applications. J. Biochem. Biophys. Methods 6, 317–339.

9. Righetti, P. G., Gianazza, E., Bianchi-Bosisio, A., Wajcman, H., and Cossu, G.(1989) Electrophoretically silent hemoglobin mutants as revealed by isoelectricfocusing in immobilized pH gradients. Electrophoresis 10, 595–599

10. Cossu, G., Manca, M., Pirastru, M. G., Bullitta, R., Bianchi-Bosisio, A., Gianazza,E., and Righetti, P. G. (1982) Neonatal screening of β-thalassemias by thin layerisoelectric focusing. Am. J. Hematol. 13, 149–157.

11. Drysdale, J. W., Righetti, P., and Bunn, H. F. (1971) The separation of human andanimal hemoglobins by isoelectric focusing in polyacrylamide gel. Biochim.Biophys. Acta. 229, 42–50.

12. Schneider, R. G. and Barwick, R. C. (1982) Hemoglobin mobility in citrate agarelectrophoresis: its relationship to anion binding. Hemoglobin 6, 199–208.

13. Alter, B. P., Goff, S. C., Efremov, G. D., Gravely, M. E., and Huisman, T. H. J.(1980) Globin chain electrophoresing: a new approach to the determination of theG/A ratio in fetal haemoglobin and to the studies of globin synthesis Br. J.Haematol. 44, 527–534.

14. Radola, B. J. (1973) Analytical and preparative isoelectric focusing in gel-stabi-lized layers. N Y Acad. Sci. 209, 127–143.

15. Westermeier, R. (1997) Electrophoresis in Practice, 2nd ed., VCH Verlagsgesell-schaft, Weinheim, Germany.

16. Harano, T., Ueda, S., Harano, K., and Shibata, S. (1980) Improved method forquantitation of biosynthesized human globin chains in reticulocytes by use of ureacellulose acetate membrane electrophoresis. Proc. Jap. Acad. 56(B), 230–234.

DNA Diagnosis of Hb Mutations 101

7

101


DNA Diagnosis of Hemoglobin Mutations

John M. Old

1. IntroductionThe hemoglobinopathies are a diverse group of inherited recessive disorders

that include the thalassemias and sickle cell disease. They were the first geneticdiseases to be characterized at the molecular level and, consequently, havebeen used as a prototype for the development of new techniques of mutationdetection. There are now many different polymerase chain reaction (PCR)–based techniques that can be used to diagnose the globin gene mutations,including dot-blot analysis, reverse dot-blot analysis, the amplification refrac-tory mutation system (ARMS), denaturing gradient gel electrophoresis(DGGE), mutagenically separated PCR, gap-PCR, and restriction endonucleaseanalysis (1,2). Each method has its advantages and disadvantages, and the par-ticular one chosen by a laboratory to diagnose point mutations depends notonly on the technical expertise available in the diagnostic laboratory but alsoon the type and variety of the mutations likely to be encountered in the indi-viduals being screened.

1.1. Diagnostic Approaches

The main diagnostic approaches for the PCR diagnosis of the hemoglobino-pathies are provided in Table 1. The ones well used in my laboratory are gap-PCR, ARMS-PCR, and restriction endonuclease analysis of amplified product.Detailed protocols for each of these techniques are presented in this chapter.The alternative well-used method for the diagnosis of hemoglobin (Hb) muta-tions, that of allele-specific oligonucleotide (ASO) hybridization by dot blot-ting or reverse dot blotting, is not covered in this chapter, but detailed protocolsmay be found elsewhere (3).

102 Old

Table 1DNA Diagnosis of Hemoglobinopathies

Disorder and mutation type Diagnostic methoda

αo-Thalassemia Gap-PCR, Southern blottingα+-Thalassemia

Deletion Gap-PCR, Southern blottingNondeletion ASO, RE, DGGE

β-ThalassemiaDeletion Gap-PCRNondeletion ASO, ARMS, DGGE

δβ-Thalassemia Gap-PCRHPFH

Deletion Gap-PCRNondeletion ASO, ARMS, RE, DGGE

Hb Lepore Gap-PCRHbS ASO, ARMS, REHbC ASO, ARMSHbE ASO, ARMS, REHbD Punjab ASO, ARMS, REHbO Arab ASO, ARMS, REHb variants RT-PCR and DNA sequencing

a Gap-PCR, gap polymerase chain reaction; ASO, allele-specific oligonucle-otide; RE, restriction endonuclease; DGGE, denaturing gradient gel electrophore-sis; RT-PCR, reverse transcriptase polymerase chain reaction.

1.2. α-Thalassemia

Gap-PCR provides a quick diagnostic test for α+-thalassemia and αo-thalas-semia deletion mutations but requires careful application for prenatal diagno-sis. Most of the common α-thalassemia alleles that result from gene deletionscan be diagnosed by gap-PCR. Primer sequences have now been published forthe diagnosis five αo-thalassemia deletions and two α+-thalassemia deletions(4–7), as given in Table 2. The αo-thalassemia deletions diagnosable byPCR are the – –SEA allele, found in Southeast Asian individuals; the – –MED and–(α)20.5 alleles, found in Mediterranean individuals; the – –FIL allele, found inFillipino individuals; and, finally, the – –THAI allele, found in Thai individuals.The two α+-thalassemia deletion mutations are the 3.7- and the 4.2-kb singleα-gene deletion mutations, designated -α3.7 and -α4.2, respectively.

Amplification of sequences in the α-globin gene cluster is technically moredifficult than that of the β-globin gene cluster, requiring more stringent condi-tions for success owing to the higher GC content of the break-point sequences


and the considerable sequence homology within the α-globin gene cluster.Experience in many laboratories has shown some primer pairs to be unreliable,resulting occasionally in unpredictable reaction failure and the problem of al-lele dropout. However, the more recently published primer sequences (6,7)seem to be much more robust than the earlier ones, possibly owing to the addi-tion of betaine to the reaction mixture. They are also designed for a multiplexscreening test, although in my laboratory they are still used in pairs to test forindividual mutations. Figures 1 and 2 show, respectively, the results of screen-ing for the five common αo and the two common α+-thalassemia mutationswith these more robust primers.

The other αo and α+-thalassemia mutations cannot be diagnosed by PCRbecause their break-point sequences have not been determined. These deletion

Table 2Thalassemia Deletion Mutations Diagnosed by Gap-PCR

Disorder Deletion mutation Reference

αo-Thalassemia – –SEA 4– –MED 4-(α)20.5 4– –FIL 6,7– –THAI 6,7

α+-Thalassemia -α3.7 5-α4.2 5

βo-Thalassemia 290-bp deletion 22532-bp deletion 23619-bp deletion 241393-bp deletion 251605-bp deletion 263.5-kb deletion 2710.3-kb deletion 2845-kb deletion 29

(δβ)o-Thalassemia Hb Lepore 18Spanish 18Sicilian 18Vietnamese 18Macedonian/Turkish 18

(Aγδβ)o-Thalassemia Indian 18Chinese 18

HPFH HPFH1 (African) 18HPFH2 (Ghanaian) 18HPFH3 (Indian) 18

104 Old

mutations are diagnosed by the Southern blotting technique using ζ-gene andα-gene probes. This approach is still very useful because it permits the diagno-sis of α-thalassemia deletions and α-gene rearrangements (the triple and qua-druple α-gene alleles) in a single test (8). The characteristic abnormalfragments used in my laboratory for the diagnosis of the more commonα-thalassemia deletions are given in Table 3.

α+-Thalassemia is also caused by point mutations in one of the two α-globingenes. These nondeletion alleles can be detected by PCR using a technique ofselective amplification of each α-globin gene followed by a general method ofmutation analysis such as DGGE (9) or DNA sequence analysis (10). Severalof the nondeletion mutations alter a restriction enzyme site and may be diag-nosed by selective amplification and restriction endonuclease analysis in amanner similar to that reported for the mutation that gives rise to the unstableα-globin chain variant Hb Constant Spring (11).

1.3. β-Thalassemia

The β-thalassemia disorders are a very heterogeneous group of defects withmore than 170 different mutations characterized to date (12). The majority ofthe defects are single-nucleotide substitutions, insertions, or deletions. Only 13large gene deletions have been identified, and eight of these can be diagnosed

Fig. 1. Ethidium bromide (EtBr)–stained gel showing screening of DNA samplesfor the five common αo-thalassemia mutations by gap-PCR. All the primers used arefrom ref. 6. The fragment sizes are as follows: normal allele (αα), 1010 bp; – –SEA,660 bp; – –THAI, 411 bp; – –FIL, 550 bp; – –MED; 875 bp; -(α)20.5, 1180 bp.


by gap-PCR, as listed in Table 2. The other types of mutations can be diagnosedby a variety of methodologies, but the strategy for identifying β-thalassemiamutations remains the same. The mutations are regionally specific, and eachat-risk population has a few common mutations together with a larger variablenumber of rarer ones. The strategy depends on knowing the spectrum of com-mon and rare mutations in the ethnic group of the individual being screened. Thecommon ones are analyzed first using a PCR method designed to detect specificmutations simultaneously. This approach will identify the mutation in more than80% of cases for most ethnic groups. Further screening of the known rare muta-tions will identify the defect in another 10–15% of cases, if necessary. Mutationsremaining unidentified at this stage are characterized by DNA sequencing.

The first PCR diagnostic method to be developed and gain widespread use wasthe hybridization of ASO probes to amplified DNA bound to nylon membrane

Fig. 2. EtBr-stained gel showing the screening of DNA samples for the two com-mon α+-thalassemia mutations by gap-PCR. The primers used to detect the 3.7-kbdeletion are from ref. 1, and the primers used for the 4.2-kb deletion are from ref. 6.The fragment sizes are as follows: for the -α3.7 allele:normal allele (αα), 1800 bp and-α3.7, 2020 bp; for the -α4.2 allele:normal allele (αα), 1510 bp and -α4.2, 1725 bp.

106 Old

by dot blotting (13). Although still in use, the method is limited by the need forseparate hybridization steps to test for multiple mutations. This problem wasbeen overcome by the development of the reverse dot-blotting technique, inwhich amplified DNA is hybridized to a panel of mutation-specific probes fixedto a nylon strip. This technique is compatible with the optimum strategy forscreening β-thalassemia mutations, using a panel of the commonly found muta-tions for the first screening and a panel of rare ones for the second screening (14).

The technique used by my laboratory and described here is the ARMS. Thistechnique fits the main requirements of a PCR technology—i.e., speed, cost,convenience, and the ability to test for multiple mutations simultaneously whileproviding a screening method without any form of labeling of primers or am-plified DNA. The simplest way is to screen for mutations with simultaneousPCR assays although the multiplexing of ARMS primers in a single PCR assayis possible (15). Figure 3 shows the results of screening a patient’s DNAsample for the seven common Mediterranean β-thalassemia mutations.

The most widely used indirect method to characterize β-thalassemia muta-tions is DGGE (16). The technique detects at least 90% of β-thalassemia muta-

Table 3The Diagnosis of α-Thalassemia Alleles by Southern Blotting

Restriction enzyme/gene probea

Allele BamHI/α BglII/α BamHI/ζ BglII/ζ SstI/LO

αα 14 12.6 10–11.3 12.6 or 5.2 5.0 7.4 5.9 10–11.3

ααα 18 12.6 10–11.3 12.6 or 16 5.0 7.4 5.9 10–11.3

αααα 22 12.6 10–11.3 12.6 or 20 5.0 7.4 5.9 10–11.3

-α3.7 10.3 16 10–11.3 16 5.05.9 10–11.3

-α4.2 9.8 8.0 10–11.3 10–11.3 5.0 7.4 5.9 8.0

-(α)20.5 4.0 10.8 5.9 10.8 5.0– –MED None None 5.9 13.9 5.0– –SEA None None 20 10.5 5.0

5.9– –SA None None 5.9 7.0 5.0– –BRIT None None 5.9 7.5 5.0– –THAI None None None None 8.0– –FIL None None None None 7.4

a Fragment sizes are given in kilobase pairs. Characteristic abnormal fragments are underlined.


tions by a shifted band pattern to normal and provides an alternative approach toASO probes or ARMS in countries where a very large spectrum of β-thalassemiamutations occur (17).

1.4. δβ-Thalassemia and Hereditary Persistence of Fetal Hb

δβ-Thalassemia and the hereditary persistence of fetal Hb (HPFH) disordersresult from large gene deletions affecting both the β- and δ-globin genes. Restric-tion enzyme mapping has enabled the characterization of more than 50 differentdeletions starting at different points between the Gγ gene and the δ gene andextending up to 100 kb downstream of the β-globin gene. In two cases, theMacedonian/Turkish (δβ)o-thalassemia gene and the Indian (Aγδβ)o-thalassemiagene, the mutation is a complex rearrangement consisting of an inverted DNAsequence flanked by two deletions. A small number of these deletions havehad their break-point sequences characterized, and these can be diagnosed bygap-PCR (18). Gap-PCR can also be used for the diagnosis of Hb Lepore, cre-ated by a deletion of the DNA sequence between the δ- and β-globin genes. Hb

Fig. 3. EtBr-stained gel showing screening of a DNA sample for seven commonMediterranean β-thalassemia mutations by ARMS-PCR. The seven mutations are asfollows: lanes 1 and 2, IVSI-110(G → A); lanes 3 and 4, IVSI-1(G → A); lanes 5 and6, IVSI-6(T → C); lanes 7 and 8, codon 39(C → T); lanes 9 and 10, codon 6 (-A); lanes11 and 12, IVSII-1 (G → A); lanes 13 and 14, IVSII-745(C → G). The gel shows theamplification products from the DNA of a β-thalassaemia heterozygote (odd-num-bered lanes) and products generated by control DNAs (even-numbered lanes). Theresults show that the patient carries the mutation IVSI-110(G → A). For mutations 1–6,the control primers D and E produced an 861-bp fragment. However, for mutation 7,IVSII-1(G → A), the HindIII/Gγ-gene restriction fragment length polymorphism(RFLP) primers were used, giving a control band of 326 bp. The primers used aregiven in Table 3.

108 Old

Lepore is the product of the δβ fusion gene, and is associated with a severeβ-thalassemia phenotype. All the deletion mutations currently diagnosable bygap-PCR are provided in Table 2; the others can only be diagnosed by the iden-tification of characteristic break-point fragments with Southern blot analysis.

1.5. Hb Variants

More than 700 Hb variants have been described to date, most of which wereidentified by protein analysis and have never been characterized at the DNAlevel. Positive identification at the DNA level is achieved by selective globingene amplification and DNA sequence analysis. However, the clinically impor-tant variants, HbS, HbC, HbE, HbD Punjab, and HbO Arab, can be diagnosedby simpler DNA analysis techniques. Sickle cell disease is caused by homozy-gosity for HbS and also, in varying degrees of severity, from interaction ofHbS with HbC, HbD Punjab, HbO Arab, and β-thalassemia trait. All thesevariants can be diagnosed by ASO hybridization; the ARMS technique; or, forall except HbC, restriction endonuclease digestion of amplified product. Thesickle cell gene mutation abolishes a DdeI recognition site at codon 6, anddiagnosis by DdeI digestion of amplified product remains the simplest methodof DNA analysis for sickle cell disease. Similarly, the mutations giving rise toHbD Punjab and HbO Arab abolish an EcoRI site at codon 121. However, theHbC mutation at codon 6 does not abolish the DdeI site and is diagnosed byother methods. HbE interacts with β-thalassemia trait to produce a clinical dis-order of varying severity ranging from thalassemia intermedia to transfusion-dependent thalassemia major. The HbE mutation can be diagnosed by ASOhybridization, ARMS, or restriction endonuclease analysis since the mutationabolishes an MnlI site in the β-globin gene sequence.

2. Materials1. For ARMS PCR the buffer used is the standard Cetus buffer: 50 mM KCl, 10 mM

Tris-HCl (pH 8.3 at room temperature), 1.5 mM MgCl2, 100 µg/mL of gelatin. A10X stock buffer can be prepared by adding a mixture of 0.5 mL of 1 M Tris-HCl(pH 8.3 at room temperature), 1.25 mL of 2 M KCl, 75 µL of 1 M MgCl2, 5 mg ofgelatin, and 3.275 mL of distilled water. The stock buffer is heated at 37°C untilthe gelatin dissolves and then is frozen in aliquots.

2. For gap-PCR the reaction buffer (10X) recommended for the particular pair ofprimers being used is required. The buffer for α-thalassemia primers also includes0.5 M betaine.

3. Stock deoxynucleotide mixture containing each dNTP at 1.25 mM: Mix together50 µL of a 100 mM solution of each dNTP (as purchased) and 3.8 mL of distilledwater. The 1.25 mM dNTP stock solution should be stored in frozen aliquots.

4. PCR reaction stock solution (4 mL): This is made of 0.5 mL of 10X buffer,0.8 mL of 1.25 mM dNTP stock solution, and 2.7 mL of distilled water.


5. Dilute aliquots of primer stock solutions to make a working solution of 1 OD U/mLand store frozen.

6. Taq polymerase: AmpliTaq Gold (PE Biosystems) is the best.

3. Methods (see Notes 1–6)3.1. Gap-PCR (see Note 1)

Gene deletion mutations in the β-globin gene cluster may be detected by PCRusing two primers complementary to the sense and antisense strand in the DNAregions that flank the deletion. For small deletions of <1 kb in size, the primerpair will generate two products, the smaller fragment arising from the deletionallele. For large deletions, the distance between the two flanking primers is toogreat to amplify the normal allele, and product is only obtained from the deletionallele. In these cases, the normal allele is detected by amplifying across one ofthe break points, using a primer complementary to the deleted sequence and onecomplementary to the flanking DNA.

1. Set up the reaction mixture to a final volume of 22 µL in a 0.5-mL tube with thefollowing components as required: 1 µL of genomic DNA (100 ng/µL), 1 µL offorward primer—flanking sequence (10 pmol/µL), 1 µL of reverse primer—flank-ing sequence (10 pmol/µL), 1 µL of primer—deleted sequence (10 pmol/µL), 1 µLof primer—inverted sequence (10 pmol/µL), 2.5 µL of 1.25 mM (dNTP mixture),2.3 µL of the reaction buffer (10X) as recommended for the primers, and steriledH2O to a final volume of 22 µL. For the α-thalassemia primers that also contain0.5 M betaine, add 2.5 µL of 5 M betaine (Sigma, St. louis, MO).

2. Overlay with 25 µL of mineral oil.3. Prepare the enzyme mixture: 0.2 µL of reaction buffer (10X), 0.1 µL of Ampli

Taq (5U/µL) (PE Biostems) for the β-gene primers, 0.1 µL of Platinum Taq (5U/µL)(Life Technologies) for the α-gene primers, and 2.7 µL of sterile dH2O to a finalvolume of 3 µL.

4. Mix the enzyme mixture and hold on ice.5. Place the reaction mixture in a thermal cycler and perform one cycle as follows,

adding 3 µL of the enzyme mix after 2 min of the 94°C denaturation step: 4 minat 94°C, 1 min at 55°–65°C (as recommended), 1.5 min at 72°C.

6. Continue for 33 cycles with the following steps per cycle: 1 min at 94°C, 1 min at55°–65°C (as recommended), 1.5 min at 72°C.

7. Finish with one cycle as follow: 1 min at 94°C, 1 min at 55°–65°C (as recom-mended), 10 min at 72°C.

8. Hold at 15°C until gel electrophoresis.9. Remove the tubes from the thermal cycler and add 5 µL of blue dye (15% Ficoll/

0.05% bromophenol blue). Mix and centrifuge.10. Load a 20-µL aliquot onto a 1–3% agarose gel (depending on expected fragment

sizes) and run at 100 V for 45 min in Tris-borate-EDTA (TBE) buffer (89 mMTris, 89 mM boric acid, 10 mM EDTA, pH 8.0).

110 Old

11. Stain gel in EtBr solution (0.5 µg/mL) for 15–30 min, visualize bands on anultraviolet light box (312 nm), and photograph with an electronic camera systemor a Polaroid CU-5 camera fitted with an orange filter (e.g., Wratten 22A).

3.2. ARMS PCR (see Note 4)

Newton et al. (19) first described the ARMS technique for detecting knownpoint mutations. It has been developed for the diagnosis of all the commonβ-thalassemia mutations and many of the rare ones (8,20). The technique isbased on the principle of allele-specific priming of the PCR process; that is, aspecific primer will permit amplification to take place only when its 3' terminalnucleotide matches with its target sequence. Thus, to detect the β-thalassemiamutation IVSI-5(G → C), the 3' nucleotide of the ARMS primer is G in orderto base pair with the substituted C in the mutant DNA. The primer forms aG-G mismatch with normal DNA, but this is a weak mismatch and will notprohibit extension of the primer by itself. Only strong mismatches (C-C, G-A,and A-A) reduce priming efficiency to zero or below 5% (21). To preventamplification, a further mismatch with the target sequence is introduced at thesecond, third, or fourth nucleotide from the 3' end of the primer. As a generalrule, if the 3' terminal mismatch is a weak one, a strong secondary mismatch isengineered; if it is a strong one, a weak secondary mismatch is introduced.

The mutation-specific ARMS primers used in my laboratory to diagnose the25 most common β-thalassemia mutations, plus the Hb variants HbS, HbC andHbE, are given in Table 4. All are 30 bases long so that they can all be used ata single high annealing temperature (65°C). Primers for the diagnosis of thenormal alleles for many of these mutations are provided in Chapter 8. Theseare required when both partners of a couple requesting prenatal diagnosisof β-thalassemia carry the same mutation.

A typical ARMS test for a single mutation consists of two amplifications inthe same reaction mixture using the same genomic DNA as substrate. Oneamplification product results from the specific ARMS primer and its primerpair (when the mutation is present in the genomic DNA), and the other ampli-fication results from two primers that generate a control fragment in all cases.The generation of control product indicates that the reaction mixture and ther-mal cycler are working optimally.

1. Prepare a reaction mixture (4 mL) comprising: 0.5 mL of 10X PCR buffer(50 mM KCl; 10 mM Tris-HCl, pH 8.3, 1.5 mM MgCl2, 100 µg/mL gelatin),1.25 mL of a 1.35 mM dNTP mixture, and 2.65 mL of sterile dH2O. When morethan one test is being performed, a primer and the enzyme can be mixed togetherin a separate tube before addition to the reaction mix. This decreases pipetingerrors as larger quantities are used.

2. Pipet 20 µL of the PCR reaction mixture into a 0.5-µL tube.


3. Add 1 µL of each primer (1 OD unit/mL).4. Add 0.05 µL of Taq DNA polymerase (5 U/µL).5. Add 1 µL of genomic DNA (100 ng/µL).6. Overlay with 25 µL of mineral oil.7. Mix, centrifuge, and place in the thermal cycler.8. Amplify for 25 cycles as follows: 1 min at 94°C, 1 min at 65°C, 1.5 min at 72°C

with a final extension period of 3 min at 72°C following the twenty-fifth cycle.9. Remove the tubes from the thermal cycler and add 5 µL of blue dye (15% Ficoll/

0.05% bromophenol blue). Mix and centrifuge.10. Load a 20-µL aliquot onto a 3% agarose gel and run at 100 V for approx 45 min

in TBE (see Subheading 3.1., step 10).11. Stain with EtBr and visualize the bands as described in Subheading 3.1., step 11.

3.3. Restriction Enzyme Digestion

A small number of the β-thalassemia mutations create or abolish a restric-tion endonuclease recognition site in the globin gene sequence. Provided thatthe enzyme is commercially available (not always the case) and that there isnot another site too close to the mutation, the loss or creation of a site can beused to diagnose the presence or absence of the mutation. This is useful for thediagnosis of a few of the common β-thalassemia mutations, as listed in Table 4,but the main use of this PCR technique is for the diagnosis of the clinicallyimportant Hb variants HbS (Fig. 3), HbD Punjab, and HbO Arab. The primersequences used in my laboratory for diagnosing these Hb variants are given inTable 5. When possible, the amplified product should include a second site forthe appropriate restriction enzyme. This site will act as a control for the diges-tion reaction since it should be fully cleaved in product from both the normaland mutant DNA alleles. This is possible for the HbS and HbE mutations butnot for HbO Arab and HbD Punjab, for which the flanking EcoRI sites are toofar away from the one in codon 121.

1. To one 0.5-mL tube, add the following: 20 µL of PCR reaction mixture (as detailedin Subheading 3.2.), 1 µL of each primer, 1 µL of genomic DNA (100 ng/µL), 2 µLof sterile dH2O, and 0.05 µL of AmpliTaq DNA polymerase (5 U/µL).

2. Overlay with 25 µL of mineral oil.3. Place in the thermal cycler and perform 30 cycles of: 1 min at 94°C, 1 min at

65°C, and 1.5 min at 72°C with a final period at 72°C for 3 min after the last cycle.4. Remove the tubes and add 5–10 U of the appropriate restriction enzyme, plus 2 µL

of the corresponding 10X buffer.5. Incubate at 37°C for a minimum of 1 h.6. Add blue dye, mix, and spin as in Subheading 3.1., steps 8 and 9.7. Load a 20-µL aliquot onto a 3% agarose gel consisting of 50% Nusieve GTC

agarose and 50% ordinary agarose.8. Electrophorese, stain, and photograph as in Subheading 3.1., step 11.

112O

ld

112

Table 4ARMS-PCR Primer Sequences Used for the Detection of Common β-Thalassemia Mutationsa

AlteredSecond Product restriction

Mutation Oligonucleotide sequence primer size (bp) site

-88(C → T) TCACTTAGACCTCACCCTGTGGAGCCTCAT A 684 +FokI-87(C → G) CACTTAGACCTCACCCTGTGGAGCCACCCG A 683 -AvrII-30(T → A) GCAGGGAGGGCAGGAGCCAGGGCTGGGGAA A 626-29(A → G) CAGGGAGGGCAGGAGCCAGGGCTGGGTATG A 625 +NlaIII-28(A → G) AGGGAGGGCAGGAGCCAGGGCTGGGCTTAG A 624CAP+1(A → G) ATAAGTCAGGGCAGAGCCATCTATTGGTTC A 597CD5(-CT) TCAAACAGACACCATGGTGCACCTGAGTCG A 528 -DdeICD6(-A) CCCACAGGGCAGTAACGGCAGACTTCTGCC B 207 -DdeICD8(-AA) ACACCATGGTGCACCTGACTCCTGAGCAGG A 520CD8/9(+G) CCTTGCCCCACAGGGCAGTAACGGCACACC B 225CD15(G → A) TGAGGAGAAGTCTGCCGTTACTGCCCAGTA A 500CD16(-C) TCACCACCAACTTCATCCACGTTCACGTTC B 238CD17(A → T) CTCACCACCAACTTCATCCACGTTCAGCTA B 239 +MaeICD24(T → A) CTTGATACCAACCTGCCCAGGGCCTCTCCT B 262CD39(C → T) CAGATCCCCAAAGGACTCAAAGAACCTGTA B 436 +MaeICD41/42(-TCTT) GAGTGGACAGATCCCCAAAGGACTCAACCT B 439CD71/72(+A) CATGGCAAGAAAGTGCTCGGTGCCTTTAAG C 241IVSI-1(G → A) TTAAACCTGTCTTGTAACCTTGATACCGAT B 281 -BspMIIVSI-1(G → T) TTAAACCTGTCTTGTAACCTTGATACGAAA B 281 -BspMIIVSI-5(G → C) CTCCTTAAACCTGTCTTGTAACCTTGTTAG B 285IVSI-6(T → C) TCTCCTTAAACCTGTCTTGTAACCTTCATG B 286 +SfaNIIVSI-110(G → A) ACCAGCAGCCTAAGGGTGGGAAAATAGAGT B 419IVSII-1(G → A) AAGAAAACATCAAGGGTCCCATAGACTGAT B 634 -HphI

DN

A D

iagnosis of Hb M

utations113

113 Table 5Oligonucleotide Primers for Detection of βS, βE, βD Punjab, and βo Arab Mutations as RFLPs

Mutation and Annealing Product Absence Presenceaffected restriction Temperature size of site of siteenzyme site Primer sequences (forward and reverse) (°C) (bp) (bp) (bp)

βSCD6 (A → T) ACCTCACCCTGTGGAGCCAC 65 443 376 201(Loses DdeI site) GAGTGGACAGATCCCCAAAGGACTCAAGGA 65 67 175

67βECD26 (G → A) ACCTCACCCTGTGGAGCCAC 65 443 231 171(Loses MnlI site) GAGTGGACAGATCCCCAAAGGACTCAAGGA 89/56/35/33 89/60/35/33βDPunjab CD121 (G → C) CAATGTATCATGCCTCTTTGCACC 65 861 861 252(Loses EcoRI site) GAGTCAAGGCTGAGAGATGCAGGA 65 309βo Arab CD121 (G → A) CAATGTATCATGCCTCTTTGCACC 65 861 861 552(Loses EcoRI site) GAGTCAAGGCTGAGAGATGCAGGA 65 309

IVSII-654(C → T) GAATAACAGTGATAATTTCTGGGTTAACGT* D 829IVSII-745(C → G) TCATATTGCTAATAGCAGCTACAATCGAGG* D 738 +RsaIbsCD6(A → T) CCCACAGGGCAGTAACGGCAGACTTCTGCA B 207 -DdeIbCCD6(G → A) CCACAGGGCAGTAACGGCAGACTTCTCGTT B 206bECD26(G → A) TAACCTTGATACCAACCTGCCCAGGGCGTT B 236 -MnlI

a The above primers are coupled as indicated with either primer A: CCCCTTCCTATGACATGAACTTAA; B: ACCTCACCCTGTGGAGCCAC;C: TTCGTCTGTTTCCCATTCTAAACT; or D: GAGTCAAGGCTGAGAGATGCAGGA. The control primers used were primers D plus E:CAATGTATCATGCCTCTTTGCACC (which yield an 861-bp product as shown in Fig. 1) for all the mutation-specific ARMS primers exceptthe two marked with an asterisk. Control primers used with these two are the Gγ-HindIII RFLP primers (8).

114 Old

4. Notes1. Gap-PCR seems to work reasonably well for amplifying deletion mutations in

the β-globin gene cluster. However, amplification of deletions in the α-gene clus-ter is technically more difficult, possibly owing to the high GC content of theα-globin gene cluster sequence. Experience in my laboratory has shown that someof the first primer pairs to be published are unreliable, resulting occasionally inunpredictable reaction failures owing to allele dropout, especially when the nor-mal and mutant specific primers are multiplexed together. On the other hand, therecently published multiplex primers seem to give more robust and reproducibleresults. The addition of betaine to the reaction mixture and the use of PlatinumTaq DNA polymerase (which has been developed for automatic hot-start ampli-fication of problematic or GC-rich templates) are key features of their success.The technique is useful for screening for a particular αo-thalassemia deletionmutation, but because of the problem of allele dropout, for a prenatal diagnosisthe result is always confirmed by Southern blot analysis.

2. Both positive and negative DNA controls should always be tested alongside anysample. For prenatal diagnosis, this usually means a normal, heterozygous, andhomozygous DNA sample for the mutation under study.

3. The relationship between fragment intensities after staining should be constantfor all DNA samples. Any deviation to the expected pattern of band intensities ina particular sample should be treated as suspect and the sample retested (e.g., asa result of poor amplification of one of the two alleles, or a partial digestion ofthe amplified product by the restriction enzyme).

4. Sometimes an ARMS primer may produce a faint positive response with a negativeDNA control. This is usually less intense than that of the product observed in the posi-tive DNA control and may be a false positive result. This occurs if there has been asubtle change in the reaction conditions or if the ARMS primer has started to lose itsspecificity through degradation of the oligonucleotide. Always use small aliquots ofprimers as a working solution and store the stock solution at –20° or –70°C if available.

5. Failure of the PCR to produce any product may be the result of the genomic DNAsample being too dilute (reprecipitate in a smaller volume) or, more often, the DNAbeing too concentrated (try a 1:10 dilution). Do not increase the number of cycles toobtain a result because nonspecific amplification products are likely to appear andthere could be a problem of coamplifying any contaminating maternal DNA in a fetalsample. Amplification failure may also be owing to an error in the primer sequence.Check the published sequence against the GenBank sequence for typing errors.

6. The unexpected failure of the PCR tests set up in one run usually results from aproblem with the dNTP mixture. The first troubleshooting step should be to trynew dNTP solutions.

References1. Embury, S. H. (1995) Advances in the prenatal and molecular diagnosis of the

haemoglobinopathies and thalassaemias. Hemoglobin 19, 237–261.2. Old, J. (1996) Haemoglobinopathies. Prenat. Diagn. 16, 1181–1186.


3. Thein, S. L., Eshari, A., and Wallace, R. B. (1993) The use of synthetic oligo-nucleotides as specific hybridisation probes in the diagnosis of genetic disorders,in Human Genetic Disease Analysis: A Practical Approach (Davies, K. E., ed.),IRL, Oxford, pp. 22–33.

4. Bowden, D. K., Vickers, M. A., and Higgs, D. R. (1992) A PCR-based strategy todetect the common severe determinants of α-thalassaemia. Br. J. Haematol. 81,104–108.

5. Baysal, E. and Huisman, T. H. J. (1994) Detection of common deletionalα-thalassaemia-2 determinants by PCR. Am. J. Hematol. 46, 208–213.

6. Liu, Y. T., Old, J. M., Fisher, C. A., Weatherall, D. J., and Clegg, J. B. (1999)Rapid detection of α-thalassaemia deletions and α-globin gene triplication bymultiplex polymerase chain reactions. Brit. J. Haematol. 108, 295–299.

7. Chong, S. S., Boehm, C. D., Higgs, D. R., and Cutting, G. R. (2000) Single-tubemultiplex-PCR screen for common deletional determinants of α-thalassemia.Blood 95, 360–362.

8. Old, J. M. (1996) Haemoglobinopathies: community clues to mutation detection,in Methods in Molecular Medicine, Molecular Diagnosis of Genetic Diseases(Elles, R., ed.), Humana, Totowa, NJ, pp. 169–183.

9. Hartveld, K. L., Heister, A. J., G. A. M., Giordano, P. C., Losekoot, M., andBernini, L. F. (1996) Rapid detection of point mutations and polymorphisms ofthe a-globin genes by DGGE and SSCA. Hum. Mutat. 7, 114–122.

10. Molchanova, T. P., Pobedimskaya, D. D., and Postnikov, Y. V. (1994) A simpli-fied procedure for sequencing amplified DNA containing the α-2 or α-1 globingene. Hemoglobin 18, 251–255.

11. Ko, T. M., Tseng, L. H., Hsieh, F. J., and Lee, T. Y. (1993) Prenatal diagnosis ofHbH disease due to compound heterozygosity for south-east Asian deletion andHb Constant Spring by polymerase chain reaction. Prenat. Diagn. 13, 143–146.

12. Baysal, E. (1995) The β- and δ-thalassemia repository. Hemoglobin 19, 213–236.13. Ristaldi, M. S., Pirastu, M., Rosatelli, C., and Cao, A. (1989) Prenatal diagnosis

of β-thalassaemia in Mediterranean populations by dot blot analysis with DNAamplification and allele specific oligonucleotide probes. Prenat. Diagn. 9, 629–638.

14. Sutcharitchan, P., Saiki, R., Fucharoen, S., Winichagoon, P., Erlich, H., andEmbury, S. H. (1995) Reverse dot-blot detection of Thai β-thalassaemia muta-tions. Br. J. Haematol. 90, 809–816.

15. Tan, J. A. M. A., Tay, J. S. H., Lin, L. I., Kham, S. K. Y., Chia, J. N., Chin, T. M.,Norkamov, B. T., Aziz, A. O. B., and Wong, H. B. (1994) The amplificationrefractory mutation system (ARMS): a rapid and direct prenatal diagnostic tech-niques for β-thalassaemia in Singapore. Prenat. Diagn. 14, 1077–1082.

16. Cai, S. P. and Kan, Y. W. (1990) Identification of the multiple β-thalassaemiamutations by denaturing gradient gel electrophoresis. J. Clin. Invest. 85, 550–553.

17. Losekoot, M. Fodde, R., Harteveld, C. L., Van Heeren, H., Giordano, P. C., andBernini, L. F. (1991) Denaturing gradient gel electrophoresis and direct sequenc-ing of PCR amplified genomic DNA: a rapid and reliable diagnostic approach tobeta thalassaemia. Br. J. Haematol. 76, 269–274.

116 Old

18. Craig, J. E., Barnetson, R. A., Prior, J., Raven, J. L., and Thein, S. L. (1994) Rapiddetection of deletions causing δβ thalassemia and hereditary persistence of fetalhemoglobin by enzymatic amplification. Blood 83, 1673–1682.

19. Newton, C. R., Graham, A., and Heptinstall, L. E. (1989) Analysis of any pointmutation in DNA. The amplification refractory mutation system (ARMS). Nucl.Acids Res. 17, 2503–2516.

20. Quaife, R., Al-Gazali, L., Abbes, S., Fitzgerald, P., Fitches, A., Valler, D., and Old,J. M. (1994) The spectrum of β-thalassaemia mutations in the U.A.E. national popu-lation. J. Med. Genet. 31, 59–61.

21. Kwok, S., Kellogg, D. E., McKinney, N., Spasic, D., Goda, L., Levenson, C., andSninsky, J. J. (1990) Effects of primer-template mismatches on the polymerasechain reaction: human immunodeficiency virus type I model studies. Nucl. AcidsRes. 18, 999–1005.

22. Faa, V., Rosatelli, M. C., Sardu, R., Meloni, A., Toffoli, C., and Cao, A. (1992) Asimple electrophoretic procedure for fetal diagnosis of β-thalassaemia due to shortdeletions. Prenat. Diagn. 12, 903–908.

23. Waye, J. S., Cai, S.-P., Eng, B., Clark, C., Adams, J. G. III, Chui, D. H. K., andSteinberg, M. H. (1991) High haemoglobin A2 βo thalassaemia due to a 532 bpdeletion of the 5' β-globin gene region. Blood 77, 1100–1103.

24. Old, J. M., Varawalla, N. Y., and Weatherall, D. J. (1990) The rapid detection andprenatal diagnosis of β thalassaemia in the Asian Indian and Cypriot populationsin the UK. Lancet 336, 834–837.

25. Thein, S. L., Hesketh, C., Brown, K. M., Anstey, A. V., and Weatherall, D. J.(1989) Molecular characterisation of a high A2 β thalassaemia by direct sequenc-ing of single strand enriched amplified genomic DNA. Blood 73, 924–930.

26. Dimovski, A. J., Efremove, D. G., Jankovic, L., Plaseska, D., Juricic, D., andEfremov, G. D. (1993) A βo thalassaemia due to a 1605 bp deletion of the 5'β-globin gene region. Br. J. Haematol. 85, 143–147.

27. Lynch, J. R., Brown, J. M., Best, S., Jennings, M. W., and Weatherall, D. J. (1991)Characterisation of the breakpoint of a 3.5 kb deletion of the β-globin gene.Genomics 10, 509–511.

28. Craig, J. E., Kelly, S. J., Barnetson, R., and Thein, S. L. (1992) Molecularcharacterisation of a novel 10.3 kb deletion causing β-thalassaemia with unusu-ally high Hb A2. Br. J. Haematol. 82, 735–744.

29. Waye, J. S., Eng, B., and Hunt, J. A., et al. (1994) Filipino β-thalassaemia due toa large deletion: identification of the deletion endpoints and polymerase chainreaction (PCR)-based diagnosis. Hum. Genet. 94, 530–532.

Analysis of Prenatal Diagnosis 117

8

117


Methods for Analysis of Prenatal Diagnosis

John M. Old

1. IntroductionPrenatal diagnosis of β-thalassemia was first accomplished in 1974, and

since then, many countries have developed an extremely successful programfor controlling the disorder based on population screening and fetal diagnosis.Initially, this was performed by the measurement of globin chain synthesis infetal blood, obtained by fetal blood sampling at 18–20 wk of gestation. How-ever, DNA analysis techniques soon began to replace the globin chain synthe-sis approach, first by the indirect technique of restriction fragment lengthpolymorphism (RFLP) analysis, followed by direct detection of mutations byrestriction enzyme digestion and later by oligonucleotide hybridization to DNAfragments on a Southern blot. All of these DNA analysis methods by the South-ern blot technique were complex and expensive, and prenatal diagnosisremained inaccessible for developing countries until the discovery of poly-merase chain reaction (PCR), which led to the development of simpler, quicker,and less expensive nonradioactive methods of mutation detection (1).

Fetal DNA was obtained from cultured amniotic fluid cells until 1982, whenchorionic villous sampling (CVS) in the first trimester of pregnancy was devel-oped (2). Currently, prenatal diagnosis by CVS DNA analysis is the method ofchoice because it is carried out at wk 10–12 of gestation, the risk of fetal mor-tality associated with the method is acceptably low at 1%, and sufficient DNAis obtained for analysis without culturing (3).

Couples at risk of severe hemoglobin (Hb) disorders are first identified byhematological screening tests as directed by published guidelines and flowcharts (4). The basic tests are the measurement of the mean corpuscular vol-ume (MCV) and mean corpuscular Hb (MCH) values, the levels of HbA2 and

118 Old

HbF, and the detection of abnormal Hbs by electrophoresis methods or high-performance liquid chromatography (HPLC). An individual with a reducedMCV and MCH with a normal HbA2 level has α-thalassemia, with a raisedHbA2 level has β-thalassemia, and with a raised HbF level of 5–15% hasδβ-thalassemia. An individual with normal red cell indices and an HbF level of15–30% has hereditary persistence of fetal Hb (HPFH). However, such use ofthese tests has many pitfalls that may lead to the wrong carrier identification.These include the presence of iron deficiency, which also reduces the MCVand MCH; mild β-thalassemia mutations, which are associated with borderlineraised HbA2 levels; and the coinheritance of a δ-thalassemia mutation, whichreduces the HbA2 level in an individual with β-thalassemia trait to a normalvalue (5).

1.1. Diagnostic Approaches

The main diagnostic approaches for the prenatal diagnosis of the hemoglo-binopathies are given in Table 1 in Chapter 7. The PCR-based ones used in mylaboratory are gap-PCR, amplification refractory mutation system (ARMS)-PCR, and restriction endonuclease analysis of amplified product. Detailed pro-tocols for each of these techniques are presented in Chapter 8. A briefdescription of the main globin gene disorders for which prenatal diagnosisshould be offered is given next.

1.2. α-Thalassemia

The most severe form of α-thalassemia results from the homozygous statefor αo-thalassemia, known as Hb Bart’s hydrops fetalis syndrome (6). Thiscondition results from a deletion of all four α-globin genes and an affectedfetus cannot synthesize any α-globin to make HbF or HbA. Examination offetal blood by HPLC or isoelectric focusing reveals only the abnormal HbBart’s (γ4) and a small amount of Hb Portland (ζ2γ2). The resulting severe fetalanemia leads to asphyxia, hydrops fetalis, and stillbirth or neonatal death. Pre-natal diagnosis is always indicated in order to avoid the severe toxemic com-plications that occur frequently in pregnancy with hydropic fetuses.

HbH disease results from the compound heterozygous state of αo- andα+-thalassemia (––/–α) or, more rarely, from the homozygous state of nondele-tion α+-thalassemia mutations affecting the more dominant α2 gene (αTα/αTα)(7). Individuals with HbH disease have a moderately severe hypochromicmicrocytic anemia and produce large amounts of HbH (β4) as a result of theexcess β-chains in the reticulocyte. Patients may suffer from fatigue, generaldiscomfort, and splenomegaly, but they rarely require hospitalization and leada relatively normal life. Therefore, prenatal diagnosis is not normally per-formed for HbH disease. However, there is also a more severe form of HbH


disease arising from the compound heterozygous state of αo-thalassemia andnondeletion α+-thalassemia (– –/αTα). Such patients seem to exhibit moresevere symptoms with a possible requirement of recurrent blood transfusionsand splenectomy. In some situations, couples at risk of this more severe formof HbH disease have opted for prenatal diagnosis and termination of an affectedfetus (8).

1.3. β-Thalassemia

The β-thalassemias are a heterogeneous group of disorders characterized byeither an absence of β-globin chain synthesis (βo type) or a much reduced rate ofsynthesis (β+ type) (9). The majority of the βo and β+ type of mutations are calledsevere mutations because in either the homozygous or compound heterozygousstate they give rise to the phenotype of β-thalassemia major, a transfusion-dependent anemia from early in life. Some β-thalassemia mutations (the mild β+

type, sometimes designated β++ type) in the homozygous state are associatedwith a milder clinical condition called thalassemia intermedia. Thalassemiaintermedia results from a wide variety of disorders including β-thalassemia,δβ-thalassemia, and Hb Lepore. The coinheritance of α-thalassemia or one ofthe many determinants resulting in a raised HbF level in adult life is also afactor that may cause thalassemia intermedia. Patients with thalassemiaintermedia present later in life relative to those with thalassemia major and arecapable of maintaining an Hb level above 6 g without transfusion. By contrast,the phenotype of compound heterozygotes when one of these mild mutations isinherited with a severe mutation is less clear and less predictable. Some of theseindividuals have a mild phenotype, especially if it involves a very mild mutationsuch as one of the “silent β-thalassemia” mutations, whereas others are moresevere and are often transfusion dependent. The unpredictability of the pheno-type in compound heterozygotes remains a diagnostic and counseling problem.

1.4. Interaction of Thalassemia with Hb Variants

The β-thalassemia mutations and various Hb variant mutations can interact toproduce a number of thalassemia and sickle cell disorders for which genetic coun-seling and prenatal diagnosis should be offered. These interactions are presented inFig. 1. The interactions are divided into combinations that have a risk of resultingin a serious disorder, those that have a risk of a less serious disorder, and those thatpose no risk of a serious disorder. Also included are the carrier combinations thatcan give rise to a hidden risk (i.e., a risk not easily discernible by simple hemato-logical analysis) of having a fetus affected with homozygous αo-thalassemia. Thiscan occur because the carrier state for various β-thalassemia disorders can maskcoexisting αo-thalassemia trait in regions where both disorders are found (e.g., inSoutheast Asia). Thus, for couples in whom one partner is diagnosed by hemato-

120 Old

logical screening as a carrier of β-thalassemia and the other a possible carrier ofαo-thalassemia, the individual with β-thalassemia should also be screenedfor αo-thalassemia mutations by DNA analysis.

2. Materials (Sources of Fetal DNA)2.1. Blood

DNA is normally prepared from 5–10 mL of peripheral blood that is antico-agulated with heparin or, preferably, EDTA. The DNA can be isolated by thestandard method of phenol-chloroform extraction and ethanol precipitation, orby using one of several available kits on the market based on salt extraction,protein precipitation, and so on. Sufficient DNA is obtained for molecularanalysis and subsequent storage in a DNA bank at –20°C. If this is not required,a much smaller quantity of blood may be used for PCR diagnosis of the globingene disorders. Mutation analysis may be carried out by simply adding 1 µL ofboiled whole blood to the PCR reaction mixture (10).

2.2. Amniotic Fluid

DNA can be prepared from amniotic fluid cells directly or after culturing. Itis prudent to prepare DNA directly from half the sample and to set up the other

Fig. 1. Diagram showing interactions of various thalassemia disorders and abnor-mal Hb variants S, C, E, D Punjab, O Arab, and Lepore.


half of the sample for cell culturing as a backup source of DNA. It takes 2 to 3 wkto grow amniocytes to confluence in a 25-mL flask, but culturing has the advan-tage that a large amount of DNA is obtained (in our experience, the yield fromsuch a flask has varied from 15 to 45 µg, enough DNA for all types of analy-ses). A diagnosis can be made using DNA from noncultivated cells in mostcases. Approximately 5 µg of DNA is obtained from 15 mL of amniotic fluid,which is sufficient for any PCR-based method of analysis. However, for geno-type analysis by Southern blotting, it is only enough for one attempt and thus abackup culture is essential in case of failure. The method of DNA preparationfor both cultured and noncultivated cells is essentially the same as that forchorionic villi (11).

2.3. Chorionic Villi

The two main approaches to CVS—ultrasound-guided transcervical aspira-tion and ultrasound-guided transabdominal sampling—both provide good-quality samples of chorionic villi for fetal DNA diagnosis. Sufficient DNA isnormally obtained for both PCR and Southern blot analysis of the globin genes.For my laboratory’s first 200 CVS DNA diagnoses, the average yield of DNAwas 46 µg and only in one instance was <5 µg obtained (11). The main techni-cal problem with this source of fetal DNA is the risk of contamination withmaternal DNA, which arises from the maternal decidua that is sometimesobtained along with the chorionic villi. However, by careful dissection andremoval of the maternal decidua with the aid of a phase-contrast microscope,pure fetal DNA samples can be obtained, as demonstrated by Rosatelli et al.(12), who reported no misdiagnoses in a total of 457 first-trimester diagnosesfor β-thalassemia in an Italian population. Maternal contamination can be ruledout in most cases by the presence of one maternal and one paternal allele fol-lowing the amplification of highly polymorphic repeat markers (13). The riskof misdiagnosis through maternal DNA contamination can be further reducedby the preparation of DNA from a single villous frond.

2.4. Fetal Cells in Maternal Blood

Fetal cells have long been known to be present in the maternal circulation, andthey provide an attractive noninvasive approach to prenatal diagnosis. Neverthe-less, attempts to isolate the fetal cells using immunological methods and cellsorters have been only slightly successful in providing a population of cells pureenough for fetal DNA analysis. Until recently, analysis of fetal cells in maternalblood could only be applied for the prenatal diagnosis of β-thalassemia in womenwhose partners carried a different mutation, as reported for the diagnosis of HbLepore (14). However, the development of the technique of isolating singlenucleated fetal erythrocytes by micromanipulation under microscopic obser-

122 Old

vation (15) has permitted the analysis of both fetal genes in single cells frommaternal blood. This approach was shown to be possible for prenatal diagnosisby the report of two successful cases of sickle cell anemia and β-thalassemia(16), but it remains technically very difficult and the method has not beenwidely adopted.

2.5. Samples for Preimplantation Genetic Diagnosis

Preimplantation genetic diagnosis of for the globin gene disorders is nowpossible either by DNA analysis of single cells biopsied from cleaving em-bryos or by the analysis of polar body DNA obtained from the two polar bodiesextruded during the maturation of the oocyte. Both approaches use a nestedPCR technique and appear to be subject to the problem of allele dropout. Thisproblem, like that of maternal contamination, is overcome by the simultaneousanalysis of other maternal and paternal markers (17). Only the eggs without thedefect are fertilized and implanted in the mother. This approach is appealing tocouples whose religious beliefs will not permit the termination of a pregnancyand for those who have already had several therapeutic abortions. However,the preimplantation genetics diagnosis approach is limited in its applicabilityby the degree of technical difficulty of the amplification procedure and thehigh costs of the obstetric procedure.

3. Methods (see Notes 1–5)The methods of DNA analysis used for prenatal diagnosis are the same as

those used for mutation screening in Chapter 7. However, in addition to themutation-specific primers described previously, normal sequence-specificprimers are required. These are necessary for the diagnosis of normal DNAsequence in cases in which both partners carry the same mutation. The normalARMS primer sequences for many of the common β-thalassemia mutationsare detailed in Table 1. Examples of the prenatal diagnosis of β-thalassemiaand sickle cell disease are shown in Figs. 2–4.

Further tests are also necessary. A second method of diagnosis is applied when-ever possible to confirm the result, and analysis of the inheritance of fetal DNApolymorphisms is necessary for checking maternal DNA contamination. Analysisof the linkage of the β-globin gene haplotype polymorphisms is a useful secondapproach for confirmation of results in some cases in which a family study is pos-sible. However, it is not so useful for checking the presence of maternal DNAcontamination and the occasional case of false paternity; a more general approachis obtained by the use of highly polymorphic markers. These can be short tandemrepeat polymorphisms or variable number tandem repeat (VNTR) polymorphisms,the latter approach favored by my laboratory because the method is very simple,using the same gel electrophoresis protocol as the ARMS procedure.

Analysis of P

renatal Diagnosis

123

Table 1Primer Sequences Used for the Detectionof Normal DNA Sequence by Allele-Specific Priming Techniquea

Second Product sizeMutation Oligonucleotide sequence Primer (kb)

–87 (CÆG) CACTTAGACCTCACCCTGTGGAGCCACCCC A 683CD5 (–CT) CAAACAGACACCATGGTGCACCTGACTCCT A 528CD8 (–AA) ACACCATGGTGCACCTGACTCCTGAGCAGA A 520CD8/9 (+G) CCTTGCCCCACAGGGCAGTAACGGCACACT B 225CD15 (G → A) TGAGGAGAAGTCTGCCGTTACTGCCCAGTA A 500CD39 (C → T) TTAGGCTGCTGGTGGTCTACCCTTGGTCCC A 299CD41/42 (–TCTT) GAGTGGACAGATCCCCAAAGGACTCAAAGA B 439IVSI-1 (G → A) TTAAACCTGTCTTGTAACCTTGATACCCAC B 281IVSI-1 (G → T) GATGAAGTTGGTGGTGAGGCCCTGGGTAGG A 455IVSI-5 (G → C) CTCCTTAAACCTGTCTTGTAACCTTGTTAC B 285IVSI-6 (T → C) AGTTGGTGGTGAGGCCCTGGGCAGGTTGGT A 449IVSI-110 (G → A) ACCAGCAGCCTAAGGGTGGGAAAATACACC B 419IVSII-1 (G → A) AAGAAAACATCAAGGGTCCCATAGACTGAC B 634IVSII-654 (C → T) GAATAACAGTGATAATTTCTGGGTTAACGC D 829IVSII-745 (C → G) TCATATTGCTAATAGCAGCTACAATCGAGC D 738βS CD6 (A → T) AACAGACACCATGGTGCACCTGACTCGTGA A 527βE CD26 (G → A) TAACCTTGATACCAACCTGCCCAGGGCGTC B 236

a See Table 4 legend of Chapter 7 for details of primers A–D and control primers.

123

124 Old

3.1. Haplotype Analysis

Linkage analysis of RFLPs within the β-globin gene cluster can often beused for prenatal diagnosis of β-thalassemia in rare cases in which one or bothof the mutations remain unidentified after screening using a direct detectionmethod such as ARMS. The technique can also enable the prenatal diagnosisof uncharacterized δβ-thalassemia deletion mutations through the apparentnon-Mendelian inheritance of RFLPs (owing to the hemizygosity created bythe inheritance of deleted sequences on one chromosome). Finally, haplotypeanalysis may provide an alternative approach for the confirmation of a prenataldiagnosis result obtained by a direct detection method such as ARMS and, invery rare instances, has helped to reveal a possible diagnostic error (18).

At least 18 RFLPs have been characterized within the β-globin gene cluster(19). However, most of these RFLP sites are nonrandomly associated with each

Fig. 2. Prenatal diagnosis for β-thalassemia using ARMS primers to detect muta-tions IVS1–110 (G → A) and codon 39 (C → T). Lanes 1 and 6, fetal DNA; lanes 2and 4, maternal DNA; lanes 3 and 5, paternal DNA. Lanes 1–3 show the results withan ARMS primer for codon 39, and lanes 4–6 show the results with an ARMS primerfor IVS1–110. The upper band is the 861-bp control product. The results show that thefetus was heterozygous for codon 39.


other and thus combine to produce just a handful of haplotypes (20). In par-ticular, they form a 5' cluster that is 5' to the δ gene and a 3' cluster that extendsdownstream from the β-globin gene. The DNA in between the two clusterscontains a relative hotspot for meiotic recombination with a rate of approx 1 in350 meioses (21). The β-globin gene cluster haplotype normally consists of 5RFLPs located in the 5' cluster (HindII/ε gene, HindIII/Gγ gene, HindIII/Aγgene, HindII/3'ψβ-gene, and HindII/5'ψβ-gene) and two RFLPs in the 3' clus-ter (AvaII/β gene, BamHI/β gene) (22).

All of the seven RFLPs except BamHI can be analyzed by PCR very simplyand quickly using the procedure described in Chapter 7 for PCR and restrictionenzyme digestion. The primer sequences and sizes of the fragments generatedare provided in Table 2. The BamHI RFLP is located within an L1 repetitive

Fig. 3. Prenatal diagnosis for β-thalassemia using ARMS primers to detect muta-tion IVS1–5 (G → C). The diagram of the β-globin gene shows the location of themutation and its specific ARMS primer (M) plus the positions of the common primer(B) and two control primers (E and D) that generate an 861-bp product. The ethidiumbromide–stained gel shows the results of screening of parental DNA samples withmutant primer in lanes 1 and 2, a homozygous IVS1–5 (G → C) control DNA withnormal primer in lane 3, and the CVS DNA with mutant primer and normal primer inlanes 4 and 5, respectively. Generation of the specific 285-bp product with normalprimer and the absence of product with mutant primer shows that the fetus is normalfor the IVS1–5 (G → C) mutation.

126 Old

element creating amplification problems, and an Hinf I RFLP located just 3' tothe β-globin gene is used instead, because these two RFLPs have been found toexist in linkage disequilibrium (23). Three other RFLPs are included in Table 2.An AvaII RFLP in the ψβ gene is extremely useful in haplotype analysis ofMediterranean β-thalassemia heterozygotes. The (–) allele for this RFLP isfrequently found on chromosomes carrying the IVSI-110 mutation, whereas itis very rare on normal β-globin chromosomes (24) and thus is a very usefulinformative marker for individuals heterozygous for this mutation. The RsaIRFLP located just 5' to the β-globin gene is useful for linkage analysis becauseit appears to be unlinked to either the 5' cluster or the 3' cluster RFLPs and thusmay be informative when the 5' haplotype and the 3' haplotype are not. Finallythe Gγ-XmnI RFLP, created by the nondeletion HPFH C → T mutation at posi-tion –158, is included because of its use in the analysis of sickle cell genehaplotypes and in individuals with thalassemia intermedia.

Fig. 4. Diagnosis of sickle cell genotypes by DdeI digestion. The diagram shows amap of the DdeI sites at the 5' end of the β-globin gene together with the results ofanalysis of heterozygous parental DNA samples (AS) in lanes 1 and 2, the CVS DNAin lane 3, a normal DNA (AA) control in lane 4, and a homozygous (SS) DNA controlin lane 5.

Analysis of P

renatal Diagnosis

127

127

Table 2Primers Used for Analysis of β-Globin Gene Cluster RFLPs

Product Coordinates Absence Presence Annealingsize on GenBank of site of site temperature

RFLP site Primer sequences: 5'–3' (bp) sequence U01317 (bp) (bp) (°C)

Hind II ε-gene 5 TCTCTGTTTGATGACAAATTC 760 18652–18672 760 315 555 AGTCATTGGTCAAGGCTGACC 19391–19411 445

Xmn I Gγ-gene 5 AACTGTTGCTTTATAGGATTTT 657 33862–33883 657 455 555 AGGAGCTTATTGATAACCTCAGAC 34495–34518 202

HindIII Gγ-gene 5 AGTGCTGCAAGAAGAACAACTACC 326 35677–35700 326 235 655 CTCTGCATCATGGGCAGTGAGCTC 35981–36004 91

HindIII Aγ-gene 5 ATGCTGCTAATGCTTCATTAC 635 40357–40377 635 327 655 TCATGTGTGATCTCTCAGCAG 40971–40991 308

HindII 5' ψβ-gene 5 TCCTATCCATTACTGTTCCTTGAA 795 46686–46709 795 691 555 ATTGTCTTATTCTAGAGACGATTT 47457–47480 104

HindII 3' ψβ-gene 5 GTACTCATACTTTAAGTCCTAACT 913 49559–49582 913 479 555 TAAGCAAGATTATTTCTGGTCTCT 50448–50471 434

AvaII ψβ-gene Sequence as for Hind 5'ψβ RFLP 795 46686–46709 795 440 5547457–47480 355

RsaI β-gene 5 AGACATAATTTATTAGCATGCATG 1200 61504–61527 411 330 555 CCCCTTCCTATGACATGAACTTAA 62680–62703 Plus constant 81

fragments of Plus694 and 95 694 and 95

AvaII β-gene 5 GTGGTCTACCCTTGGACCCAGAGG 328 62416–62439 328 228 655 TTCGTCTGTTTCCCATTCTAAACT 62720–62743 100

HinfI β-gene 5 GGAGGTTAAAGTTTTGCTATGCTGTAT 474 63974–64001 320 213 555 GGGCCTATGATAGGGTAAT 64429–64447 Plus constant 107

fragment of and154 154

128 Old

3.2. VNTR Analysis

A check for maternal contamination in the fetal DNA sample by polymor-phism analysis should always be set up at the same time as the globin gene muta-tion assays. In my laboratory, we routinely analyze the fetal DNA and parentalDNA samples for two VNTR (13) polymorphisms, the Apo B and IgJh VNTRs.In the very rare cases in which neither of the polymorphic markers providesinformative results that exclude the possibility of maternal contamination, otherVNTR polymorphisms are tried such as the Col2A1gene VNTR locus (25) andthe D4S95 marker from the Huntington disease region of chromosome 4 (26).The primer sequences and size range of the PCR products for these four VNTRmarkers are given in Table 3. All except the IgJh primers use the standard ARMSPCR buffer. The IgJh primers require an (NH4)2SO4 buffer: 75 mM Tris-HCl(pH 9.0), 20 mM (NH4)2SO4, 2.0 mM MgCl2, 0.01% Tween, 10% dimethylsul-foxide, 10 mM β-mercaptoethanol (all final concentrations).

4. Notes1. The main problem of prenatal diagnosis is diagnostic error leading to misdiagno-

sis. An audit of the accuracy of prenatal diagnosis for the Hb disorders in theUnited Kingdom from 1974 to 1999 revealed a diagnostic error rate of 0.41%.Diagnostic errors were recorded to have occurred from the very high sensitivityof PCR to maternal DNA contamination, the failure to amplify the target sequence,false paternity, sample exchange, and various nonlaboratory errors such as incor-rect referral or diagnosis by hematological screening of parental phenotypes (18).

2. Nonlaboratory errors are minimized by insisting that fresh blood samples bereceived for confirmation of the parental phenotypes in every case. In cases whena fresh blood sample from the father is simply not available (in couples at risk ofa sickle cell disorder), extra tests for other possible globin gene mutations arecarried out. In particular, when a fetal genotype of AS is diagnosed, the fetalDNA is always analyzed for the βC mutation and the common β-thalassemiamutations observed in the ethnic group of the father.

3. Laboratory errors are minimized by performing duplicate tests, and preparingDNA from both a single frond and the bulk CVS material whenever possible.Technical errors such as partial digestion or allele dropout are minimized by usingtwo independent diagnostic methods on each sample whenever possible.

4. Polymorphism analysis is used routinely to exclude error owing to maternal DNAcontamination or nonpaternity. Maternal DNA contamination must be excluded inall cases in which the fetal diagnosis is the same genotype as the mother. The risk ofmaternal DNA contamination is much lower in cases in which the fetus is normal, ishomozygous, or has inherited a different mutation from that carried by the mother.

5. The precautions in Notes 1–4 form a best code of practice for minimizing errorsin prenatal genetic testing for any genetic disorder. The guidelines for best prac-tice are as follows:

Analysis of P

renatal Diagnosis

129

129

Table 3Primers Used for the Check for Maternal DNA Contamination by VNTR Analysis

Annealing Repeat Size range ofVNTR Primer pair temperature (°C) length (bp) products (bp)

Apo B 5'-GAAACGGAGAAATTATGGAGGG-3'5'-TCCTGAGATCAATAACCTCG-3' 55 30 541–871

IgJh 5'-GGGCCCTGTCTCAGCTGGGGA-3'5'-TGGCCTGGCTGCCCTGAGCAG-3' 68 50 520–1720

Col2A1 5'-CCAGGTTAAGGTTGACAGCT-3'5'-GTCATGAACTAGCTCTGGTG-3' 55 34 and 31 584–779

D4S95 5'-GCATAAAATGGGGATAACAGTAC-3'5'-GACATTGCTTTATAGCTGTGCCTCAGTTT-3' 60 39 900–1600

130 Old

a. Ensure that fresh parental blood samples are obtained with the fetal sample inorder to check the parental phenotypes and to provide fresh control DNA samples.

b. Ensure that the chorionic villus sample has undergone careful microscopicdissection to remove any contaminating maternal decidua.

c. Always analyze parental and the appropriate control DNAs with the fetal DNAand always repeat the fetal DNA analysis to confirm the result.

d. Whenever possible use an alternative diagnostic method to confirm the diagnosis.e. Use a limited number of amplification cycles to minimize any coamplifica-

tion of maternal DNA sequences.f. Check for maternal DNA contamination in every case.g. Be sure that the fetal DNA diagnosis report details the types of DNA analysis

used and clearly states the risk of misdiagnosis owing to technical errors basedon current data.

References1. Old, J. (1996) Haemoglobinopathies. Prenat. Diagn. 16, 1181–1186.2. Old, J. M., Ward, R. H. T., Petrou, M., Karagozlu, F., Modell, B., and Weatherall,

D. J. (1982) First-trimester fetal diagnosis for haemoglobinopathies: three cases.Lancet 2, 1413–1416.

3. Old, J. M. (1999) Haemoglobinopathies, in Fetal Medicine: Basic Science andClinical Practice (Rodeck, C. H. and Whittle, M. J., eds.), Churchill Livingstone,London, pp. 483–498.

4. The Thalassemia Working Party of the BCSH General Haematology Task Force (1994)Guidelines for the fetal diagnosis of globin gene disorders. J. Clin. Pathol. 47, 199–204.

5. Cao, A., Rosatelli, M. C., and Eckman, J. R. (2001) Prenatal diagnosis and screeningfor thalassemia and sickle cell disease, in Disorders of Hemoglobin: Genetics, Patho-physiology, and Clinical Management (Steinberg, M. H., Forget, B. G., Higgs, D. R.,and Nagel, R. L., eds.), Cambridge University Press, Cambridge, MA, pp. 958–978.

6. Weatherall, D. J.and Clegg, J. B., ed. (1981) The Thalassemia Syndromes,Blackwell Scientific, Oxford.

7. Higgs, D. R., Vickers, M. A., Wilkie, A. O. M., et al. (1989) A review of themolecular genetics of the human a-globin gene cluster. Blood 73, 1081–1104.

8. Ko, T. M., Tseng, L. H., Hsieh, F. J., and Lee, T. Y. (1993) Prenatal diagnosis ofHbH disease due to compound heterozygosity for south-east Asian deletion andHb constant spring by polymerase chain reaction. Prenat. Diag. 13, 143–146.

9. Olivieri, N. F.and Weatherall, D. J. (2001) Clinical aspect of b-thalassemia, inDisorders of Hemoglobin: Genetics, Pathophysiology, and Clinical Management(Steinberg, M. H., Forget, B. G., Higgs, D. R., and Nagel, R. L., eds.), CambridgeUniversity Press, Cambridge, MA, pp. 277–341

10. Liu, Y. T., Old, J. M., Fisher, C. A., Weatherall, D. J., and Clegg, J. B. (1999)Rapid detection of a-thalassemia deletions and a-globin gene triplication by mul-tiplex polymerase chain reactions. Br. J. Haematol. 108, 295–299.

11. Old, J. M. (1986) Fetal DNA analysis, in Genetic Analysis of the Human Disease:A Practical Approach (Davies, K. E., ed.), IRL, Oxford, England, pp. 1–16.


12. Rosatelli, M. C., Sardu, R., Taveri, T., Scalas, M. T., Di-Tucci, A., De-Murtas, M.,Loudianos, G., Monni, G., and Cao, A. (1990) Reliability of prenatal diagnosis of geneticdiseases by analysis of amplified trophoblast DNA. J. Med. Genet. 27, 249–251.

13. Decorte, R., Cuppens, H., Marynen, P., and Cassiman, J.-J. (1990) Rapid detec-tion of hypervariable regions by the polymerase chain reaction technique. DNACell. Biol. 9, 461–469.

14. Camaschella, C., Alfarano, A., Gottardi, E., Travi, M., Primignani, P., Cappio, F.C., and Saglio, G. (1990) Prenatal diagnosis of fetal hemoglobin Lepore-Bostondisease on maternal peripheral blood. Blood 75, 2102–2106.

15. Sekizawa, A., Watanabe, A., Kimwa, T., et al (1996) Prenatal diagnosis of thefetal RhD blood type using a single fetal nucleated erythrocyte from maternalblood. Obstet. Gynaecol. 87, 501–505.

16. Cheung, M.-C., Goldberg, J. D., and Kan, Y. W. (1996) Prenatal diagnosis ofsickle cell anemia and thalassemia by analysis of fetal cells in maternal blood.Nat. Genet. 14, 264–268.

17. Kuliev, A., Rechitsky, S., Verlinsky, O., Ivakhnenko, V., Cieslak, J., Evsikov, S.,Wolf, G., Angastiniotis, M., Kalakoutis, G., Strom, C., and Verlinsky, Y. (1999)Birth of healthy children after preimplantation diagnosis of thalassemias. J. Assist.Reprod. Genet. 16, 207–211.

18. Old, J., Petrou, M., Varnavides, L., Layton, M., and Modell, B. (2000) Accuracyof prenatal diagnosis of hemoglobin disorders in the United Kingdom: twenty-five years experience. Prenat. Diagn. 20, 986–991.

19. Kazazian, H. H. Jr. and Boehm, C. D. (1988) Molecular basis and prenatal diag-nosis of b-thalassaemia. Blood 72, 1107–1116.

20. Antonarakis, S. E., Boehm, C. D., Diardina, P. J. V., and Kazazian, H. H. J. (1982)Non-random association of polymorphic restriction sites in the b-globin gene clus-ter. Proc. Natl. Acad. Sci. USA 79, 137–141.

21. Chakravarti, A., Buetow, K. H., Antonarakis, S. E., Waber, P. G., Boehm, C. D.,and Kazazian, H. H. (1984) Non-uniform recombination within the humanb-globin gene cluster. Am. J. Hum. Genet 36, 1239–1258.

22. Old, J. M., Petrou, M., Modell, B., and Weatherall, D. J. (1984) Feasibility ofantenatal diagnosis of b-thalassemia by DNA polymorphisms in Asian Indiansand Cypriot populations. Br. J. Haematol. 57, 255–263.

23. Semenza, G. L., Dowling, C. E., and Kazazian, H. H. Jr. (1989) Hinf I polymor-phisms 3' to the human b globin gene detected by the polymerase chain reaction(PCR). Nucl. Acids Res. 17, 2376.

24. Wainscoat, J. S., Old, J. M., Thein, S. L., and Weatherall, D. J. (1984) A newDNA polymorphism for prenatal diagnosis of b-thalassemia in Mediterraneanpopulations. Lancet 2, 1299–1301.

25. Berg, E. S. and Olaisen, B. (1993) Characterization of the COL2A1 VNTR poly-morphism. Genomics 16, 350–354.

26. Allitto, B. A., Horn, G. T., Altherr, M. R., Richards, B., McClatchey, A. I.,Wasmuth, J. J., and Gusella, J. F. (1991) Detection by PCR of the VNTR poly-morphism at D4S95. Nucl. Acids Res. 19, 4015.

132 Old

Hemoglobin Fluorescence 133

9

133


Hemoglobin Fluorescence

Rhoda Elison Hirsch

1. IntroductionProtein structural analysis took a big leap forward with the discovery of

aromatic amino acid and protein fluorescence (1–4). The intrinsic fluorescenceof proteins is a highly sensitive reporter of conformational change at or nearthe fluorescent tryptophans (Trp) and tyrosines (Tyr). Phenylalanine also exhib-its ultraviolet (UV) fluorescence excitation and emission, with a low quantumyield that becomes insignificant in proteins containing Tyr and Trp. The bind-ing of specific extrinsic fluorescent probes allows the site-specific probing ofother microdomains or nonfluorescent side chains. Fluorescence resonanceenergy transfer measurements serve as a “spectroscopic ruler” to measure intra-molecular and intermolecular distances and may also be used to ascertain themagnitude of conformational change on ligand binding, protein folding, andprotein-protein interactions ([5]; for basic principles of fluorescence, see ref. 6).

For more than two decades, intact heme-proteins (i.e., the protein with itsheme moiety [or moieties] and subunits required for functionality), includingnatural hemoglobin (Hb) variants, had been excluded from this highly sensi-tive and informative direct spectroscopic structural probing. This exclusionwas based on the general assumption that the fluorescence emission from theTyr and Trp residues was effectively quenched by the heme moieties (7).Despite the presumed quenching effects, clever utilization of the phenomenonof fluorescence quenching by the hemes provided informative ligand-bindingstudies of Hbs (e.g., see ref. 8–11).

The choice of optics in fluorescence detection contributed significantly tothe dogma that heme proteins do not exhibit fluorescence emission. Standardfluorescence instruments typically employ right-angle optics wherein a highlyabsorptive sample, such as Hb, introduces significant inner-filter effects that

134 Hirsch

mask the emission. It has been estimated that the hemes give rise to ~99%nonradiative quenching of the aromatic intrinsic fluorophores (7), but this mayneed to be reevaluated when factoring in corrections for inner-filter effect.

Front-face fluorometry and/or alternative excitation and emission detectionsources enabled the direct detection of fluorescence emission from Hb. Theapplication of a synchrotron light excitation source yielded the first direct fluo-rescence lifetime decay measurements in the nanosecond range of Hb and itssubunits compared with that of the apoprotein (albeit, as noted by the authors,with poor precision [±0.25 ns]) (12). In 1980, the simultaneous discovery ofsignificant steady-state Hb intrinsic fluorescence emission, by independentlaboratories, using more sensitive detectors (13) or front-face optics (14), facil-itated the application of fluorescence principles and methodology to provide apowerful tool to probe Hb structure. The use of Trp Hb mutants (with substitu-tions that increased or decreased the number of tryptophans) demonstrated thesignificance of the fluorescence emission (Fig. 1). In contrast to theoreticalcalculations by others (15), the experimental data by different laboratories indi-cated that β37 Trp at the α1β2 interface is the primary contributor to the fluo-rescence emission and report on alterations in the R → T transition (for areview, see refs. 16 and 17).

With these observations in mind, heme-protein fluorescence was revisitedby Alpert, Jameson, Weber, and colleagues (13,18), who concluded that con-sideration of motions of groups involved in energy transfer mechanisms maydramatically reduce the transfer energy resulting in the observed unquenchedsteady-state emission.

This chapter focuses on details of the methodology regarding front-face fluo-rometry of Hbs: (1) intrinsic Hb fluorescence and (2) the employment of extrin-sic fluorescence probes to explore nonaromatic site-specific microdomains ofthe Hb tetramer. For in-depth explanations of general fluorescence principlesand heme-protein fluorescence (see refs. 6, 16, and 17, respectively).

1.1. Front-Face Fluorometry

Front-face fluorometry provides multiple advantages in measuring the fluo-rescence of any protein solution with a high extinction coefficient of absorp-tion such as Hb. With standard right-angle optics, emission is detected at rightangles from the exciting beam through optics focused to the center of the cuvet.Therefore, in a strongly absorbing solution, all absorption takes place nearthe front surface, with little excitation occurring in the center of the cuvet, andthe detector receives little or no light. In essence, using right-angle geometry, thehighly absorbent solution itself acts as an inner filter.

Inner-filter effects are essentially eliminated by front-face fluorescence mea-surements. Optimal front-face measurements are made when the incident light


makes an angle of 34° with the normal to the cell face, or 56°, depending on theorientation of the front-face cell adapter (Fig. 2, [19]). This permits the detec-tion of fluorescence emission from optically dense concentrated solutions ofHb. This feature is desirable because the dimer-tetramer dissociation equilib-rium (discussed later) is shifted toward the native tetramer at higher (i.e., mil-limolar or submillimolar) concentrations, in contrast to the micromolarrequirements of right-angle optics.

Unlike right-angle optics, with front-face optics, there is a certain concentra-tion of fluorophore wherein the fluorescence intensity is no longer dependent onconcentration (19). This is advantageous because it eliminates artifacts such asthose introduced by small pipeting errors. For HbA, this concentration-independent plateau is reached at concentrations >0.3 g% (~0.19 mM heme or~0.05 mM tetramer) (Fig. 3, [14]).

Fig. 1. Front-face steady-state intrinsic fluorescence emission (uncorrected) ofoxyHb tryptophan variants (from Hirsh et al. [14]). H*, HbH β4 [2 β15Trp and 2 β37Trp], where the sensitivity of the recorder is one-third less than that recorded for theother Hbs (i.e., the actual relative intensity is three times that shown); F, HbF (α2γ2);A, HbA, α2β2 [α14 Trp, β15Trp, β37Trp]; RC, Hb Rothschild (α14Trp, β37 Trp →Arg). More recently, under different conditions and preparations, a low-intensitydefined emission maximum near ~330 nm (excitation: 296 nm) has been observed forHb Rothschild, while the emission spectrum with 280 nm excitation appears the same(A). (B) The intrinsic fluorescence emission spectra of variant hemoglobins obtainedwith 296 nm excitation that specifically excites tryptophan.

136 Hirsch

Front-face measurements may be simply, but suboptimally, achieved in aright-angle configuration with the use of small (millimolar) rounded cuvets ortriangular cuvets (14,16–17,20), with the latter providing more sensitive detec-tion. A front-face cell is designed for easy insertion into a standard cuvet holderfor 1 × 1 cm cells and orients the sample for the optimal angle requirement(Fig. 4A). The small volume required for this cell (100–200 µL) becomes ad-vantageous when studying heme-proteins with limited availability (e.g., scarcemutants or recombinant mutants). However, an instrument designed with ahorizontal orientation of the light source slit may preclude use of this cell.Most companies now offer the option of temperature controlled front-faceadapters designed specifically for the fluorometer.

Fig. 2. Comparison of fluorescence optics: (A) front-face; (B) right-angle optics.(From ref. 17.)


Novel variations in front-face optical designs provided further advantage inthe study of heme-protein fluorescence. The rhombiform optical cell (Fig. 4B),designed by Horiuchi and Asai (21), simultaneously measures absorption andfluorescence. This allows direct and continuous measurements of the bindingof a fluorescent allosteric effector to Hb (at a limited range of concentration),while assessing variations in the partial pressure of oxygen during deoxygen-ation. The solution is gently stirred for gas exchange. Caution must be exer-cised when stirring any protein solution, and especially Hbs, which may besubject to mechanical instability (e.g., HbS [22]). With the purpose of elimi-nating reflections and stray emissions (which may become significant for therelatively low fluorescence emission of heme-proteins), Bucci and colleagues(23,24) developed an optimized shielded cuvet as well as designed an opticalcell with a front-face configuration that operates on a free liquid surface (Fig. 4C).This also avoids any possible protein conformational changes induced by aprotein-solid interface. However, air-water interfaces do have the potential toinduce protein unfolding for some proteins and Hb mutants (25–26).

Absolute fluorescence and the determination of quantum yields are not pos-sible with heme-proteins until one can design a true “blank”: the identicalglobin fold without the heme. Finding a true blank remains a challenge sincethe respective apoglobins (i.e., globin without the heme) are structurally dis-

Fig. 3. Concentration dependence of Hb fluorescence emission intensity plateauswhen using front-face optics. Excitation wavelength: 280 nm; oxyHbA: 0.07 mM tet-ramer, 0.05 M potassium phosphate buffer, 25°C. (From ref. 14.)

138 Hirsch

Fig. 4. Novel fluorescence optical designs for detection of heme-protein fluores-cence. (A) Front-face optics is achieved by an insert placed in a standard right-anglecuvet holder. The base plate shown on the left is removable. The key feature is that theexciting light makes an angle of 34° with the normal to the cell face, or, by inverting,one may make the angle of incidence 56°. The central rays of the excitation and emis-sion beams intersect normally at the center of the cuvet holder for either configuration.


tinct from intact Hb or intact myoglobin and, therefore, unsuitable for this pur-pose. Apohemoglobin and apomyoglobin exhibit shifted fluorescence emis-sion maximas consistent with findings that apohemoglobin is a dimer (27,28)and apomyoglobin is unfolded (29). Apohemoglobin derived from HbA exhib-its a fluorescence emission maximum shifted ~14 nm to longer wavelengths.Obviously, in the quest for a blank, the buffer does not represent a true baselinefor a heme-protein. Therefore, until a true blank is designed, absolute fluores-cence quantum yields are unattainable. Yet, this limitation has not impeded theutility of heme-protein fluorescence analysis and interpretation.

Since fluorescence polarization calculations are based on right-angle optics,only relative polarization and anisotropic measurements are meaningful withfront-face fluorescence using adapters with quartz cuvets. Alternative front-face cell designs (Fig. 4B,C) may provide a means to reduce the distortions inanisotropic measurements that are introduced by front-face fluorometry (24).

Front-face optics also have been used in time-resolved fluorescence mea-surements of hemoglobins (30). Generally, with state-of-the-art time-resolvedfluorescence measurements, normal Hb exhibits a multiexponential decay thatfits to three lifetimes. Since Trp itself exhibits a multiexponential decay, inter-pretation of the intrinsic fluorescence lifetimes (picosecond, subnanosecond,and nanosecond) remains controversial and is discussed at length in ref. 17.Nevertheless, the intrinsic and extrinsic fluorescence of Hb is an establishedproperty that is useful in probing structural perturbations in Hb.

Noteworthy is that front-face fluorometry is clinically important for the detec-tion of fluorescent components circulating in blood. The hematofluorometerwas designed to measure blood levels of zinc protoporphyrin, which rises inlead poisoning and iron deficiency anemia, and blood levels of protoporphyrinIX, which may rise in porphyria diseases (e.g., erythropoietic protoporphyria)(31–33). Circulating bilirubin may also be detected by this method (34). Fur-thermore, front-face fluorometry has been useful in detecting the binding ofporphyrins to Hb (35); correlating high zinc protoporphyrin levels in sickle

Fig. 1. (continued) The front window of the cell is 0.5 mm thick and the sample thick-ness is 1 mm. This cuvet is advantageous for rare samples, requiring ~100–200 µL.(From ref. 19.) (B) Shown is the schematic of the rhombiform optical cell compart-ment. Components (a) and (b) are made of quartz, and (c) is the Hb sample. The solidline depicts the incident excitation light beam; the broken and dotted lines show thetransmitted and the emitted light, respectively. θ is 52.4°, avoiding light direct excita-tion beam reflectance. (From ref. 21.) (C) Side view of free-surface cuvet. 1–3, Fixedquartz windows; 4, sliding quartz window; 5, metallic mirror; 6, body of the cover; 7,body of the cuvet; 8, supporting stem; 9, liquid sample; 10, O-rings. (From refs. 23and 24.) (Composite figure from ref. 17.)

140 Hirsch

cell patients with low HbF levels (36); and detecting circulating fluorescentdrugs, such as the antibiotic tetracycline (37), and drugs used in inflammatorybowel disease, such as the aminosalicylic acid derivatives that circulate inblood (38–39).

1.2. Intrinsic Hb Fluorescence Emission Is Sensitive to Tertiaryand Quaternary Structural Alterations

While Tyr fluorescence may be distinguished in a heme-protein containingboth Tyr and Trp (14,29), Trp fluorescence emission generally predominatesas a result of a greater quantum yield and fluorescence resonance energy trans-fer from Tyr to Trp. In general, Tyr and Trp are excited with 280 nm excitationlight, while 296 nm selectively excites Trp (40). The contribution by Tyr maybe dissected out by the difference spectrum (296 nm excitation emission spec-trum –280 nm excitation emission spectrum) (40). The emission maximum ofTyr is ~305 nm, which is blue shifted from the emission maximum of Trp.

It is well established that the Trp emission maximum is a function of themicroenvironment: Trp in a hydrophilic environment or exposed environmentexhibits an emission maximum at 350–353 nm, whereas the maximum for ahydrophobic or buried Trp is at 330–332 nm; Trp in limited contact with waterexhibits an emission maximum at 340–342 nm (41). This environmental sensi-tivity of Trp arises from a large dipole change on excitation (42). Experimen-tally, the exact emission maximum wavelength may vary (up to ~5 nm) withthe specific instrument employed.

Evidence that the fluorescence signal emanates from intact Hb is supportedin part by the ~330-nm emission wavelength, which is that of a buried Trp,consistent with the location of β37 Trp. By contrast, if α14 Trp and β15 Trp,which lie close to the surface, were the primary emitter, a longer wavelengthemission maximum (~345–355 nm) corresponding to partially or fully exposedTrp would be expected. Likewise, if the Hb fluorescence emission originatedfrom an exposed Trp, it should be quenched by KI. This is not the case (14).Similarly, if the emission arose from an apoglobin, the emission maximumwould be shifted to longer wavelengths than that observed.

An example of a shifted emission maximum when Trp is in an aqueousmicroenvironment is seen in the recombinant Hb α96 Val → Trp designed byHo and collaborators (43,44). This Hb exhibits low oxygen affinity, highcooperativity, and no unusual subunit dissociation (43). The steady-state fluo-rescence emission maximum of Hb α96 Trp is of higher intensity and ~5 nmshifted to longer wavelengths in comparison with HbA (Fig. 5), suggestingthat the additional α96 Trp is exposed to an aqueous environment. This predic-tion (as opposed to the one formulated by molecular dynamics simulation [43])was confirmed by the high-resolution X-ray crystal structure showing the addi-


tional α96 Trp indole side chain directed away from the α1β2 interface anddirected toward the water-filled central cavity (44).

1.2.1. Ligand Binding and Quaternary Structure Changes in Hb

It is well established, by several different laboratories, that the steady-statefluorescence emission intensity is dependent on the R (oxy) → T (deoxy) tran-sition (for a review, see refs. 16 and 17): an 18–25% increase in the fluores-cence intensity is observed on deoxygenation (Fig. 6). This R → T transitionalchange in fluorescence intensity is sensitive to pH as modulated by inositolhexaphosphate (IHP) for carp Hb (45) and HbA (Fig. 7). These pH effects areobserved in the range where Trp and Tyr fluorescence emission is pH insensi-tive (i.e., pH 3.0–11.0) (46). Therefore, the data presented in Fig. 7 are modu-lated by the R → T transition, which, to a degree, may be correlated with theBohr effect.

Fig. 5. Steady-state front-face fluorescence emission spectra of a Trp-plus Hbrecombinant mutant compared with HbA: COHb α96 Val → Trp and COHbA. Thesolution was 0.05 M HEPES, pH 6.5, 25°C. Note the ~5-nm shift to longer wave-lengths of the emission maximum (relative to COHbA in the same conditions). Thiswavelength shift indicates that the additional Trp is in a more exposed or hydrophilicenvironment, as confirmed by the high-resolution X-ray crystal structure (44). Theemission maximum of HbA falls at ~320 nm, indicative that the primary emitter is thatof a buried or hydrophobic Trp (e.g., β37 Trp). Both Hbs contain α14 Trp, β15 Trp,and β37 Trp, with the recombinant Hb containing the additional α96 Trp.

142 Hirsch

Relative fluorescence comparisons of variant hemoglobins to HbA areinstructive. Conformational changes in non-Trp-substituted Hb mutants arereflected by emission differences compared to HbA. For example, fluores-cence emission intensity differences are seen among R-state HbC (β6 Glu →Lys), HbS (β6 Glu → Val), and HbA. Coupled with functional studies, circulardichroism, differential fluorescence perturbations by allosteric effectors, andUV resonance Raman studies, significant differences in the A-helix and thecentral cavity of the β6 mutants were revealed (47–50). Spectroscopic solutionstudies may reveal fluctuations that are not seen in the crystal structure becauseof lattice constraints. This serves as an example of the importance of spectros-copy to reveal fluctuations that occur in solution but that may be constrained inthe crystal structure and, thus, not observed with ~2Å resolution.

Fluorescence spectroscopy combined with resonance Raman spectroscopyand functional studies revealed site-specific tertiary and quaternary differencesin the Tyr-substituted Hb, Hb Montefiore (α126 Asp → Tyr), which exhibitshigh oxygen affinity and low cooperativity (51). OxyHb Montefiore exhibits a~40% increase in fluorescence compared with oxyHbA. This difference is morethan would be expected with the additional Tyr. The difference spectrum using

Fig. 6. Hb fluorescence is a sensitive reporter of the R → T transition. The front-face intrinsic fluorescence emission of HbA varies as a function of ligand binding. Allsolutions are 0.155 mM Hb tetramer (pH 7.35), 0.05 M phosphate, 25°C. The lowestcurve is the buffer solution. (From ref. 57.)


280-nm excitation exhibits a shoulder at ~308 nm, providing a spectral markerfor α126 Tyr. Confirmation of this marker is shown by the difference emissionspectrum which arises with 296-nm excitation selective for tryptophans, thatdoes not show the ~308-nm shoulder. The large difference in the fluorescencecompared to HbA indicates a conformational change or a change in the fluc-tuation properties of this Hb. The molecular alteration appears to be more sig-nificant in the T state than in the R state since the difference spectrum whensubtracting deoxyHb Montefiore from deoxyHbA is significantly greater than

Fig. 7. The intrinsic fluorescence of HbA is sensitive to pH and is further modu-lated by IHP. (a) Plotted is the change in fluorescence intensity of deoxyHbA minusoxyHbA in the absence of IHP and presence of IHP (excitation: 280 nm; emissionmaximum: 330 nm). (b) Plotted is the difference between the change in the fluores-cence intensity in the absence of IHP [deoxy – oxy] minus the fluorescence intensitychange in the presence of IHP [deoxy – oxy]. Note that Trp or indole fluorescenceintensity is not sensitive to pH within this range (46,81) (from Lin and Hirsch,unpublished data; ref. 82).

144 Hirsch

the difference spectrum of the oxy forms. The T-state fluorescence differencemay result from the alteration in the important contact between α126 Asp andthe α1β2 interface residues found in normal Hb, specifically β35 Tyr and β34Val and the C-terminal 141 Arg. The probable perturbation of this contact byα126 Tyr and conformational alteration is likely to extend to the nearby β37Trp that serves as the reporter of this altered T state. This destabilized T statemay bind oxygen with higher affinity than deoxyHbA (51).

Binding of allosteric effectors and their perturbation of Hb conformationmay be monitored by front-face fluorometry. For example, the synthetic allos-teric effector 3,4-dichloro-benzyloxy acetic acid (DCBAA) decreases the oxy-gen affinity of Hbs by binding specifically at the deoxyHb surface/creviceresidue α14 Trp (52). The crystal structure of DCBAA bound to deoxyHbAdemonstrates site-specific binding to the A-helix of deoxyHb, specifically α14Trp (52). Thus, binding of DCBAA to Hb as monitored by Hb intrinsic fluores-cence changes serves as a specific reporter of the A helix at α14 Trp. This isseen by probing distally to the β6 site of mutation in R states of HbC and HbS.The differences in oxyHb intrinsic fluorescence in response to DCBAA areshown in Fig. 8; oxyHbC and oxyHbS show a minimal decrease in the inten-sity of the intrinsic fluorescence emission maximum on titration with DCBAA.These titration results show that the fluorescence intensity changes of oxyHbCand oxyHbS, with increasing concentration of DCBAA, are just at the level ofresolution of the instrument. By contrast, oxyHbA exhibits a larger decrease influorescence intensity (~6%) with clear resolution of the fluorescence intensitychanges as a function of DCBAA titration. Consistent with the findings by

Fig. 8. oxyHb intrinsic fluorescence spectra as a function of synthetic allostericeffector DCBAA titration. A titration of oxyHbA with DCBAA, up to a molar ratio of10:1 (DCBAA:Hb tetramer ratio), is monitored by decreases in the intrinsic fluores-cence emission of Hb (pH 7.35, 0.1 M HEPES). Excitation wavelength: 280 nm(unpublished data; see ref. 53).


Mehanna and Abraham (52), the oxyHbA titration data indicate that DCBAAbinds to R-state HbA in a 6:1 mole ratio. The titration curve (Fig. 8) exhibits achange of slope at a ratio of 2:1, which may imply two sites with differentaffinity and capable of allosteric change. The ability of DCBAA to serve as afluorescence quencher is shown by the significant decrease in fluorescence ofliver alcohol dehydrogenase on addition of DCBAA (53).

The above data further demonstrate differences in the A-helix of HbC andHbS. A further conclusion that may be drawn from these studies is that therelatively small intrinsic fluorescence quenching of Hb on binding of DCBAAimplies that α14 Trp is a small contributor to the overall intrinsic fluorescencesignal emanating from HbA.

Changes in the relative fluorescence intensity in the presence of allostericeffectors may also be explained as a function of the R → T transition. The 2,3-diphosphoglycerate (DPG) analogs—IHP (e.g., Fig. 7) and the fluorescent 1,3-hydroxypyrene-trisulfonate (HPT) (see Subheading 1.3.)—both inducechanges in fluorescence intensity and have been useful in interpreting Hb fluo-rescence, comparing structural perturbations in Hb variants, as well as obtain-ing binding constants (54). Since the natural allosteric effectors, such as DPGand chloride, alter the conformation of Hb that is revealed as a perturbation inthe fluorescence emission (49,55), it is important to strip Hb of these factorsbefore embarking on such titration studies. The method to strip Hb is describedin Subheading 3.

Hb-reducing agents such as sodium dithionite should not be used for deoxy-genation, because dithionite exhibits significant UV absorption and fluores-cence that overlaps with Hb excitation and intrinsic emission. However,dithionite interference is minimal in the visible light range and may be used todeoxygenate Hb bound with an extrinsic fluorophore that emits visible light(56). Deoxygenation without dithionite is carried out by gently blowing nitro-gen or helium over an Hb solution in a closed system for up to 90 minutes ifneeded, without met (Fe+3) Hb formation.

1.2.2. Hb Oxidation

Intrinsic fluorescence emission intensity increases significantly (greater thantwofold) on oxidation to methemoglobin compared with oxyHb and deoxyHb(54,57). In addition, the chemical oxidation of Hb may be monitored as a func-tion of the generation of a fluorescent heme degradation end product usingH2O2 as the oxidizing agent. The fluorescent end-product exhibits an emissionmaximum at 465 nm with 321-nm excitation (58–60). The coupling of front-face fluorometry with this method permits comparison of the oxidation pro-pensity of various Hb mutants at concentrations at which the Hb remains atetramer (55).

146 Hirsch

1.2.3. Hb Dissociation

Hb fluorescence studies using right-angle optics require low Hb concentrations.Generally, when right-angle optics are employed, low protein concentrations (onthe order of micromolar) are required. However, in the case of intact HbA (a tet-ramer composed of two identical α- and two identical β-chains) significant disso-ciation to dimers occurs at low concentration in the oxy or R-state forms: underconditions of moderate ionic strength (~0.1 M NaCl), KD = 1.0 × 10–6 M. Inthe case of deoxyHb, dissociation is significantly less (KD = 2.0 × 10–11 M)(61–62). Note that a high salt concentration will shift the dissociation equi-librium to dimers (27,63–64).

The percentage of dimer dissociation (α) is calculated by (64):

α = {KDM4[1 + (16c/KDM4)] – KDM4}/8c

in which KD is the dissociation constant in molarity, M4 is the molecular weightof the tetramer, and c is the concentration in grams/liter.

Dimerization results in emission maximum shifts to longer wavelengths as aresult of Trp exposure to a more hydrophilic environment (65–66). This con-centration-dependent dissociation (1) complicates the interpretation and com-parison of Hb fluorescence studies performed under different solutionconditions, and (2) highlights the advantage of using front-face optics whichreduces inner-filter effects that arise in a strongly absorbing solution.

Reversible protein dissociation and unfolding may be investigated usinghigh hydrostatic pressure (up to ~2 bBar) coupled to fluorescence (67). A num-ber of laboratories have utilized steady-state and anisotropic fluorescence mea-surements in conjunction with the application of high pressure to study thedissociation properties of variant hemoglobins (68–72).

In summary, Hb in its native state is a tetramer, and unwarranted solutionconditions (e.g., dilute solutions, high salt concentration) can shift the equilib-rium to the preponderance of dimers that differ in structure and function; someHb variants are more prone to dissociation (73); and the apoprotein (i.e., globinwithout hemes) results in a distinct structure without resemblance to the nativetetramer. Dissociation and apoglobin formation may be revealed by front-facefluorometry. The fluorescent moiety 1-anilinonaphthalene-8-sulfonic acid(ANS), known to bind to the empty heme pocket, was first used to demonstratethat the fluorescence arises from intact Hb (13).

1.3. Extrinsic Fluorescence

The site-specific labeling of proteins with extrinsic fluorescent probes allowsspectroscopic probing of side chains of amino acid residues that are nonfluorescentand may serve as a ruler to measure intra- and intermolecular distances. Front-


face fluorometry permits direct monitoring of the probe bound to a heme-protein. For example, iodoacetamidofluorescein covalently modifies β93 Cys(the nearest neighbor to the proximal His of the heme) and is responsive to theR → T transition (74).

Fluorescence quenching studies of HPT when bound to Hb demonstratedthat HPT serves as a DPG analog, binding noncovalently (one per Hb tetramer)to the central cavity (11,75–77). DPG is the natural allosteric effector of thered blood cell that binds to Hb in a 1:1 ratio, effectively lowering the oxygenaffinity so that sufficient oxygen is released to tissues with low oxygen satura-tion. Direct monitoring of HPT fluorescence is a means to explore the Hb centralcavity and has been useful in demonstrating (1) structural alterations distal fromthe site of mutation, such as HbS (β6 Glu → Val) and HbC (β6 Glu → Lys) (48);and (2) central cavity differences anticipated in crosslinked Hbs designed aspotential therapeutic oxygen carriers (78). Another fluorescent DPG analog,1,3,6,8-pyrenetrisulfonate, may be advantageous for time-resolved fluores-cence studies probing the DPG pocket; this application revealed a long-rangecommunication from the positively charged substitution in the middle of thecentral cavity of Hb Presbyterian (β108 Asn → Lys) to the DPG-binding pocketthat lies at the entrance to the ββ cleft (79).

In summary, intrinsic and extrinsic fluorescence properties of Hb are valu-able reporters of site-specific conformational changes.

2. Materials1. Purified hemoglobins.2. Fluorescence spectrophotometer with UV excitation and emission monochrometers.3. Front-face adapter or specially designed cuvets for front-face optics.4. Cuvet washer.5. 100% Ethyl alcohol contained in glass.6. Nitric acid.7. Anaerobic glove box or glove bags.8. Fluorescence probes (e.g., 5-iodoacetamidofluorescein, cat. no. I-3; Molecular

Probes, Eugene OR; or 1,3-hydroxypyrene trisulfonate, H-1529; Sigma, St.Louis, MO).

3. Methods (see Notes 1–9)3.1. Purification of Hemoglobins

For reasons already noted, it is critical to this technique that the Hb be homo-geneously purified, and that a concentration be selected wherein it remainsintact in its tetrameric native state containing all four hemes.

Depending on the Hb mutant, Hb may be separated and purified by liquidcolumn chromatography using anion- and cation-exchange resins. The red cell

148 Hirsch

lysate (hemolysate) contains 95% Hb. It also contains a small percentage ofother molecules, cofactors that interact with Hb, and a variety of enzymes andproteins including minor Hbs (e.g., HbF, HbA2, HbA1a1, HbA1a2, HbA1b,HbA1c). Thus, it is imperative that these other proteins and compounds beremoved. This is specifically addressed by Pin et al. (70). Therefore, for mean-ingful comparisons, the proteins should be purified and handled according toone method of choice (see ref. 80). (Hb purification is further developed inChapters 3, 6, 10, and 14.)

Purified Hbs are stripped (i.e., DPG and various ions are removed) bySephadex G-25 gel filtration chromatography. Stripping twice ensures thepreparation of fully stripped Hbs, which may be assessed by oxygen equilibriummethods: it is known that stripped Hb has a higher oxygen affinity comparedwith nonstripped Hb.

3.2. Covalent Modification with Fluorescent Probes

As an example, iodoacetamidofluorescein (5-IAF) (cat. no. I-3, MolecularProbes) covalently binds to sulfhydryl groups. β93 labeling of Hb may beeffected by a slight modification of a procedure described earlier (74).

A purified Hb solution (~3–5 g%, 5 mL) in the presence of an ~5-IAF:1heme in the desired buffer is incubated for 3 hours at 4°C with gentle handrotation every 20–30 min. After 3 h, the solution is added to a Sephadex G-25column (50-mL volume) equilibrated in the desired buffer. The solution is col-lected, repurified, and concentrated in Centricon 10 (YM 10, Amicon) threetimes or until no fluorescence is found in the dialysate as detected by a fluo-rometer. Isoelectric focusing and mass spectrometry are used to assess completemodification and to ensure purity. An inability to titrate with paramecuric-benzoic acid is another method to verify that the reactive —SH groups are allbound. However, if available, mass spectrometry is the method of choice fordetermination of site-specific and complete modification. Functional alter-ations that may arise as a result of site-specific labeling are examined by oxy-gen-equilibrium methods.

4. Notes1. Quartz cuvets are required for UV excitation light and emission of intrinsic

fluorescence.2. At millimolar Hb concentrations, the Raman band should not interfere with the

emission spectrum as observed with dilute aqueous solutions.3. Do not store liquid buffers or Hb solutions in plastic tubes for any length of time (hours);

plastic derivatives that scatter and fluoresce may be introduced into the solutions.4. The choice of buffer is important, with 0.05 M HEPES is optimal. Phosphates

may bind in the DPG pocket of the central cavity. Tris buffers should be avoided


because Tris exhibits fluorescence (although this may not be the case withultrapurified Tris). Therefore, the buffer baseline should always be recorded toensure no background fluorescence from the buffer or from any residual materialin the cuvet.

5. Cuvets may be soaked with 50% nitric acid for several minutes up to a few hours.If soaked longer or if higher concentrations of nitric acid are used longer than afew minutes, etching of the cuvet is possible. The use of detergents is not recom-mended because they may contribute to the fluorescence background. The cuvetshould be rinsed thoroughly with distilled water, followed by a final rinse with100% ethyl alcohol, and dried on a vacuum-cuvet washer.

6. Pipeting samples into the cuvet should be carefully done without scratching. Ifnecessary, soft tubing may be added to the end of a needle or hard pipet tip. Thecuvets should be held at the edges to avoid fingerprints.

7. As for any fluorescence study, the same cuvet should be used for relative com-parisons. Moreover, the cuvet must be placed in the identical position duringmeasurements.

8. Excitation sources such as intense lasers or light arising from a synchrotron maycause heating, which can interfere with the stability of the protein. This may beavoided by rotating the cuvet, replacing the sample after every third scan, orrecording spectra in a closed flowing cell.

9. Fluorescence intensity is temperature dependent (i.e., the higher the temperature,the lower the intensity), and, therefore, temperature must be kept constant duringthe course of the experiment and for relative comparisons. For studies of tem-perature-sensitive mutants, the fluorescence difference as a function of tempera-ture between the wild-type protein and the temperature-sensitive variant must befactored in.

AcknowledgmentsThis work was supported in part by the American Heart Association, Heri-

tage Affiliate Grant-in-Aid No. 0256390T; and the National Institutes of HealthR01 HL58038 and RO1 HL58247.

References1. Weber, G. (1953) Rotational brownian motion and polarization of the fluores-

cence of solutions. Adv. Protein. Chem. 8, 415–459.2. Teale, F. W. J. and Weber, G. (1957) Ultraviolet fluorescence of the aromatic

amino acids. Biochem. J. 65, 476–482.3. Teale, F. W. J. and Weber, G. (1959) Ultraviolet fluorescence of proteins.

Biochem. J. 72, 156.4. Teale, F. W. J. (1960) The ultraviolet fluorescence of proteins in neutral solution.

Biochem. J. 76, 381–388.5. Stryer L. (1978) Fluorescence energy transfer as a spectroscopic ruler. Annu. Rev.

Biochem. 47, 819–846.

150 Hirsch

6. Lakowicz, J. R. (1999) Principles of Fluorescence Spectroscopy, 2nd ed., KluwerAcademic/Plenum, New York.

7. Weber, G. and Teale, F. W. J. (1959) Electronic energy transfer in haem proteins.Disc. Faraday Soc. 28, 134–141.

8. Nagel, R. L. and Gibson, Q. H. (1967) Kinetics and mechanism of complex for-mation between hemoglobin and haptoglobin. J. Biol. Chem. 242, 3428–3434.

9. Nagel, R. L. and Gibson, Q. H. (1971) The binding of hemoglobin to haptoglobinand its relation to subunit dissociation of hemoglobin. J. Biol. Chem. 246, 69–73.

10. Benesch, R. E., Ikeda, S., and Benesch, R. (1976) Reaction of haptoglobin withhemoglobin covalently cross-linked between the alpha beta dimers. J. Biol. Chem.251, 465–470.

11. Marden, M. C., Hazard, E. S., and Gibson, Q. H. (1986) Testing the two-statemodel: anomalous effector binding to human hemoglobin. Biochemistry 25,7591–7596.

12. Alpert, B. and Lopez-Delgado, R. (1976) Fluorescence lifetimes of haem proteinsexcited into the tryptophan absorption band with synchrotron radiation. Nature263, 445, 446.

13. Alpert, B., Jameson, D., and Weber, G. (1980) Tryptophan emission from humanhemoglobin and its isolated subunits. Photochem. Photobiol. 31, 1–4.

14. Hirsch, R. E., Zukin, R. S., and Nagel, R. L. (1980) Intrinsic fluorescence emis-sion of intact oxy hemoglobins. Biochem. Biophys. Res. Commun. 93, 432–439.

15. Gryczynski, Z., Tenenholz, T., and Bucci, E. (1992) Rates of energy transfer be-tween tryptophans and hemes in hemoglobin, assuming that the heme is a planaroscillator. Biophys. J. 63, 648–653.

16. Hirsch, R. E. (1994) Front-face fluorescence spectroscopy of hemoglobins. Meth-ods Enzymol. 232, 231–246.

17. Hirsch, R. E. (2000) Heme protein fluorescence, in Topics in Fluorescence Spec-troscopy, vol. 6, Protein Fluorescence (Lakowicz, J. R., ed.), Kluwer Academic/Plenum, New York, pp. 221–255.

18. Fontaine, M. P., Jameson, D. M., and Alpert, B. (1980) Tryptophan-heme energytransfer in human hemoglobin: dependence upon the state of the iron. FEBS Lett.116, 310–314.

19. Eisinger, J. and Flores, J. (1979) Front-face fluorometry of liquid samples. Ana-lytical Biochem. 94, 15–21.

20. Bucci, E., Malak, H., Fronticelli, C., Gryczynski, I., Laczko, G., and Lakowicz, J.R. (1988) Time-resolved emission spectra of hemoglobin on the picosecond time-scale. Biol. Chem. 32, 187–198.

21. Horiuchi, K. and Asai, H. (1980) Binding of β-naphthyl triphosphate to humanadult hemoglobin accompanying deoxygenation. Investigated by simultaneousmeasurements of fluorescence, absorbance and partial pressure of oxygen. Eur. J.Biochem. 131, 613–618.

22. Asakura, T., Agarwal, P. I., Relman, D. A., McCray, J. A., Chance, B., Schwartz,E., Friedman, S., and Lubin, B. (1973) Mechanical instability of the oxy-form ofsickle haemoglobin. Nature 244, 437–438.


23. Bucci, E., Gryczynski, Z., Fronticelli, C., Gryczynski, I., and Lakowicz, J. R.(1992) Fluorescence intensity and anisotropy decays of the intrinsic tryptophanemission of hemoglobin measured with a 10-Ghz fluorometer using front-facegeometry on a free liquid surface. J. Fluorescence 2, 29–36.

24. Gryczynski, Z. and Bucci, E. (1993) A new front-face optical cell for measuringweak fluorescent emissions with time resolution in the picosecond time scale.Biophys. Chem. 48, 31–38.

25. Elbaum, D., Harrington, J., Roth, E. F. Jr., and Nagel, R. L. (1976) Surface activ-ity of hemoglobin S and other human hemoglobin variants. Biochim. Biophys.Acta 427, 57–69.

26. Hirsch, R. E., Elbaum, D., Brody, S. S., and Nagel, R. L. (1980) Hemoglobin-Aand Hemoglobin-S films at an air-water interface: absorption spectra studies.J. Colloid. Interface Sci. 78, 212–216.

27. Antonini, E. and Brunori, M. (1971) Hemoglobin and Myoglobin in Their Reac-tions with Ligands. North Holland, Amsterdam.

28. Sassaroli, M., Bucci, E., Leisegang, J., Fronticelli, C., and Steiner, R. F. (1984)Specialized functional domains in hemoglobin: dimensions in solution of theapohemoglobin dimer labeled with fluorescein iodoacetamide. Biochemistry 23,2487–2491.

29. Hirsch, R. E. and Peisach, J. (1986) A comparison of the intrinsic fluorescence ofred kangaroo, horse and sperm whale met-myoglobins. Biochim. Biophys. Acta872, 147–153.

30. Gryczynski, Z., Lubkowski, J., and Bucci, E. (1997) Intrinsic fluorescence ofhemoglobins and myoglobins. Methods Enzymol. 278, 38–69.

31. Blumberg, W. E., Eisinger, J., Lamola, A. A., and Zuckerman, D. M. (1977) Thehematofluorometer. Clin. Chem. 23(2 Pt. 1), 270–274.

32. Blumberg. W. E., Doleiden, F. H., and Lamola, A. A. (1980) Hemoglobin determinedin 15 microL of whole blood by “front-face” fluorometry. Clin. Chem. 26, 409–413.

33. Lamola, A. A. (1981) Fluorescence methods in the diagnosis and management ofdiseases of tetrapyrrole metabolism. J. Invest. Dermatol. 77, 114–121

34. Cashore, W. J., Oh, W., Blumberg, W. E., Eisinger, J., and Lamola, A. A. (1980)Rapid fluorometric assay of bilirubin and bilirubin binding capacity in blood ofjaundiced neonates: comparisons with other methods. Pediatrics 66, 411–416.

35. Hirsch, R. E., Lin, M. J., and Park, C. M. (1989) The interaction of zinc protopor-phyrin with intact oxy hemoglobin. Biochemistry 28, 1851–1855.

36. Hirsch, R. E., Pulakhandam, U. R., Billett, H. H., and Nagel, R. L. (1991) Bloodzinc protoporphyrin is elevated only in sickle cell patients with low fetal hemo-globin. Am. J. Hematol. 36, 147–149.

37. Park, C. M, Pulakhandan, U. R., and Hirsch, R. E. (l986) The interference offluorescent drugs with the determination of zinc protoporphyrin levels in humans:The case of tetracycline. Clin. Res. 34(2), 466A.

38. Hirsch, R. E., Lin, M. J., and Das, K. M. (1990) The estimation of 5-aminosali-cylic acid and its metabolite in human serum by front-face fluorometry: a simpleand sensitive method. J. Lab. Clin. Med. 116, 45–50.

152 Hirsch

39. Ritland, S. R., Leighton, J. A., Hirsch, R. E., Morrow, J. D., and Gendler, S. J.(1999) Evaluation of 5-aminosalicylic acid (5-ASA) for cancer chemoprevention:Absence of efficacy against nascent adenomatous polyps in the ApcMin mouse.Clin. Cancer Res. 5, 855–863.

40. Eisinger, J. (1969) Intramolecular energy transfer in adrenocorticotropin. Bio-chemistry 8, 3902–3908.

41. Burstein, E.A, Vedenkina, N. S., and Ivkova, M. N. (1973) Fluorescence and thelocation of tryptophan residues in protein molecules. Photochem. Photobiol. 18,263–279.

42. Vivien, J. T. and Callis, P. R. (2001) Tryptophan fluorescence shift mechanisms inproteins: simulation study of Trp rotational conformers. Biophys. J. 80(Pt. 1), 362a.

43. Kim, H. W., Shen, T. J., Ho, N. T., Zou, M., Tam, M. F., and Ho, C. (1995) A novellow oxygen affinity recombinant hemoglobin (α96 Val → Trp): switching quater-nary structure without changing the ligation state. J. Mol. Biol. 248, 867–882.

44. Puius, Y. A., Zou, M., Ho, N. T., Ho, C., and Almo, S. C. (1998) Novel watermediated hydrogen bonds as the structural basis for the low oxygen affinity of theblood substitute candidate rHb (α96 Val → Trp). Biochem. USA 37, 9258–9265.

45. Hirsch, R. E. and Noble, R. W. (l987) Intrinsic fluorescence of carp hemoglobin:A study of the R → T transition. Biochim. Biophys. Acta 914, 213–219.

46. Williams, R. T. and Bridges J. W. (1964) Fluorescence of solutions: A review.J. Clin. Pathol. 17, 371–394.

47. Hirsch, R. E., Lin, M. J., Vidugiris, G. J., Huang, S., Friedman, J. M., and Nagel,R. L. (1996) Conformational changes in oxyhemoglobin C (β6 Glu → Lys)detected by spectroscopic probing. J. Biol. Chem. 271, 372–375.

48. Hirsch, R. E., Juszczak, L. J., Fataliev, N. A., Friedman, J. M., and Nagel, R. L.(1999) Solution-active structural alterations in liganded hemoglobins C (β6 Glu→ Lys) and S (β6 Glu → Val). J. Biol. Chem. 274, 13,777–13,782.

49. Sokolov, L. and Mukerji, I. (1998) Conformational changes in FmetHbS probeswith UV resonance Raman and fluorescence spectroscopic methods. J. Phys.Chem. B. 102, 8314–8319.

50. Juszczak, L.J, Hirsch, R. E., Nagel, R. L., and Friedman, J. M. (1998) Conforma-tional differences in CO derivatives of HbA, HbC (E 6K) and HbS (E 6V) in thepresence and absence of inositol hexaphosphate (IHP) detected using ultravioletresonance Raman spectroscopy. J Raman Spectrosc. 29, 963–968.

51. Wajcman, H., Kister, J., Galacteros, F., Spielvogel, A., Lin, M. J., Vidugiris, G. J.A., Hirsch, R. E., Friedman, J. M., and Nagel, R. L. (1996) Hb Montefiore[α126(H9)Asp → Tyr]: high oxygen affinity and loss of cooperativity secondaryto C-terminal disruption. J. Biol. Chem. 271, 22,990–22,998.

52. Mehanna, A. S. and Abraham, D. J. (1990) Comparison of crystal and solutionhemoglobin binding of selected antigelling agents and allosteric modifiers. Bio-chemistry 29, 3944–3952.

53. Hirsch, R. E., Juszcak, L. J., Abraham, D. J., Friedman, J. M., and Nagel, R. L.(1997) Further evidence for solution-active structural differences in the β6 mutantsHbC and HbS. Blood 90(10, Suppl. 1, Pt. 1), 126a.


54. Mizukoshi, H., Itoh, M., Matsukawa, S., Mawatari, K., and Yoneyama, Y. (1982)Tryptophan fluorescence of human hemoglobin. II. Effect of inositol hexaphos-phate on the T-R transition. Biochim. Biophys. Acta 700, 143–147.

55. Chen, Q. Y., Bonaventura, C., Nagel, R. L., and Hirsch, R. E. (2002) Distinctdomain responses of R-state human hemoglobins A, C, and S to anions. BloodCells Mol Dis. 29, 119–132.

56. Hirsch, R. E., and Nagel, R. L. (1989) Stopped-flow front-face fluorometer: aprototype design to measure hemoglobin R → T transition kinetics. Anal.Biochem. 176, 19–21.

57. Hirsch, R. E. and Nagel, R. L. (1981) Conformational studies of hemoglobinsusing intrinsic fluorescence measurements. J. Biol. Chem. 256, 1080–1083.

58. Nagababu, E. and Rifkind, J. M. (1998) Formation of fluorescent heme degrada-tion products during the oxidation of hemoglobin by hydrogen peroxide. Biochem.Biophys. Res. Commun. 247, 592–596.

59. Nagababu, E. and Rifkind, J. M. (2000) Heme degradation during autooxidationof oxyhemoglobin. Biochem. Biophys. Res. Commun. 273, 839–845.

60. Nagababu, E., Chrest, F. J., and Rifkind, J. M. (2000) The origin of red cell fluores-cence caused by hydrogen peroxide treatment. Free Radic. Biol. Med. 29, 659–663.

61. Ackers, G. K., Johnson, M. L., Mills, F. C., and Ip, S. H. (1976) Energetics ofoxygenation-linked subunit interactions in human hemoglobin. Biochem. Biophys.Res. Commun. 69, 135–142.

62. Imai, K. (1982) Allosteric Effects in Hemoglobin, Cambridge University Press,New York.

63. Bunn, H. F. and Forget, B. G. (1986) Hemoglobin: Molecular, Genetic and Clini-cal Aspects, W. B. Saunders, Philadelphia.

64. Herskovits, T. T., Cavanagh, S. M., and San George, R. C. (1977) Light-scatter-ing investigations of the subunit dissociation of human hemoglobin A: effects ofvarious neutral salts. Biochemistry 16, 5795–5801.

65. Chothia, C., Wodak, S., and Janin, J. (1976) Role of subunit interfaces in theallosteric mechanism of hemoglobin. Proc. Natl. Acad. Sci. USA 73, 3793–3797.

66. Hirsch, R. E., Squires, N. A., Discepola, C., and Nagel, R. L. (1983) The detection ofhemoglobin dimers by fluorescence. Biochem. Biophys. Res. Commun. 116, 712–718.

67. Pin, S. and Royer, C. A. (1994) High-pressure fluorescence methods for observ-ing subunit dissociation in hemoglobin. Methods Enzymol. 232, 42–55.

68. Marden, M. C., Hoa, G. H. B., and Stetzkowski-Marden, F. (1986) Heme proteinfluorescence versus pressure. Biophys. J. 49, 619–627.

69. Silva, J. L., Villas-Boas, M., Bonafe, C. F. S., and Meirelles, N. C. (1989) Anomalouspressure dissociation of large protein aggregates. J. Biol. Chem. 264, 15,863–15,868.

70. Pin, S., Royer, C. A., Gratton, E., Alpert, B., and Weber, G. (1990) Subunit inter-actions in hemoglobin probed by fluorescence and high-pressure techniques. Bio-chemistry 29, 9194–9202.

71. Hirsch, R. E., Harrington, J. P., and Scarlata, S. F. (1993) The differential effectsof carbon dioxide and oxygen on the pressure dissociation of Lumbricus terrestrishemoglobin. Biochim. Biophys. Acta 1161, 285–290.

154 Hirsch

72. Hirsch, R. E., Friedman, J. M., Harrington, J. R., and Scarlata, S. F. (1994) Stabil-ity of a potential blood substitute, HbXL99α under high pressure. Biochem.Biophys. Res. Commun. 200, 1635–1640.

73. Sharma, V. S., Newton, G. L., Ranney, H. M., Ahmed, F., Harris, J. W., andDanish, E. H. (1980) Hemoglobin Rothschild (β 37(C3)Trp replaced by Arg): Ahigh/low affinity hemoglobin mutant. J. Mol. Biol. 144, 267–280.

74. Hirsch, R. E., Zukin, R. S., and Nagel, R. L. (1986) Steady-state fluorescenceemission from the fluorescent probe, 5-iodoacetamidofluorescein, bound to he-moglobin. Biochem. Biophys. Res. Commun. 138, 489–495.

75. MacQuarrie, R. and Gibson, Q. H. (1971) Use of a fluorescent analogue of 2,3-diphosphoglycerate as a probe of human hemoglobin conformation during carbonmonoxide binding. J. Biol. Chem. 246, 5832–5835.

76. MacQuarrie, R. and Gibson, Q. H. (1972) Ligand binding and release of an ana-logue of 2,3-diphosphoglycerate from human hemoglobin. J. Biol. Chem. 247,5686–5694.

77. Serbanescu, R., Kiger, L., Poyart, C., and Marden, M. C. (1998) Fluorescenteffector as a probe of the allosteric equilibrium in methemoglobin. Biochim.Biophys. Acta 1363, 79–84.

78. Gottfried, D. S., Juszczak, L. J., Fataliev, N. A., Acharya, A. S., Hirsch, R. E., andFriedman, J. M. (1997) Probing the hemoglobin central cavity by direct quantifi-cation of effector binding using fluorescence lifetime methods. J. Biol. Chem.272, 1571–1578.

79. Gottfried, D. S., Manjula, B. N., Malavalli, A, Acharya, A. S., and Friedman, J. M.(1999) Probing the diphosphoglycerate binding pocket of HbA and HbPresbyterian(β 108 Asn → Lys). Biochemistry 38, 11,307–11,315.

80. Schroeder, W. A. and Huisman, T. H. J. (1980) The Chromatography of Hemo-globin, Marcel, Dekker, New York.

81. White, A. (1959) Effect of pH on fluorescence of tyrosine, tryptophan, and relatedcompounds. Biochem. J. 71, 217–220.

82. Lin, M. J., Rao, M. J., Friedman, J. M., Acharya, A. S., and Hirsch, R. E. (1991)Inositol hexaphosphate induced pH sensitive conformational changes of the α1β2interface of hemoglobin. Biophys. J. 59(2), 290a.

Nucleation and Crystal Growth of HbC 155

10

155


Nucleation and Crystal Growth of Hemoglobins

The Case of HbC

Peter G. Vekilov, Angela Feeling-Taylor, and Rhoda Elison Hirsch

1. IntroductionHemoglobin (Hb) crystallization is of significance both in vivo and in vitro.

Hb crystals form in red blood cells (RBCs), as occurs in the case of patientsexpressing βC-globin (β6 Glu → Lys). In vitro, high-resolution structuraldetermination by crystallographic methods requires the growth of Hb crystals toapprox ~1 mm in diameter, which may be induced by a variety of precipitants.

The first indication that oxyHb and deoxyHb exhibit two distinct conforma-tional states and different crystal habits was first observed in 1938 byHaurowitz (1), who noted cracking of the horse deoxyHb crystal on oxygen-ation. Years later, Perutz and colleagues (2–4) obtained the high-resolutionstructure of deoxy (T-state) and oxy (R-state) human HbA. Since then, crystaldiffraction methodology has continued to provide high-resolution details ofstructural alterations that occur on point mutations or peptide changes in natu-ral Hb mutants or engineered recombinant variants (see Chapter 1).

1.1. HbC Forms Crystals in RBCs

HbC is the second most commonly encountered abnormal Hb in the UnitedStates and, next to HbS and HbE, the third most prevalent hemoglobin struc-tural variant worldwide (5,6). Approximately 3 of 100 African Americans carrythe HbC gene. Individuals homozygous for HbC exhibit a mild hemolytic ane-mia, not considered a life-threatening disease. However, double heterozygotesfor both HbS and HbC have sickle cell (SC) disease, which results in a reducedlife expectancy and significant morbidity. It is life-threatening after the age of

156 Vekilov et al.

20, and some patients have severe retinal, osteonecrotic, and pulmonary com-plications (for a review, see ref. 5).

It has long been known that HbC (β6 Glu → Lys) forms tetragonal crystals inred cells of CC patients (individuals homozygous for the expression of βC-globin)without resulting in morbid pathophysiology. In the venous blood of splenecto-mized patients, ~3% of RBCs contain crystals with all of the Hb recruited into asingle crystal (7–9). Unknown was the Hb state in which the intraerythrocyticcrystal formed.

In 1985, it was first demonstrated by video-enhanced microscopy, (1) thatthese intraerythrocytic HbC crystals formed in the oxygenated (R) ligandedstate in cells that contained no detectable fetal hemoglobin (HbF), and (2)that deoxygenation (or switching to the T-state) resulted in dissolution of theintraerythrocytic crystal (10). The lack of vasoocclusion in CC patients couldbe explained as follows: Deoxygenation in the microcirculation (secondaryto oxygen delivery to tissues) will result in the dissolution of the oxyHbCcrystals, avoiding vasoocclusion by allowing the CC red cell to regain itspliability, necessary to navigate through narrow capillaries. Individualscoexpressing HbS and HbC exhibit a moderately severe disease, SC disease,arising from the polymerization of deoxyHbS induced by the increased intra-cellular hemoglobin concentration (6,11). Yet, along with RBCs containingHbS polymers, intraerythrocytic crystals are also detected in SC patients (12).To date, little is known about the mechanism of oxy (R-state) HbC crystalli-zation nor why the oxy form of HbC crystallizes in the red cell whereas thedeoxy form of HbS polymerizes in the red cell. Our laboratories have takenseveral different approaches to elucidate the mechanisms of liganded HbCcrystallization.

1.2. In Vitro Batch Nucleation Studies

Since CC erythrocytes containing HbF did not contain crystals (10), in vitrobatch nucleation were undertaken to determine the effects of co-habitinghemoglobins in the RBC on HbC crystallization (13). In vitro, purified HbCforms tetragonal crystals within 15–30 min in concentrated phosphate buffer(1.8 M) at 30°C (Fig. 1). The size of the crystal is dependent on nucleationkinetics (i.e., the faster the nucleation rate, the smaller the crystal).

Similar solution conditions were first employed by Adachi and colleagues(14,15) to study deoxyHbS nucleation and polymerization. A lag phase (on theorder of 15–30 minutes) is always seen to precede any observation of crystalformation from a purified HbC solution using the methods outlined below(Fig. 2A,B). In agreement with the general expectations about any nucleationprocess (16–18), the length of the lag phase for nucleation and crystallizationis dependent on the supersaturation of the solution (19,20).


These batch crystallization methods demonstrated in vitro that HbF inhibitsnucleation (Fig. 2) (13), while HbS (sickle cell Hb, β6 Glu → Val) acceleratednucleation and is incorporated into the crystal (21). HbA simply serves as adiluent in these nucleation studies (13,21).

The value of using in vitro batch crystallization to identify contact sites(Table 1) and the effects on crystallization of binary mixtures of Hb andcell components soon became apparent (13,21–26). Interestingly, intra-erythrocytic crystal morphology is altered in heterozygous individualsexpressing HbC and other point mutated globins: those expressing HbCand Hb Korle-bu (β73 Asp → Asn) form cubic crystals (22), while thoseexpressing HbC and Hb αG-Philadelphia (β68 Asn → Lys) form unusuallylong, narrow crystals (24). Different intertetrameric contacts are impliedand may give rise to the altered morphology in a manner analogous to thatproposed by Gallagher et al. (27).

Fig. 1. Tetragonal oxy or CO (R-state) HbC crystals form in concentrated potas-sium phosphate buffer (1.8 M, pH 7.35). The Hb concentration is 2 g% (magnifica-tion: ×1000).

158 Vekilov et al.

The question of why R-state HbC gives rise to crystals, in contrast to poly-mer formation when HbS is deoxygenated (T state), is addressed by a varietyof approaches. Front-face fluorescence and ultraviolet resonance Raman spec-troscopic studies, employed to probe intratetrameric R-state differences in HbSand HbC compared with HbA, at nonaggregating concentrations, suggestintramolecular alterations in the A-helix position and in the central cavity. (Formethodological details of front-face fluorescence, see Chapter 9.)

Video-enhanced differential interference contrast (DIC) microscopy com-pared aggregation/crystallization pathways of oxyHbC and deoxyHbC in con-centrated salt conditions. It was demonstrated that R-state HbC exhibits a largepropensity to crystallize in a tetragonal habit, whereas under similar condi-tions, deoxyHbC is driven to form a variety of morphological aggregates (e.g.,radial arrays and macroribbons) while hexagonal crystal formation is a rareand least favored pathway (28).

1.3. In Vitro Solubility Studies

Further quantification of R-state HbC crystal growth parameters, such asprotein solubility and its dependence on temperature, was assessed by a novelscintillation method (29). An exploded view of the new scintillation arrange-ment is shown in Fig. 3A. The solution is contained in a silica microcell. This

Fig. 2. (a) Effects of HbA and HbF on kinetics of nucleation. (A) Dependence ofthe total number of crystals nucleated in fixed solution volume on concentrations ofHbA (upper curve) and HbF (lower curve). (B) Time dependence of number of crys-tals nucleated in a crystallization cell in presence of concentrations of HbA and HbFindicated on plots. Note that HbA and HbF increase the time lag and decrease thenumber of nucleated crystals; that is, both proteins decrease the rate of nucleation,with HbF having a markedly stronger action. (From ref. 13).


cell is surrounded by a machined brass jacket that sits on a thermoelectric heatpump (Peltier cooler) connected to a programmable controller. The use ofPeltier elements to maintain temperature increases the temperature’s stabilityto about ± 0.02°C and allows temperature ramps at rates of up to 5°C/min. Thetemperature of the brass block is monitored with a type-T thermocouple. Theattached controller facilitates programmed temperature changes. A laser beamfrom a self-contained laser diode assembly is directed through the solution.Light scattered normally to the incident beam is detected by an integrateddetector/amplifier photodiode through a polished rod capping the microcell. Asmall segment of latex rubber tubing envelops the microcell and the cap andminimizes evaporation of the solvent. A beam splitter between the laser andcell diverts some of the laser’s output to a second integrated photodiode, whosesignal is used to correct for intensity fluctuations of the laser. Backscatter oflight, which passes through the cell, is minimized by painting the inside of thebrass block black and by a light trap in the cavity formed by a rotating horse-shoe magnet. This magnet drives a small nickel wire (0.6 mm in diameter, 5–7 mmlong) used as a stirring bar inside the lower part of the solution, not illuminatedby the laser.

The output from the two integrated photodiodes is amplified and filtered witha four-pole Butterworth-style circuit located on a circuit board mounted to thenylon block, which minimizes the signal path length. Low-noise, low-drift/offset(0.6 mV/°C, 25 mV) precision op-amps, along with low-temperature coefficient(<100, 50 ppm/°C) trimming resistors and surface-mount resistors and capacitorsare used.

Table 1Nucleation and Crystallization Effectsby Binary Mixtures of HbC with Hb Variants

Effect on oxyHbCHbC compound Site-specific nucleation and Crystal Heterozygote substitution crystallization morphology Reference

HbS β6 Glu→Val Accelerates Tetragonal 13Hb Korle-bu β73 Asp→Asn Accelerates Cubic-like 21HbF β87 Thr→Gln Inhibits — 22Hb N-Baltimore β95 Lys→Glu Accelerates Tetragonal 23Hb Riyadh β120 Lys→Asn Inhibits — 23HbαG- α68 Asn→Lys Accelerates Tetragonal and 24 Philadelphia numerous 3X

elongatedHb J-Baltimore β16 Gly→Asp Accelerates Tetragonal 25

(in vitro)

160 Vekilov et al.

The whole assembly, together with a stirring motor, is housed in a lightmetal enclosure with a water-cooling loop to extract the heat from the Peltierdevice. The amplified/filtered output of the two photodiodes and the thermo-couple are interfaced to a Macintosh computer via a MacADIOS II, which is

Fig. 3. Determination of Hb solubility using the miniaturized scintillation technique.(a) Schematic of scintillation cell arrangement. (b) Variations in temperature and cor-responding scintillation signal changes in a solubility determination run with a solutioncontaining 40 mg/mL of HbC and 1.9 M K2HPO4/K2HPO4 buffer at pH 7.37. Arrowon right ordinate, the temperature axis, indicates the temperature of equilibrium Teq

between this solution and the crystals. (Inset) The expanded part of the signal traceillustrates the requirement for steady scintillation signal (i.e., crystals—solution equi-librium), before temperature is changed.


also connected to the thermoelectric temperature controller. A custom-mademodule employing the LabView programming environment changes the cell/solution temperature according to the changes in the scintillation signal.

In this method, the correspondence between temperature and equilibriumconcentration is established by searching for the temperature at which a solu-tion with a given protein concentration is in equilibrium with the crystallinematerial of interest. For this, a number of small crystallites are nucleated at atemperature that ensures sufficiently high supersaturation. The formation ofthese crystals decreases the solution concentration to roughly the equilibriumvalue at this temperature. Then the temperature is changed in steps in the direc-tion of undersaturation, until all crystals have dissolved. In this way, the equi-librium is approached from the side of dissolution. This approach providessignificant advantages over methods in which equilibrium is approached fromthe growth side (i.e., batch techniques) The advantages are twofold: (1) duringdissolution, layers start retracting from the crystals’ edges, and thus no “disso-lution layer source” is needed; (2) impurity pinning of steps (30,31) is believedto be less common during layer retraction. Kinetic hindrances, associated withgrowth layer generation and with impurity effects at low supersaturations, canlead to cessation of growth in supersaturated solutions, and thus bias equilib-rium point determinations from the supersaturated side.

An interesting finding, made on separate and numerous occasions using lightand DIC video-enhanced microscopy and the scintillation technique, is thatnucleation and crystallization do not occur in the presence of direct light. Wehad hypothesized that the CO was photolyzed, resulting in deoxyHb, whichhas a significantly longer nucleation lag time and rarely results in crystals (38).However, oxyHb, in which the ligand does not dissociate as a result of pho-tolysis, exhibited the same phenomenon. This phenomenon of light inhibitionof nucleation and crystal growth remains to be explained, and does not appearto be a simple artifact.

After the solution is introduced in the light-scattering cell (see Fig. 3), thetemperature is raised to a value in the range of 30–35°C. Tetragonal crystals,10–50 µm on an edge, with the typical morphology illustrated by Fig. 1, wereobserved under the microscope with ×250 magnification within 1 to 2 h. Thecell is then inserted in the scintillation apparatus described previously.

These small crystals scatter light that is detected by the photodetector. Thenthe control program lowers the temperature to an operator-defined value, where-on the crystals begin to dissolve and the light scattered from them decreases.Representative temperature changes and the response of the photodiode signalare displayed in Fig. 3B. After 0.5–1 h, the signal reaches a steady value (seeFig. 3, inset), indicating that the remaining crystals are at equilibrium with thesolution at this temperature. The temperature is further lowered in steps.

162 Vekilov et al.

Because of dissolution of all crystallites, the steady value of the signal re-turns to baseline. This indicates that all crystallites formed at the initially raisedtemperature have dissolved, and the solution concentration is identical to theinitial one (verified by spectrophotometric determinations). The equilibriumtemperature for the given protein concentration falls between the last two tem-perature steps. We approximate it by the lower temperature value (see arrow inFig. 3B). To minimize the error introduced through this assumption, we opti-mized the magnitude of the final temperature step.

These data were used to design a novel strategy for growing HbC crystalsfor X-ray structure studies by the temperature gradient technique (33). Thismethod provides the following advantages for X-ray ready-crystals: First, crys-tallization occurs in the X-ray capillaries and crystal handling between growthand diffraction data collection is avoided. Second, only one or very few well-separated crystals form, which eliminates interference of diffraction patternsof multiple intergrown crystals. Third, growth occurs in a controlled, steady-temperature environment, conducive to higher crystal perfection (33). In thismethod, a linear temperature gradient is set across an X-ray capillary. The highT value is chosen such that it provides for supersaturation at which crystalnucleation occurs, on average, over 2 to 4 d. For a solution containing 20 mg/mLof HbC, this temperature was found to be 24–25°C. The first HbC crystalsgrown by this method diffracted to 1.8 Å resolution. This is an improvementover previous studies, in which batch-grown HbC crystals diffracted to 2.1–2.0 Å.Efforts to further increase the diffraction resolution by optimizing the tempera-ture conditions in the capillary are currently under way.

1.4. Atomic Force Microscopy

Besides the clinical and biochemical significance of the in vitro studies ofHbC crystallization, atomic force microscopy (AFM) is a suitable model forcrystal growth of a multisubunit, allosteric protein. AFM of tetragonal HbCcrystals, generated in 1.8 M phosphate, is employed to determine crystal growthmechanisms at the molecular level. To prepare samples for imaging, we placeddroplets of a crystallizing solution of ~50 µL on 12-mm glass cover slipsmounted on iron disks. To avoid evaporation, the droplets were covered withglass covers, hermetically sealed, and kept for a few hours in a controlled-temperature chamber at ~22°C. Typically, this leads to the formation of 3–20crystals of sizes ranging from 20 to 200 µm firmly attached to the glass bottom.Droplets with three to five crystals were selected and magnetically mounted onthe AFM scanner. The fluid AFM cell was filled with the crystallizing solutionand imaging commenced.

Temperature in the laboratory was stabilized to ~22°C. No additional tem-perature control of the solution in the AFM fluid cell was employed. Insertion


of a thermocouple in the crystallizing solution revealed that its temperaturewas higher than the room temperature by ~0.5–1.0°C.

All images were collected in situ during growth of the crystals using the lessintrusive tapping imaging mode (34–37). This allows visualization of adsorbedprotein and impurity species; tip impact in the contact imaging mode oftenprevents such imaging.

We used the standard SiN tips, and tapping drive frequency was adjusted inthe range of 25–31 kHz to the resonance value for the used tip. Other scanningparameters were adjusted such that continuous imaging affected neither thesurface structure nor the process dynamics. For verification, we varied the scansizes and the time elapsed between image collections and saw that neither thespatial nor the temporal characteristics of the processes changed. For detailsand tests about the determination of the maximum resolution of 16 Å, and thecalibration of the AFM imaging technique with other studied proteins, see ref.38. The experiments with COHbC crystals in supersaturated solutions revealedthat the thickness of a layer on a (101) face is 55 Å, and the periodicity alongthe c-axis is 195 Å, in agreement with the X-ray structure (32,39)

Figure 4 provides examples of data attainable by an AFM investigation. Ifthe width of the scanning area is 10 µm or wider (using the J scanner, it can beas wide as 140 µm), as in Fig. 4A, we can see that the crystals grow by a two-step mechanism: (1) a new layer is generated by a surface nucleation process;(2) these layers incorporate building blocks from the solution and spread tocover the whole facet. Note that the generation of a subsequent layer occurswhile the underlying layer is still growing. This leads to many layers spreadingand chasing one another on the crystal surface. Volmer (40) published thiscrystallization mechanism in the 1930’s, and it has been observed for numer-ous small-molecule, protein and virus crystals (38,41–44). Zooming in on theedge of the growing layer (Fig. 4B) we find that layer thickness equals ~55 Å,and this is the molecular dimension in the a (or b) crystallographic directionof the unit cells. Figure 4C–F reveals that as the molecules attach to the edgeof the unfinished top crystal layer, this layer advances and the crystal grows.Furthermore, the edge of the unfinished layer in Fig. 4B is rough, and thecharacteristic length scale of the roughness equals one molecular dimension. Thisis only possible if molecules join the crystal one by one. We conclude that thebuilding blocks of CO HbC crystals are a single protein molecule. Accordingly, insupersaturated solutions, the surface lattice parameter is ~200 Å and, within theresolution of our technique, equals the one expected from crystal structure.

1.5. Impurities and Crystal Growth

The earlier notion that crystallization is a method for protein purificationnow requires revision as shown by crystal growth studies wherein crystal

164 Vekilov et al.

imperfections arise from the incorporation of impurities. It was found thatimpurities affect growth and are often abundantly incorporated into the crys-tals. Species that have been considered impurities include microheterogeneousmolecules of the crystallizing protein, aggregates and clusters of this protein,other protein molecules remaining in the solution after isolation and purifica-tion, ligands or cofactors that naturally bind to the protein, as well as small

Fig. 4. AFM characterization of the mechanisms of incorporation of molecules intoCO HbC crystals during growth. (a) Multiple layers spread along the surface, arrowpoints at a newly nucleated layer. (b) Molecular resolution imaging of the growthinterface. The crystallographic unit cell is highlighted in a white box, and the rough-ness of the edge of the spreading layer is highlighted in white revealing the lengthscale of a single molecule.


molecules such as salts and buffers. For instance, the presence of other pro-teins and a covalently bound molecular dimer were shown to severely affectthe shape of the interface, reduce the growth rate by factors of up to five, andcompletely inhibit growth at low supersaturations (45–49). More important, itwas found that these same impurities are preferentially incorporated into thecrystals and exhibit severely nonuniform distribution with a region of veryhigh impurity incorporation in the central regions of a crystal (50,51). There-fore, crystallization should not be considered a method of protein purificationwithout further verification.

Our studies of the crystallization of Hb revealed that all of these mechanismsapply. The effects of HbS, HbA, and HbF, microheterogeneous molecules affect-ing the nucleation and crystal growth of HbC, are discussed under Subhead-ing 1.1. and in Table 1. As far as small molecules are concerned, it was foundthat HbC nucleation is accelerated by intracellular components and analogs suchas 2,3-diphosphoglycerate (DPG), inositol hexaphosphate, and Band 3 (23,52).This raises the question, Are erythrocyte components involved in the nucleationand crystallization of HbC in vivo? This in turn introduces the possibility of invivo correlates to the present concepts of crystal growth and impurities.

Video-enhanced DIC microscopy was used to observe the fine structure ofthe growing crystals in the solution. A detailed account of the findings of thisinvestigation is provided in ref. 28. Within the context of a discussion of theeffects that impurities may have on the growth and quality of the Hb crystals, itis important to note that these studies revealed well-pronounced striations par-allel to the crystal faces (Fig. 5). Previous studies with other proteins haveshown that these striations are owing to temperature variations during growthand are significantly fainter when the impurity content is lower (46,49,53). Inanalogy to these previous results, we suspect that the striation in also reflectsenhanced impurity incorporation of the variation in growth rate caused by tem-perature instability.

2. Materials2.1. Purification of Hemoglobins

1. Heparanized vacuum tubes for blood collection (Vacutainer tubes; Becton-Dickinson, Franklin Parks, NY).

2. Columns for liquid chromatography (Kontes, Vineland, NJ).3. Preswollen and microgranular anion (DE-52, cat. no. 4057-200) and cation

(CM-52, cat. no. 4037-200) exchangers (Whatman, Newton, MA).4. Sephadex G-25 Fine gel filtration (cat. no. G25-80; Sigma, St. Louis, MO).5. Protein concentrators (e.g., Centriprep 10, cat. no. 4304; Amicon, Beverly, MA].6. Isotonic saline (0.9%) prepared by dissolving 9 g of NaCl in distilled water and

brought to 1 L.

166 Vekilov et al.

2.2. Batch Nucleation Studies

1. 2.1 M potassium phosphate buffer, pH 7.35.2. Glass test tubes (5 mL, 75 × 12 mm diameter) (cat. no. 55.476; Sarstadt).3. Pipettors with delivery capabilities of 1–10 µL and several hundred microliters.3. Incubator (30°C).4. Hematocytometer or other fixed grid for counting crystals in a reproducible fashion.5. Timer (minutes).6. Light microscope.

2.3. Video-Enhanced DIC Microscopy

1. Zeiss Axiovert 35 microscope: Similar to the video-enhanced DIC microscopedescribed by Samuel et al. (54), it is equipped with a polarizer and analyzer,Wollaston prism, 546 interference filter, heat cut and reflecting filters, and a 100-WHg light source.

Fig. 5. Video-enhanced DIC imaging of formation of tetragonal crystals of oxyHbC.Magnification: ×4000; bar = 8.7 µm. (From ref. 28).


2. Hamamatsu video camera, Hamamatsu C2400 analog enhancer, HamamatsuArgus-10 Digital Image Processor, Mitsubishi Diamond Pro video recorder, andSony monitor: The specimen image is projected onto the video camera and ana-log enhanced, then passed through the digital image processor and video recordedand displayed on the monitor.

3. Mitsubishi Video Copy Processor and VCR cassettes: A record is obtained withthe processor and/or recorded over time onto the cassettes.

4. 35-mm Camera attachment, to photograph unenhanced video images.5. Standard microscope slides and cover slips.6. Nitrogen or helium for deoxygenation of Hbs.7. Sodium dithionite (product 13551, cat. no. 7775-14-6; Sigma, St. Louis, MO) to

reduce and deoxygenate the Hbs.8. Glove box or glove bags, for anaerobic preparation of slides.9. Cover glass sealant to maintain anaerobic conditions.

2.4. Determination of Solubility

1. Silica microcell (model 37G; Wilmad Glass).2. Thermoelectric heat pump (Peltier cooler) MI1062T-03AC (12 Wmax heat load;

Marlow, Dallas, TX).3. Programmable controller SE 5010 (Marlow).4. Type-T thermocouple (Omega).5. Laser diode assembly VLM 25L, 5 mW, 670 nm (Applied Laser Systems).6. Detector/amplifier photodiode UDT 455 (United Detector Technology).7. Beam splitter (stock number A 32,600; Edmund Scientific).8. Horseshoe magnet AM-300-RH (Active Magnetics).9. Nickel wire 0.6 mm in diameter, 5–7 mm long.

10. Low-noise, low-drift/offset (0.6 mV/°C, 25 mV) precision op-amps OP27 (Preci-sion Monolithics).

11. Stirring motor, 720 rpm BA P/N 4201-001 (Hurst).12. Macintosh computer with a MacADIOS II (GW Instruments) interface board.13. LabView programming environment (National Instruments).

2.5. Atomic Force Microscopy

1. Multimode Atomic Force Microscope Nanoscope IIIa (Veeco, SantaBarbara, CA).

2. J and E scanners (Veeco).3. Cantilever holder for imaging in fluids (Veeco).4. Disks (12 mm) cut of glass cover slips.5. Iron disks (12 mm) (Veeco).6. Epoxy resin.7. Glass cup (5 mL).8. Parafilm.9. Syringe (1 mL), for solution loading into AFM fluid cell.

168 Vekilov et al.

2.6. Adhering Erythrocytes to AFM Disks

1. Trimethylchlorosiline (Sigma).2. Ruby Red Mica Sheets (Electron Microscopy Sciences, Washington, PA).3. Cover glass (Corning) or Microscope Cover Glass (Fisherbrand).4. Citrate-phosphate-dextrose (CPD): 87.7 mM citric acid, 15.2 mM sodium cit-

rate (Na3C6H5O72H2O), 15.8 mM NaH2PO4, 139 mM dextrose (anhydrousdextrose), pH ~5.63 (1.45 mL of CPD/10-mL whole-blood collection, which isusually equivalent to one vacutainer).

3. Methods3.1. Purification of Hbs

HbA, normal adult Hb, is obtained from volunteers. Naturally occurring Hbmutants are obtained from patients exhibiting specific hemoglobinopathies.Some mutations are spuriously detected in individuals who exhibit no patho-physiology for the amino acid substitution but may be under treatment for someother condition. HbC is obtained from CC or CA or SC individuals. Heterozy-gous RBCs ensure an excellent control since it allows for the handling andsimultaneous separation and purification of these Hbs. In all these cases, writ-ten consent is required according to guidelines of the National Institutes ofHealth under the specific guidelines of the institution’s committee on clinicalinvestigation. Whole blood must be assumed infectious and handled withproper precautions, such as wearing gloves, protective garments over clothing,and eye shields. Venous blood should be drawn into a vacuum tube containingan anticoagulant. For our studies, heparinized vacuum tubes are employed. Onopening, hold the tube away from the body over a sink or basin. Open slowlyand deliberately to avoid spurting of blood as air rushes in. Any spillage mustbe wiped off with a disinfectant such as Chlorox. The blood may be refriger-ated overnight. A hemolysate should be prepared within 24 h from the timedrawn. Preparation of a hemolysate is as follows:

1. Separate the red cells from the plasma by standing or spinning the whole blood at~3000–5000 rpm in low-speed tabletop centrifuges.

2. Draw off and discard the plasma and buffy coat (a grayish thin layer containingleukocytes [<1% total blood volume] atop the RBCs).

3. Resuspend RBCs in isotonic saline (0.9%).4. Wash the cells three times in this manner to ensure removal of the plasma.

Recall that the plasma contains proteins and other compounds that bind specifi-cally or nonspecifically to Hb with significant affinity—hence, the need forpurified Hbs.

5. After washing the RBCs, lyse the cells by the addition of distilled water (1:1),shaken to break the membranes, then frozen in liquid nitrogen. Repeat the freeze-thaw step at least three times, each time transferring the supernatant to a clean


tube. Finally, spin the material at least three times at high speed (e.g., 10,000 rpmfor at least 20 min) or until the membranous material is no longer visualized. Thislysate is termed a hemolysate. Alternatively, membranes may be removed withthe addition of distilled water:toluene (1:1 to the ratio of RBCs) to ensure lysis ofthe erythrocyte membrane. However, it is not advisable to use toluene for crys-tallization studies: it is known that toluene binds to Hb at α14 Trp, and tolueneaccelerates nucleation and crystallization. In fact, toluene is often added in verysmall quantities to the precipitants to induce nucleation and crystallization ofhemoglobins or Hbs that do not readily crystallize.

6. Depending on the specific Hb mutation and subsequent charge modification,purify the Hb by liquid column chromatography using specific anion- and cation-exchange resins, depending on its charge (see ref. 55).

7. Strip the purified hemoglobins of DPG and various ions by Sephadex G-25 gelfiltration chromatography. We find that repeating this twice ensures thepreparation of stripped Hbs, which may be assessed by oxygen equilibrium meth-ods. Stripped Hb has a higher oxygen affinity.

8. Dialyze the Hb to the desired buffer and concentrate. Freeze drop-size pellets inliquid nitrogen and store under liquid nitrogen or temperatures not higher than~–136°C.

3.2. Batch Nucleation and Crystallization Studiesof HbC and Mixtures of HbC

This method is a modification of a procedure introduced by Adachi andAsakura (56–58) to study polymerization and crystallization of HbS and HbC.Note that they employed Rayleigh light scatter to detect Hb aggregates, in con-trast to our microscope and scintillation techniques. We clearly observe a lagphase for HbC crystallization in contrast to their reports of no observed lagphase for HbC crystallization. The difference in these reports may arise fromtheir technique used to detect aggregation.

It is important to use volumes that ensure a final experimental buffer con-centration of at least 1.83 M potassium phosphate in order to observe crystalsof HbC within 15–30 min. Therefore, the concentration of Hb must be high(~14 g%) in order that the volumes used to obtain a final concentration of 2 g%will be small. If the Hb availability is limited, then one can work with a totalvolume of 0.5 mL and up to 2 mL for batch crystallization in the indicatedtubes. Surface area may be a likely contributing factor to the kinetics.

CO hemoglobins (preferable in order to minimize oxidation) or oxyhemo-globins are mixed, and the tube is held between two fingers, gently tappedabout 12 times, and placed in an incubator at 30°C. This is considered timezero. Note that there is no difference in nucleation and crystallization kineticsin the CO or oxy ligand states. At time zero and at 15-min intervals, the tube isremoved, tapped as just described, and gently inverted to ensure mixing. Thecrystals are less dense than the solution. A 10-µL aliquot is removed and placed

170 Vekilov et al.

into a hematocytometer. The four grids of the outer corners are observed andcrystals are counted. If a hematocytometer is not available, a slide with a fixedgrid for counting may also serve the purpose. Since these are relative compari-sons, it is important to use the same method of counting. Aliquots are usuallyobserved for about 2 h. For solutions containing 100% HbC, red tetragonalcrystals generally appear within 15–30 min under these conditions (Fig. 1).Mixtures of hemoglobins or HbC mixed with various factors may result incrystallization faster (within the dead time) or slower (hours or days). The lognumber of crystals is plotted against time (Fig. 2).

Should it be desirable to collect the crystals, the batch solution is placed in asyringe with a Millipore filter adapter (micron size) to separate the crystalsfrom the mother liquor. The mixture of crystals and mother liquor is pushedthrough the syringe. The filter containing the crystals is removed and carefullywashed with the concentrated phosphate buffer to remove excess mother liquor.The crystals may then be dissolved in a few microliters of low concentrationbuffer (e.g., 0.05 M). The Hb solution is harvested and analyzed as necessary(e.g., electrophoresis, isoelectric focusing).

3.3. Growth of Single Crystals >2 mm via Batch Methods

1. Prepare 14 mg/mL of CO HbC in 1.8 M KH2PO4/K2HPO4, pH 7.35. A concen-trated Hb solution is used at a volume which brings the 2.1 M potassium phos-phate buffer concentration to 1.80–1.82 M final concentration. To measure thepH of a high concentration buffer (i.e., 1.8–2 M), it is recommended that one add0.1 mL of the buffer to 2 mL distilled water.

2. Add 500-µL aliquots of the aforementioned mixture to a 7-mL test tubes.3. Seal the test tubes tightly with parafilm.4. Under a fume exhaust hood, gently add CO gas (~5 min) toward the surface of

the aforementioned solutions without bubbling by placing a small hole in theparafilm with a pipet tip. Gentle rotation is allowed. A COHb solution appearscherry red, in contrast to the red oxyHb and purple deoxyHb solutions.

5. Cover the opening with parafilm and the test tubes with aluminum foil. Place thetest tubes in a dark drawer at room temperature.

6. Add CO gas every 3 d by the method described in step 4 and re-cover withparafilm. Large crystals (~1 mm and greater) usually form within 10 d.

3.4. Growth of One to Three CO HbC Crystals Insidea Single X-Ray Diffraction Capillary (see Note 1)

1. Prepare 20 mg/mL of CO Hb C in 1.9 M KH2PO4/K2HPO4 in a 7-mL test tube.Excessive agitation may initiate nucleation of numerous small tetragonal crys-tals. If this occurs, placing the test tube mixture on ice or in a refrigerator for 10 minup to 4 h can dissolve the crystals.

2. Fill the X-ray diffraction capillary to its capacity. Handle these fragile capillarieswith a gentle but firm touch.


3. Cap the ends of the capillary with melted wax. To achieve this, melt 2 to 3 g ofwax in a beaker on a hot plate. Allow the wax by diffusion to enter the capillary,~2–3 mm. As the wax hardens, add additional wax until a small bulblike struc-ture appears to secure the ends.

4. Place the sealed capillary in the refrigerator for 1 h to dissolve small nuclei thatmay have formed during handling.

5. Place the capillary in a thermostated solution growth cell (33). The capillary is posi-tioned such that one-quarter to one-third of the capillary sits over the growth sting orhot spot.

6. Program the localized heated growth sting at 24 to 25°C to provide a minimumsupersaturated environment; meanwhile, set the thermostated jacket that sur-rounds the remaining capillary at temperatures <12°C, temperatures that will pre-vent nucleation.

7. Cover the entire apparatus with aluminum foil to prevent exposure to light.8. One to three crystals should grow at the growth sting within 2 to 3 d. The crystal-

lization solution will become clear after 1.5–3 wk, at which time the crystal (orcrystals) will have reached maximum size.

3.5. Adhering CO HbC Crystals to AFM Scanning Disk

1. Glue an untreated cover glass to the steel AFM scanning disks.2. Place the disks inside 24-well crystallizing plates.3. Dispense 20-µL aliquots of 14 and 16 mg/mL of CO HbC in 1.6 M KH2PO4/

K2HPO4 on each disk.4. Cover and seal the crystallizing plates with parafilm. Numerous small tetragonal

crystals will grow overnight (e.g., 14 mg/mL produces few but larger crystals; 16mg/mL produces smaller but more numerous crystals), some of which will beattached to the glass substrate whereas others will be floating in the crystallizingsolution.

5. Remove floating crystals by ciphering off the crystallizing solution with a 22-gage1-1/2 needle. Discard the crystallizing solution and the floating crystals. Gentlyadd and remove 10 µL of 1.6 M KH2PO4/K2HPO4 repeatedly until the remainingfloating crystals are removed. Crystals attached to the glass substrate are used forAFM studies.

6. To test that the CO HbC crystals are firmly attached, place 10 µL of 1.6 MKH2PO4/K2HPO4 over the crystals (as though a bubble of solution is formed overthe crystal). Place this disk under a microscope for viewing. Using a 22-gage 1-1/2needle, add 2 µL of 1.6 M KH2PO4/K2HPO4 while viewing the disk under themicroscope. The examiner must determine whether the crystals actually move orremain attached. The disk will appear as though a wave of solution has run acrossthe crystals. If the crystals do not move, they are assumed to be firmly attached tothe glass substrate.

7. Place the disk on the scanner piezoelectric tube and xyz translator. For crystalgrowth studies, add 0.2 mg/mL of CO Hb in 1.6 M KH2PO4/K2HPO4 to theprecipitant. This solution must be filtered because clusters of the Hb molecules

172 Vekilov et al.

sometimes arise and impair the viewing field. (The clusters interfere with thelaser light that diffracts off the “scanning” cantilever tip.) (see Note 2).

3.6. Adhering CC Erythrocytes to AFM Scanning Disk (see Note 3)

A cover glass treated full strength with trimethylchlorosiline or micaglued to cover slips can be used. (Use tape to uncover a fresh layer of micafor each new experiment.) A droplet of RBCs treated with CPD is placedon the cover glass and incubated overnight. Depending on the requirementsof the experiment, incubation can be done between 4 and 37°C. However,incubations >24 h at 37°C often leave hollow membrane seals and crematedcells. Incubations >24 h should be done at <30°C. The red cell droplet isrinsed with 0.9% saline or phosphate-buffered saline (PBS) and used “asis” for scanning (see Note 3).

Intraerythrocytic crystals can be induced by incubating CC red cells with3% saline (8,12). Higher yields of intraerythrocytic crystals are observed whenthe whole blood is not treated with CPD, but, rather, is incubated at 37°C for 4h in 2% NaCl with 80 mM KCl, 20 mM HEPES, 1 mM MgCl2, and 60 mMNaCl. Using the methods mentioned above, these HbC crystal-containing cellscan be attached to treated cover slips. These cells can then be viewed by anoptical microscope, or by AFM.

3.7. Video-Enhanced DIC Microscopy to Observe In Vitro CrystalGrowth

4 µL oxy, CO, or deoxy Hb (2 g% Hb, 1.8 M potassium phosphate buffer[e.g., 28]) are placed on a slide and observed over time (see Subheading 2.3.and refs. 28 and 54 for a description of the microscope configuration). TheCOHb does not oxidize readily to form met-Hb and, therefore, is advantageousin investigating R-state forms of Hb. For anerobic conditions, it is importatntto deoxygenate the hemoglobin, check for 100% deoxygenation by absorptionspectroscopy, and seal the slide well to prevent air from entering (this isdiscussed earlier).

4. Notes1. CO HbC is prepared by gently adding CO gas to >140 mg/mL of concentrated

HbC. Be sure to recalculate HbC concentration values; CO gas tends to furtherconcentrate the mixture. For this reason, buffers are made by first bubbling COgas into H2O and then by adding calculated portions of buffer/precipitants. Add-ing CO gas directly into the HbC solution results in incorrect concentration val-ues for the solution.

2. The concentration of the solution must remain low to prevent nucleation so thatthe crystals do not interfere with the laser light.


3. Erythrocytes can be fixed by treating cover slips with full-strength poly-L-lysine.Droplets of RBCs are added and incubated. The RBCs are rinsed two to threetimes with PBS and fixed with 1% glutaraldehyde for imaging (2 to 3% glutaral-dehyde has also been used).

AcknowledgmentsThis work was supported in part by the American Heart Association, Heritage

Affiliate Grant-in-Aid No. 0256390T; the National Institutes of Health R01HL58038 and NHLBI 1F31 HL09564; and the Universities Space ResearchAssociation Research Contract 03537.000.013. We would like to acknowledgeDr. S.-T. Yau for his efforts with the atomic force microscope imaging.

References1. Haurowitz, F. (1938) Das Gleichgewicht zwischen Hamoglobin und Sauerstoff.

Z. Physiol. Chem. 254, 266–274.2. Perutz, M. F. and Mathews, F. S. (1966) An x-ray study of azide methaemoglobin.

J. Mol. Biol. 21(1), 199–202.3. Perutz, M. F. and Lehmann, H. (1968) Molecular pathology of human haemoglo-

bin. Nature 219(157), 902–909.4. Perutz, M. F. (1969) The Croonian Lecture, 1968. The haemoglobin molecule.

Proc. R. Soc. Lond. B. Biol. Sci. 173(31), 113–140.5. Nagel, R. L. (1991) The distinct pathobiology of SC disease: therapeutic

tmplications, in Hematology/Oncology Clinics of North America, vol. (Nagel, R.L., ed.), W. B. Saunders, Philadelphia, pp. 433–451.

6. Nagel, R. L. and Steinberg, M. H. (2000) Hb SC and Hb C disease, in Disorders ofHemoglobin: Genetics, Pathophysiology, Clinical Management, (Steinberg, M. H.,Forget, B. G., Higgs, D. R., Nagel, R. L., eds.), Cambridge University Press, MA.

7. Diggs, L. W. and Kraus, A. P. (1954) Intraerythrocytic crystals in a white patient withhemoglobin C in the absence of other types of hemoglobin. Blood 9, 1172–1184.

8. Kraus, A. P. and Diggs, L. W. (1956) In vitro crystallization of hemoglobin occurringin citrated blood from patients with hemoglobin. C. J. Lab. Clin. Med. 47, 700–705.

9. Charache, S., Conley, C. L., Waugh, D. F., Ugoretz, R. J., and Spurrell, J. R.(1967) Pathogenesis of hemolytic anemia in homozygous hemoglobin C disease.J. Clin. Invest. 46(11), 1795–811.

10. Hirsch, R. E., Raventos-Suarez, C., Olson, J. A., and Nagel, R. L. (1985) Ligandstate of intraerythrocytic circulating HbC crystals in homozygote CC patients.Blood 66(4), 775–777.

11. Bunn, H. F., Noguchi, C. T., Hofrichter, J., Schechter, G. P., Schechter, A. N., andEaton, W. A. (1982) Molecular and cellular pathogenesis of hemoglobin SC dis-ease. Proc. Natl. Acad. Sci. USA 79(23), 7527–7531.

12. Lawrence, C., Fabry, M. E., and Nagel, R. L. (1991) The unique red cell heteroge-neity of SC disease: crystal formation, dense reticulocytes, and unusual morphol-ogy. Blood 78(8), 2104–2112.

174 Vekilov et al.

13. Hirsch, R. E., Lin, M. J., and Nagel, R. L. (1988) The inhibition of hemoglobin Ccrystallization by hemoglobin F. J. Biol. Chem. 263(12), 5936–5939.

14. Adachi, K. and Asakura, T. (1981) Aggregation and crystallization of hemoglo-bins, A., S, and, C., Probable formation of different nuclei for gelation and crys-tallization. J. Biol. Chem. 256(4), 1824–1830.

15. Adachi, K., Segal, R., and Asakura, T. (1980) Nucleation controlled agregation ofdeoxyhemoglobin. S. J. Biol. Chem. 255, 7595–7603.

16. Kashchiev, D. (1969) Solution of the non-steady state problem in nucleationkinetics. Surf. Sci. 14, 209–220.

17. Kashchiev, D., (1995) Nucleation, in Science and Technology of Crystal Growth (vanEerden J. P. and Bruinsma, O. S. L., eds.), Kluwer Academic, Norwell, MA, pp. 53–56.

18. Mutaftschiev, B. (1993) Nucleation theory, in Handbook of Crystal Growth, vol.1 (Hurle, D. T. J., ed.), Elsevier, Amsterdam, pp. 189–247.

19. Weber, P. (1991) Physical principles of protein crystallization, in Advances inProtein Chemistry, vol. 41 (Afinsen, C. B., Richards, F. M., Edsal, J. T., andEisenberg, D. S., eds.), Academic, New York.

20. Weber, P. C. (1997) Overview of protein crystallization methods, in Methods inEnzymology, vol. 276. (Carter, C. W. Jr. and Sweet, R. M., eds.), Academic, NewYork, pp. 13–22.

21. Lin, M. J., Nagel, R. L., and Hirsch, R. E. (1989) The acceleration of hemoglobinC crystallization by hemoglobin S. Blood 74, 1823–1825.

22. Nagel, R. L., Lin, M. J., Witkowska, H. E., Fabry, M. E., Bestak, M., and Hirsch,R. E. (1993) Compound heterozygosity for hemoglobin C and Korle-Bu: moder-ate microcytic hemolytic anemia and acceleration of crystal formation [corrected][published erratum appears in Blood 1994; 83(10):3105]. Blood 82(6), 1907–1912.

23. Hirsch, R. E., Witkowska, H. E., Shafer, F., Lin, M. J., Balazs, T. C., Bookchin,R. M., and Nagel, R. L. (1997) HbC compound heterozygotes [HbC/Hb Riyadhand HbC/Hb N-Baltimore] with opposing effects upon HbC crystallization. Br. J.Haematol. 97(2), 259–265.

24. Lawrence, C., Hirsch, R. E., Fataliev, N. A., Patel, S., Fabry, M. E., and Nagel, R. L.(1997) Molecular interactions between Hb alpha-G Philadelphia, HbC, and HbS:phenotypic implications for SC alpha-G Philadelphia disease. Blood 90(7), 2819–2825.

25. Hirsch, R. E., Shafer, F., Wajcman, H., Fataliev, N., and Nagel, R. L. (1999) HbJ-Baltimore Favors Crystallization of OxyHbC, but chain assembly abnormalities bluntthe phenotype of the compound heterozygote. Blood 92(10)(Suppl. 1, Pt. 1), 11a.

26. Adachi, K., Lai, C. H., Konitizer, P., Donahee, M., and Campbell, A., S. S. (1994)Crystallization of recombinant hemoglobins with basic amino acid substitutions(Lys and Arg) at the 6 position. Blood 84, 1309–1313.

27. Gallagher, D. T., Eisenstein, E., Fisher, K. E., et al. (1998) Polymorphous crystal-lization and diffraction of threonine deaminase from Escherichia coli. Acta. Cryst.D. 54, 467–469.

28. Hirsch, R. E., Samuel, R. E., Fataliev, N. A., Pollack, M. J., Galkin, O., Vekilov,P. G., and Nagel, R. L. (2001) Differential pathways in oxy and deoxy HbCaggregation/crystallization [in process citation]. Proteins 42(1), 99–107.


29. Feeling-Taylor, A. R., Banish, R. M., Hirsch, R. E., and Vekilov, P. G. (1999)Miniaturized scinitillation technique for protein solubility determinations. Rev.Sci. Instr. 70(6), 2845–2849.

30. Cabrera, N. and Vermileya, D. A. (1958) The growth of crystals form solution, inGrowth and Perfection of Crystals (Doremus, R. H., Roberts, B. W., and Turnbul,D., eds.), Wiley, New York.

31. Voronkov, V. V. and Rashkovich, L. N. (1994) Step kinetics in the presence ofmobile adsorbed impurity. J. Crystal Growth 144, 107–115.

32. Dewan, J. C., Feeling-Taylor, A., Puius, Y. A., et al. (2002) Structure of mutanthuman carbonmonoxyhemoglobin C (βE6K) at 2.0 Å resolution. Acta. Crystallogr.D58, 2038–2042.

33. Rosenberger, F., Howard, S. B., Sowers, J. W., and Nyce, T. A. (1993) Tempera-ture dependence of protein solubility—determination and application to crystalli-zation in X-ray capillaries. J. Crystal Growth 129, 1–12.

34. Hansma, H. G. and Hoh, J. H. (1994) Biomolecular imaging with the atomic forcemicroscope. Annu. Rev. Biophys. Biomol. Struct. 23, 115–139.

35. Hansma, P. K., Cleveland, J. P., Radmacher, M., et al. (1994) Tapping modeatomic force microscopy in liquids. Appl. Phys. Lett. 64(13), 1738–1740.

36. Möller, C., Allen, M., Elings, V., Engel, A., and Müller, D. J. (1999) Tapping-mode atomic microscopy produces faithful high-resolution images of protein sur-faces. Biophys. J. 77, 1150–1158.

37. Noy, A., Sanders, C. H., Vezenov, D. V., Wong, S. S., and Lieber, C. M. (1998)Chemically sensitive imaging in tapping mode by chemical force microscopy:relationship between phase lag and adhesion. Langmuir 14, 1508–1511.

38. Yau, S.-T., Petsev, D. N., Thomas, B. R., and Vekilov, P. G. (2000) Molecular-level thermodynamic and kinetic parameters for the self-assembly of apoferritinmolecules into crystals. J. Mol. Biol. 303(5), 667–678.

39. Fitzgerald, P. M. and Love, W. E. (1979) Structure of deoxy hemoglobin C (betasix Glu replaced by Lys) in two crystal forms. J. Mol. Biol. 132(4), 603–619.

40. Volmer, M. (1939) Kinetik der Phasenbildung. Steinkopff, Dresden.41. Giesen, M., Schulze Icking-Konert, G., Stapel, D., and Ibach, H. (1996) Step fluc-

tuations on Pt(111) surfaces. Surface Sci. 366, 229–238.42. Malkin, A. J., Kuznetsov, Y. G., Land, T. A., DeYoreo, J. J., and McPherson, A.

(1996) Mechanisms of growth of protein and virus crystals. Nat. Struct. Biol. 2,956–959.

43. McPherson, A., Malkin, A. J., and Kuznetsov, Y. G. (2000) Atomic force micros-copy in the study of macroimoleular crystal growth. Annu. Rev. Biomol. Struct.20, 361–410.

44. Yip, C. M. and Ward, M. D. (1996) Atomic force microscopy of insulin singlecrystals: direct visulization of molecules and crystal growth. Biophysical J. 71,1071–1078.

45. Thomas, B. R., Vekilov, P. G., and Rosenberger, F. (1998) Effects of microhetero-geneity on hen egg white lysozyme crystallization. Acta Crystallogr. Sect. D 54,226–236.

176 Vekilov et al.

46. Thomas, B. R., Vekilov, P. G., and Rosenberger, F. (1996) Heterogeneity deter-mination and purification of commercial hen egg white lysozyme. Acta Crystallogr.Sect. D 52, 776–784.

47. Vekilov, P. G. (1993) Elementary processes of protein crystal growth, in Studiesand Concepts in Crystal Growth (Komatsu, H., ed.), Pergamon, Oxford: pp. 25–49.

48. Vekilov, P. G., Monaco, L. A., and Rosenberger, F. (1995) Facet morphologyresponse to non-uniformities in nutrient and impurity supply. I. Experiments andinterpretation. J. Crystal Growth 156, 267–278.

49. Vekilov, P. G. and Rosenberger, F. (1996) Dependence of lysozyme growthkinetics on step sources and impurities. J. Crystal Growth 158, 540–551.

50. Stojanoff, V., Siddons, D. P., Monaco, L. A., Vekilov, P. G., and Rosenberger, F.(1997) X-ray topography of tetragonal lysozyme grown by the temperature con-trolled technique. Acta Crystallogr. Sect. D 53, 588–595.

51. Vekilov, P. G., Monaco, L. A., Thomas, B. R., Stojanoff, V., and Rosenberger, F.(1996) Repartitioning of NaCl and protein impurities in lysozyme crystallization.Acta Crystallogr. Sect. D 52, 785–798.

52. Hirsch, R. E., Rybicki, A. C., Fataliev, N. A., Lin, M. J., Friedman, J. M., andNagel, R. L. (1997) A potential determinant of enhanced crystallization of Hbc:spectroscopic and functional evidence of an alteration in the central cavity ofoxyHbC. Br. J. Haematol. 98(3), 583–588.

53. Monaco, L. A. and Rosenberger, F. (1993) Growth and etching kinetics of tet-ragonal lysozyme. J. Crystal Growth 129, 465–484.

54. Samuel, R. E., Salmon, E. D., and Briehl, R. W. (1990) Nucleation and growth offibres and gel formation in sickle cell haemoglobin. Nature 345, 833–835.

55. Schroeder, W. A. and Huisman, T. H. J. (1980) The Chromatography of Hemo-globin, Marcel Dekker, Nw York.

56. Adachi, K. and Asakura, T. (1979) Gelation of deoxyhemoglobin A in concen-trated phosphate buffer. Exhibition of delay time prior to aggregation and crystal-lization of deoxyhemoglobin, A., J. Biol. Chem. 254(24), 12,273–12,276.

57. Adachi, K. and Asakura, T. (1979) Nucleation-controlled aggregation of deoxy-hemoglobin S: possible difference in the size of nuclei in different phosphate con-centrations. J. Biol. Chem. 254(16), 7765–7771.

58. Adachi, K. and Asakura, T. (1979) The solubility of sickle and non-sickle hemo-globins in concentrated phosphate buffer. J. Biol. Chem. 254(10), 4079–4084.

Semisynthesis of Hb 177

11

177


Semisynthesis of Hemoglobin

Seetharama A. Acharya and Sonati Srinivasulu

1. Introduction1.1. Recombinant DNA Technology and Total Chemical Synthesisfor Generation of Mutant Forms of Proteins

Protein engineering, generation of mutant or modified forms of protein,has become the first step for studying the correlation of structure and func-tion of proteins. Design and generation of novel protein molecules with tai-lor-made properties is the long-range goal of such studies. Such novel proteinmolecules are now designed and generated by recombinant DNA technol-ogy, as long as these protein molecules contain only the naturally occurring20 amino acids residues (1,2). However, if unnatural amino acids needs to beintroduced, cell-free protein expression system and special manipulation ofthe tRNA is necessary (3,4). Incorporation of the unnatural amino acid resi-dues into a protein in a site-specific fashion could also be achieved throughtotal chemical synthesis. Gutte and Merrifield (5) achieved the total chemi-cal synthesis of RNase-A using solid-phase synthesis, starting from the car-boxyl end of the molecule and building, one residue at a time, to its aminoterminus. Hoffman et al. (6) introduced an alternate approach that involvedthe synthesis of a limited number of medium-size, protected segments of themolecule and condensing them to generate the full-length protein. Thisapproach, generally referred to as a segment condensation approach (6), hasgained significant attention in recent years. The molecular size of the pro-teins that biochemists desire to design and assemble are larger compared toRNase A. Accordingly, interest in developing newer and simpler approachesof segment condensation has increased.

178 Acharya and Srinivasulu

1.2. Semisynthesis of Proteins

Semisynthesis of a protein can be considered as a specialized case of totalchemical synthesis of protein by the segment condensation approach, where asignificantly large portion of the protein is derived from the wild-type protein,and only a small segment of the protein is chemically synthesized with thedesired changes in the covalent structure. This segment is then assembled withthe complementary segment from the wild-type protein to generate a mutantform of the protein. The assembly may involve splicing of the two segments toestablish chain contiguity. These semisynthetic reactions are referred to ascovalent semisynthesis. However, establishing chain contiguity may not benecessary if the complementary segments exhibit strong noncovalent interac-tion among them that facilitates the assembly of the native folding of the pro-tein (fragment-complementing systems). The latter represents the case ofnoncovalent semisynthesis.

1.2.1. Noncovalent Semisynthesis

So far, in choosing the appropriate segment of the parent protein suited forchemical synthesis, information on the permissible discontinuity region of theprotein has provided the road map (7). Many proteins have been converted intofunctionally active fragment-complementing systems either by limited pro-teolysis or site-specific chemical cleavage of the protein (8–10). In the modi-fied protein, generally referred to as the fragment-complementing system, two(or more) segments of the protein are held together by strong noncovalent inter-actions, and accordingly, the modified protein conserves most of the confor-mational aspects of the parent protein. However, the interacting segments ofthe fragment-complementing system could be separated under denaturing con-ditions. In addition, a functional unit having the conformational and functionalproperties similar to that of the starting material could be generated by reas-sembling the complementary segments of the protein under the physiologicalconditions. In such a system, the amino acid sequence of segments of the pro-tein is readily accessible for chemical manipulation through peptide synthesis.The modified peptide segment could be assembled with other segments of thesystem. The assembled product carrying a chemically synthesized segment is asemisynthetic protein and is analogous to the fragment-complementing systemof the parent protein (11).

1.2.2. Covalent Semisynthesis

Over the years, it has been established that it is now possible to induce theprotease that generated the fragment-complementing system of a protein toreligate the discontinuity in the polypeptide chain of the new semisynthetic


fragment-complementing system (12). The approach of splicing the discontinuityhas been referred to as covalent semisynthesis. There are many examples of suchcovalent semisynthetic reactions in the literature to date (13–15). A recent modifi-cation of this approach introduced by Proudfoot et al. (16) is to have a very reactivegroup on the α-carboxyl group of the discontinuity site. In such a fragment-complementing system, the nucleophilic attack of the activated carboxyl groupby the α-amino group of the discontinuity site established the contiguity to thepolypeptide chain. Since the noncovalent interaction of the complementary seg-ments facilitating the generation of native-like conformation in the fragment-complementing system is pivotal to the splicing reaction, this reaction is referred toas a conformationally assisted protein ligation reaction (17).

1.3. α-Globin Semisynthetic Reaction

The V8 protease catalyzes the splicing of the complementary segments ofα-globin (α1–30 and α31–141) (18), and has been used by our laboratory groupfor the preparation of many chimeric α-globins. A schematic representation ofthe generation of chimeric (semisynthetic) α-globin by exchanging one of thecomplementary segments of human α-globin with that of the animal α-globin isshown in Fig 1. Similarly, an exchange between the two animal α-globin chainscould also be carried out to generate animal-animal chimeric α-globin chain.The V8 protease–catalyzed splicing reaction (semisynthetic reaction) is noveland very distinct from the previously described covalent protein semisyntheticreactions. This ligation reaction is facilitated by the conformation aspects of theproduct, rather than that of the “native-like” conformational aspects of reactants(i.e., the fragment complementing system). The continuity of the polypeptidechains established in the mixture of the complementary segments facilitates theinduction of α-helical conformation into the contiguous chain in the presence ofthe organic cosolvent. This secondary structure of the ligated segment protectsthe Glu30 Arg31 peptide bond from proteolysis (19,20). There are several uniquefeatures of this α-globin semi synthetic reaction. First, there is the absence ofnoncovalent interactions between the two reacting peptides that establish anative-like structure in the fragment-complementing system. Second, the splic-ing reaction requires the presence of 30% propanol (or other α-helix-inducingorganic solvents). Third, an extensive excision of the amino-terminal and thecarboxyl-terminal region of α1–30 and α31–141 can also be made without influenc-ing the equilibrium yields of the splicing reaction. Therefore, reaction has beenexploited for the generation of semisynthetic hemoglobins (Hbs) (21–24).

1.4. Semisynthesis of Hbs

Hb tetramer contains four polypeptide chains, two copies each of two sub-units, the α- and β-chains. Each of these chains is composed of the protein part,


globin, and the non-protein part, heme. Thus, the generation of tetrameric Hbfrom semisynthetic α-globin involves the assembly of the heme with semisyn-thetic α-globin, and the hybridization of the semisynthetic α-chain (heme-bound polypeptide chain) with the appropriate β-chain to generate the α2β2structure. Accordingly, the protocol for semisynthesis of Hb involves two majorsections: (1) covalent semisythesis of desired variant or chimera of α-globin, and(2) assembly of semisynthetic α-globin with heme and β-chain to generate thetetramer through the alloplex intermediate pathway (25) (see Note 1).

2. Materials2.1. Preparation of α and β-Globin Chains of HbA and/or Animal Hb

1. Chromatographically purified HbA or HbS (refer to Chapter 3 for procedures).2. p-Hydroxymercuribenzoate (HMB) (see Note 2).3. 0.1 N NaOH (Fischer).4. 0.1 N Acetic acid (Fischer Scientific).5. Chromatographic columns (Rainin or Pharmacia), 1.5 × 30 cm for loads of

50–200 mg of protein, and 2.5 × 50 cm for loads of 1–2.5 g and higher.6. Ion-exchange resin, CM-52 cellulose (Whatman).7. Phosphate buffers: 10 mM phosphate buffer, pH 6.5, and 15 mM phosphate

buffer, pH 8.3.

Fig. 1. Schematic illustration of V8 protease–catalyzed slicing and splicing ofα-globin to generate chimeric (semisynthetic) α-chains. The complementary segments(α1–30 and α31–141). of α-chains with single or multiple sequence differences in eitherthe α1–30 or α31–141 segments or in both segments are spliced together to reduce orincrease the number of sequence differences in the α-chain as compared with that ofhuman α-chain.


8. 0.5% Acid acetone (prepared by mixing 5 mL of concentrated HCl with 995 mLof acetone).

9. Corex centrifugation flasks (200–250 mL).10. Sorval centrifuge RC-5C, LKB fraction collector, and a manual linear gradient

marker when using a single-pump system or gravity for chromatography. Alter-natively, a fast protein liquid chromatogrphy (FPLC) or an Acta system fromPharmacia can be used.

2.2. Preparation of α1–30 and α31–141 from Human and/orAnimal α-Globins

1. 10 mM Ammonium acetate buffer, pH 4.0.2. Lyophilized α-globin (about 100 mg).3. Staphylococcus aureus V8 protease (Pierce, Rockford, IL). The V8 protease from

Pierce comes as a lyophilized sample. Generally, a stock solution of the enzymeis made in water and stored at –80°C. One milligram of the enzyme is dissolvedin water; the exact concentration of the enzyme is determined spectrophotometri-cally. The absorbance of a 1 mg/mL solution at 280 nm is 0.67.

4. Reverse-phase C4 column, analytical reverse-phase high-performance liquidchromatography (RP-HPLC) column (Vydac) for analytical runs, and semipre-parative or preparative columns, for isolation of the complementary segments ofα-globin using RP-HPLC.

5. Sephadex G-50, for purification of the complementary fragments of α-globinunder denaturing conditions (0.1% trifluoroacetic acid [TFA] in water).

6. Urea (98+% purity) (Sigma, St. Louis, MO).7. Buffer A: 5 mM phosphate buffer, pH 7.0, containing 8 M urea and 50 mM

β-mercaptoethanol.8. Buffer B: 25 mM phosphate buffer, pH 7.0, containing 8 M urea and 50 mM

β-mercaptoethanol.9. Buffer C: 50 mM phosphate buffer, pH 7.0, containing 8.0 M urea and 50 mM

β-mercaptoethanol.10. HPCL setup (we use a Shimadzu system), for the RP separation of the comple-

mentary fragments11. LKB fraction collector, FPLC or Acta (both from Pharmacia).

2.3. V8 Protease–Catalyzed Ligation of α1–30 with α31–141 andPurification of Semisynthetic α-Globin

1. An α1–30 segment that is to be spliced, generated either by chemical synthesisincorporating the desired sequence differences (mutation) or by the V8 proteasedigestion of an animal α-globin carrying a number of sequence differences.

2. Desired α31–141 segment from the α-globin of either human or mammal.3. 50 mM Ammonium acetate buffer, pH 6.0 containing 30% n-propanol.4. V8 protease: a stock solution prepared as discussed in Subheading 2.2. is used.5. C-4 RP-HPLC column (Vydac).6. CM-52 cellulose (Whatman).


7. Sephadex G-50.8. Urea.

2.4. Assembly of Semisynthetic Hb and Its Purification

1. Mutant semisynthetic α-globin, or internally or externally deleted semisyntheticα-globin, or semisynthetic chimeric α-globin.

2. Chromatographically purified HMB βA- or βS-chains.3. Catalase.4. 100 mM EDTA in water (37.2 mg/mL of water).5. 100 mM Dithiothreitol (DTT) (15.5 mg/mL) (Sigma).6. Hemin (Sigma) solution: Dissolve 5 mg of hemin in 200 µL of 0.1 N NaOH.7. Sodium cyanide: 1 mg in 100 µL of water.8. Hemin dicyanide solution: 200 µL of hemin solution mixed with 60 µL of

sodium cyanide solution and made up to 5 mL with double-distilled water(see Note 3).

9. Chromatographic columns: 1.5 × 50 cm and 0.9 × 30 cm (Rainin).10. Sephadex G-25.11. CM-52 cellulose (Whatman).12. 100 mM Tris-HCl buffer, pH 7.4.13. Globin-dissolving buffer: 50 mM Tris-HCl buffer, pH 7.4, containing 8 M urea,

1 mM EDTA, and 2 mM DTT.

2.5. Chemical and Functional Characterization of theSemisynthetic Hb

1. C4 column (Vydac), for RP-HPLC analysis of semisynthetic Hb.2. Mass spectral analysis of semisynthetic α-globin of semisynthetic Hb isolated by

RP-HPLC (API-III Triple-Quadrupole Mass Spectometer, Perkin-Elmer Sciex®).3. Isoelectric focusing of semisynthetic Hb (using the instrument from Isolab).4. Hem-O-Scan or Hem-Ox-Analyzer, for analysis of O2 affinity of semisynthetic Hb.

3. Methods3.1. Preparation of α- and β-globin Chains from HbA and/orAnimal Hb

3.1.1. α- and β-HMB Chains of HbA or HbS

Reaction of HbA or HbS with HMB around pH 6.0 in the presence of200 mM NaCl generates HMB α- and β-chains (26), which can be separatedby CM-cellulose chromatography.

Reaction of HbA or its mutant or chemically modified forms with HMB iscarried out at a final concentration of 0.1 mM (6.5 mg/mL) in 20 mM phos-phate buffer, pH 6.0, and containing 200 mM NaCl. A stock solution of Hb,generally at a concentration of 2.5 mM, is diluted with distilled water to a con-centration of 0.2 mM (approx 12–15 mg/mL). When all the reagents are added,


and the pH is readjusted to 6.0, the volume of the reaction mixture is nearlydoubled and protein concentration will be approx 6.5 mg/mL. A volume of 1.0 Mphosphate buffer, pH 6.0, equivalent to one-fiftieth of the volume of the 0.2 mMHb solution is added to this solution. Similarly, an amount of 1.0 M NaCl in20 mM phosphate buffer, equivalent to one-fifth of the final volume (1:2.5with respect to the 0.2 mM Hb solution) of the reaction mixture is added to thissolution. Enough HMB, to make the final concentration of the reagent in thefinal reaction mixture 1.0 M, is dissolved in a minimum amount of 0.1 N NaOH.Once the reagent is completely dissolved, giving a clear solution, it is neu-tralized with 0.1 N acetic acid until a light whitish turbidity appears in thesolution; it should not precipitate. This freshly prepared HMB solution is addedcompletely to the Hb solution and mixed gently. The final volume of thereaction mixture is made up by adding water (the final concentration of Hb is0.1 mM in tetramer). The pH of the reaction mixture is adjusted to 6.0 withdilute acetic acid. The reaction mixture is kept on an ice bath in a cold roomovernight (generally 16–20 h).

After the overnight HMB reaction with Hb, generally some precipitation isseen in the reaction mixture. Such a precipitate is removed by centrifugingof the reaction mixture (7000 rpm for 20 min in a Sorval centrifuge at 4°C),and the supernatant, which contains the HMB α-and β-chains, is dialyzedagainst three changes of 10 mM phosphate buffer, pH 6.0. The sample is thenconcentrated to approx 50 mg/mL. The concentrated sample is chroma-tographed on a CM-cellulose column (0.9 × 30 cm), equilibrated to pH 6.0.The chromatogram is developed with a linear gradient generated from anequal volume of 10 mM phosphate buffer, pH 6.0 (starting buffer), and 15 mMphosphate buffer, pH 8.5 (final buffer). A 0.9 × 30 cm column can easily purifythe chains from a load of 200 mg of HMB-reacted Hb employing a gradientgenerated by 250 mL each of starting (10 mM phosphate buffer, pH 6.0) andfinal buffers (15 mM phosphate buffer, pH 8.5). Elution of the protein is moni-tored by following the absorption of the effluent at 540 nm. The HMB β-chainelutes first from the column, and the HMB α-chain elutes at the end of thegradient. The identity as well as the purity of the HMB chains as they elutefrom the CM-cellulose column are assessed by RP-HPLC of the samples(the HMB globin chains as well as the HMB-free globin chains elute at thesame position in RP-HPLC). The chromatographically purified HMB α-andβ-chains are pooled and concentrated and stored at –80°C until needed.

3.1.2. α-and β-Globin Chains of Hb

The heme-free α-and β-globin chains can be prepared from the respectiveHMB α-and β-chains by acid acetone preparation (27). Alternately, the α- andβ-globin chains can be prepared by CM-52 cellulose–urea column chromatography


(28) of the total globin prepared by the acid acetone precipitation of the Hbchosen for the study (see Note 4). In our experience, both methods yield globinchains that work well in the semisynthetic reaction. Since the HMB reaction ofanimal Hbs has not been successful in generating the α-and β-chains, we gener-ally follow CM-52 cellulose–urea column chromatography for preparation ofthe globin chains of animal Hbs.

3.1.2.1. ACID ACETONE PRECIPITATION OF TOTAL HB

Under strong acidic conditions, heme dissociates from the globin chain, andacetone precipitates the globin chains (27). Thus, the heme remains in solu-tion, and globin chains precipitate.

The protocol for the precipitation involves diluting of the Hb sample firstwith water to a concentration of about 10 mg/mL and keep it cold in an icebath. The Hb solution is transferred to Corex centrifuging tubes or flasks. Tothis Hb solution 10 vol of acid acetone is slowly added. Until the addition ofnearly 7 to 8 vol, the solution remains clear; afterward the addition of acidacetone results in precipitation of the protein as fluffy white material. Theremaining volume of the acid acetone is added to the solution while the solu-tion is mixed by using a glass rod. After the mixing of the Hb solution and acidacetone are completely mixed, the tube (or flask) is left in the ice bath for30 min. All the protein precipitates as fluffy material. The sample is centri-fuged to pellet down the precipitated globin. The supernatant, which is coloredbecause it contains the heme, is decanted and discarded. The globin pellet isredissolved in 0.1 M acetic acid (in a volume equivalent to that of the originalHb solution, 10 mg/mL), and the acid acetone protocol is repeated two or threetimes until no more heme is extracted into the acid acetone phase. The finalpellet of globin is dissolved in 0.1 M acetic acid (about 1 mg/mL) and lyo-philized. Globin lyophilizes as white fluffy material.

3.1.2.2. CM-52-CELLULOSE-UREA CHROMATOGRAPHY OF ACID ACETONE

PRECIPITATED GLOBIN

Thirty grams of CM-52 cellulose is first equilibrated with buffer A (50 mMphosphate buffer, pH 7.0, containing 8.0 M urea and 50 mM β-mercapto-ethanol). The equilibrated resin is packed into a 2.5 × 15 cm column and fur-ther equilibrated by washing the column with 5 bed vol of buffer A. Thiscolumn can resolve 150–200 mg of acid acetone–precipitated globin.

The lyophilized sample of acid acetone–precipitated globin is dissolved inbuffer A (10–15 mg/mL) and dialyzed against the same buffer (20 times overthe volume of the protein solution) for 3 to 4 h. This dialyzed sample is loadedonto the CM-52 column prepared fresh, and the protein sample is eluted with alinear gradient of buffers B and C (250 mL each). The protein elution is moni-


tored by measuring the optical density of the fractions at 280 nm. The protein-containing fractions are pooled and their identity is established by RP-HPLC.The pooled fractions containing α- and β-globins are dialyzed extensively toget rid of both the urea and the salts and then lyophilized. The lyophilizedmaterial is stored at –20°C until needed.

3.2. Preparation of α1–30 and α31–141 from Human and/orAnimal α-Globin Chains

The human α-globin is readily and quantitatively digested by V8 protease atpH 4.0 and 37°C to generate α1–30 and α31–141 (29). The animal α-globin is alsodigested in the same fashion (30,31).

3.2.1. V8 protease Digestion of Human or Animal α-Globin

The α-globin sample is taken in 10 mM acetate buffer, pH 4.0, at a concentra-tion of 0.5 mg/mL and placed in a 37°C water bath. When the α-globin solutionis equilibrated to 37°C , protease digestion is initiated by adding the requiredamount of V8 protease. A substrate-to-enzyme ratio of 200:1 (w/w) is used forthe digestion (2.5 µL of V8 protease solution [1 mg/mL]/1 mL of α-globin solu-tion). Aliquots of the reaction mixture are analyzed by RP-HPLC to determinecompletion of the digestion (Fig. 2, inset A). When the digestion is complete, theratio of the integrated area of α1–30 to α31–141 is nearly 1:3. Complete digestion ofα-globin takes nearly 1–3 h. Once digestion is complete, the digest is lyophilized.

3.2.2. Purification of Complementary Fragments of α-Globin

V8 protease digestion of 5–10 mg of α-globin has been routinely purified byour laboratory using RP-HPLC. A semipreparative Vydac C-4 column is usedfor such a purification. For a large-scale purification of the complementarysegments of α-globin, size-exclusion chromatography (SEC) on SephadexG-50 under denaturing conditions has been found very convenient.

The lyophilized digest of α-globin is dissolved in 0.1% TFA in water(20–30 mg/mL). This is loaded onto a Sephadex G-50 column (1.5 × 70 cm)equilibrated with 0.1% TFA, and size-exclusion chromatographic separationof the fragments is achieved by eluting the column with 0.1% TFA at a flowrate of 0.5 mL/min. A load of 100 mg of V8 protease digest of α-globin is wellresolved into complementary fragments in about 6 h. A typical purificationprofile of one such preparation is shown in Fig. 2. The identity and purity ofthe resolved complementary segments of α-globin can be established by RP-HPLC(Fig. 2, insets B and C). The fractions representing α1–30 and α31–141 are pooledand lyophilized. The purity of α31–141 is further established by tryptic digestion andRP-HPLC of the tryptic peptides. The absence of the tryptic peptides αT1, αT2,and αT3 in the tryptic digest establishes the purity of this fragment.


3.2.3. Chemical Synthesis of Mutant α1–30 Segment

The desired α1–30 segments with deletion/replacement/addition have alsobeen generated by chemical synthesis. The fragments that are chemically syn-thesized include α1–30 (H2OQ), α1–30 (K16E), and α1–30des23–26. Prior to usingthese synthetic peptides, they were subjected to purification by RP-HPLC usinga semipreparative column.

3.3. V8 Protease–Mediated Splicing of α1–30 Carrying DesiredStructural Modification with α31–141

Splicing of the desired complementary segments is carried out in 50 mMammonium acetate buffer (pH 6.0) containing 30% n-propanol. n-propanol

Fig. 2. Large-scale purification of α1–30 and α31–141 from a V8 protease digest ofhuman α-globin on a sephadex G-50 column (1.5 × 100 cm). The size-exclusion chro-matography was developed using 0.1% TFA. Elution of the complementary segmentsfrom the column was followed by monitoring the absorption of the fractions at 280 nm.The high molecular weight fraction (fraction a) has been identified as α31–14 (inset B)and the lower molecular weight fraction as α1–30 (inset C). (Inset A) The RP-HPLCpattern of the total V8 protease digest is shown. Insets B and C are the RP-HPLCpatterns of pooled fractions of a and b isolated from the Sephadex G-50 column.RP-HPLC analysis was carried out using a Vydac C4 column employing a linear gra-dient of 5–70% acetonitrile in 0.1% TFA in 130 min. The flow rate was 1 mL/min, andelution of the fragments was monitored at 210 nm.


induces α-helical conformation into the contiguous segments generatedthrough protease-mediated splicing (18). Other organic cosolvents, such aspropanediol and butanediol, are also suitable for the splicing reaction.

3.3.1. Splicing of α1–30 with α31–141

Nearly a 1.2-fold molar excess of α1–30 or its mutant form over the desiredα31–141 is mixed in 0.1% TFA and lyophilized to obtain a fluffy material. Thelyophilized material is taken up in 50 mM ammonium acetate buffer (pH 6.0)containing 30% n-propanol, and a clear solution should be obtained. If a clearsolution is not obtained with this level of organic solvent, the concentration ofn-propanol can be increased to obtain a clear solution. If this also does notfacilitate solubility of the mixture of the complementary segments, other organicsolvents such as propanediol or butanediol can be tried. The final concentrationof the complementary fragments is kept at about 10 mg/mL. The solution iskept at 4°C, and the semisynthetic reaction is initiated by adding the requiredamount of a stock solution of the V8 protease. An enzyme-to-substrate ratioof 1:200 is maintained in the reaction mixture. Progress of the ligation of thecomplementary segments is monitored by RP-HPLC analysis of the sample atdifferent time intervals. The decrease in the amount of α1–30 in the reactionmixture as a function of time reflects the progress of the splicing reaction.Nearly 50% of the α1–30 is spliced with α31–141 within the initial 24 h of thereaction. Nonetheless, the incubation is generally continued up to 48 h. Oncethe reaction attains equilibrium, the reaction mixture is lyophilized and storedat –20°C until further processing.

3.3.2. Purification of Unreacted α1–30 from Ligated and Unligated α31–141

The unreacted α1–30 in the reaction is generally recovered in order to subjectit to a second cycle of the splicing reaction. Recovery of the unreacted α1–30 isachieved by subjecting the lyophilized sample to an SEC on a Sephadex G-50column as described in Subheading 3.2.2. The unreacted α1–30 and the mix-ture of the semisynthetic chimeric α-globin and α31–141 are pooled separatelyand isolated by lyophilization. The α1–30 is subjected to a second round of thesplicing reaction using a new sample of α31–141 and processed similarly.

3.3.3. Purification of Semisynthetic α-Globin

The high molecular weight fraction from the SEC of the spliced sample onSephadex G-50 column is a mixture of α31–141 and the semisynthetic mutant orchimeric α1–141. The resolving power of size-exclusion chromatographiccolumn is not sufficient to resolve the two, and accordingly, both elute togetherfrom the column. However, semisynthetic α-globin can be purified by CM-52cellulose–urea column chromatography (28), as explained in Subheading


3.1.2.2. The fractions from the chromatography containing the purified chimericα-globin and α31–141 or mutant α1–141 are extensively dialyzed against 0.1%acetic acid and lyophilized. The lyophilized material is stored at –20C°.

3.4. Assembly of Semisynthetic Hb and its Purification

To generate a functional tetrameric molecule, the semisynthetic (chimeric)α-globin has to be assembled with the complementary β-chain in the presenceof heme (used as hemin dicyanide) (see Note 3). Depending on the objectivesof the investigation, we have assembled the semisynthetic α-globin with eitherβA- or βS-chains. For these assembly reactions, the alloplex intermediate path-way, originally developed by Yip et al. (25) is used. This protocol takes advan-tage of the propensity of the β-chains of Hb (with free thiols) to interactnoncovalently with heme-free α-globin to generate a tetramer, referred to asalloplex intermediate (only the β-chains of the tetramer containing heme).When hemin dicyanide is added to this, it occupies the heme-binding pocket ofthe molecule. The dithionite reduction of such a complex generates a func-tional tetramer.

3.4.1. Regeneration of the Sulfhydryl Groups of HMB β-Chain

The HMB βA- or βS-chain, as established by the experimental protocol, isdiluted into 50 mM Tris-HCl buffer, pH 7.4, containing 1 µg/mL of catalase,2 mM DTT, and 1 mM EDTA to get a solution of 5 mg/mL. This solution keptat 4°C for about 45 min. The DTT removes the HMB groups from the thiolgroup of Cys-residue, regenerating the free sulfhydryl group.

3.4.2. Regeneration of Sulfhydryl Groups of the Semisyntheticα-Globin

The semisynthetic α-globin is dissolved in 50 mM Tris-HCl buffer (pH 7.4)containing 8.0 M urea, 2 mM DTT, and 1 mM EDTA to get a solution of 5 mg/mL.This solution is incubated for 30–45 min at room temperature.

3.4.3. Preparation of Half-Filled Molecules (Alloplex Intermediate)

Half-filled molecules are prepared by slowly adding the α-globin and β-chainsolutions to the dilution buffer (50 mM Tris-HCl buffer, pH 7.4, containing1 mM DTT, 1 mM EDTA, and 1 µg/mL of catalase). The two solutions areadded to the dilution buffer (nearly 10 times the volume of the solution ofsemisynthetic α-globin) simultaneously with constant stirring at 4°C so thatthe urea concentration is lowered to 0.8 M. After the dilution, the final concen-tration of the protein is about 1 mg/mL (0.5 mg/mL of each chain). This mix-ture is incubated at 4°C for 30 min to facilitate the formation of half-filledmolecules.


3.4.4. Generation of Cyanomet Semisynthetic Hb

To the solution of half-filled molecules generated in Subheading 3.4.3., an equiva-lent amount of freshly prepared hemin dicyanide is added dropwise, to generate a1.1-fold molar excess of hemin dicyanide in solution over that of globin. This addi-tion is carried out with mild shaking of the sample. The reaction between hemindicyanide and half-filled molecules should then be allowed to proceed for about60 min at 4°C. This will generate the semisynthetic molecule in the cyanomet form.

This solution containing the cyanomet form of semisynthetic Hb is subjectedto an extensive dialysis against 50 mM Tris-Hcl buffer, pH 7.4. During dialy-sis, some amount of precipitation occurs. This is removed by centrifuging thesample at 4°C for 20 min at 7000 rpm. The clarified dialyzed sample is concen-trated by ultrafiltration to a concentration of 20 mg/mL.

3.4.5. Dithionite Reduction of Cyanomet Form of Semisynthetic Hb

The semisynthetic Hb generated in Subheading 3.4.4. is in the ferric state. Toconvert it to the ferrous state, the sample has to be reduced by either an enzy-matic procedure (32) or a chemical method (33). In our laboratory, we have rou-tinely used the sodium dithionite to reduce the methemoglobin sample (MetHb).This is done using a Sephadex G-25 column under anaerobic conditions.

Preswollen Sephadex G-25 column equilibrated with 10 mM phosphatebuffer, pH 7.0 is packed into a column (1.5 × 50 cm) and the column is equili-brated with 10 mM phosphate buffer (pH 7.0) that is constantly purged with N2

gas. Once the column is washed with 2 to 3 bed vol of the buffer, the dithionitesolution is freshly prepared. Sodium dithionite, approx 1.1 equivalents overthe semisynthetic α-globin used in the reconstitution, is dissolved in 10 mMphosphate buffer, pH 7.0, degassed with N2 gas. The volume used to dissolvethe sodium dithionite is equal to that of the semisynthetic cyanoMetHb solu-tion that needed to be reduced. This solution is placed on the top of theSephadex G-25 column very gently without disturbing the gel and allowed toenter the bed completely. Once the dithionite solution enters the column, thecolumn is washed with a volume of buffer (degassed with nitrogen) equivalentto that of the dithionite solution. The column is then loaded with semisyntheticcyanoMetHb. About 2 to 3 mL of 10 mM phosphate buffer, pH 7.0, previouslydegassed with nitrogen gas is used to rinse the top of the column, and the chro-matogram is developed with 10 mM phosphate buffer. During the elution, thebuffer tank is continuously purged with N2 gas. The effluent is collected as a1-mL fraction, and elution of Hb is monitored by measuring the absorption at540 nm. The fractions containing Hb are analyzed for the concentration ofMetHb. Samples of semisynthetic Hb containing <2 to 3% of the MetHb arepooled and concentrated by an ultrafiltration unit.


3.4.6. Chromatographic Purification of Semisynthetic Hb

The semisynthetic Hb is purified by CM-52 cellulose column chromatogra-phy. The chromatographic conditions used for the separation of HMB α- andβ-chains are also appropriate for purification of semisynthetic Hb. Chromatog-raphy is carried out on a column (0.9 cm × 30 cm) generally equilibrated with10 mM phosphate buffer, pH 6.5. The dithionide-reduced semisynthetic Hb isdialyzed against 10 mM phosphate buffer, pH 6.5, for just by couple of hoursin the cold, before loading onto the column. The column is developed using alinear gradient generated from 250 mL each of 10 mM phosphate buffer, pH 6.5,and 15 mM phosphate buffer, pH 8.5. Approximately 3.4-mL fractions are col-lected, and elution of the protein is monitored by measuring the absorption at540 nm. The fractions containing protein are analyzed by RP-HPLC to estab-lishing the identity of assembled semisynthetic Hb. The fractions containingsemisynthetic Hb are pooled and concentrated by ultrafiltration.

3.5. Chemical and Functional Characterization of Semisynthetic Hb

The semisynthetic Hb thus generated has to be subjected to (1) RP-HPLCanalysis of the globin chains, (2) mass spectral and/or tryptic peptide mappinganalysis of the semisynthetic α-globin chain isolated from the RP-HPLC runsof the semisynthetic Hb, (3) isoelectric focusing analysis of the tetramer, and(4) analysis of the functional properties of the semisynthetic Hb. The methodsfor each of these are not discussed here. The reader should refer to Chapters 2,3, and 6 for further details.

4. Notes1. Site-directed mutagenesis is a powerful tool for protein design and engineering.

However, the protein chemists’ desire is to expand the range of the modificationof the covalent structure of proteins by incorporating unnatural amino acids intothe protein or by introducing unique rigid elements of three-dimensional struc-ture into the protein. Since only limited variations in the amino acid side chainsare possible through genetic approaches, the search for innovative approachesfor construction of proteins has continued. Protease-mediated semisynthesis ofproteins is one such approach. Such approaches, however, are generally veryspecific to a given protein system. The α-globin semisynthetic approach dis-cussed here has been very useful system in the study of structure-function rela-tionships in Hb, particularly in exposing the synergy of the intermolecularcontacts of deoxyHb polymer (24).

2. HMB is a light sensitive material. Accordingly, while preparing the HMB solu-tion, it is necessary to avoid exposing the reagent to direct light. After adding theHMB solution to the Hb solution and adjusting of the pH to 6.0 (see Subheading3.1.1.), the flask containing the reaction mixture is wrapped with aluminum foil,to avoid any further decomposition of the reagent during the overnight reaction.


3. Extreme care should be exercised during preparation of hemin dicyanide (seeSubheading 2.4.) and handling of the hemin dicyanide solution (see Subhead-ing 3.4.). Hand gloves should be used during these procedures, to avoid any con-tact of cyanide with the body. All the solutions are prepared in a fume hood.

4. Urea solutions for the CM-52 urea chromatography must be prepared freshlywith good-quality urea. The ultrapure molecular biology–grade material fromSigma is used in all our studies. The pH of all the urea-containing solutions mustbe adjusted with dilute phosphoric acid after complete dissolution of the urea andbefore adding β-mercaptoetanol to the solution. Use fume hoods when workingwith β-mercaptoethanol. The addition of mercaptoethanol will not affect the pHof the buffer. The slurry of the CM-52 cellulose must be prepared with urea-containing buffer a couple of hours before use, and this preparation cannot bestored for further use. We generally run the CM-52 urea chromatography inside afume hood.

References1. Mathews, B. W. (1993) Structural and genetic analysis of protein stability. Ann.

Rev. Biochem. 62, 139–161.2. Smith, M. (1994) Synthetic DNA and biology. Angew. Chem. Int. Ed. Eng. 33,

1214–1221.3. Hecht, S. M. (1992) Probing the synthetic capabilities of a center of biochemical

catalysis. Acc. Chem. Res. 25, 545–555.4. Mendel, D., Cornigh, V. W., and Schultz, P. G. (1995) Site directed mutagenesis

with an expanded genetic code. Annu. Rev. Biophys. Biomol. Struct. 24, 435–462.5. Gutte, B. and Merrifield, R. B. (1969). The total synthesis of an enzyme with

ribonuclease A activity. J. Am. Chem. Soc. 91, 501, 502.6. Hoffman, K., Kisser, J. P., and Finn, F. M. (1969) Studies of Polypeptides: XLII

Synthesis of S-peptide1–20 by two routes. J. Am. Chem. Soc. 91, 4883–4887.7. Anfinsen, C. B. and Scheraga, H. A. (1975) Experimental and theoretical aspects

of protein folding. Adv. Protein Chem. 29, 205–294.8. Richards, F. M. and Vithayathil, P. J. (1959) The preparation of subtilisin modi-

fied ribonuclease A and the separation of peptide and protein component. J. Biol.Chem. 234, 1459–1465.

9. Tanuichi, H., Parr, G. R., and Juillerat, M. A. (1986) Complementation in foldingand fragment exchange. Methods Enzymol. 131, 185–217.

10. Vita, C., Dalzoppa, D., and Fontana, A. (1985) Limited proteolysis of thermolysineby subtilisin: Isolation and characterization of partially active enzyme derivative.Biochemistry 24, 1798–1806.

11. Wallace, C. J. (1995) Pepide ligation and semisynthesis. Curr. Opin. Biotechnol.6, 403–410.

12. Homandberg, G. A. and Laskowski, M. (1979) Enzymatic synthesis of the hydro-lyzed peptide bond(s) of ribonuclease S. Biochemistry 18, 586–592.

13. Wallace, C. J. (1993) Understanding cytochrome C function: engineering proteinstructure by semisynthesis. FASEB J. 7, 505–515.


14. Wallace, C. J. (1993) The curious case of protein splicing: mechanistic insightssuggested by protein semisynthesis. Protein Sci. 2, 697–705.

15. Ni, X. and Schachman, H. K. (2001) In vivo assembly of aspartate transcarbamy-lase from fragmented and circularly permutated catalytic polypeptide chains. Pro-tein. Sci. 10, 519–527.

16. Proudfoot, A. E., Rose, K., and Wallace, C. J. (1989). Conformation directedrecombination of enzyme activated peptide fragments: a simple and efficientmeans to protein engineering: its use in the creation of cytochrome C analogs forstructure function studies. J. Biol. Chem. 264, 8764–8770.

17. Kullman, W. (1987) Enzymatic Peptide Synthesis, CRC, Boca Raton, FL.18. Sahni, G., Cho, Y., Iyer, K. S., Khan, S., Seetharam, R., and Acharya, A. S. (1989)

Synthetic hemoglobin A: reconstitution of functional tetramers from semisyntheticα-globin. Biochemistry 28, 5456–5461.

19. Roy, R. P., Khandke, K. M., Manjula, B. N., and Acharya, A. S. (1992) Helixformation in the enzymatically ligated peptides as a driving force for the syntheticreaction. Biochemistry 31, 7249–7255.

20. Sahni, G., Khan, S., and Acharya, A. S. (1998). Chemistry of the ‘Molecular Trap’of protease catalyzed splicing reaction of the complementary segments of α-subunitof hemoglobin A. J. Protein Chem. 17, 669–678.

21. Roy, R. P., Nagel, R. L., and Acharya, A. S. (1993). Molecular basis of the inhibi-tion of βS chain polymerization reaction by mouse α-chain: semisynthesis of chi-meras of human and mouse α-chains. J. Biol. Chem. 268, 16,406–16,412.

22. Nacharaju, P., Roy, R. P., White, S. P., and Acharya, A. S. (1997). Inhibition ofsickle β-chain (βS) chain dependent polymerization by non-human α-chain: a superinhibitory mouse-horse chimeric α-chain. J. Biol. Chem. 272, 27,869–27,876.

23. Rao, M. J., Malavalli, A., Manjula, B. N., Kumar, R. Prabhakaran, R., Sun, D. P.,Ho, N. T., Ho, C., Nagel, R. L., and Acharya, A. S. (2000) Interspecies hybridHbS: complete neutralization of Val-6(β) dependent polymerization of humanβ-chain by pig α-chain. J. Mol. Biol. 300, 1389–1406.

24. Srinivasuslu, S., Malavalli, A., Prabhakaran, M., Nagel, R. L., and Acharya, A. S.(1999) Inhibition of βS chain dependent polymerization by synergistic comple-mentation of contact site perturbations of α-chain: application of chimeric α-chain.Protein Eng. 12, 1105–1111.

25. Yip, K. Waks, M., and Beychock, S. (1977). Reconstitution of native human he-moglobin from separated globin chains and alloplex intermediates. Proc. Natl.Acad. Sci. USA 74, 64–69.

26. Bucci, E. (1981) Preparation of isolated chains of human hemoglobin. MethodsEnzymol. 76, 97–106.

27. Rose-Fanelli, A., Antonini, E., and Caputo, A. (1958) Studies on the structure ofhemoglobin: 1. Physicochemical properties of hemoglobin. Biochem. Biophys.Acta. 30, 608–615.

28. Clegg, J. B., Naughton, M. A., and Weatherall, D. J. (1966). Abnormal hemoglobins:separation and characterization of the α and β chains by chromatography and determi-nation of two variants, Hb-Chesapeak and HbJ (Bangkok). J. Mol. Biol. 19, 91–108.


29. Iyer, K. S. and Acharya, A. S. (1987) Conformational studies of α-globin in1-propanol: propensity of the alochol to limit the sites of proteolytic cleavage.Proc. Natl. Acad. Sci. USA 84, 7014–7018.

30. Roy, R. P., and Acharya, A. S. (1994). Semisynthesis of hemoglobin. MethodsEnzymol. 231, 194–215.

31. Nacharaju, P. and Acharya, A. S. (000) Hemoglobin semisynthesis, in Semi-synthesis of Proteins, (Wallace, C. J., ed.), CRC, Boca Raton, FL, pp. 151–198.

32. Hayashi, A., Suzuki, T., and Shin, M. (1973). An enzymatic reduction system formet myoglobin and met hemoglobin and its application to functional studies ofoxygen carriers. Biochim. Biophys. Acta. 310, 309–316.

33. Dixon, H. B. F. and McIntosh, R. (1967) Reduction of met hemoglobin hemoglobinsamples using gel filtration for continuous removal of reaction products. Nature213, 399,400.

β-Globin-like Gene Cluster Haplotypes 195

12

195


β-Globin-like Gene Cluster Haplotypesin Hemoglobinopathies

Shanmugakonar Muralitharan, Rajagopal Krishnamoorthy,and Ronald L. Nagel

1. IntroductionThe pioneering work of Kan and Dozy (1) revealed by restriction endonu-

clease mapping a genetic variation in an HpaI recognition site about 5000nucleotides from the 3' end of the β-globin gene. Instead of a normal 7.6-kbfragment containing the β-globin gene, 7.0- and 13.0-kb variants were detectedand were found in African Americans, Asians, and Caucasians. The 13.0-kbvariant (HpaI+) was frequently associated with the sickle hemoglobin (Hb)mutation. Kan and Dozy (1) predicted that polymorphisms in a restrictionenzyme site could be considered a new class of genetic marker and may offer anew approach to linkage analysis and anthropological studies. Based on lim-ited data (2), they reported that linkage to the wild-type HpaI-positive site wascharacteristic of West Africans while an HpaI-negative site typified East Afri-cans. This finding did not show definitively that the mutation had occurred intwo different chromosomal backgrounds, because a secondary mutation at theHpaI site could have postdated the sickle mutation.

Orkin (3) demonstrated in samples from three regions of Africa that thedistribution of the HpaI linkage disequilibrium was more complex. An HpaIpolymorphism was territorially segregated in Africa in three geographical loca-tions (4). Atlantic West Africa and Bantu-speaking Central Africa had HpaI-negative -linked βS genes, while Central West Africa had HpaI-positive-linkedβS genes. This observation increased the possibility that the βS mutation couldhave been multicentric in origin. Nevertheless, it would still be possible, albeitwith diminishing probability, that these mutations occurred after the sickle

196 Muralitharan et al.

mutation. The next stage of this development came when Mears et al. (5)developed the concept of globin haplotype based on a series of restrictionendonuclease–defined polymorphisms in and around the β-globin-like genecluster.

In these studies, DNA sequence differences in the β-globin gene clusteramong different individuals were detectable by restriction enzymes that fail tocut DNA if the enzyme target sequence is not exactly correct. Pagnier et al. (6)used haplotypes to link different thalassemia mutations to particular haplotypeswith the hope that haplotypes could serve as diagnostic tools. This approachwas not totally successful since it rapidly became evident that more than onethalassemic mutation was linked to the same haplotype and that more than onemutation was linked to the same mutation. Nevertheless, the effort to under-stand the relationship between thalassemia and β-globin-like gene clusterhaplotypes stimulated others to apply this technique to detect the origins of thesickle mutation.

A breakthrough in this quest came when 11 restriction sites were examined(7) to define haplotypes in sickle cell (SS) anemia patients from three regionsin Africa previously studied by Mears et al. (5,6). This work established thatthe βS-globin gene was present on three distinctly different chromosomes. Eachwas identifiable by its specific array of DNA polymorphism haplotypes, andeach was localized exclusively to one of the three separate geographical areas:Atlantic West Africa, Central West Africa, and Bantu-speaking Central andSouthern Africa. Hence, the βS gene in Africa is principally distributed aroundthese three main geographical locations, each exhibiting a center of very highfrequency surrounded by regions of declining frequencies. The conclusion fromthese findings was that the βS gene originated independently at least three timeswith subsequent expansion of the frequency of the abnormal gene in each ofthese geographical areas (8).

The strongest argument for this interpretation is the geographical segrega-tion of these distinct haplotypes with only haplotype associated with the βS

gene in each of these locales. Typical haplotypes, such as low-frequencyhaplotypes different from the major haplotypes associated with the βS gene, areall explainable by crossing-over events around a “hot spot” of recombination 5'to the β-globin gene (9). Differences between atypical and typical haplotypesof each geographical area are generally found in the region 5' to this “hot spot”(10). This picture has gotten more complex with more recent findings, as dis-cussed later. In addition to the three major haplotypes linked to the βS gene, afourth minor African haplotype, the Cameroon (described later) has been foundto be a “private” haplotype restricted to the Eton ethnic group, indicating afourth independent origin of the HbS gene in Africa (11). In this group, theCameroon haplotype reached polymorphic frequencies, but expansion beyond


the original ethnic group did not occur. Further evidence regarding the sepa-rate origin of the three major haplotypes linked to the βS-globin gene camefrom the studies of Chebloune et al. (12) on variable repeats of the ATTTTmotifs found about 1.5 Kb 5' to the β globin gene and the AT repeats (followedby T runs of different size) found about 0.5 kb 5' of the β-globin gene. EarlyDNA sequencing in this region suggested that these repeats were polymorphic.Chebloune et al. (12) found that ATTTT repeated either four or five times with(AT)X TY probes having X = 7 or 11 and Y = 7 or 3. Their results were comple-mented by sequence data from –1080 bp 5' to the cap site of the β-globin gene.It is apparent that the combination of these polymorphic areas is unique foreach haplotype, supporting the independent origin of the Arab-Indian haplo-type found today among the tribals of India and among Arabs living in theeastern oasis of Saudi Arabia and in Oman.

1.1. β-Globin-like Gene Cluster Haplotypes in Biology, Medicine,and Anthropology

Haplotypes of the β-globin-like clusters have been used for the followingpurposes:

1. To provide anthropological correlations: They have been used to give evidenceof and/or define the common origin and the likelihood of an ancestral home forthe tribals of India (13) and their potential origin in the Harappa culture, in themargins of the Indus River; to give a biological basis to the linguistical basis ofthe Bantu expansion hypothesis in Africa (8); and determine the Indian tribalorigin and east African origin of the sickle gene, respectively, in Indian and Afri-can inhabitants of Mauritius Island (14).

2. To provide a source of clinical diversity among SC patients: Evidence exists thatthe linkage of the βS gene to the Senegal and Arab Indian India haplotypes isassociated with higher expression of HbS in SS and more benign hematologicalprofile (15–17). Conversely, the Bantu haplotype has the most severe course (18).

1.2. Study of Gene Flow

1.2.1. Slave Trade–Based Gene Flow of Sickle Gene to America

Strikingly, of more than 20 haplotypes associated with the βS-globin gene inJamaica whose population was generated by forced African migration from allover Africa to the Americas, the three haplotypes described in Africa (7) com-prised more than 95% of the cases (19,20). This demonstrated that the threegeographically segregated haplotypes were the major βS-linked haplotypes inAfrica and suggested that the rest might represent “private” haplotype linkagesrepresented by fresh mutations, gene conversion, or more classic crossing-overevents around the putative hot spot 5' to the β-globin gene. Nevertheless, since


Jamaica was populated from Africa, these three major haplotypes and otheratypical haplotypes have coexisted only since the eighteenth century limitingthe potential for the suggested crossing-over events.

1.2.2. Determination of the African Origin of Sickle Mutation in Sicily (21)

The question had been raised whether the sickle mutation was autochtho-nous to Sicily or was imported by gene flow from Africa. The haplotype analy-sis demonstrated that the sickle mutation was linked to the Benin haplotypewhich is characteristic of the African population of central west Africa. Never-theless, using an “African marker” located between the two gamma genes, itwas possible to ascertain that the incidence of this polymorphism was less than1% of the Sicilian population, hence the sickle gene was imported in smallnumbers to Sicily from Africa and latter expanded by the selective pressure ofp. falciparum malaria.

1.2.3. Expansion of the Sickle Gene in Middle East Duringthe Sassanian Empire (22)

The presence of the Arab-India haplotype in the populations of the Arabianpeninsula reinforces the hypothesis that this particular mutation originated inthe Harappa culture or in a nearby population and, in addition, reveals that theSassanian Empire might have been the vehicle by which this Indo-Europeansickle mutation migrated (gene flow) to the present-day Arabian peninsula (22).More recently, it has been established that the sickle gene is linked to the Arab-India haplotype in Central Iran, giving further support to this hypothesis (23).

Recent sickle gene flow studies have included Venezuela, Southern Tunisia,the Medenka population in Senegal, Colombia, United Arab Emirates,Guadaloupe (FWI), the Afro-Brazilian population from the Amazon region,Madagascar, Cuba and Guinea (Conackry) (23,24).

1.3. Biochemical Inquiries of Mechanisms Involved in Diversityof Haplotype/Phenotype Associations

Gilman and Huisman (35) proposed that the -158 site 5' to the G γ gene(detected by XmnI + site) determines the G γ expression after the first 4 mo oflife. DNA from SS patients from Africa and β-thalassemic homozygotes fromAlgeria demonstrated that the XmnI site is strongly linked to the Senegal hap-lotype among SS patients, to haplotype IX (most probably identical to theSengal haplotype), and to haplotype III among the Algerian thalassemics(36,37). It was concluded that, although highly correlated, the –158 C→T sub-stitution does not perfectly predict the presence of high G γ expression.

Further study of the relationship between these markers and Fetal hemoglo-bin (HbF) expression judged by F-cell levels in unrelated nonanemic AS het-


erozygotes from Sicily, all linked to the Benin haplotype and differing only bytheir βA chromosomes, were informative (38). F-cell expression was morestrongly associated with LCR-HS2 polymorphism than with XmnI polymor-phism. The observed association between XmnI polymorphism and HbF expres-sion is very likely owing to linkage disequilibrium with LCR-HS2 sequences. Itis clear that the expression of HbF is under polygenic control involving determi-nants both linked and unlinked to the β-globin gene cluster on chromosome 11.

1.4. Haplotype Studies of Other Hemoglobinopathies

Haplotypes have allowed determination of the unicentric origin of HbC inAfrica, with its epicenter in Burkina-Faso (39), although isolated appearancesof this mutation elsewhere have been linked to different haplotypes. In addi-tion, correlations between the phenotype and the haplotype have been reportedin SC patients (double heterozygotes for HbC and HbS) (40). Extensive studiesof haplotype definition in different thalassemic mutations have been studied indifferent ethnic groups (41–51).

1.5. Miscellaneous Haplotype Research Applications

From the panoply of applications of haplotype research there are some recentinteresting findings that merit mention: HbG-Coushatta [β-22 (B4) Glu→Ala]is found in the Silk Road region of China but is also present in the North Ameri-can Coushatta Indians, and a commonality of origin was suspected. Neverthe-less, haplotype studies revealed that the Chinese and Louisiana Coushatta haddifferent haplotypes associated with the identical HbG mutation (52). On theother hand, the strong previous evidence of the connection between Amerindianpopulations and Asian populations has been further strengthened by β-globingene cluster haplotype analysis of the Huichol Indians of Mexico (53). Haplo-type analysis with grouped worldwide populations showed Native Americansas the population closest to the Huichols, followed by Pacific Islanders andAsians. Present observations are consistent with an important Asian contribu-tion to the Huichol genome in this chromosomal region.

The relationship between growth in children with SS and the differentβ-globin haplotypes, as well as components of the insulin-like growth factor(IGF)/IGF-binding protein (IGFBP) axis, has been studied (54). Patients withthe Bantu/Bantu haplotype had significantly lower mean growth velocity com-pared with those with Ben/Ben, and total IGF levels in Bantu/Bantu patientswere also lower compared with the Ben/Ben genotype. A positive correlationwas found between hematocrit and total IGF-1 and between HbF percentagesand the Z-scores for total IGF-1 and IGFBP-3. These interactions suggest thatthe delayed growth of these patients may be linked to the low circulatingconcentrations of the various elements of the GH/IGF-laxis, and that the


decrease in total IGF-1 concentrations in patients with Bantu/Bantu haplotypeis secondary to the severity of the disease associated with this haplotype.

HbF modulates the phenotypic diversity of SS, and the prevalence of manydisease complications are related to the level of HbF. Hydroxyurea increasesHbF levels in many patients. While the beneficial effects of hydroxyurea areprobably the product of many factors, modulation of γ-globin gene expressionis only one of them. In a multicenter trial of hydroxyurea (55), F-cellsincreased in HU-treated patients compared with control subjects, and theincreases in the HbF level at 2 yr were greatest in patients who had the highestbaseline counts of reticulocytes and neutrophils, two or more episodes ofstudy-defined myelotoxicity, and absence of a Bantu haplotype.

The Senegal haplotype is associated with higher expression of HbF inchildren with sickle cell anemia, compared to the Benin and Bantu haplotypes.Finally, the almost 500 publications that include β-gene-like cluster haplotyperesearch, since its first description, attest to the variety of applications of thistechnology.

2. Materials1. Whole blood collected in an anticoagulant (EDTA)-coated tube.2. NH4Cl.3. NH4HCO3 (Sigma, St. Louis, MO).4. NaCl.5. EDTA.6. Triisopropylnaphthalene sulfonic acid (TPNS).7. Butanol.8. Sodium dodecyl sulfate (SDS).9. Tris-HCl.

10. Phenol.11. Chloroform.12. Octanol.13. Ethanol.14. RNase A.15. Spectrophotometer (Pharmacia).16. Oligonucleotides.17. Taq DNA polymerase.18. dNTP mix (dA, dG, dC, dT).19. Thermal cycler (Perkin Elmer).20. Agarose.21. TAE Buffer (Tris-acetic acid-EDTA).22. Restriction enzymes.23. Water bath.24. Refrigerated centrifuge.


3. MethodsThe methods detailed here pertain to the analysis of genetic variation by

restriction endonuclease polymorphism in the β-globin gene that defines a par-ticular haplotype. The methods consist of genomic DNA extraction, poly-merase chain reaction (PCR) amplification of β-globin gene, and restrictionenzyme digest analysis of the β-globin gene.

3.1. Genomic DNA Extraction

The first step in haplotype analysis is the preparation of high molecularweight chromosomal DNA from the nucleated white blood cells (WBCs) fromthe patient’s whole blood; it is described in Subheadings 3.1.1–3.1.9. The pro-cedure includes preferential lysis of red blood cells (RBCs), lysis of WBCs,phenol chloroform extraction, and ethanol precipitation (see Note 1).

3.1.1. Lysis of RBCs

1. Centrifuge whole blood collected in an anticoagulant (EDTA)-coated tube at lowspeed (2000g) for 15 min in a refrigerated centrifuge (4°C).

2. Carefully decant the supernatant to avoid the loss of WBCs. After approximateestimation of the volume of the RBC pellet, add five times of RBC lysis solution(1.5 mM NH4Cl and 0.5 mM NH4HCO3).

3. Gently invert the tubes several times and incubate on ice for 10 min.4. Centrifuge the mix at 2000g for 15 min and decant the lysed RBCs.5. Repeat the lysis procedure until the pellet is white. The WBC pellet is ready for

immediate DNA extraction or can be stored for several months at –70°C.

3.2.1. Lysis of WBCs

1. Resuspend the WBC pellet red in WBC lysis solution (0.15 M NaCl and 0.1 MEDTA, pH 10.5).

2. Approximately 0.8 mL for a pellet from 10–15 mL of whole blood.3. Add 1 mL of WBC lysis solution (6% TPNS, 8% 2-butanol, and 3% SDS). Com-

plete lysis of WBC is judged by the progressive increase in viscosity.

3.2.2. Phenol-Chloroform Extraction

1. Add an equal volume of neutralized phenol to the WBC lysate.2. Mix very well and centrifuge at 2000g for 10 min.3. Recover the aqueous phase.

3.1.4. Octanol Extraction of Chloroform

1. Add an equal volume of a mixture of chloroform:octanol (24:1), mix very well,and centrifuge at 2000g for 10 min.

2. Recover the aqueous phase.


3.1.5. Precipitation of DNA

1. To the aqueous phase, add approx 5 vol of cold absolute ethanol. As the ethanolis being added, the DNA fibers solve out of the solution and are visible.

2. Spool out the filamental DNA using a glass Pasteur pipet.3. Air-dry the retrieved DNA and suspend in 1 mL of TE buffer (10 mM Tris-HCl,

1 mM EDTA, pH 7.4).4. Allow the high molecular weight DNA to dissolve completely in a rotating wheel

for 6–8 h.

3.1.6. Removal of RNA and Protein Contaminants

1. Mix the dissolved DNA with an appropriate volume of 20X saline sodium citrate(SSC) to reach a final concentration of 2X SSC.

2. Add RNase A to a final concentration of 50 µg/mL and incubate at 37°C for 1 h.3. Add 20% SDS to a final concentration of 0.1%, and then add proteinase K to a

final concentration of 120 µg/mL and incubate at 37°C for 3 h.

3.1.7. Cleaning of DNA

1. After proteinase K digestion, ethanol precipitate the DNA again as in Subhead-ing 3.1.5. Resuspend the DNA in TE buffer as in Subheading 3.1.5., step 4.

2. Extract the dissolved DNA with phenol and chloroform/octanol as in Subhead-ing 3.1.4.

3. After ethanol precipitation and drying the DNA pellet, dissolve the pellet in TEbuffer.

3.1.8. Quantitation of DNA

1. After the DNA is completely dissolved in TE buffer, make up a dilution (e.g.,2 µL in 300 µL).

2. Read the optical density (OD) in an ultraviolet (UV) spectrophotometer at 260and 280 nm. One OD of DNA at 260 nm corresponds to a concentration of 50 µg/mL.An OD260/OD280 ratio in the range of 1.6–2.0 represents a clean DNA with lesscontaminants.

3.1.9. Agarose Gel Electrophoresis

1. Analyze the quality of the DNA in a 0.8% agarose gel with TAE buffer (Fig. 1).2. Dissolve 0.8 g of agarose in 100 mL of 1X TAE buffer.3. Boil this mixture in a microwave oven.4. After cooling the melted agarose, add 0.5 mg/mL of ethidium bromide and mix well.5. Pour the gel in a gel-casting tray with a comb.6. After the gel is set (15 min), immerse the gel in 1X TAE buffer in the gel tank.7. Mix 5 µL of extracted DNA with the loading dye and apply on the gel.8. Carry out electrophoresis at 100 V using a power pack.9. After electrophoresis, visualize the gel in a UV transilluminator.


3.2. β-Cluster Haplotype Determination by PCR

PCR is a powerful technique in which the target DNA is amplified in vitroexponentially through the enzymatic action of DNA polymerase for specificamplification of a DNA region. The chemical reaction is based on the anneal-ing and extension of two oligonucleotide primers that flank the target region induplex DNA. The method employs repeated cycles of denaturation (95°C),annealing at 50–64°C of oligonucleotide primers to the target DNA, and enzy-matic primer extension (72°C) to amplify the DNA flanked by the primers. Ineach subsequent cycle, the amplification product serves as a template, andhence the process is exponential.

The primary step in haplotype analysis is the PCR amplification of theβ-globin gene by using specific oligonucleotides (see Note 2). This includesPCR reaction, analysis of the PCR product in an agarose gel with 1X TAEbuffer, restriction enzyme digestion of the PCR product, and analysis of therestriction digest in agarose gel.

Fig. 1. Analysis of extracted genomic DNA in 0.8% agrose gel with 1X TAE buffer.Lane 1, λ HindIII marker.


3.2.1 PCR Amplification of β-Globin Gene

The β-globin gene cluster consists of a DNA region of 60 kb encompasingsix different β-globin-like genes (Fig. 2): (starting from the 5' end of the cluster)the embryonic ε-globin gene, two fetal Gγ- and Aγ-globin genes, the pseudog-ene (Ψβ), and the adult δ- and β-globin genes. As in the case of the α-globingenes, the β-globin genes share the same configuration with 3 exons (peptide-encoding regions) and 2 introns (intervening sequences). Both Gγ and Aγpolypeptides are identical with the exception of a single amino acid at position136, which is alanine (Aγ) in Aγ, while it is glycine (Gγ) in Gγ.

For haplotype analysis, a series of polymorphic sites in the β-globin gene isamplified, the success of the PCR reaction is confirmed by agarose gel electro-phoresis analysis of the PCR product, and the polymorphisms are identified byrestriction endonuclease enzyme cleavage (Figs. 3 and 4) (Table 1). A standardPCR reaction consists of the following components to a final volume of 50 µL(see Note 3): 5 µL of 10X PCR buffer, 1 µL (10 pm/µL) of forward primer,1 µL (10 pm/µL) of reverse primer, 0.25 µL (25 mM) of dNTP mix, 1.5 mM(25 mM) MgCl2, 1 µL (100 ηg) of DNA, 0.25 µL (5 U/µL) of Taq polymerase,and 40 µL of H2O. A standard PCR cycling condition consists of the fol-lowing steps: 94°C for 5 min; 94°C for 30 s; 55°C for 1 min; 72°C for 45 s;72°C for 7 min.

3.2.2. Restriction Enzyme Digest Analysis

For restriction enzyme analysis, 10 µL of the PCR product is used. A standardrestriction enzyme analysis consists of the following components to a final vol-ume of 15 µL (see Note 4): 10 µL of PCR product, 1 µL (10 U) of restrictionenzyme, 1.5 µL of 10X buffer, and 2.5 µL of H2O. This mixture is incubated at37°C for a minimum period of 3 h. After the incubation is complete, the restric-tion analysis is carried out in an agarose gel electrophoresis with 1X TAE buffer.

4. Notes1. During ethanol precipitation of the DNA, in most of the samples you can very

easily observe that the nucleic acid is precipitated and floats like a fiber. In somesamples, the DNA is not visible because of the poor yield owing to partial lysis ofthe leukocytes. In these samples, it is absolutely necessary that the samples be

Fig. 2 Organization of β-globin gene cluster.


Fig. 3. Analysis of restriction enzyme digests (HincII and HindIII) in agarose gelwith 1X TAE buffer. +/+, presence of the restriction site in both chromosomes(homozygous). -/-, absence of the restriction site.

Fig. 4. Diagrammatic representation of different β-globin-like gene clusterhaplotypes.

206M

uralitharan et al.

Table 1Primer Sequences for Different Polymorphic Sites

AnnealingRestriction Product Absence Presence temperature site Primer sequence (5'–3') size (bp) of site (bp) of site (bp) (°C)

HincII ε TCT CTG TTT GAT GAC AAA TTC 760 760 446 + 314 58AGT CAT TGG TCA AGG CTG ACC

XmnI Gγ AAC TGT TGC TTT ATA GGA TTT T 655 655 450 + 205 54AGG AGC TTA TTG ATA ACT CAG AC

HindIII Gγ AGT GCT GCA AGA AGA ACA ACT ACC 328 328 91 + 237 65CTC TGC ATC ATG GGC AGT GAG CTC

TaqI CCT GAC CAG GAA CCA GCA GA 960 960 753 + 207 64CTT ATC GGA GGC AAG CTG TAT CT

HindIII Aγ TGC TGC TAA TGC TTC ATT ACA A 761 761 435 + 325 65TAA ATG AGG AGC ATG CAC ACA C

HincII 5'ψβ TCC TAT CCA TTA CTG TTC CTT GAA 794 794 104 + 690 64ATT GTC TTA TTC TAG AGA CGA TTT

HincII 3'ψβ TCT GCA TTT GAC TCT GTT AGC 620 620 540 + 80 54GGA CCC TAA CTG ATA TAA CTA

RsaI 5' β ACT CCC AGG AGC AGG GAG GGC AGG 1152 413 + 644 + 95 331 + 82 + 644 + 95 65TTC GTC TGT TTC CCA TTC TAA ACT

β-HinfI AGT AGA GGC TTG ATT TGG AGG 638 336 + 302 123 + 213 + 302 58GTT AAG GTG GTT GAT GGT AAC

206


kept in –20°C for 1 h and then centrifuged at 2000g to pellet the DNA. Aftercentrifugation, the aqueous phase is removed and the DNA pellet is dried.

2. Different polymorphic sites in the β-globin gene cluster are amplified by usingappropriate pair of primers. The annealing temperature of the particular pair ofprimers depends on the sequence composition of the primers. Care should be takento set up the PCR cycling condition with an appropriate annealing temperature.

3. Each PCR reaction is standardized by varying the concentration of MgCl2, dNTPand Taq polymerase. Based on the standardization, an optimum concentration ofthe different components of the PCR is decided for the final reaction. The finalvolume of the PCR reaction can be changed into different volumes such as 25and 10 µL and the different components of the PCR reaction are used in an appro-priate concentration ratio to the final volume.

4. Usually, restriction enzyme analysis is carried out according to the conditionsprovided by the enzyme’s manufacturer. For example, some enzymes need bo-vine serum albumin in the reaction (0.1%). The optimum incubation temperaturefor most of the restriction enzymes is 37°C, but some enzymes need to be incu-bated at a higher temperature. The appropriate reaction conditions and the opti-mum temperature are usually given in the manufacturer’s instructions.

References1. Kan, Y. W. and Dozy, A. M. (1978) Polymorphism of DNA sequence adjacent to

human β-globin structural gene : relationship to sickle mutation. Proc. Natl. Acad.Sci. USA 75, 5631–5635.

2. Kan, Y. W. and Dozy, A. M. (1980) Evolution of the hemoglobin S and C genes inworld populations. Science 209, 388–391.

3. Orkin, S. H. (1978) Selective restriction endonuclease cleavage of human globingenes. J. Biol. Chem. 253, 12–15.

4. Orkin, S. H., Kazazian, H. H., Antonarakis, S. E., Goff, S. C., Boehm, C. D.,Sexton, J. P., Waber, P. G., and Giardina, P. J. (1982) Linkage of β-thalassaemiamutations and beta-globin gene polymorphisms with DNA polymorphisms in hu-man β-globin gene cluster. Nature 296, 627–631.

5. Mears, J. G., Beldjord, C., Benabadji, M., Belghiti, Y., Baddou, M. A., Labie, D.,and Nagel, R. L. (1981) The sickle gene: polymorphisms in North Africa. Blood58, 599–601.

6. Mears, J. G., Lachman, H. M., Cabannes, R., Amegnizin, K. P., Labie, D., Nagel,R. L. (1981). Sickle gene: its origin and diffusion from West Africa. J. Clin Invest.68, 606–610.

7. Pagnier, J., Mears, J. G., Dunda-Belkhodja, O., Schaefer-rego, K. E., Beldjord,C., Nagel, R. L., and Labie, D. (1984) Evidence for the multicentic origin of thesickle cell hemoglobin gene in Africa. Proc. Natl. Acad. Sci. USA 81, 1771–1773.

8. Nagel, R. L. and Steinberg, M. H., (2000) Genetic variability in sickle cell ane-mia, in Disorders of Hemoglobin: Genetics, Pathophysiology, Clinical Manage-ment (Steinberg, M. H., Forget, B. G., Higgs, D. R., and Nagel, R. L., eds.),Cambridge University Press, Cambridge, MA.


9. Chakravarti, A., Buteow, K. H., Antonarkis, S. E., Aber, P. G., Boehm, C. D., andKazazian H. H. (1984) Non uniform recombination within the human β globingene cluster. Am. J. Hum. Genet. 36, 1239–1235.

10. Srinivas, R., Dunda, O., Krishnamoorthy.R., Fabry, M. E., Georges, A., Labie,D., and Nagel, R. L. (1988) Atypical haplotypes linked to the βS gene in Africaare likely to be the product of recombination. Am. J. Hematol. 29, 60–62.

11. Lapoumerouli, C., Dunda, O., Ducrocq, R., Trabuchet, G., Mony-Lobe, M., Bodo,J. M., Carnevale, P., Labie, D., Elion, J., and Krishnamoorthy, R. (1992) A novelsickle cell mutation of yet another origin in Africa. Hum. Genet. 89, 333–337.

12. Chebloune, Y., Pagnier, J., Trabuchet, G., Faure, C., Verdier, G., Labie, D., andNigon, V., (1988) Structural analysis of the 5' flanking region of the β-globingene in African sickle cell anemia patients: further evidence for three origins ofthe sickle cell mutation in Africa. Proc. Natl. Acad. Sci. USA 85, 4431–4435.

13. Labie, D., Srinivas, R., Dunda, O., Dode, C., Lapomeroulie, C., Devei, V., Devi,S., Ramasami, K., Elion, J., Ducroq, R., Krishnamoorthy, R., and Nagel, R. L.(1989) Haplotypes in tribal Indians bearing the sickle gene: evidence for theunicentric origin of the β S mutation and the unicentric origin of the tribal popula-tions of India. Hum. Biol. 61, 479–491.

14. Kotea, N., Baligadoo, S., Surran, S., Ramasawmy, R., Lu, C. Y., Ducrocq, R.,Labie, D., Krishnamoorthy R., and Nagel, R. L. (1995) Bicentric origin of sicklehemoglobin among the inhabitants of Mauritius Island. Blood 86, 407–408.

15. Nagel, R. L., Fabry, M. E., Pagnier, J., Zohoum, I., Wajcman, H., Baudin, V., andLabie, D (1985) Hematologically and genetically distinct forms of sickle cell ane-mia in Africa: the Senegal type and the Benin type. N. Engl. J. Med. 312, 880–884.

16. Nagel, R. L., Rao, S. K., Dunda-Belkhodja, O., Connolly, M.M, Fabry, M. E.,Georges, A., Krishnamoorthy, R., and Labie, D. (1987) The Hematologic charac-teristics of sickle cell Anemia bearing the Bantu haplotype: the relatioship betweenG γ and HbF level. Blood 69, 1026–1030.

17. Steinberg, M. H., Lu, Z. H., Nagel, R. L., Venkataramani, S., Milner, P. F., Huey,L., Safaya, S., and Reider, R. F. (1998) Hematological effects of atypical andCameroon β-globin gene haplotypes in adult sickle cell anemia. Am. J. Hematol.59, 121–126.

18. Powars, D. R. (1991) βS-gene cluster haplotypes in sickle cell anemia. Clinical andhematological features. Hematol. Oncol. Clin. North Am. [review] 5(3), 475–493.

19. Wainscoat, J. S., Bell J. I., Thein, S. L., Higgs, D. R., Sarjeant, G. R., Peto, T. E.,and Weatheral, D. J. (1983) Multiple origins of the sickle mutation: evidence fromβS-globin gene cluster polymorphisms. Mol. Biol. Med. 1, 191–197.

20. Antonarakis, S. E., Boehm, C. D., Serjeant, G. R., Theisen, C. E., Dover, G. J.,and Kazazian H. H. Jr. (1984) Origin of the βS-globin gene in blacks: the contri-bution of recurrent mutation or gene conversion or both. Proc. Natl. Acad. Sci.USA 81, 853–856.

21. Ragusa, A., Lombardo, M., Sortino, G., Lombardo, T., Nagel, R. L., and Labie,D.(1988) βS gene in Sicily is in linkage disequilibrium with the Benin haplotype:Implications for gene flow. Am. J. Hematol. 27, 139–141.


22. Dar, S., Hussain, H. M., Gravel, D., Nagel, R. L., and Krishnamoorthy, R.(2000)Genetic epidemiology of HbS in Oman: multicentric origin of the βS gene. Am. J.Hematol. 64, 39–46.

23. Rahgozar, S., Poorfathollah, A. A., Moafi, A. R., and Old, J. M. (2000) βS gene incentral Iran is in linkage disequilibrium with the Indian-Arab haplotype. Am. J.Hematol. 65, 192–195.

24. Currat, M., Trabuchet, G., Rees, D., Perrin, P., Harding, R. M., Clegg, J. B.,Langane, A., and Excoffier, L. (2002) Molecular analysis of the β-globin genecluster in the Niokholo Mandenka population reveals a recent origin of the βS

Senegal mutation. Am. J. Hum. Genet. 70, 207–223.25. Cuellar-Ambrosi, F., Mondragon, M. C., Figueroa, M., Prehu, C., Galceteros, F,

and Ruiz-Linares, A. (2000) Sickle cell anemia and β-globin gene clusterhaplotypes in Colombia. Hemoglobin 24, 221–225.

26. Romana, M., Keclard, L., Froger, A., Lavocat, E., Saint-Martin, C., Berchel, C.,and Merault, G. (2000) Diverse genetic mechanisms operate to generate atypicalβS-haplotypes in the population of Guadeloupe. Hemoglobin 24, 77–87.

27. Arends, A., Alvarez, M., Velazquez, D., Bravo, M., Salazar, R., Guevara, J. M., andCastillo, O.(2000) Determination of β globin gene cluster haplotypes and prevalence ofα-thalassemia in sickle cell anemia patients in Venezuela. Am. J. Hematol. 64, 87–90.

28. Pante-DeSousa, G., Mousinho-Ribeiro, R. C., Dos Santos, E. J., Guerreiro, J. F. (1996)β-globin haplotypes analysis in Afro-Brazilians from the Amazon region: evidencefor a significant gene flow from Atlantic West Africa. Ann. Hum. Biol. 26, 365–373.

29. Frikha, M., Fakhfakh, F., Mseddi, S., Gargouri, J., Ghali, L., Labiadh, Z., Harrabi,M., Soussi, T., and Ayadi, H. (1998) Hemoglobin βS haplotype in the Kebilliregion (Southern Tunisia). Transfus. Clin. Biol. 5, 166–172.

30. El-Kalla, S. and Baysal, E. (1998) Genotype-phenotype correlation of sickle celldisease in the United Arab Emirates. Pediatr. Hematol. Oncol. 15, 237–242.

31. Hewitt, R., Krause, A., Goldman, A., Cambell, G., and Jenkins, T. (1996) Betaglobin haplotype analysis suggests that a major source of Malagasy ancestry isderived from Bantu-speaking Negroids. Am. J. Hum. Genet. 58, 1303–1308.

32. Keclard, L., Ollendorf, V., Berchel, C., Loret, H., and Merault, G. (1996)Haplotypes, α-globin gene status and hematological data of sickle cell diseasepatients in Guadeloupe (F. W. I.). Hemoglobin 20, 63–74.

33. Muniz, A., Corral, L., Alaez, C., Svarch, E., Espinosa, E., Carbonell, N., Di Leo,R., Fellicetti, L., Nagel, R. L., and Martinez, G. (1995) Sickle cell anemia andβ-globin gene cluster haplotypes in Cuba. Am. J. Hematol. 49, 163–164.

34. Sow, A., Peterson, E., Josifovska, O., Fabry, M. E., Krishnamoorthy, R., andNagel, R. L. (1995) Linkage-disequilibrium of the Senegal haplotype with theβS-gene in the Republic of Guinea. Am. J. Hematol. 50, 301–303.

35. Gilman, J. G. and Huisman, T. H. (1984) Two independent genetic factors in the β-globingene cluster are associated with high Gγ levels in the HbF of SS patients. Blood 64, 452–457.

36. Labie, D., Dunda-Belkhodja, O., Rouabhi, F., Pagnier, J., Ragusa, A., and Nagel,R.L (1985) The -158 site 5' to the Gγ gene and G gamma expression. Blood 66,1463–1465.


37. Perichon, B., Ragusa, A., Lapomeroulie, C., Romand, A., Moi, P., Ituka, T., Labie,D., Elion, J., and Krishnamoorthy, R. (1993) Inter ethnic polymorphism of theβ-globin gene locus control region (LCR) in sickle cell anemia patients. Hum.Genet. 91, 464–468.

38. Merghoub, T., Perichon, B., Maier-Redelsperger, M., et al. (1997) Dissection of theassociation status of two polymorphisms in the β-globin gene cluster with varia-tions in F-cell number in non-anemic individuals. Am. J. Hematol. 56, 239–243.

39. Boehm, C. D., Dowling, C. E., Antonarakis, S. E., Honig, G. R., and Kazazian, H.H. Jr. (1985) Evidence supporting a single origin of the βC-globin gene in blacks.Am. J. Hum. Genet. 37, 771–777.

40. Steinberg, M. H., Nagel, R. L., Lawrence, C., Swaminathan, V., Lu, Z. H.,Plonczynski, M., and Harrel, A. (1996) Beta-globin gene haplotype in Hb SCdisease Am. J. Hematol. 52, 189–191.

41. Perrin, P., Bouhassa, R., Mselli, L., Garguier, N., Nigon, M., Bennani, C., Labie,D. and Trabuchet, G. (1998) Diversity of sequence haplotypes associated withβ-thalassemia mutations in Algeria: implications for their origin. Gene 213,169–177.

42. Tadmouri, G.O, . Garguier, N., Demont, J., Perrin, P., and Basak, A. N. (2001)History and origin of β-thalassemia in Turkey: sequence haplotype diversity ofβ-globin genes. Hum. Biol. 73, 661–674.

43. Zahed, L., Qatanani, M., Nabulsi, M., Taher, A. (2000) β-thalassemia mutationsand haplotype analysis in Lebanon. Hemoglobin 24, 269–276.

44. Kotea, N., Ramasawmy, R., Lu, C. Y., Fa, N. S., Gerard, N., Beesoon, S., Ducrocq,R., Surrun, S. K., Nagel, R. L., and Krishnamoorthy, R. (2000) Spectrum ofβ-thalassemia mutations and their linkage to β-globin gene haplotypes in the Indo-Mauritians. Am. J. Hematol. 63, 11–15.

45. Bandyopadhyay, A., Bandyopadhyay, S., Chowdhury, M. D., and Dasgupta, U.B. (1999) Major β-globin gene mutations in eastern India and their associatedhaplotypes. Hum. Hered. 49, 232–235.

46. Samakoglu, S., Philipsen, S., Grosveld, F., Luleci, G., and Bagci, H.(1999) Nucle-otide changes in the γ-globin promoter and the (AT)X NY(AT)Z polymorphicsequence of beta LCRHS-2 region associated with altered levels fo HbF. Eur. J.Hum. Genet. 7, 345–356.

47. Garner, C., Mitchell, J., Hatzis, T., Reittie, J., Farrall, M., and Thein, S. L. (1998)Haplotype mapping of a major quantitative-trait locus for fetal hemoglobin pro-duction on chromosome 6q23. Am. J. Hum. Genet. 62, 1468–1474.

48. Perrin, P., Bouhassa, R., Mselli, L., Garguier, N., Nigon, V. M., Benani, C., Labie, D.,and Trabuchet, G.(1998) Diversity of sequence haplotypes associated with β-thalas-semia mutations in Algeria: Implications for their origin. Gene 213, 169–177.

49. Furumi, H., Firdous, N., Inoue, T., Ohta, H., Winichagoon, P., Fuchaaroen, S.,and Fukumaki, Y. (1998) Molecular basis of β-thalassemia in the Maldives.Hemoglobin 22, 141–151.


50. Rund, D., Oron-Karni, V., Filon, D., Goldfarb, A., Rachmilewitz, E., and Oppenheim,A. (1997) Genetic analysis of β-thalassemia intermedia in Israel: diversity of mecha-nisms and unpredictability of phenotype. Am. J. Hematol. 54, 16–22.

51. Pacheco, P., Loureiro, P., Faustino, P., and Lavinha, J.(1996) Haplotypicheterogenity of β thalassemia IVS1(G A) mutation in Southern Portugal. Br. J.Hematol. 94, 767.

52. Li, J., Wilson, D., Plonczynski, M., Harrel, A., Cook, C. B., Scheer, W.D, Zeng,Y.T Coleman, M. B., and Steinberg, M. H. (1999) Genetic studies suggests amulticentric origin for Hb G-Coushatta [β22(B4)Glu Ala]. Hemoglobin 23, 57–67.

53. Villalobos-arambula, A. R., Rivas, F., Sandoval, L., Perea, F. J., Casas-Castaneda,M., Cantu, J. M., and Ibara, B. (2000) β(A) globin gene haplotypes in MexicanHuichols: Genetic relatedness to other populations. Am. J. Human Biol. 12, 201–206.

54. Luporini, S. M., Bendit, I, Manhani, R., Bracco, O. L., Manzella, L., and Gianella-Neto, D. (2001) growth Harmone and insulin like growth factor I axis and growthof children with different sickle cell anemia haplotypes. Pediatr. Hematol. Oncol.23, 357–363.

55. Steinberg, M. H. Determinants of fetal hemoglobin response to hydroxyurea.Semin. Hematol. 199: 34, 8–14.

56. Green, N. S., Fabry, M. E., Kaptue-Noche, L., and Nagel, R. L. (1993) Senegalhaplotype is associated with higher HbF than Benin and Cameroon haplotypes inAfrican children with sickle cell anemia. Am. J. Hematol. 44, 145–146.

Transgenic Mice and Hemoglobinopathies 213

13

213


Transgenic Mice and Hemoglobinopathies

Mary E. Fabry, Eric E. Bouhassira, Sandra M. Suzuka,and Ronald L. Nagel

1. IntroductionA wide variety of transgenic mouse models expressing human globin genes

have been generated in the last decade and a half. The majority of these modelshave been sickle transgenic models because they can advance our understand-ing of the pathophysiology of sickle cell disease, aid in development of thera-peutic approaches, aid in development of preclinical strategies for antisicklinggene therapy, and may be used for the identification and study of pleiotropicand epistatic genes.

One of the most interesting features of the current sickle cell models is theextent to which they reproduce the pleiotropic aspects of sickle cell disease.That is, simply introducing a single amino acid mutation (β6 glu→val, whichresults in an abnormal β globin, βS) results in a polymerizable hemoglobin(Hb) and generates a wide range of pathology in mice that mimics that found inhuman sickle cell disease.

Another important aspect of pathology in mice as well as in humans areepistatic effects (see Note 1). That is, the phenotype of a given genotype isinfluenced by the interaction of many genes. Furthermore, these genes maybe polymorphic. In some inbred strains of mice, polymorphisms (see Note 2)may be fixed, and the combinations of inbred strains that are used to generatetransgenic mice may result in an array of epistatic effects that would not bepresent if the mice were bred onto a genetically defined background. Epi-static effects in mouse models may differ from those in humans due to differ-ent polymorphisms and/or different isozymes or tissue expression of genes(see Note 3).

214 Fabry et al.

1.1. Early Transgenic Models for Sickle Cell Disease

The earliest attempts at producing a murine model for sickle cell diseaseintroduced only the mutated human β globin (βS) (1) and produced a mousewithout pathology. It was subsequently shown that mouse α globin inhibitspolymer formation as effectively as human γ globin (2). All successfultransgenic models of sickle cell disease have approximately equal expressionof human α globin and βS.

1.1.1. Early Models

The first models expressing moderately high levels of both human α- andβS-globin chains were reported by Greaves et al. (3) and Ryan et al. (4). Themice produced by Greaves et al. (3) failed to propagate but those produced byRyan et al. (4) were bred with thal mice that have a deletion of mouse βmajor;this increases expression of βS by reducing competition from the mouse βglobins. Ryan et al. (4) used two constructs: a locus control region (LCR) withthe human α1 gene and an LCR with the βS gene. These were then coinjectedand the founder mice were bred with thal mice to produce mice that were hem-izygous for the thal deletion. The HbS/thal exhibited intracellular polymer for-mation and sickling but had normal Hb and reticulocyte counts.

1.1.2. SAD Mouse

The SAD mouse (5) expresses SAD-Hb at a low level (about 55% human αand 19% HbSAD), but this Hb has super-HbS properties. In HbSAD the sicklemutation is accompanied by two other mutations that enhance polymer forma-tion (5). Sickling, polymer formation, and irreversibly sickled cells (ISCs) havebeen observed. The SAD mouse has normal hematocrit and reticulocyte count.The red cells have increased density, and this property has been used to testclotrimazol, a Gardos channel blocker that inhibits sickle dense cell formation(6) (dense cells are known to participate in vasoocclusion) and to test Mg++

supplementation, aimed at inhibiting red cell K-Cl cotransport (7), alsoinvolved in dense sickle cell formation. A form of clotrimazol, modified toeliminate the anti-P450 activity, is now in clinical trials.

A more severe form of the SAD mouse was generated by breeding tohemizygosity with the βmajor deletion to produce a SAD-thal mouse (5). TheSAD-thal mouse has 26% SAD as opposed to 19% in the SAD mouse and anincrease in reticulocytes from 2.6 to 6.2; however, it is more difficult to breedand has not been used in the majority of work reported. The effect of adding γto the SAD mouse has been studied by breeding in lines expressing two differ-ent levels of human γ (8). Since the percentage of reticulocytes and the level ofHb are normal, no changes in these features were found; however, the life-span


of SAD mice is shortened from the 700 d found for C57BL to 474 d, and in theSAD mouse with 18.8% γ the life-span is increased to 552 d, the percentage ofvery dense cells was decreased, and the glomerular profile area was decreased.At high levels of γ, the SAD transgene became homozygous, suggesting thatcompetition with γ had reduced the percentage of βSAD below the levelrequired to produce pathology.

1.1.3. NY1DD Model

The NY1DD model (9,10) expresses about 75% βS and 55% human α-chains(the balance are murine globins) and presents a moderate phenotype, owing topartial inhibition of polymerization by murine α-chains. Intracellular polymersof HbS are generated on deoxygenation and the red cells sickle. A deoxy potas-sium efflux can also be detected and linked to increased red cell density, aproperty that is unique to sickle cell disease and that increases pathology byincreasing the intracellular Hb concentration, thereby favoring polymer forma-tion and sickling. The model exhibits a hypoxia-inducible urine concentrationdefect and constitutively increased glomerular filtration rate, features of sicklecell anemia. Peripheral retinopathy and choroid infarcts were also detected(11), the latter not previously recognized as a complication of this disease, butlater confirmed in human autopsies. Interestingly, this model also provided thefirst in vivo evidence of malaria protection afforded by HbS (12), as well as invivo evidence of oxidative stress in hypoxia-exposed sickle mice (13).

1.1.4. The S+S-Antilles Model

The S+S-Antilles model (14) is similar to the first three models, in that it is notanemic but, in contrast to the first three models, it does have a mild reticulocyto-sis and a constitutive urine concentration defect. Introduction of 11% human γ(Aγ+Gγ/Aγ+Gγ+βS+βS-Antilles+βmin) into this mouse line reduces reticulocytosis,normalizes red cell density, and corrects the urine-concentrating defect.

In vivo adhesion of sickle cells to the endothelium was demonstrated for thefirst time in this model (15). Kaul et al. (16) showed an increased endothelialnitric oxide synthase (eNOS) expression, low mean arterial blood pressure,and constitutive microcirculatory vasodilation by video microscopy in an invivo cremaster preparation of the S+S-Antilles mouse. A nonselective inhibitorof NOS (L-NAME) caused a significant increase in mean arterial bloodpressure and decrease in the diameters of cremaster muscle arterioles that wasreversible after administration OF L-arginine in both control and transgenicmice, confirming NOS activity. Based on data on nitric oxide (NO)-mediatedvasodilators and forskolin (a cyclic adenosine monophosphate–activatingagent), Kaul et al. (16) concluded that increased eNOS/NO activity results inlower blood pressure and diminished arteriolar responses to NO-mediated

216 Fabry et al.

vasodilators. Although the increased NOS/NO activity may compensate for flowabnormalities, it may also cause pathophysiological alterations in vascular tone.

S+S-Antilles mice have a reduced plasma arginine level (17) similar to thatreported for human sickle cell patients (18). Arginine is required for the pro-duction of NO, a vasodilator that plays a crucial role in maintaining vasculartone. In arginine-supplemented S+S-Antilles mice red cell density, the percent-age of high-density red cells and the Vmax of the Ca++-activated K+-channel(K[Ca] or Gardos channel) are all reduced (17). Specifically, the clotrimazole-sensitive, deoxy-stimulated K+ efflux was reduced in red cells from supple-mented vs nonsupplemented mice, suggesting the involvement of the Gardoschannel. This was confirmed by direct measurements of the significant reduc-tion in the channel Vmax. Animals taken off the diet for 2 mo and retestedreturned to baseline. Hence, 5% arginine supplementation in sickle transgenicmice significantly reduces deoxy K+ efflux and normalizes red cell density byinhibiting K(Ca) channel activity.

Poorly oxygenated tissues are at increased risk of vasoocclusion in the pres-ence of polymerizable Hbs. Fabry et al. (19) have detected deoxyHb in kidneyand liver of the sickle cell disease mouse model S+S-Antilles by using bloodoxygen level–dependent magnetic resonance imaging (BOLD-MRI), in whichimage intensity is compared in tissues while the animals first breathe room airand then 100% O2.

If elevated deoxyHb is the result of to a reduction in flow or partialobstruction by sickled cells, then infusion of oxygen-carrying material withsmall particle size (<0.4 µm) such as a perfluorocarbon emulsion (PFCE) couldimprove oxygenation and flow. A PFCE comprised primarily of Perflubron®

was administered to S+S-Antilles mice at volumes equivalent to 5, 10, and20% of blood volume (BV) by tail vein and BOLD-MRI images and T2 mapswere obtained. The intensity of change was compared with that seen in C57mice and C57 mice injected with 10% BV of PFCE. PFCE at 10% of BV resultsin a larger reduction in the change of image intensity in S+S-Antilles micewhen compared to that observed in C57BL control mice. These observationsdemonstrate that infusion of PFCE results in reduction in deoxyHb in S+S-Antilles mouse kidney and liver because the excess percentage change in signalintensity is proportional to the deoxyHb present and PFCE reduced thatpercentage in S+S-Antilles mice to that seen in control mice. Infusion of PFCEmay reduce risk of extending and/or alleviate sickle cell vasoocclusion duringsickle cell painful crisis or sickle liver crisis.

1.2. Sickle Knockout Mice that Express Exclusively Human Hbs

Four groups have reported sickle transgenic mouse models in which all ofthe murine globin genes are “knocked out” and express only human globins


(20–23). Although the earlier models successfully reproduced much of the pa-thology of sickle cell disease, they did not exhibit the anemia that gives thedisease its name. All of the knockout (KO) mice have significant anemia,reticulocytosis, and abundant irreversibly sickled cells. The first two sickleknockout models were described by Ryan et al. (20) and Paszty et al. (21).Ryan et al. (20) coinjected two constructs, LCRα1 and LCRAγβS, and reportedsix independent lines of mice. The resulting mice had adult HbF between 3.2 and7.7%. There was some amelioration of reticulocytosis and anemia in mice withhigher levels of γ; however, since these are independent lines with different inte-gration sites and potential differences in globin chain expression and balance, itis difficult to make a direct comparison. The mice described by Paszty et al. (21)(referred to hereafter as BERK mice) were generated by coinjecting three con-structs: the LCR, α1, and GγAγδβS. This resulted in one successful line withminimal expression of HbF in mature mice. Chang et al. (22) generated atransgenic line of sickle mice using two copies of the human α2 gene linked to anLCR and a βS yeast artificial chromosome (YAC). This line of mice is severelyanemic (Hct of 22 vs 47, sickle vs control, respectively), has a low meancorpuscular Hb (MCH) (10.4 vs 16.1, sickle vs control, which suggests thepossibility of β-thalassemia-like characteristics), and has a high reticulocytecount (20 vs 1.1, sickle vs control). This is the first model to incorporate themajority of the β-globin locus and is particularly suitable for studying regulationof the γ genes. Finally, Fabry et al. (23) used the previously described sickletransgenic line (NY1) generated by Costantini and introduced murine α- and β-globin KOs and three different levels of human HbF. These mice expressexclusively human Hb and we refer to them as NY1KO mice.

1.2.1. Birmingham Mouse and Berkeley Mouse

The Birmingham mouse described by Ryan et al. (20) is very anemic with adecrease in Hb that is almost double that seen in sickle cell anemia. Whenaveraging the Hbs of Birmingham mice in which more than one animal wasstudied, the value is 4.9 g/dL, a decrease of 10.1 g/dL from the control C57BL.The average Hb for sickle cell anemia patients is 8.4 g/dL, a decrease of 5.6 g/dL.Although the original publication describing the BERK mice did not report aHb level (24), we find a value of 6.1 g/dL. The NY1KO mice described inSubheading 1.2.2. have higher values for Hb, 9.8 g/dL and 11.9 g/dL for theNY1KO-γM and NY1KO-γH mice, respectively. As described in a previouspublication (23), the BERK and the NY1KO-γM mice have very similar hema-tocrits and reticulocyte counts, so the difference in Hb is the result of to thelarge difference in mean corpuscular hemoglobin concentration (MCHC)between the two types of mice. The imbalance in chain synthesis and very lowMCHC of the BERK mice suggests that they have a thalassemic component.

218 Fabry et al.

The organ damage reported in BERK mice is more severe than that reportedin earlier models, with grossly enlarged spleens that are characteristic of allsickle KO mice. The bad news is the very low MCHC (18.5 vs 33.8 g/dL [con-trol]) observed in the BERK line that provides a form of protection againstsickling not found in human disease. This feature, plus chain imbalance andthe decrease in mean corpuscular hemoglobin (MCH), strongly suggests thepresence of a coexisting thalassemia-like defect (23). Hence, how much of theanemia is thalassemia-like and how much is sickle is not clear. The presence ofthalassemia in this model suggests that the amelioration of the phenotype bythalassemia is indispensable for the survival of an otherwise too-severe model.This interpretation is further supported by the usually high number of matingsnecessary to obtain homozygotes; by the presence in the mouse of hyper-osmolar plasma (330 vs 290, mouse vs human), and the high intraerythrocytic2,3-diphosphoglycerate (DPG) (about double that found in humans) thatfacilitates polymer formation (25). These last three features are characteristicsof all sickle KO transgenic mice studied to date. In contrast, it has been relativelyeasy to generate mice that express exclusively human nonsickling Hbs (such asHbA or HbC (26)). In effect, in the absence of ameliorating features such asthalassemia (low MCHC) or added HbF, sickle cell anemia is lethal in the KO micethat express exclusively human Hbs studied up to now.

1.2.2. KO Mice Expressing Various Levels of Human γ Globin (NY1KO)

Fabry et al. (23) have recently reported on mice expressing exclusively humansickle Hb with three levels of HbF. Mice with the least adult HbF expressionwere the most severe. A progressive increase in HbF from <3 to 20 to 40% (whichare called NY1KO-γL, -γM, and -γH, respectively; see Table 1) correlated witha progressive increase in hematocrit (22 to 34 to 40%) and a progressive decreasein reticulocyte count (60 to 30 to 13%). High HbF normalized urine-concentratingability, and tissue damage detected by histopathology and organ weight wereameliorated by increased HbF. The introduction of γ into the BERK model alsoprogressively corrected its “thalassemic” aspects.

Mean survival time reflects the cumulative effects of chronic organ damageand acute ischemic events. Kaplan-Meier mean survival times for NY1KOmice were calculated, and those with the least adult HbF had the shortest meansurvival. Higher levels of HbF resulted in progressively longer mean survival.In each class, an approximately equal number of mice were withdrawn fromthe calculation owing to sacrifice for experimentation. In the NY1KO-γMgroup only, males had a shorter survival. This excludes the effect of HbF onsurvival because all γM mice express the same transgenes and have the samelevel of HbF expression. Hence, this mouse model clearly points to gendereffects other than HbF.


1.3. What Is the Perfect Transgenic Model for Sickle Cell Anemia?

Is there a perfect model? By definition, it is not possible. HbS is a mutationof a single gene, while sickle cell anemia is the product of many genes (multi-genic) because the phenotype is affected by epistatic (modifier) genes in addi-tion to the indispensable primary mutation (sickle gene). These epistatic genesvary among individuals, explaining the interindividual variation in severity insickle cell anemia; can ameliorate or aggravate different components of thephenotype; and can interact with each other, in an additive, a neutral, or a can-celing fashion. In transgenic mice, potential epistatic genes may differ fromthose in humans: for example, the red cells of the KO mouse contain onlyhuman Hbs, but they are literally half the size of human red cells, and theirmembrane and cytosolic components are murine.

1.4. Transgenic Mice Are Useful for Identification and Studyof Pleiotropic Effects and Epistatic Genes

The KO mice have now completed the panoply of phenotypic intensities.For testing therapeutics and inducible pathology, the NY1DD model is usefulbecause it is easy to breed and has hypoxia-inducible pathology. The S+S-Antilles and the SAD-mouse models are useful in pathophysiological studiesand are relatively easy to breed. The KO mice are excellent models for long-term pathology studies and, particularly if the thalassemic features are cor-rected, for gene therapy dry runs.

1.5. Transgenic Mice Expressing HbC

The homozygous form of HbC (CC disease) increases red cell density, afeature that is the major factor underlying the pathology in patients with sicklecell (SC) disease (27). The basis for the increased red cell density has not yetbeen fully defined. An HbC founder mouse expressing 56% human α and 34%human βC was bred to KOs of mouse α and β globins in various combinationsincluding full KO of all mouse globins (26). All partial KOs have normal MCH.Full KOs, which express exclusively HbC, have minimally reduced MCH anda ratio of β- to α-globin chains of 0.88 determined by chain synthesis; hence,these mice are not thalassemic. Mice with βC >30% have increased MCHC,dense reticulocytes, and increased K:Cl cotransport. Red cell morphology stud-ied by scanning electron microscopy is strikingly similar to that of human CCcells with bizarre folded cells. Red cells of these mice have many propertiesthat closely parallel the pathology of human disease in which HbC is the majordeterminant of pathogenesis. These studies also establish the existence of in-teractions with other gene products that are necessary for pleiotropic effects(red cell dehydration, elevated K:Cl cotransport, morphological changes) that

220F

abry et al.

220

Table 1Mouse Nomenclature

αβ-Globin Mousetransgene γ Mouse β-knockout

Nickname name Description of transgene Construct α-knockout or deletion

THAL — — — + // + Hbbth-1//Hbbth-1 h

NY1DD NY1 miniLCRα2, miniLCRβS a — + // + Hbbth-1//Hbbth-1 h

SAD SAD miniLCRα2, miniLCRβSAD b — + // + + // +SAD-thal SAD miniLCRα2, miniLCRβSAD — + // + +//Hbbth-1 h

S-AntillesDD S-Antilles HS2α2, HS2βS-Antilles c — + // + Hbbth-1//Hbbth-1 h

S+S-Antilles NY1 and miniLCRα2, miniLCRβS + — + // + Hbbth-1//Hbbth-1 h

S-Antilles HS2α2, HS2βS-Antilles

NY1KO γL NY1 miniLCRα2, miniLCRβS γLe Hba0//Hba0 g Hbb0//Hbb0 i

NY1KO γM NY1 miniLCRα2, miniLCRβS γMf Hba0//Hba0 g Hbb0//Hbb0 i

NY1KO γH NY1 miniLCRα2, miniLCRβS γHf Hba0//Hba0 g Hbb0//Hbb0 i

BERKd BERK miniLCR, α1, GγAγδβSd — Hba0//Hba0 g Hbb0//Hbb0 j

BERK γMd BERK miniLCR, α1, GγAγδβSd γMf Hba0//Hba0 g Hbb0//Hbb0 j

a See ref. 10.b See ref. 5.c See ref. 66.d See ref. 21.e See ref. 67.f See ref. 23.g See ref. 69.h See ref. 68.i See ref. 70.jSee ref. 55.


are also present in these transgenic mice, validating their usefulness in theanalysis of pathophysiological events induced by HbC in red cells.

K:Cl cotransport (KCl) is elevated in human SS and CC disease. In the caseof SS, at least part of this elevation is correlated with increased reticulocytecount since density fractions rich in reticulocytes have higher KCl activity.The case for HbC disease is less clear, since KCl in CC red cells is nearly ashigh as SS red cells, but retic counts are lower.

KCl activity was studied in the mice described above. HbAKO mice (miceexpressing exclusively HbA) have a small volume-stimulated KCl, which isstimulated by NO3

– as reported in previous studies of early transgenic linessuch as NYIDD, transgenic mice expressing 56% human α, 75% βS, andresidual mouse globins that are insensitive to DIOA and stimulated by NO3

–.In KO mice expressing exclusively human HbC or HbS+γ, the results are verydifferent: KCl had a strong volume-stimulated component for C and S+γ mousered cells vs sulfamate that was partially inhibited by NO3

– (48 vs 37% for Cand S+γ mouse red cells, respectively) and also by DIOA. A similar and evenlarger effect was observed for KCl activity measured at pH 7.0, which wasmore pronounced in the HbC mice. To eliminate the contribution of elevatedreticulocyte, K:Cl cotransport in founder mice expressing 56% human α, 33%βC, and residual mouse globins that have low (3–5%) reticulocyte counts wasstudied. A strong volume dependence and sensitivity to NO3

– (34%) and DIOA(30%) in these mice was found. Therefore βC interacts differently and morestrongly with the transporter and/or its regulators than does βS.

1.6. Use of Transgenic Mice in Study of Innate Resistanceto Malaria

Shear (28) has reviewed the use of transgenic mice in the study of innateresistance to malaria. More recently, γ-expressing transgenic mice have beenused to test the hypothesis based on in vitro studies (29) that the growth ofPlasmodium falciparum in cells containing fetal hemoglobin (HbF = α2γ2) isretarded. Transgenic (γ) mice expressing human Aγ and Gγ chains resulting in40–60% αM

2γ2 Hb were infected with rodent malaria. Three species of rodentmalaria were studied: P. chabaudi adami, which causes a nonlethal infection;P. yoelii 17XNL, which causes a nonlethal infection; and P. yoelii 17XL, alethal variant of P. yoelii 17XNL that causes death in mice. Data indicate thatthis strain may cause a syndrome resembling cerebral malaria caused by P.falciparum (30). Results suggest that HbF does indeed have a protective effectin vivo, which is not mediated by the spleen (31). In terms of mechanisms,light microscopy showed that intraerythrocytic parasites develop slowly in HbFerythrocytes, and electron microscopy showed that hemozoin formation wasdefective in these transgenic mice. Finally, digestion studies of HbF by

222 Fabry et al.

recombinant plasmepsin II demonstrated that HbF is digested only half as wellas HbA. Hence, HbF provides protection from P. falciparum malaria by theretardation of parasitic growth. The mechanism involves resistance to digestionby malarial hemoglobinases based on the data presented and with the well-known properties of HbF as a superstable Hb. These studies also establishedHbF as the mechanism for the strong innate resistance to malaria by neonates.

2. Generation of Transgenic Mice Expressing Human GlobinsThe human β-like globin genes have strict developmental and tissue-specific

regulation. The tissue specificity is conferred by regulatory elements proximalto the genes, and the developmental regulation is conferred in part by proximalcis-acting elements (32) but depends, in addition, on the combination of genespresent in the construct and on the distance of the genes from the LCR. Forinstance, the β-globin gene is more correctly developmentally regulated in thepresence of a γ-globin gene in the construct than in its absence (33,34). TheLCR, a group of hypersensitive sites (HS) located 50–15 kb upstream of thegenes, regulates the level of expression of all the globin genes but has a mini-mal impact on developmental and tissue specificity. α-Globin genes are alsodevelopmentally regulated.

2.1. Overall Construct Design

The design of constructs for the creation of transgenic mice expressinghuman globin depends greatly on the purpose of the experiments. When theexperimental goal is to produce mutant globin proteins, simple constructs con-taining a segment of the LCR attached to a short genomic fragment containingthe globin genes and their proximal regulatory sequences are sufficient. Whenthe experimental goal is to study the cis-acting regulatory elements of the locus,or to study the pharmacological induction of the γ-globin genes, largerconstructs containing the intact locus are preferable because the relativearrangement of the different genes and their regulatory elements (including theLCR) have been shown to be critical.

2.1.1. Short Constructs

Production of transgenic mice by injection of DNA constructs into the malepronucleus of fertilized mouse ovocytes leads to the integration of multiplecopies of the transgenes at random integration sites in the mouse genome (usu-ally one site per founder). Multiple copies of short genomic fragments contain-ing the globin genes and their proximal regulatory sequences integrated atrandom sites in the mouse genome are expressed at variable but usually verylow levels because of position effects caused by the influence of the site ofintegration and the presence of multiple copies. Typical genomic fragments


used for these experiments include the gene itself plus 1–3 kb of sequenceupstream and downstream. cDNA fragments are very poorly expressed. Mostinvestigators therefore have almost always used entire intact genomic genes astransgenes.

Inclusion of the LCR dramatically improves the level of expression (35). Inthe presence of LCR fragments, the level of expression per integrated copy,measured at the RNA level, can be as high as that of the endogenous globingenes.

2.1.2. LCR Derivatives

Numerous LCR derivatives that can confer high-level expression to globintransgene have been produced (36–40). These LCR derivatives are assembledfrom genomic fragments containing one or more of the hyper-sensitives (HS)sites making up the LCR plus a variable amount of sequence flanking the HSsites. Usually, the larger the amount of flanking sequence the stronger the LCR.Spacing of the various HS sites within the constructs has also been reportedto be important for expression. Because a weak LCR derivatives can be com-pensated for by a higher number of integrated copies, most LCR derivativescan provide adequate enhancing activities to achieve high-level expression insome founders. However, if the size of the construct is not a concern, a largerLCR derivative is preferable (i.e., miniLAR). The human LCR is usually usedfor creation of transgenic mice expressing abnormal Hbs. Other LCRs (i.e.,mouse or rabbit) would probably be adequate too.

2.2. Controlling Expression

Even in the presence of an LCR, the level of expression of the globintransgenes cannot be predicted because the number of integrated copies cannotbe controlled. If a specific level of expression is sought, several founders canbe screened until one with the requisite level of expression is identified.

An alternate strategy to vary the level of expression of a globin transgene isto include one Lox site in the construct. Breeding mice expressing a Lox sitewith mice expressing the cre recombinase in the germ line will lead to reduc-tion (complete or partial) of the arrays of integrated copies and therefore varythe level of expression (41) (see Notes 4 and 5).

2.3. Position Effects

In the presence of LCR fragments, position effects are attenuated but arenot eliminated (42–44). Position effects can be stable (every red cell expressesthe transgene but at a lower level than the endogenous genes) or variegating(the transgene is silenced in a fraction of the red cells). If expression of the transgenein all red cells is important for the experiment, expression of the transgene

224 Fabry et al.

should be tested by a method that allows detection of the transgenic globin insingle cells (FACS, in situ hybridization, reverse transcriptase polymerasechain reaction) (see Note 6).

2.4. Balanced α- and β-Globin Expression

Unbalanced expression of β-globin chains is toxic because of precipitationof the globin chains and release of heme and iron leading to oxidative damage.To obtain adult mice with a high level of circulating transgenic globin, it iscritical to express α- and β-like globin genes at approximately equal levels andat the same time. Constructs for the α-like globin genes can be based on thesame model as those for the β-like genes since LCR derivatives activate theα-globin gene as effectively as the β-globin gene (45). For the purpose ofbalancing β-globin expression, a construct containing an α-globin genomicfragment plus a couple of kilobases of flanking sequences on either side anddriven by an LCR derivative is perfectly adequate (see Note 7).

2.5. Use of Embryonic Stem Cells for Modificationof Endogenous Locus

An alternative method of producing mutant globin chains in mice is to modifythe endogenous globin genes via homologous recombination in embryonic stemcells. The Ley laboratory (44) has recently reported the creation of a mouse thatexpresses a mutant globin (β6I) in which the sixth codon of the mouse β-majorchain has been mutated in an attempt to mimic the human βS-chain that isresponsible for sickle disease. Although technically more delicate than microin-jection in the pronucleus, this approach could be generalized. In theory, the cod-ing sequences of one or more endogenous globin genes could be substituted bythe coding sequence of any other globin. Such an approach would probably facili-tate the precise control of the level of transgene expression (see Note 8).

2.6. Lentiviral Vectors Expressing Globin Genes

Moloney-based retroviruses containing globin transgenes were producedmore than ten years ago, but could not be used for the production of transgenicmice because of poor expression owing to silencing, either early in develop-ment if the virus was used to infect blastocysts (46) or during differentiation ifbone marrow stem cell infection followed by transplantation in irradiated re-cipient was the chosen gene transfer methodology (47). Difficulties in infect-ing quiescent multipotential stem cells with retroviral vectors compounded theproblems associated with the latter approach. However, recent advances in viralgene transfer could revolutionize these approaches.

Lois et al. (48) have recently reported that self-inactivating, VSV-G-pseudotyped lentiviral vectors appear to escape developmental silencing. Itshould therefore be possible to produce transgenic mice with mutant globins


by infecting the blastocyst with virus containing a globin gene and an LCRderivative. Blastocyst or ovocyte infection requires less equipment and is easierto perform than microinjection. In addition, controlling the number of copiesof the integrated transgenes should be easier than with microinjection, sincelentiviral vectors always integrate as single copies.

Production of transgenic mice by infection of hematopoietic stem cellsfollowed by bone marrow transplantation has also been revolutionized bythe use of VSV-G-pseudotyped lentiviral vectors since these vectors caninfect quiescent murine hematopoietic stem cells at high efficiency. Usingsuch an approach, two teams have cured mice of β-thalassemia and sicklecell disease (49,50). Although these vectors were produced for gene therapypurposes, they could be used to generate mice producing any globintransgene.

While technically quite demanding, this approach could allow laboratorieswith the requisite expertise in bone marrow transplantation and lentiviral vec-tor production to produce several vectors to test various combinations ofα- and β-globin antisickling transgenes or to test globin chains that might betoo toxic to allow survival during the fetal or perinatal periods. Of course,transgenic mice produced by bone marrow transplantation will not transmittheir transgenes through their germ lines.

2.7. Large Constructs

The main advantage of large constructs (yeast artificial chromosomes [YACs]or bacterial artificial chromosomes [BACs]) is that distance between the genesthemselves, and between the genes and the regulatory elements, is normal. Whenlarge constructs are used, expression at the mRNA level of the human globin genesis often equivalent to that of their mouse counterparts (51–53) although positioneffects are clearly not eliminated (see Subheading 2.3.). However, at the proteinlevel, on a per integrated-copy basis, the level of expression is much lower thanthat of the endogenous genes, probably because of poor translation (54).

When human YACs are introduced into the mouse genome, the developmen-tal regulation of the human adult globin genes is recapitulated. Silencing of theγ-globin gene in adult life is also recapitulated. However, expression of the humanglobin genes in mouse early embryos and fetal liver differs from expression ofthese genes in human cells since the γ-globin genes are expressed very earlyduring development and the ε gene is expressed after the γ genes (or at the sametime-depending on reports [44,51–53] rather than prior to the γ genes.

2.8. KO Mice

Mice generated by homologous recombination with deletion of their adultα- or β-globin genes are available (20,54–57). Mice with deletion of Ey or bh1

226 Fabry et al.

are also available (Steve Fiering, personal communication). Mice with dele-tions of various size in the globin clusters that were induced by irradiation arealso available from Jackson Laboratory. The most commonly available of theseis the βmajor-deletion described by Skow et al. (68).

3. Breeding Mice with Severe Sickle PhenotypesIn general, mice with severe phenotypes cannot be bred by mating mice

homozygous for the transgene and also homozygous for the KOs or deletionsnecessary for enhancing Hb expression to each other (see Note 9). Since thebreeders are not homozygous, the pups will have a variety of genotypes, andtesting them to determine Hb expression and genotype is a necessary part ofany breeding program. The first step in successful breeding is accurately char-acterizing the mice that you have, and the second step is characterizing theoffspring. In this section, we discuss determining Hb composition and geno-type and breeding strategies for mice with severe phenotypes.

3.1. Determining Hemoglobin Composition and Genotype

3.1.1. Validating the Mutation

In many cases, mice with mutant Hbs will be obtained from commerciallaboratories or originating laboratories that have already established the iden-tity of the Hb. However, in newly created lines of transgenic mice, the identityof the globin chains should be confirmed. In the case of known common humanHbs and mutants, authentic samples may be available for testing by addition ofa known sample to the test sample followed by isoelectric focusing (IEF) orhigh-performance liquid chromatography (HPLC). A more general techniqueis mass spectroscopy (MS).

MS can determine the molecular weights of individual globin chains towithin ±one atomic mass unit. This level of accuracy allows detection of post-translational modification and verification of mutant and recombinant Hbs, and,in contrast to electrophoretic techniques, MS can separate similarly chargedsamples. Individual bands or peaks from IEF or HPLC can also serve as thestarting sample. Sample requirements are very small—a few picomoles of protein.

MS has also been used for complete sequencing of proteins based on identi-fication of fragments. This approach is particularly useful for mutant Hbs sincesequence homology allows good working approximations to be formulated.Fragments can be produced classically by proteolytic digestion and thenexposed to matrix-assisted laser desorption ionization MS. The abnormal frag-ments can be identified and, in many cases, the mutation deduced. With a fewexceptions, whole blood hemolysates can be subjected to digestion withoutfurther separation. Separation is necessary when the variant is present at a low


level, a mass difference of 1 Dalton is suspected, or high levels of HbF arepresent. In these cases, the sample can be purified by IEF or HPLC prior todigestion (58). Alternatively, the protein can be fragmented in the spectrom-eter itself without resorting to wet chemistry, and the fragments produced inthe spectrometer can be used to identify the portion bearing the mutant aminoacid (59–61).

3.1.2. Initial Screening

3.1.2.1. STORING AND SHIPPING RED CELLS AND HB

Murine red cells are more fragile than human red cells, and therefore greatercare needs to be exercised in both storage and shipping. The best way to storeor ship cells is in their own plasma at 4°C or on wet ice with the cells separatedfrom direct contact with the ice. Murine Hbs are also less stable than humanHbs. The best way to store murine Hb for 1 or 2 d is in red cells in autologousplasma; the cells can then be washed and hemolyzed as needed. If the cellshave already been hemolyzed, the hemolysate should be stored in a low-tem-perature freezer, –135°C, or liquid nitrogen. If neither is available, a –80°Cfreezer is the next best choice. Do not leave hemolysate or red cells at roomtemperature. Do not freeze hemolysates in a refrigerator freezer. A time-dependent degradation occurs under poor storage conditions which may gener-ate shifted or even additional bands or peaks.

3.1.2.2. POLYMERASE CHAIN REACTION

PCR is useful for identifying the first-founder mice; however, since the workon transgenic mice expressing human/mutant Hbs is focused on the effects ofthe Hb itself, direct determination of mutant Hb levels is a necessary part ofidentifying the mice. In addition, the correlation between protein expressionand either the presence of the gene may depend on multiple factors (Notes 4, 6,16, and 17).

3.1.2.3. ELECTROPHORESIS

At pH 8.6, all human Hbs have a net negative charge and migrate in anelectric field toward the positive pole or anode. Separation of Hbs by electro-phoresis is based on the relative charge of the αβ dimer; therefore, mutationsthat do not alter the charge may be “silent” and not detectable by electrophore-sis. Most electrophoretic methods separate Hb tetramers, but only tetramerscomposed of two identical αβ dimers, or homotetramers, are seen at the end ofthe separation process (see Notes 10 and 11).

Cellulose acetate electrophoresis at pH 8.4 is a standard method and kits areinexpensive and easy to use. Charts accompanying these kits can be used to

228F

abry et al.

228

Table 2Characteristics of Selected Sickle Transgenic Micea

Reticsu- UrineβS αH γ (%) MCH MCHC locytes Hema- conc.

(%) (%) (>9 wk) (pg/cell) (g/dL)c (% Sysmex) tocrit (mOsm)

C57BL 3147a

CONTROL — — — 14.5 33 2.2 48 1688b

C57BL Hbbth-1//Hbbth-1

THAL — — — 12.7 24.9 24.6 32.3 2820a

α2 βSAD

SAD βSAD 21 52 — 15.1 37.3 3.6 44 3147a

α2 βSAD

SAD γγγγγ βSAD NA NA 5.2 NA b 3.3 c —α2βS Hbbth-1//Hbbth-1

NY1DD 75 56 — 14.1 35.7 3.2 47.0 2821a

α2βS α2βS-Antilles Hbbth-1//Hbbth-1 βS 42 1302a

S+S-Antilles βS-Ant 38 58 — 14.3 36.2 11.1 44.5 1350b

α2βS α2βS-Antilles γ(G100)Hbbth-1//Hbbth-1 βS 36S+S-Antilles γγγγγH βS-Ant 34 59 10 14.5 35 7.7 45.8 2810a

α2βSγ(F1352) Hba0//Hba0 Hbb0//Hbb0

NY1KO γγγγγL 97 100 <3 14.2 20.8 63.2 22.4 —α2βSγ(G203) Hba0//Hba0 Hbb0//Hbb0

Transgenic M

ice and Hem

oglobinopathies229

229

NY1KO γγγγγM 80 100 20 13.7 24 30.1 34.0 1176b

α2βSγ(G100) Hba0//Hba0 Hbb0//Hbb0

NY1KO γγγγγH 60 100 40 14.4 31 12.9 41.1 3285a

α1GγAγδβS Hba0//Hba0 Hbb0//Hbb0

BERK >99 100 <1 9.3 18.5 36.5 28.7 898b

α1GγAγδβSγ(G203) Hba0//Hba0 Hbb0//Hbb0

BERK γγγγγM 79 100 21 10.8 22.9 37.2 41.6 1710a

a Twenty-four-hour water deprivationb Eight-hour water deprivation.

230 Fabry et al.

identify common Hbs. A set of reference Hbs, which could be HbA, HbS, andHbC and a relevant mouse Hb, should be included with each run. It is useful tomix known standards with the test sample when the presence of mutants withelectrophoretic properties similar to normal and common variants is suspected.Electrophoresis can also be carried out on separated globin chains if denatur-ing conditions are used (62,63). In these cases, urea is added to the electro-phoresis buffer and the diluent in which the Hb is dissolved. Another approachthat sometimes allows separation of overlapping Hbs, one of which containscysteine, is treatment of the sample with cystamine (64). This simplifies analy-sis for samples with multiple α- and β-globin chains; however, at this point it isreasonable to turn to a higher-resolution technique such as IEF, HPLC, or MS.

3.1.2.4. ISOELECTRIC FOCUSING

IEF is capable of much higher resolution than cellulose acetate electrophore-sis. Proteins and amino acids all have a pH at which the net charge is zero thatis called the isoelectric point, or pI. At this pH there is no net movement in thepresence of an externally applied electric field. To separate proteins based ontheir isoelectric points, a stable pH gradient needs to be created. This isachieved by applying a set of ampholites with pIs that cover the range of pIs ofthe proteins that are to be separated on a support matrix. During the initialperiod after the current is applied, both the ampholites and the proteins to beseparated move as the pH gradient is formed. If a protein molecule finds itselfon the acidic side of its pI it will migrate to the cathode, and if it finds itself onthe basic side of its pI it will migrate toward the anode (hence the term isoelec-tric focusing). Sharp bands of individual proteins are thus formed. If focusingis continued, the pH gradient is eventually degraded and the protein bands beginto spread. A major factor that degrades the pH gradient is the effect of heat;therefore, efficient cooling is a crucial aspect of all IEF systems (see Notes 12and 13).

3.1.3. More precise Determination HPLC

HPLC, and in particular denaturing HPLC, gives both quantitative and quali-tative information of mouse globins. The combination of screening with IEFand further characterizing the sample with HPLC can eliminate most ambigu-ities in both overlapping bands and identification of partial KOs and deletions.

The equipment used for HPLC is much more expensive, sophisticated, anddifficult to maintain than that used for electrophoresis or IEF, but it is still wellwithin the reach of individual research laboratories. In HPLC, ionic and hydro-phobic interactions of the sample with the supporting matrix are the basis ofseparation. The sample is applied as a thin layer to the top of the column underconditions wherein it interacts strongly with the matrix. The proteins are then


eluted with a developing solution (buffer) of gradually increasing strength, untilall of the proteins are eluted. In cation- and anion-exchange chromatography,the properties of the developing solution that are varied are pH and ionicstrength (salt concentration) and in reverse-phase chromatography, the hydro-phobicity (organic solvent) content is also varied. Hb may be separated as theintact tetramer or, under denaturing conditions, the individual globin chainscan be separated (see Notes 14–16). Human Hbs usually have a relatively smallnumber of possible homotetramers, and analysis of the intact tetramer gener-ally yields readily interpretable results. However, Hb from transgenic mice,because of the possible formation of human-mouse chimeric αβ-dimers andhence a wide variety of tetrameric forms, yields a more readily interpretablechromatogram when denaturing conditions are used and the isolated α- andβ-chains are detected. Very small internal diameters increase column resolu-tion and decrease the amount of sample required at the cost of increased timeper sample (65) (see Note 17).

3.1.4. Refining the Screen

Complete blood counts are sometimes useful for detection of deletions or KOs.The red cells may have lower MCH or MCV. To make use of this approach, oneneeds to establish reference values for mice of known genotype (see Note 18).

3.2. Breeding Strategies for Mice with Severe Phenotypes

3.2.1. Choice of Breeders

As stated earlier, mice with severe phenotypes usually cannot be bred bymating mice homozygous for the transgene and also homozygous for the KOsor deletions necessary for enhancing Hb expression to each other. In general,the best strategy is a male of the desired genotype and a healthy female of arelated genotype. Use of Punnett squares for hybrid and dihybrid crosses tocalculate expected ratios of offspring is desirable because some crosses thatlook possible may have very small predicted yields. Punnett squares can beused to choose the pairs yielding the highest predicted percentage of desiredmice and, when possible, regenerate desirable breeders (see Notes 19–22).

In the breeding schemes described, the best possible outcome is 50% of thepups born with the desired genotype, and a more common predicted outcome isthat between 12.5 and 25% of the pups born will have the desired genotype. Evenin models with moderate severity, such as the S+S-Antilles mouse, many fewerpups are born and survive to 10 d than would be predicted. From theseobservations, it is clear that anticipated production will be low at best and thatmisidentification of breeding mice can cut productivity even further. The needfor efficient screening and rigorous identification of all breeders should be clear.

232 Fabry et al.

3.2.2. Epistatic Efects, Polymorphisms, Founder Effectsand the Need to Backcross

Founder effects (loss of genetic variation when a new colony is formed by avery small number of individuals from a larger population) are present in alltransgenic lines because generation of transgenic mice usually occurs on mixedbackgrounds of several inbred lines, but they are frequently diluted in the ini-tial phase of expanding a newly created transgenic line and in breeding in theKOs or deletions needed to enhance expression of the new transgenes. How-ever, founder effects may reappear (with a different set of polymorphisms)when one successful male fathers most of the mice of a given genotype in acolony. This scenario is probable when severe mice are bred.

Very often the first few (10–20) mice with a given severe genotype are moresevere than their third- and fourth-generation descendants. This is an expectedoutcome since founders are frequently the combination of two or more inbredlines and the usual breeding strategy is to choose the most successful malesand females for further breeding. This strategy, while necessary for efficientpropagation, can rapidly screen out deleterious genes that impact the pathol-ogy of the selected Hb and enhance the frequency of ameliorating genes. Fre-quently a single male may father the majority of pups in a particular line ofmice. These mice will generally have a less severe phenotype than their prede-cessors that are identical in the selected genes but may differ substantially ingenes contributing to epistatic effects. One way to exert partial control overthese effects is to backcross onto an inbred background.

3.3. Record Keeping

Computerized record keeping is the only way to maintain accurate recordsonce a mouse colony begins to grow. The best choice of databases are rela-tional databases, which allow a great deal of flexibility in setting up and subse-quently modifying tables and the ability to query one or more tables in a verysophisticated way. Several popular relational databases are available. Data canalso be transferred to a personal digital assistant for portable access to detailedinformation about individual mice while in the animal colony.

4. Notes1. Epistasis is the interaction between genes at two or more loci, such that the phe-

notype differs from that that would be expected if the loci were expressed inde-pendently.

2. Polymorphism is a condition in which a population possesses more than one alleleat a locus.

3. Examples of epistatic effects in human sickle cell disease are the effect ofα-thalassemia and genetically determined levels of HbF expression.


4. The level of globin chains in mouse red cells is affected by differential assemblyof the globin tetramers and by the fact that human globin mRNA is poorly trans-lated when compared with the endogenous mouse globin (71). Ratios of β-globinmRNA to protein in transgenic mice ranging from 5 to 10 have been reported. Asa consequence, mRNA measurements are poor predictors of the mutant globin inperipheral blood.

5. Some transgenes can be bred to homozygosity, thereby doubling the level of expres-sion. However, many transgenes cannot be bred to homozygosity either becausetheir insertion in the genome led to a recessive lethal mutation or because high-level expression of the protein is not compatible with either fetal or adult life.

6. Both stable and variegating position effects can be age dependent, with expres-sion of the transgene decreasing as the animal ages. It is therefore important tomeasure expression levels at the age at which the experiment will be performed

7. There are two ways to obtain expression of two genes at the same time. The twogenes can be placed in the same construct and either share the same LCR deriva-tive or be controlled by two different LCRs. Alternatively, two independent con-structs each with its own LCR can be coinjected into the fertilized eggs. Suchcoinjection generally results in cointegration of the two transgenes at the samesite of integration, although the proportion of each globin chain produced willvary in each founder.

8. Recently, methods to perform site-specific integration such as recombinase-mediated cassette exchange (RMCE) (72,73) have been developed. RMCE maybe combined with homologous recombination and could provide a powerful wayto produce a mouse model expressing reproducible and predictable levels oftransgenic globins.

9. When an Hb is introduced into a transgenic mouse, it must compete with themurine Hb. Higher levels of expression can be attained by introducing deletions,such as the βmajor deletion (68), or KOs of the murine α- and β-globins(22,55,69,70). In some cases, mice with exclusively human Hb can be readilyproduced (mice with HbA or HbC); however, in other cases (mice with HbS), thephenotype is severe and production of pups with the desired genotype occurs at amuch lower frequency than would be predicted.

10. Hb is a tetramer composed of two αβ dimers. The αβ dimers are formed at thetime of Hb synthesis and are stable under all physiological conditions; denatur-ing or near-denaturing conditions, such as low pH, are required to break up αβdimers. The dimers exchange readily under solution conditions (in the presenceof oxygen), but only homodimers are seen at the end of most techniques used toseparate Hbs.

11. In mice expressing both murine and human Hbs, in addition to αβ dimers that arecomposed of αmouseβmouse or αhumanβhuman, there are αhumanβmouse and αmouseβhuman

dimers. Some inbred lines have multiple α or β globins, further confusing thepicture, especially when some of the bands overlap. The best way to deal withmultiple and overlapping bands is to isolate the bands (most easily done from anIEF plate) and run them on a denaturing HPLC to identify the globins present.

234 Fabry et al.

12. Human globins usually focus much faster than mouse globins. Mouse globinsmay require run times nearly twice as long as human globins. Heating and distor-tion owing to contamination of the sample or the gel with the anodic or cathodicbuffer solutions are common sources of error. In long runs, it may be necessary tostop the run and remove accumulated moisture from the top of the apparatus.

13. When evaluating an unfamiliar Hb that may contain a mixture of both mouse andhuman hemoglobins, it is useful to isolate the bands on the IEF (usually by applyingthe same sample to several slots in the IEF gel, combining the bands at the same level,and extracting them with buffer) and then characterize these bands on the HPLC.

14. Resolution of commercially supplied columns may depend on the characteristicsof the individual column and may require adjustment of the developing buffer tocope with variation. Variations among columns from the same manufacturer withthe same specification may be large. For example, the composition of the startingbuffer may need to be varied by 10% or more to achieve the same elution profile.In addition, peaks that are partially separated on one column may overlap com-pletely on another. Manufacturers frequently allow testing and return of indi-vidual columns if they fail to meet the user’s requirements.

15. Protect columns and extend column life by centrifuging and filtering solutionsprior to application and by using a guard column.

16. There are many factors that may affect expression of Hb transgenes in mice. Thoseoccurring at or prior to translation into protein such as, insertion point, copy number,silencing, translation, and transcription were described in Subheading 2. Thoseoccurring posttranslation such as instability, competition for insufficient α- orβ-chains, and ineffective assembly are also factors that can affect protein expres-sion and interfere with producing healthy mice. Unanticipated Hb instability canoccur when mutations that do not occur in nature are introduced. Most of the knownmutations of human Hb and their effect on stability, p50, and many other factorsare listed in the Globin Gene Server (http://globin.cse.psu.edu). Imbalance betweenα- and β-chains results in thalassemia, and balanced production of chains is largelya matter of luck using the most common current methods for producing transgenicmice (see Subheading 2.) for alternatives. When there are an insufficient numberof either α- or β-chains and two or more types of the complementary chains present,some chains may be more successful in the competition, leading to a smallerpercentage of the poor competitor than would be predicted from chain synthesis orother types of measurement.

17. The percentage of individual globins in peripheral blood may vary with age andeither decrease or increase. Silencing, as described in Subheading 2., usuallyleads to a decrease in expression. In sickle transgenic mice that express HbF inF-cells (i.e., some cells have HbF and some do not), the F-cells may be enriched.That is, cells with HbF may survive longer in the circulation and the percentageof HbF may increase with time (23). As a consequence Hb expression shouldalways be measured at the time of the experiment.

18. Commercial instruments for determination of CBCs usually have a means of bypass-ing automatic dilution (which requires a large sample) and accept prediluted samples


with hematocrits between 8 and 12. A good minimum volume is 300 µL of hemat-ocrit 10, which will allow repeat measurements, although smaller samples can beused. Prediluting the sample allows smaller, mouse-sized samples to be used. It isimportant to remember that the cells will ultimately be suspended in a solution withan osmolarity suitable for human red cells (usually 290–300 mOsm) which is lowerthan that of mouse plasma (about 330 mOsm). This will result in a systematicallyhigher MCV and hematocrit and lower MCHC than would be measured by hand.

19. A simple Punnett square for breeding two mice hemizygous for the NY1transgene will be represented as an “S” and the absence of the transgene will berepresented by a “–”:

– S

– – – –S

S –S SS lethal

This square predicts that of the mice conceived, 25% will have no transgene,50% will be hemizygous for the transgene, and 25% will be homozygous for thetransgene that is lethal. A Punnett square for breeding a male S+S-Antilles mousethat is hemizygous for the NY1 transgene or “S,” hemizygous for the S-Antillestransgene or “A,” and the absence of a transgene will again be represented by“–” with a female mouse that is hemizygous for the NY1 transgene:

– – – – –S –S

– – – – – – – – – – –S– – –S– –

A– A– – – A– – – AS– – AS– –

–S –S –S– – –S–S lethal –S–S lethal

AS AS– – AS– – AS–S lethal AS–S lethal

This square predicts that of the mice conceived, 12.5% will have no transgene,12.5% will be hemizygous for the S-Antilles transgene, 25% will be hemizygousfor the NY1 transgene “S,” 25% will be hemizygous for S+S-Antilles, 12.5%will be homozygous for NY1 that is lethal, and 12.5% will be homozygous forNY1 and hemizygous for S+Antilles that is lethal.

20. Example 1: To breed S+S-Antilles mice several strategies could be used (all ofthese strategies call for using mice homozygous for the βmajor deletion and all ofthe offspring will also be homozygous for the βmajor deletion):a. They could be bred directly to each other. This is undesirable for two reasons:

S+S-Antilles mice are a moderately severe phenotype and the mothers some-

236 Fabry et al.

times die, have small litters, or fail to nurture their pups; and although theS-Antilles line can be homozygous for the transgene, the NY1 line cannot behomozygous for the transgene under any condition, and the combination ofNY1 and homozygosity for S-Antilles is also lethal in the presence of homo-zygosity for the βmajor deletion. This breeding scheme would result in 25% ofthe desired offspring and 25% lethals of various forms.

b. A homozygous S-Antilles female (also homozygous for the βmajor deletion)can be bred to an NY1DD male. This is the most efficient mating and resultsin 50% S+S-Antilles pups and 50% S-Antilles pups.

c. Most other crosses, S+S-Antilles x NY1DD or homozygous S-Antilles x S+S-Antilles, yield 25% S+S-Antilles, but the last cross also generates 25% homo-zygous S-Antilles, which regenerates the breeding stock.

21. Example 2: NY1KO-γL mice have a very short survival (about 40 d) and thefemales either fail to survive, produce small litters (one pup), or fail to nurture thepups born. The solution here is the same as that given for breeding S+S-Antillesmice. Use a male of the desired phenotype and a healthy female. A productivecross uses an NY1KO-γL male and an HbAKO-γLγL female. This cross yields25% of the desired phenotype (NY1KO-γL) divided between mice that are hemi-and homozygous for the γL transgene. The remaining mice are 25% lethal (owingto the absence of an α transgene), 25% HbAKO mice, and 25% HbAHbSKO mice,which can also be used as breeders. If only one of the mice is hemizygous for the γLtransgene, then the yield of NY1KO-γL mice drops to 12.5%.

22. Example 3: BERK mice (21) are bred using a similar approach. Once again, femaleBERK mice are unsuccessful breeders. A male BERK full KO mouse (whichexpresses only human Hb) is mated to a female BERK mouse that is hemizygousfor the βmajorβminor KO and may be either hemi- or homozygous for the BERKtransgene. The BERK transgene is weakly expressed in mice that are hemizygousfor the βmajorβminor KO and the percentage of βS of all β-chains reaches only 15 or30% for the hemi- or homozygote for the BERK transgene, respectively. The lowlevel of βS expression in mice hemizygous for the βmajorβminor KO is consistent withthe observed thalassemia of these mice and the lack of severity in mice hemizygousfor the βmajorβminor KO. Both types of female yield 25% of the desired BERK fullKO and a mix of mice hemizygous for the βmajorβminor KO.

References1. Rubin, E. M., Lu, R. H., Cooper, S., Mohandas, N., and Kan, Y. W. (1988) Intro-

duction and expression of the human Bs-globin gene in transgenic mice. Am. J.Hum. Genet. 42, 585–591.

2. Rhoda, M. D., Domenget, C., Vidaud, M., Bardakdjian Michau, J., RouyerFessard, P., Rosa, J., and Beuzard, Y. (1988) Mouse α-chains inhibit polymeriza-tion of hemoglobin induced by human βS or βS-Antilles chains. Biochim. Biophys.Acta. 952, 208–212.

3. Greaves, D. R., Fraser, P., Vidal, M. A., Hedges, M. J., Ropers, D., Luzzatto, L.,and Grosveld, F. (1990) A transgenic mouse model of sickle cell disorder [seecomments]. Nature 343, 183–185.


4. Ryan, T. M., Townes, T. M., Reilly, M. P., Asakura, T., Palmiter, R. P., andBehringer, R. R. (1990) Human sickle hemoglobin in transgenic mice. Science247, 566–568.

5. Trudel, M., Saadane, N., Garel M-C, Bardakdjuan-Michau, J., Blouquit, Y.,Guerquin-Kern J-L, Rouyer-Fessard, P., Vidaud, D., Pachniss, A., Romeo P-H,Beuzard, Y., and Costantini, F. M. (1991) Towards a transgenic mouse model ofsickle cell disease: hemoglobin SAD. EMBO J. 10, 3157–3168.

6. de Franceschi, L., Saadane, N., Trudel, M., Alper, S. L., Brugnara, C., andBeuzard, Y. (1994) Treatment with oral clotrimazole blocks Ca(2+)-activated K+transport and reverses erythrocyte dehydration in transgenic SAD mice. A modelfor therapy of sickle cell disease. J. Clin. Invest. 93, 1670–1676.

7. de Franceschi, L., Villa-Moruzzi, E., Fumagalli, L., Brugnara, C., Turrini, F.,Motta, R., Veghini, E., Corato, C., Alper, S. L., and Berton, G. (2001) K-Clcotransport modulation by intracellular Mg in erythrocytes from mice bred forlow and high Mg levels. Am. J. Physiol. Cell Physiol. 281, C1385–C1395.

8. Blouin, M. J., Beauchemin, H., Wright, A., De Paepe, M., Sorette, M., Bleau, A.M., Nakamoto, B., Ou, C. N., Stamatoyannopoulos, G., and Trudel, M. (2000)Genetic correction of sickle cell disease: insights using transgenic mouse models[in process citation]. Nat. Med. 6, 177–182.

9. Fabry, M. E., Costantini, F., Pachnis, A., Suzuka, S. M., Bank, N., Aynedjian, H.S., Factor, S. M., and Nagel, R. L. (1992) High expression of human βS- andα-globins in transgenic mice: erythrocyte abnormalities, organ damage, and theeffect of hypoxia. Proc. Natl. Acad. Sci. USA 89, 12,155–12,159.

10. Fabry, M. E., Nagel, R. L., Pachnis, A., Suzuka, S. M., and Costantini, F. (1992) Highexpression of human βS- and α-globins in transgenic mice: hemoglobin compositionand hematological consequences. Proc. Natl. Acad. Sci. USA 89, 12,150–12,154.

11. Lutty, G. A., McLeod, D. S., Pachnis, A., Costantini, F., Fabry, M. E., and Nagel,R. L. (1994) Retinal and choroidal neovascularization in a transgenic mouse modelof sickle cell disease. Am. J. Path. 145, 490–497.

12. Hood, A. T., Fabry, M. E., Costantini, F., Nagel, R. L., and Shear, H. L. (1996)Protection from lethal malaria in transgenic mice expressing sickle hemoglobin.Blood 87, 1600–1603.

13. Kaul, D. K. and Hebbel, R. P. (2000) Hypoxia/reoxygenation causes inflamma-tory response in transgenic sickle mice but not in normal mice [see comments].J. Clin. Invest. 106, 411–420.

14. Fabry, M. E., Sengupta, A., Suzuka, S. M., Costantini, F., Rubin, E. M.,Hofrichter, J., Christoph, G. W., Manci, E. A., Culberson, D., Factor, S. M., andNagel, R. L. (1995) A second generation transgenic mouse model expressing bothhemoglobin S (HbS) and HbS-Antilles results in increased phenotypic severity.Blood 86, 2419–2428.

15. Kaul, D. K., Fabry, M. E., Costantini, F., Rubin, E. M., and Nagel, R. L. (1995) Invivo demonstration of red cell-endothelial interaction, sickling and alteredmicrovascular response to oxygen in the sickle transgenic mouse. J. Clin. Invest.96, 2845–2853.

238 Fabry et al.

16. Kaul, D. K., Liu, X. D., Fabry, M. E., and Nagel, R. L. (1998) Increased nitricoxide synthase expression in transgenic sickle mice is associated with relativehypotension and altered microvascular response. Blood 92, 330a.

17. Romero, J. R., Suzuka, S. M., Nagel, R. L., and Fabry, M. E. (2002) Argininesupplementation of sickle transgenic mice reduces red cell density and Gardoschannel activity. Blood 99, 1103–1108.

18. Enwonwu, C. O. (1989) Increased metabolic demand for arginine in sickle cellanemia. Med. Sci. Res. 17, 997–998.

19. Fabry, M. E., Kennan, R. P., Paszty, C., Costantini, F., Rubin, E. M., Gore, J. C.,and Nagel, R. L. (1996) Magnetic resonance evidence of hypoxia in a homozy-gous α-knockout of a transgenic mouse model for sickle cell disease. J. Clin.Invest. 98, 2450–2455.

20. Ryan, T. M., Ciavatta, D. J., and Townes, T. M. (1997) Knockout-transgenicmouse model of sickle cell disease [see comments]. Science 278, 873–876.

21. Paszty, C., Brion, C. M., Manci, E., Witkowska, H. E., Stevens, M. E., Mohandas,N., and Rubin, E. M. (1997) Transgenic knockout mice with exclusively humansickle hemoglobin and sickle cell disease [see comments]. Science 278, 876–878.

22. Chang, J. C., Lu, R., Lin, C., Xu, S. M., Kan, Y. W., Porcu, S., Carlson, E.,Kitamura, M., Yang, S., Flebbe-Rehwaldt, L., and Gaensler, K. M. (1998)Transgenic knockout mice exclusively expressing human hemoglobin S aftertransfer of a 240-kb betas-globin yeast artificial chromosome: a mouse model ofsickle cell anemia. Proc. Natl. Acad. Sci. USA 95, 14,886–14,890.

23. Fabry, M. E., Suzuka, S. M., Weinberg, R. S., Lawrence, C., Factor, S. M.,Gilman, J. G., Costantini, F., and Nagel, R. L. (2001) Second generation knockoutsickle mice: the effect of HbF. Blood 97, 410–418.

24. Paszty, C. (1997) Transgenic and gene knock-out mouse models of sickle cellanemia and the thalassemias [review]. Curr. Opin. Hematol. 4, 88–93.

25. Poillon, W. N., Kim, B. C., and Castro, O. (1998) Intracellular hemoglobin S poly-merization and the clinical severity of sickle cell anemia. Blood 91, 1777–1783.

26. Fabry, M. E., Romero, J. R., Suzuka, S. M., Gilman, J. G., Feeling-Taylor, A.,Odunusi, E., Factor, S. M., Bouhassira, E. E., Lawrence, C., and Nagel, R. L.(2000) Hemoglobin C in transgenic mice: effect of HbC expression from foundersto full mouse globin knockouts [In Process Citation]. Blood Cells Mol. Dis. 26,331–347.

27. Fabry, M. E., Kaul, D. K., Raventos Suarez, C., Chang, H., and Nagel, R. L.(1982) SC erythrocytes have an abnormally high intracellular hemoglobin con-centration: pathophysiological consequences. J. Clin. Invest. 70, 1315–1319.

28. Shear, H. L. (1993) Transgenic and mutant animal models to study mechanismsof protection of red cell genetic defects against malaria. Experientia 49, 37–42.

29. Pasvol, G., Weatherall, D. J., and Wilson, R. J. (1977) Effects of foetal haemoglo-bin on susceptibility of red cells to Plasmodium falciparum. Nature 270, 171–173.

30. Kaul, D. K., Nagel, R. L., Llena, J. F., and Shear, H. L. (1994) Cerebral malaria inmice: demonstration of cytoadherence of infected red blood cells and micro-rheologic correlates. Am. J. Trop. Med. Hyg. 50, 512–521.


31. Shear, H. L., Grinberg, L., Gilman, J., Fabry, M. E., Stamatoyannopoulos, G.,Goldberg, D. E., and Nagel, R. L. (1998) Transgenic mice expressing human fetalglobin are protected from malaria by a novel mechanism. Blood 92, 2520–2526.

32. Starck, J., Sarkar, R., Romana, M., Bhargava, A., Scarpa, A. L., Tanaka, M.,Chamberlain, J. W., Weissman, S. M., and Forget, B. G. (1994) Developmentalregulation of human g. Blood 84, 1656–1665.

33. Peterson, K. R. and Stamatoyannopoulos, G. (1993) Role of gene order in devel-opmental control of human g. Mol. Cell Biol. 13, 4836–4843.

34. Hanscombe, O., Whyatt, D., Fraser, P., Yannoutsos, N., Greaves, D., Dillon, N.,and Grosveld, F. (1991) Importance of globin gene order for correct developmen-tal expression. Genes Dev. 5, 1387–1394.

35. Grosveld, F., van Assendelft, G. B., Greaves, D. R., and Kollias, G. (1987) Posi-tion-independent, high-level expression of the human beta-globin gene intransgenic mice. Cell 51, 975–985.

36. Forrester, W. C., Novak, U., Gelinas, R., and Groudine, M. (1989) Molecularanalysis of the human beta-globin locus activation region. Proc. Natl. Acad. Sci.USA 86, 5439–5443.

37. Sadelain, M., Wang, C. H., Antoniou, M., Grosveld, F., and Mulligan, R. C. (1995)Generation of a high-titer retroviral vector capable of expressing high levels ofthe human beta-globin gene. Proc. Natl. Acad. Sci. USA 92, 6728–6732.

38. Emery, D. W., Chen, H., L. i., Q., and Stamatoyannopoulos, G. (1998) Develop-ment of a condensed locus control region cassette and testing in retrovirus vectorsfor A gamma-globin. Blood Cells Mol. Dis. 24, 322–339.

39. Einerhand, M. P., Antoniou, M., Zolotukhin, S., Muzyczka, N., Berns, K. I.,Grosveld, F., and Valerio, D. (1995) Regulated high-level human beta-globin geneexpression in erythroid cells following recombinant adeno-associated virus-mediated gene transfer. Gene Ther. 2, 336–343.

40. Hargrove, P. W., Vanin, E. F., Kurtzman, G. J., and Nienhuis, A. W. (1997) High-level globin gene expression mediated by a recombinant adeno-associated virusgenome that contains the 3' gamma globin gene regulatory element and integratesas tandem copies in erythroid cells. Blood 89, 2167–2175.

41. Garrick, D., Fiering, S., Martin, D. I., and Whitelaw, E. (1998) Repeat-inducedgene silencing in mammals. Nat. Genet. 18, 56–59.

42. Porcu, S., Kitamura, M., Witkowska, E., Zhang, Z., Mutero, A., Lin, C., Chang,J., and Gaensler, K. M. (1997) The human beta globin locus introduced by YACtransfer exhibits a specific and reproducible pattern of developmental regulationin transgenic mice. Blood 90, 4602–4609.

43. Alami, R., Greally, J. M., Tanimoto, K., Hwang, S., Feng, Y. Q., Engel, J. D.,Fiering, S., and Bouhassira, E. E. (2000) Beta-globin YAC transgenes exhibituniform expression levels but position effect variagation in mice. Hum. Mol.Genet. 9(4), 631–636.

44. Kaufman, R. M., Pham, C. T., and Ley, T. J. (1999) Transgenic analysis of a100-kb human beta-globin cluster-containing DNA fragment propagated as abacterial artificial chromosome. Blood 94, 3178–3184.

240 Fabry et al.

45. Ryan, T. M., Behringer, R. R., Townes, T. M., and Palmiter, R. D., Brinster, R. L.(1989) High-level erythroid expression of human alpha-globin genes in transgenicmice. Proc. Natl. Acad. Sci. USA 86, 37–41.

46. Jahner, D., Stuhlmann, H., Stewart, C. L., Harbers, K., Lohler, J., Simon, I., andJaenisch, R. (1982) De novo methylation and expression of retroviral genomesduring mouse embryogenesis. Nature 298, 623–628.

47. Rivella, S. and Sadelain, M. (1998) Genetic treatment of severe hemoglobinopa-thies: the combat against transgene variegation and transgene silencing. Semin.Hematol. 35, 112–125.

48. Lois, C., Hong, E. J., Pease, S., Brown, E. J., and Baltimore, D. (2002) Germlinetransmission and tissue-specific expression of transgenes delivered by lentiviralvectors. Science 295, 868–872.

49. May, C. and Sadelain, M. (2001) A promising genetic approach to the treatmentof beta-thalassemia. Trends Cardiovasc. Med. 11, 276–280.

50. Pawliuk, R., Westerman, K. A., Fabry, M. E., Payen, E., Tighe, R., Bouhassira, E.E., Acharya, S. A., Ellis, J., London, I. M., Eaves, C. J., Humphries, R. K.,Beuzard, Y., Nagel, R. L., and Leboulch, P. (2001) Correction of sickle cell dis-ease in transgenic mouse models by gene therapy. Science 294, 2368–2371.

51. Peterson, K. R., Zitnik, G., Huxley, C., Lowrey, C. H., Gnirke, A., Leppig, K. A.,Papayannopoulou, T., and Stamatoyannopoulos, G. (1993) Use of yeast artificialchromosomes (YACs) for studying control of gene expression: correct regulationof the genes of a human beta-globin locus YAC following transfer to mouse eryth-roleukemia cell lines. Proc. Natl. Acad. Sci. USA 90, 11,207–11,211.

52. Gaensler, K. M., Kitamura, M., and Kan, Y. W. (1993) Germ-line transmission anddevelopmental regulation of a 150-kb yeast artificial chromosome containing the humanbeta-globin locus in transgenic mice. Proc. Natl. Acad. Sci. USA 90, 11,381–11,385.

53. Strouboulis, J., Dillon, N., and Grosveld, F. (1992) Developmental regulation of acomplete 70-kb human beta-globin locus in transgenic mice. Genes Dev. 6, 1857–1864.

54. Chang, J., Lu, R. H., Xu, S. M., Meneses, J., Chan, K., Pedersen, R., and Kan, Y.W. (1996) Inactivation of mouse alpha-globin gene by homologous recombina-tion: mouse model of hemoglobin H disease. Blood 88, 1846–1851.

55. Ciavatta, D. J., Ryan, T. M., Farmer, S. C., and Townes, T. M. (1995) Mousemodel of human beta zero thalassemia: targeted deletion of the mouse beta maj-and beta min-globin genes in embryonic stem cells. Proc. Natl. Acad. Sci. USA92, 9259–9263.

56. Yang, B., Kirby, S., Lewis, J., Detloff, P. J., Maeda, N., and Smithies, O. (1995) Amouse model for beta 0-thalassemia. Proc. Natl. Acad. Sci. USA 92, 11,608–11,612.

57. Shehee, W. R., Oliver, P., and Smithies, O. (1993) Lethal thalassemia after inser-tional disruption of the mouse major adult beta-globin gene. Proc. Natl. Acad.Sci. USA 90, 3177–3181.

58. Witkowska, H. E., Lubin, B. H., Beuzard, Y., et al. (1991) Sickle cell disease in apatient with sickle cell trait and compound heterozygosity for hemoglobin S andhemoglobin Quebec-Chori. N. Engl. J. Med. 325, 1150–1154.

59. Light-Wahl, K. J., Loo, J. A., Edmonds, C. G., Smith, R. D., Witkowska, H. E.,Shackleton, C. H., and Wu, C. S. (1993) Collisionally activated dissociation and


tandem mass spectrometry of intact hemoglobin beta-chain variant proteins withelectrospray ionization. Biol. Mass Spectrom. 22, 112–120.

60. Bakhtiar, R., W. u., Q., Hofstadler, S. A., and Smith, R. D. (1994) Charge statespecific facile gas-phase cleavage of Asp 75-Met 76 peptide bond in the alpha-chain of human apohemoglobin probed by electrospray ionization mass spectrom-etry. Biol. Mass Spectrom. 23, 707–710.

61. Ferranti, P., Carbone, V., Sannolo, N., Fiume, I., and Malorni, A. (1993) Mass spec-trometric analysis of rat hemoglobin by FAB-overlapping: primary structure of thealpha-major and of four beta constitutive chains. Intl. J. Biochem. 25, 1943–1950.

62. Ueda, S. and Schneider, R. G. (1969) Rapid differentiation of polypeptide chains ofhemoglobin by cellulose acetate electrophoresis of hemolylsates. Blood 34, 230–235.

63. Schneider, R. G., Hosty, T. S., Tomlin, G., and Atkins, R. (1974) Identification ofhemoglobins and hemoglobinopathies by electrophoresis on cellulose acetateplates impregnated with citrate agar. Clin. Chem. 20, 74–77.

64. Whitney, J. B. (1978) Simplified typing of mouse hemoglobin (Hbb) phenotypesusing cystamine. Biochem. Genet. 16, 667–672.

65. Huisman, T. H. (1987) Separation of hemoglobins and hemoglobin chains by high-performance liquid chromatography [review]. J. Chromatog. 418, 277–304.

66. Rubin, E. M., Witkowska, H. E., Spangler, E., Curtin, P., Lubin, B. H., Mohandas,N., and Clift, S. M. (1991) Hypoxia-induced in vivo sickling of transgenic mousered cells. J. Clin. Invest. 87, 639–647.

67. Arcasoy, M. O., Romana, M., Fabry, M. E., Skarpidi, E., Nagel, R. L., and Forget,B. G. (1997) High levels of human gamma-globin gene expression in adult micecarrying a transgene of deletion-type hereditary persistence of fetal hemoglobin.Mol. Cell. Biol. 17, 2076–2089.

68. Skow, L. C., Burkhart, B. A., Johnson, F. M., Popp, R. A., Popp, D. M., Goldberg,S. Z., Anderson, W. F., Barnett, L. B., and Lewis, S. E. (1983) A mouse model forbeta-thalassemia. Cell 34, 1043–1052.

69. Paszty, C., Mohandas, N., Stevens, M. E., Loring, J. F., Liebhaber, S. A., Brion,C. M., and Rubin, E. M. (1995) Lethal alpha-thalassaemia created by gene target-ing in mice and its genetic rescue. Nat. Genet. 11, 33–39.

70. Yang, B., Kirby, S., Lewis, J., Detloff, P. J., Maeda, N., and Smithies, O. (1995)A mouse model for β°-thalassemia. Proc. Natl. Acad. Sci. USA 92, 11,608–11,612.

71. Alami, R., Gilman, J. G., Feng, Y. Q., Marmorato, A., Rochlin, I., Suzuka, S. M.,Fabry, M. E., Nagel, R. L., and Bouhassira, E. E. (1999) Anti-beta s-ribozymereduces beta s mRNA levels in transgenic mice: potential application to the genetherapy of sickle cell anemia. Blood Cells Mol. Dis. 25, 110–119.

72. Bouhassira, E. E., Westerman, K., and Leboulch, P. (1997) Transcriptionalbehavior of LCR enhancer elements integrated at the same chromosomal locus byrecombinase-mediated cassette exchange. Blood 90, 3332–3344.

73. Feng, Y. Q., Seibler, J., Alami, R., Eisen, A., Westerman, K. A., Leboulch, P.,Fiering, S., and Bouhassira, E. E. (1999) Site-specific chromosomal integration inmammalian cells: highly efficient CRE recombinase-mediated cassette exchange.J. Mol. Biol. 292, 779–785.

242 Fabry et al.

Single Globin-Chain Expression and Purification 243

14

243


Recombinant Single Globin-ChainExpression and Purification

Kazuhiko Adachi

1. IntroductionThe development of molecular biological techniques to selectively replace

individual amino acids has furthered our understanding of the relationshipbetween the structure and function of hemoglobin (Hb). Initial reportsdescribed production of normal and modified human globin chains in bacteriaemploying a fusion-protein expression vector (1). An expression system waslater developed in which α- and β-globin chains were coexpressed, resulting inthe formation of soluble tetrameric Hb in yeast (2,3). Coexpression of humanα and β globin in Escherichia coli that resulted in the formation of solubletetrameric Hbs was described (4), as well as a system for high expression ofinsoluble β-globin chains in E. coli. (5). These last two systems, however, resultin globin chains containing an N-terminal methionine that may affect the func-tional properties of Hb. In 1993, Shen et al. (6) expressed soluble Hb tetramerslacking the N-terminal methionine in bacteria by coexpression of α- and β-globincDNAs with methionine aminopeptidase (MAP) cDNA.

To further understand Hb assembly and folding, production of solublesingle-chain Hb variants is critical; however, expression of recombinant,soluble individual globin chains has not been realized to date (4,5,7,8). Globinsexpressed in cells with and without additional hemin often form insoluble inclu-sion bodies that require harsh denaturing conditions for solubilization. After solu-bilization, chains must then be renatured in vitro and form correctly folded nativeglobin chains, which then must properly assemble to form authentic Hb tetram-ers (1,7–9). This process is labor-intensive, and efficiency of tetramer reconstitu-tion from denatured globin chains is very low. In addition, insoluble apo-α-globinchains expressed in E. coli were refolded with heme after solubilization in 0.1 M

244 Adachi

NaOH in the absence of native β-chains (10). However, the functional proper-ties and heme environment of these resolubilized recombinant α-chains werenot exactly the same as those of normal human α-chains (10). Furthermore,differences between Thr at γ112 at the α1γ interaction site instead of Cys atβ112 make it difficult to isolate individual native, heme-intact γ-chains fromnative α2γ2 tetramers using p-mercuribenzoate (11). It is therefore critical toexpress soluble globin chains in vivo for evaluation of folding and assembly ofα-globin chains with non-α-globin chains. We can now express soluble authen-tic β-, α-, and γ-globin chains employing an E. coli expression system thatcontains cDNAs for human globin chains and MAP (12–14).

2. Materials2.1. Generation of Plasmids for Soluble Recombinant HumanGlobin Chains in E. Coli

The original pHE2 plasmid (kindly provided by Drs. C. Ho and T.-J. Shen,Carnegie Mellon University, Pittsburgh, PA) was constructed to coexpress α- andβ-globin chains with MAP (10) under transcriptional control of a ptac pro-moter in order to obtain soluble authentic human HbA without N-terminalmethionine (6).

1. Expression vector pHE 2β: To obtain authentic β-globin chain expression vectorpHE 2β, the α-globin cDNA is removed from pHE2 (10) by digestion with XbaI(Gibco-BRL, Gaithersburg, MD), and the 6.3-kb fragment that contains β globinand MAP cDNAs is purified using a Gene Clean II kit (BIO 101, Vista, CA) andligated by incubation with T4 DNA ligase (Gibco-BRL). A diagram of the β globinexpressing plasmid pHE2β is shown in Fig. 1.

2. Expression vector pHE 2α: To obtain expression α-globin chain expression vec-tor pHE 2α, β-globin cDNA is removed from pHE2 plasmid (10) by digestionwith PstI and NheI, and the NheI end is filled by the Klenow fragment. The PstIend is cleaved by T4 DNA polymerase and the 6.3-kb fragment that contains αglobin and MAP cDNAs is then purified using a Gene Clean II kit and ligated byincubation with T4 DNA ligase (Fig. 1).

3. Expression vector pHE 2γ: To obtain expression γ-globin chain expression vec-tor pHE 2γ, human Gγ-globin cDNA (441 bp) can be generated by polymerasechain reaction (PCR) from pGS 389γ, which we previously used as a yeast expres-sion vector and which contains α- and Gγ-globin cDNAs (15). Two primers, no. 1(5'-TACCGTTCTGACTTCGAAATA-3' linked to 5'-sequence that contains aPstI site and complementarity to a ribosome binding site [RBS] present in pHE2)and no. 2 (5'-TGTGAAATGACCCATATGTTATTCCTCCT-3', which containsa 3'-end sequence corresponding to the RBS in pHE2 followed by a 24-bpcomplementary overlap to primer no. 3), can be used to generate PCR fragment1. Fragment 1 therefore contains a PstI site linked to an RBS. Two other primers,


no. 3 (5'-GAATAACATATGGGTCATTTCACAGAGGA-3', which is comple-mentary to the RBS and 5'-untranslated region of γ-globin cDNA in pGS 389γ)and no. 4 (5'-GACCGCTTCTGCGTTCGTA-3', which contains an NheI site fol-lowed by the 3'-end γ-cDNA sequence), can be used to generate PCR fragment 2.We have created a third PCR product that contains PCR fragments 1 and 2 byoverlap PCR using primers no. 1 and no. 4. Annealing of PCR fragments 1 and 2can be facilitated by sequence complementarity of primers no. 2 and no. 3 origi-nally used to generate PCR fragments 1 and 2, respectively. The resultant PCRfragment 3 contains a 5' PstI site linked to an RBS followed by full-length humanγ-globin cDNA linked to a 3'NheI site. PCR fragment 3 is isolated, digested withPstI and NheI, and then exchanged for β-globin cDNA in the vector pHE 2 (10)after PstI and NheI digestion to remove the β-globin cDNA insert. The resultingvector pHE 2αγ contains both α- and γ-globin cDNAs for expressing HbF inbacteria. The α-globin cDNA insert is removed following digestion with XbaI,and the remaining fragment is isolated and religated to generate pHE2γ, whichcan be used for expression of individual γ-chains in bacteria. A diagram ofplasmid pHE2γ which expresses γ-globin chain would be the same as that shownin Fig. 1.

Fig. 1. Expression vector pHE2β containing human β-globin and mAP cDNAs.Ptac, Ori, 5S, and T1T2 refer to tac promoter, origin of DNA replication, 5S rRNAgene, and transcriptional terminators, respectively.

246 Adachi

3. Methods (see Notes 1–3)3.1. Expression of βββββ-Globin Chains

To achieve expression of authentic β-globin chain alone, the plasmid is trans-fected into E. coli (JM 109) (Promega, Madison, WI), and the bacteria are grown at30˚C with shaking at 225 rpm in 1 L terrific broth (TB) containing 10 µM ampicil-lin to a density of about 3 × 1010 bacteria/mL. β-Globin chain expression is inducedfor 2 h at 30˚C by the addition of 0.2 mM isopropyl-β-D-thiogalactoside (IPTG)(Fisher, Fair Lawn, NJ), and cultures should then be supplemented with 10 µMhemin (Aldrich, Inc., Milwaukee, WI) and 0.1% (w/v) glucose.

3.2. Isolation and Purification of Soluble βββββ-Globin Chains

After a 2-h incubation, bacterial cultures should be saturated with CO gas toconvert expressed β globin to the CO form. Bacteria are pelleted by centrifug-ing at 2300g for 10 min; resuspended in 10 mM phosphate buffer, pH 8.6;lysed by sonication at 4˚C; and then centrifuged at 4°C for 45 min at 27,000g.Soluble β-globin chains are purified as described as follows at 4°C, and COgas should be introduced at each purification step to maintain β globin in theCO form. The supernatant is then applied to a DEAE-cellulose (Sigma, St.Louis, MO) column equilibrated with 10 mM phosphate buffer, pH 8.6. Thiscolumn is washed with 5 column vol of buffer and thereafter fractions are elutedwith 50 mM phosphate buffer, pH 6.3. The partially purified β-globin fractionis rechromatographed on a Mono Q column equilibrated with 10 mM phos-phate buffer, pH 8.6, and further purified with a linear gradient from 10 mMphosphate buffer, pH 8.6, to 50 mM phosphate buffer, pH 6.3. The purifiedsoluble β globin in the CO form is then concentrated by Centriprep 10 (Amicon,Beverly, MA) and stored at –70˚C before use. Separation of polymeric andmonomeric forms of β globin can be achieved by gel filtration on a Superose12 column in 100 mM potassium phosphate buffer, pH 7.0.

3.3. Expression of ααααα-Globin Chains

To achieve expression of individual α-globin chains, the plasmid (pHE 2α)is transfected into E. coli (JM 109), and the bacteria are grown at 30˚C withshaking at 225 rpm in 1 L of TB containing 10 µM ampicillin to a density ofabout 3 × 1010 bacteria/mL. Expression of α globin is then induced for 2 h at30˚C by the addition of 0.2 mM IPTG, and cultures are supplemented with 30 µMhemin and 0.1% (w/v) glucose.

3.4. Isolation and Purification of Soluble α-Globin Chains

After a 2-h incubation and before cell lysis, bacterial cultures are saturatedwith CO gas to convert expressed α globin to the CO form. Bacteria is then


pelleted by centrifuging at 2300g for 20 min; resuspended in 10 mM phosphatebuffer, pH 6.0; lysed by sonication at 4˚C, and centrifuged at 4°C for 45 min at27,000g. Soluble α-globin chains can be purified as described below at 4˚C,and CO gas should be introduced at each purification step to maintain α globinin the CO form. The supernatant is then applied to a CM-52 column equili-brated with 10 mM phosphate buffer, pH 6.0. The column is washed with 5 col-umn volumes of buffer, and thereafter fractions are eluted with 50 mMphosphate buffer, pH 8.3. The partially purified α-globin fraction is rechrom-atographed on a Source 15S column (Pharmacia Biotech, Piscataway, NJ)equilibrated with 40 mM Bis-Tris buffer, pH 5.8. α Globin is eluted followinga linear gradient from 40 mM Bis-Tris buffer pH 5.8, to 40 mM Bis-Tris buffer,containing 0.2 M NaCl, pH 6.3. The purified soluble α globin in the CO formcan be concentrated by Centriprep 10 and be stored at –70°C before use.

3.5. Expression of γγγγγ-Globin Chains

For expression of individual γ-globin chains, human Gγ-globin cDNA (441bp) can be generated by the same conditions are used for expression of γ-chainvariants as for expression of β- and α-chains.

3.6. Isolation and Purification of Soluble γγγγγ-Globin Chains

After a 2-h induction and before cell lysis, bacterial cultures are saturatedwith CO gas to convert expressed γ-globin chains to the CO form. Bacteria arethen pelleted by centrifuging at 2300g for 20 min; resuspended in 10 mM phos-phate buffer, pH 6.0; lysed by sonication at 4°C; and centrifuged at 4°C for45 min at 27,000g. Soluble γ-globin chains can be purified as described asfollows at 4°C. CO gas should be introduced at each purification step to main-tain γ globin in the CO form. The supernatant containing γ-globin chains isapplied to a Q-Sepharose column equilibrated with 10 mM phosphate buffer,pH 8.0. The column is washed with 5 column vol of buffer, and the γ-globinfraction is eluted with 50 mM phosphate buffer, pH 6.3. The partially purifiedγ-globin fraction is rechromatographed on a Source 15S column equilibratedwith 40 mM Bis-Tris/HCl buffer, pH 5.8, and γ globin are eluted following alinear gradient to 40 mM Bis-Tris/HCl buffer containing 0.2 M NaCl, pH 6.3.The purified soluble γ globin is then concentrated by Centriprep 10 (Amicon)and stored at –70°C before use.

3.7. Biochemical Characterization of Purified Globin Chains

Molecular mass and sample purity of expressed globin chains can be asses-sed by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) as previously described (16). In addition, mass determination shouldbe done to confirm independently results from SDS-PAGE and to evaluate

248 Adachi

N-terminal methionine cleavage from globin chains. Electrospray ionizationmass spectrometry can be performed on a VG BioQ triple quadrupole massspectrometer (Micromass, Altrincham, Cheshire, UK) (17). Purified globinchains should also be analyzed by cellulose acetate electrophoresis and mobili-ties compared with those of authentic human globin chains on Titan III mem-branes at pH 8.6 with Super-Heme buffer (Helena Laboratories, Beaumont,TX). Absorption spectra of the purified globin chains in the CO form should berecorded using a spectrophotometer. CO of Hbs can be removed by first blow-ing oxygen across the surface of the Hb solution on ice in a rotary evaporatorunder a 150-W floodlight bulb. Assembled tetramers using recombinant α andnon-α single chains can be characterized after separation from excess freeglobin chains by fast protein liquid chromatography using a Source 15S col-umn. Formation of α2β2 tetramers can also be monitored by high-performanceliquid chromatography using a POROS HQ (10 × 0.46 cm) column (PerSeptive,Framingham, MA) and by cellulose acetate electrophoresis on Titan III mem-branes at pH 8.6 with Super-Heme buffer. Oxygen-dissociation curves ofassembled and human native tetramers can be determined in 50 mM Bis-Trisbuffer containing 0.1 M NaCl and 5 mM EDTA, pH 7.2, at 20˚C using a HemoxAnalyzer (TCS, Huntingdon Valley, PA) (18).

4. Notes1. Major critical factors in the production of single globin chains with high yields

are (1) the use of fresh replated bacterial cells with the plasmids using fresh mediarather than frozen bacterial cells, and (2) the prevention oxidation of Hb by bub-bling with CO gas after expression and prior to each purification step to maintainglobin chains in the CO form.

2. Purified β-chains migrate predominantly as 32-kDa β-chain dimers causedmainly by oxidization of β93 Cys, which results in formation of disulfide-linkeddimers (12). Addition of 20 mM dithiothreitol to β-chains in solution convertsthe dimers to monomers.

3. Globin-chain variants can be constructed and expressed using the single-chainpHE 2β, 2α, or 2γ plasmid vectors, which contain cDNAs coding for each globinchain and MAP. The basic strategy for generation of amino acid variants by site-specific mutagenesis of normal single chains involves recombination/PCR asdescribed previously (18). Clones should be subjected to DNA sequence analysisof the entire globin cDNA region using site-specific primers and fluorescentlytagged terminators in a cycle-sequencing reaction in which extension productsare analyzed on an automated DNA sequencer.

References1. Nagai, K., and Thogerson, H. C. (1984) Generation of β-globin by sequence-specific

proteolysis of a hybrid protein produced in Escherichia coli. Nature 309, 810–812.


2. Wagenbach, M., O’Rourke, K., Vitez, L., Wieczorek, A., Hoffman, S., Durfee, S.,Tedesco, J., and Stetler, G. (1991) Synthesis of wild type and mutant human hemo-globins in Saccharomyces clevisiae. Bio/Technology 9, 57–61.

3. Adachi, K., Konitzer, P., Lai, C. H., Kim, J., and Surrey, S. (1992) Oxygen bind-ing and other physical properties of human hemoglobin made in yeast. ProteinEngin. 5, 807–810.

4. Hoffman, S. J., Looker, D. L., Roehrich, J. M., Cozart, P. E., Durfee, S. L., Tedesco,J. L., and Stetler, G. L. (1990) Expression of fully functional tetrameric humanhemoglobin in Escherichia coli. Proc. Natl. Acad. Sci. USA 87, 8521–8525.

5. Herman, R. A., Hui, H. L., Andracki, M. E., Nobel, R. W., Sligar, S. G., Walder,J. A., and Walder, R. Y. (1992) Human hemoglobin expression in Escherichiacoli: importance of optimal codon usage. Biochemistry 31, 8619–8628.

6. Shen, T-J., Ho, N. T., Simplaceanu, V., Zou, M., Green, B. N., Tam, M. F., andHo, C. (1993) Production of unmodified human adult hemoglobin in Escherichiacoli. Proc. Natl. Acad. Sci. USA 90, 8108–8112.

7. Groebe, D. R., Busch, M. R., Tsao, T. Y. M., Luh, F. Y., Tam, M. F., Chung, A.E., Gaskell, M., Liebhaber, S. A., and Ho, C. (1992) High-level production ofhuman α-and β-globins in insect cells. Protein Expression Purif. 3, 134–141.

8. Fronticelli, C., O’Donnell, J. K., and Brinigar, W. S. (1991) Recombinant humanhemoglobin: expression and refolding of β-globin from Escherichia coli. J. Pro-tein Chem. 10, 495–501.

9. Nagai, K., and Thogerson, H. S. (1987) Synthesis and sequence-specific proteoly-sis of hybrid proteins produced in Escherichia coli. Methods Enzymol. 153(Pt. D),461–481.

10. Sanna , M. T., Razynska, A., Karavitis, M., Koley, A. P., Friedman, F. K., Russu,I. M., Brinigar, W. S., and Fronticelli, C. (1997) Assembly of human hemoglobin:studies of Escherichia coli-expressed α-globin. J. Biol. Chem. 272, 3478–3486.

11. Huehns, E. R., Dance, N., Jacobs, M., Beaven, G. H., and Shooter, E. M., (1965)Isolation and properties of the βA- and γF-chain subunits from normal and foetalhaemoglobins. J. Mol. Biol. 12, 215–224.

12. Yamaguchi, T., Pang, J., Reddy, K. S., Witkowska, H. E., Surrey S., and Adachi,K. (1996) Expression of soluble human β-globin chains in bacteria and assemblyin vitro with α-globin chains. J. Biol. Chem. 271, 26,677–26,683.

13. Adachi, K., Zhao, Y., Yamaguchi, T., and Surrey, S. (2000) Assembly of γ- withα-globin chains to form human fetal hemoglobin ion vitro and in vivo. J. Biol.Chem. 275, 12,424–12,429.

14. Adachi, K., Yamaguchi, T., Yang, Y., Konitzer, P. T., Pang, J., Reddy, K. S., Ivanova,M., Ferrone, F., and Surrey, S. (2000) Expression of functional soluble human alpha-globin chains of hemoglobin in bacteria. Protein Expr. Purif. 20, 37–44.

15. Adachi, K., Konitzer, P., Kim, J., Welch N., and Surrey, S. (1993) Effects of β6aromatic amino acids on polymerization and solubility of recombinant hemoglo-bins made in yeast. J. Biol. Chem. 268, 21,650–21,656.

16. Laemmli, U. K. (1970) Cleavage of structural proteins during the assembly of thehead of bacteriophage T4. Nature 227, 680–685.

250 Adachi

17. Shackleton, C. H. and Witkowska, H. E. (1994) Mass spectometry in thecharacterization of variant hemoglobins, in Mass Spectrometry: Clinical andBiomedical Applications, vol. 2 (Desiderio, D. M., ed.), Plenum, New York,pp. 135–199.

18. Festa, R. S. and Asakura, T. (1979) The use of an oxygen dissociation curve ana-lyzer in transfusion therapy. Transfusion 19, 107–113.

Nuclear Magnetic Resonance of Hb 251

15

251


Nuclear Magnetic Resonance of Hemoglobins

Jonathan A. Lukin and Chien Ho

1. Introduction1.1. Theory of Nuclear Magnetic Resonance

Nuclear magnetic resonance (NMR) spectroscopy detects the interactionof radiofrequency (rf) radiation with the nuclear spins of molecules placed inan applied magnetic field. Because the spins are sensitive to their environ-ment, and may be coupled to one another both through chemical bonds andthrough space, NMR can provide a wealth of information on the structureand dynamics of macromolecules. In particular, NMR has proven to be apowerful technique for investigating the structure-function relationship ofhemoglobin (Hb). In this chapter, we focus on the procedures involved inapplying one-dimensional and two-dimensional NMR spectroscopy to Hband give examples of the information that may be obtained from this method.We begin with a brief outline of theory; a more complete treatment can befound in several excellent books (1–8). A typical NMR sample may containapprox 3 × 10–7 mol of Hb, which include ≈1021 hydrogen atoms, each ofwhich has a nucleus (i.e., a proton) with a nuclear spin 1/2. In the presence ofan applied magnetic field B0, each nucleus will occupy one of two possibleenergy levels, corresponding to the z-component of the spin being either par-allel or antiparallel to B0, which conventionally points along the z-axis. Atthermal equilibrium, a slight excess (a few parts in 105) of spins will occupythe lower energy level and be parallel to B0. This small population differenceis crucial to the NMR signal resulting from the absorption of rf energy, whichexcites spins from the lower to the upper energy state. The equilibrium popu-lation distribution is restored by spin-lattice relaxation, which takes placewith a characteristic relaxation time T1.

252 Lukin and Ho

The individual spins add up to give the bulk magnetization M of the sample,which at equilibrium is parallel to the applied field B0. However, if M is tiltedat an angle θ to B0, the magnetization will experience a torque perpendicular toboth M and B0 (see Fig. 1). This torque causes M to precess about B0, at afrequency (in radians/seconds) ω0 = γB0, in which γ is the gyromagnetic ratiocharacteristic of the type of nucleus, and ω0 is called the Larmor frequency.We now consider a rotating reference frame (x', y', z'), in which z' points alongB0, while the x'- and y'-axes rotate so as to keep pace with the precessing mag-netization. Viewed in this frame, M appears motionless, so the effective mag-netic field vanishes in the rotating frame. Now introduce a rotating magneticfield B1, along the x' axis. As seen in the rotating frame, B1 will appear to be astatic field, so M will precess about the x'-axis at an angular frequency ω1 = γB1.The motion of M with respect to the laboratory frame will be a combination ofits precession about B0 and B1. In a modern NMR spectrometer, the static fieldB0 is provided by a superconducting solenoid, and the oscillating rf field B1 isgenerated by a small coil in the probe. The strength of the magnet is oftenexpressed in terms of the Larmor frequency of protons converted to Hertz; i.e.,ν0 = ω0/2π. For example, a 600-MHz spectrometer has a 14.0-T magnet.

In the simplest one-pulse NMR experiment, the sample begins at equilib-rium, with its magnetization along z. The rf field B1 is applied for a time τ suchthat γB1τ = π/2 and is then switched off. This 90° pulse rotates M into the x-yplane. The subsequent precession of M at the Larmor frequency causes a chang-ing magnetic flux through the same coil used to generate B1. The oscillatingvoltage induced in the coil is amplified, mixed with the rf reference frequency

Fig. 1. Illustration of sample magnetization M, applied static magnetic field B0, andrf field B1. In the absence of B1, the magnetization will precess about B0 at the Larmorfrequency ω0 = γB0.


in a phase-sensitive detector, digitized by an analog-to-digital converter(ADC), and stored in a computer’s hard drive. The time-dependent NMRsignal is called the free induction decay (FID). Its amplitude decays as aresult of relaxation processes, which are classified into two types. Spin-lat-tice, or longitudinal relaxation (mentioned earlier), involves the exchange ofenergy between spins and the molecule’s motional degrees of freedom. Thisrestores the Boltzmann population distribution among spins, so that the netmagnetization returns exponentially, with a characteristic time T1, to the +z axis.The second type of relaxation is spin-spin, or transverse relaxation, whichcauses the spins to “fan out” in the x-y plane following a 90° pulse. Thus, thenet transverse magnetization (the vector sum) decays with a characteristictime T2. In a typical 1D-NMR experiment, the FID is acquired for ≈1 s. Then,the pulse sequence is repeated, and the second FID is added to the first incomputer memory. This process is repeated until an adequate signal-to-noiseratio is achieved.

The time-dependent NMR signal is converted to the frequency-domain spec-trum by Fourier transformation. According to the theory we have alreadydescribed, this would yield a single resonance at the Larmor frequency, with aLorentzian line shape of width ∆ν = 1/(πT2). Fortunately, a real NMR spec-trum is more informative than this. Within each molecule, the static magneticfield B0 induces circulation of the electrons, so as to produce an opposing mag-netic field. Thus, the surrounding electrons will partially shield, or screen, anucleus from the influence of the field B0. Each nucleus experiences an effec-tive field B = B0(1 – σ), in which the shielding constant σ depends on theenvironment of the proton in the molecule. This effect, called the chemicalshift, is expressed as the fractional difference between a given resonance fre-quency and that of a reference NMR peak, such as the methyl 1H resonance ofthe sodium salt of 2,2-dimethyl-2-silapentane-5-sulfonate (DSS). Thus, for aresonance frequency ν, the corresponding chemical shift δ in parts per millionis δ = 106 × (ν – νDSS)/vDSS. In practice, DSS is not added to NMR samples ofHb. Instead, we calibrate the 1H chemical shift scale using the easily measuredNMR peak of water, which resonates at 4.76 ppm from DSS at 29°C, with atemperature coefficient of –0.01 ppm/°C.

The existence of a range of chemical shifts among the spins in a sampleimplies that a single rf pulse cannot be exactly on-resonance for all of the spins.There is a reciprocal relationship between the duration of a pulse and the band-width of frequencies that it excites (its excitation profile). A high-power, “hard”90° pulse lasting 10 µs gives an effective range of frequencies of ≈105 Hz (200 ppmat 500 MHz), enough to uniformly excite all the protons in the sample. Some-times, it is desirable to use a long, low-power “soft” pulse in order to irradiatea small part of the spectrum.

254 Lukin and Ho

1.2. NMR Spectrum of Hb

The 1H NMR spectrum of normal human adult hemoglobin (HbA) can bedivided into spectral regions that have been used to monitor structural changesassociated with the ligation of HbA, changes in pH (the Bohr effect), and theaddition of allosteric effectors such as 2,3-bisphosphoglycerate or inositolhexaphosphate (9). Figure 2 shows the 300-MHz 1H spectrum of carbon-monoxyhemoglobin A (HbCO A) in 0.1 M phosphate at pH 7.1 in H2O. Thepeaks at 12.9 and 12.1 ppm from DSS have been assigned to the Hε2 protons ofα122His and α103His, respectively, which participate in H-bonds across theα1β1-subunit interface (10). Resonances at 10.7, 10.4, and 10.1 ppm have beenassigned to the Hε2 protons of β37Trp, α14Trp, and β15Trp, respectively (10).β37Trp is of particular interest because it lies within the α1β2 interface, a regionessential to the cooperative oxygenation of HbA (11). The large number of

Fig. 2. The 300-MHz proton NMR spectrum of HbCO A in 0.1 M phosphate at pH7.1 in H2O at 29°C is shown. Water suppression was achieved by the jump-and-returnpulse sequence, which yields a spectrum where signals upfield and downfield of thewater resonance appear with opposite sign. For clarity, the negative signals have beeninverted.


overlapping peaks between +6 and +10 ppm originates from aromatic andamide protons. The intensity of the latter can be greatly reduced by recordingthe spectrum of a sample in D2O. Resonances in the most crowded spectralregion (from 0 to +4 ppm) arise from aliphatic protons. The most upfield-shifted resonances in Fig. 2 (i.e., those with chemical shifts <0 ppm) originatefrom ring current–shifted protons located above or below either the hemeporphyrins or aromatic amino acid residues. The two barely resolved peaksat –1.8 ppm are assigned to the side-chain γCH3 protons of E11Val (α62Valand β67Val), which are sensitive markers for the tertiary structure of the hemepocket (9).

In both oxyhemoglobin (HbO2 A) and HbCO A, the heme iron atoms are inthe low-spin, diamagnetic ferrous state. However, in other ligated states, aswell as deoxyHb, the iron atoms adopt nonzero values of S, corresponding tovarious degrees of paramagnetism (9,12). Methemoglobin (MetHb) is in thehigh-spin ferric state, with S = 5/2. The low spin (S = 1/2) ferric state is occu-pied by cyanomet-Hb and azidomet-Hb. Unliganded (deoxy) Hb adopts thehigh-spin ferrous state with S = 2. The presence of one or more paramagneticions in a protein affects both the chemical shifts and relaxation properties ofnearby nuclear spins. Unpaired electron spins on the iron induce paramagnetichyperfine shifts by means of two contributions (9,12). The scalar or Fermicontact contribution δcon arises from unpaired spin delocalization onto resonat-ing protons through chemical bonds or hyperconjugation. The pseudo-contactor dipolar shift δdip operates through space with a 1/r3 distance dependence aswell as a complicated dependence on the polar coordinates of the nucleus in aniron-centered coordinate system. Both contributions to the hyperfine shift areproportional to S(S + 1)/T, in which T is the absolute temperature. The para-magnetic contribution to the longitudinal relaxation rate R1 ≡ 1/T1 varies as 1/r6,so that a non-selective T1 measurement can yield the ratio of distances of twonuclei to the iron. A similar distance dependence is seen in the paramagneticcontribution to the spin-spin (transverse) relaxation rate. This effect, whichcontributes to the line width, also contains a term proportional to B0

2. Becauseof the strong field dependence of the line width of hyperfine-shifted resonances,these NMR lines are best observed on a 300- or 400-MHz spectrometer, ratherthan a higher-field instrument (9).

The large spread of chemical shifts induced by unpaired electrons can beseen in Fig. 3, which shows the 300-MHz 1H-NMR spectrum of deoxyHbA.The range of chemical shifts (≈100 ppm) provides the selectivity and resolu-tion necessary to investigate specific regions of the Hb molecule (9). The broadpeaks at 75 and 63 ppm from DSS arise from the hyperfine-shifted NδH pro-tons of the proximal histidyl residues. They can be used to monitor the bindingof O2 to the α- and β-hemes of Hb. Resonances in the region +10 to +23 ppm

256 Lukin and Ho

from DSS are owing to two sources: hyperfine-shifted protons on the hemegroups and nearby amino acid residues, and exchangeable protons owing tointra- and interresidue hydrogen bonds. As in the spectrum of HbCO A (Fig. 2),peaks from +6 to +10 ppm from DSS originate from aromatic and amide pro-tons, while those from 0 to +4 ppm arise from aliphatic protons. Resonancesfrom 0 down to -20 ppm arise from ring-current- and hyperfine-shifted protonson or near the hemes.

1.3. Spin-Spin Coupling and 2D NMR

Two nuclear spins may be coupled both through chemical bonds and throughspace. Consider two spin-1/2 nuclei, A and B, in atoms that are covalentlybonded. The nuclear magnetic moment of spin A produces a local field thatperturbs the surrounding electrons. Since the electron orbitals extend to theother atom participating in the bond, spin B experiences a slightly different

Fig. 3. The 300-MHz proton NMR spectrum of deoxyHbA under the same condi-tions as in Fig. 2 is shown. Spectral regions in dashed boxes are shown expanded inthe insets.


effective field depending on whether spin A points “up” or “down.” This elec-tron-mediated scalar coupling is expressed as JIA·IB, in which J (expressed inHertz) is independent of the applied field B0. Its effect is to split the resonancelines at νA and νB by J. In heteronuclear NMR experiments (discussed in Sub-heading 1.4.), it is usually desirable to remove the effects of coupling betweeneach proton and its bonded 13C or 15N nucleus during acquisition, so that theresonance lines appear as singlets. Such broadband decoupling can be achievedby specifically designed, composite pulse sequences (3,6). Generally, NMRcan detect scalar couplings between nuclear spins separated by up to threebonds. Nuclear spins are also coupled through space by means of the dipole-dipole interaction. Consider a spin IA subjected to a continuous selective pulse.The population of the two energy levels will be equalized, so the intensity ofthe corresponding resonance line will vanish (saturation). A nearby spin IB

(within ≈5 Å of IA) will cross-relax with IA through the mechanism of mutualspin-flips. This will perturb the population of the energy levels of IB, resultingin a fractional change in the intensity of the corresponding resonance, calledthe nuclear Overhauser effect (NOE) (13). The initial buildup of the NOE isproportional to 1/r6, in which r is the distance between spins. Depending on thearrangement of nuclei, a two-step pathway for cross-relaxation IA → IC → IB

may be more efficient than the direct pathway IA → IB. In this case, the NOE atIB is no longer directly related to the distance rAB. This effect, termed spindiffusion, may be reduced by using short NOE mixing times, and by replacingmost of the protons in the protein with deuterons (2H).

The NOE experiment can determine the distance between a given nucleusand other nearby nuclei in a molecule. The convenience of measuring allpairwise distances in a single experiment is provided by 2D NOE spectroscopy(2D-NOESY). The 2D-NOESY experiment, illustrated schematically in Fig. 4,is worth describing in some detail, because it provides a good example of ageneral 2D-NMR experiment. The 2D-NOESY experiment uses only nonse-lective 90° rf pulses. The pulse sequence begins with a preparation periodconsisting of an initial delay time during which the spins relax to their equilib-rium state, followed by a 90° rf pulse which rotates the magnetization into thex'y' plane. During the evolution period t1, each spin becomes “frequencylabeled” as it precesses by an angle that depends on its chemical shift. Then,the second 90° pulse rotates the spins from the x'y' plane to the x'z' plane. Dur-ing the mixing period τ, the spins cross-relax as already described, so that theirlevel populations (and corresponding z-components of magnetization Mz)change. The third 90° pulse converts Mz to detectable transverse (x'y'-plane)magnetization. The FID is digitized and recorded as a function of the detectiontime t2, as each spin precesses according to its chemical shift. However, theamplitude of the FID also depends on the chemical shifts of NOE-coupled

258 Lukin and Ho

spins, which have evolved during t1. The pulse sequence is repeated severaltimes, keeping τ fixed but incrementing t1 systematically, generating a sig-nal that is a function of both t1 and t2. These data are Fourier transformedwith respect to both time variables to yield a 2D spectrum, which correlatesthe precession frequencies during the evolution time with those during thedetection time. In a 2D-NOESY spectrum, usually displayed as a contourplot, a cross-peak will appear at coordinates (δA, δB) if two protons withthose chemical shifts are within ≈5 Å of each other. While NOESY detectscouplings through space, 2D correlation spectroscopy (COSY) reveals cou-plings among protons linked to one another by one, two, or three chemicalbonds. The COSY pulse sequence differs from that of the NOESY experi-ment, but may also be divided into preparation, evolution, mixing, and detec-tion periods.

1.4. Heteronuclear NMR

2D 1H-NMR spectra can provide useful information on pairwise interac-tions between protons, provided that the corresponding resonances are resolvedin the 1D 1H spectrum. However, most of the resonances in the spectrum of Hbare unresolved. Large proteins, such as Hb, undergo relatively slow tumblingmotion in solution, leading to short transverse relaxation times, causing broad-ening of 1H line widths. This effect, together with the large number of hydro-gen atoms in Hb, contributes to the extreme overlap of resonances seen in Figs. 2and 3. In addition, rapid transverse relaxation causes spin coherence to decayduring the time required for the transfer of magnetization through bonds. If the1H line width exceeds the typical three-bond coupling 3JHH ≈ 3–5 Hz, thenCOSY-type experiments become very inefficient. In this situation, a more suc-cessful technique uses the large scalar coupling between a proton and its

Fig. 4. Schematic illustration of 2D-NOESY pulse sequence. This is an example ofa general 2D experiment, consisting of preparation, evolution, and mixing periodsfollowed by detection (acquisition). See the text for a detailed discussion of thisexperiment.


directly bonded heteronucleus (carbon or nitrogen). The spin-1/2 isotopesdesirable for NMR, namely 13C and 15N, occur at low natural abundance. How-ever, these isotopes (as well as 2H) can be incorporated at high levels in Hbthrough the use of a bacterial expression system for the protein (14,15).

Isotopically labeled Hb samples allow the acquisition of heteronuclear-edited spectra, which have two main advantages over homonuclear (1H)experiments (3). First, the chemical shift dispersion of 13C or 15N resonancesis inherently better than that of 1H resonances. Second, magnetization trans-fer between a proton and a heteronucleus is much more efficient than betweentwo protons, since the former involves a much larger through-bond couplingJ. Because the delay required for magnetization transfer is proportional to1/J, a one-bond heteronuclear transfer can be achieved in a shorter period,during which less transverse relaxation occurs, relative to the case of two- orthree-bond 1H-1H transfer. Thus, heteronuclear NMR remains sensitive forrelatively large proteins. Examples of such NMR experiments are 2Dheteronuclear single- and multiple-quantum coherence (HSQC and HMQC,respectively), which correlate the chemical shifts of protons and their directlybonded nitrogens. Applications of these experiments to Hb are discussed inSubheading 3.

In general, a 3D-NMR pulse sequence can be performed by combiningtwo 2D sequences, leaving out the detection period of the first experimentand the preparation period of the second. A useful 3D-NMR experiment is15N-edited NOESY-HSQC, in which the 2D-NOESY spectrum is spread intoa third dimension corresponding to the chemical shift of the 15N nucleusbonded to one of the protons. This 15N editing helps resolve the NOESYspectrum, which in 2D would be impossibly crowded. To interpret theNOESY cross-peaks in terms of distances between protons, the 1H and 15Nchemical shifts must be assigned to specific nuclei in the protein. The mod-ern strategy for resonance assignment (16) uses 3D triple-resonance experi-ments to sequentially transfer magnetization along specific pathways in a(15N,13C)-labeled protein. These experiments provide overlapping sets ofchemical shift correlations, which collectively cover the polypeptide back-bone. However, even heteronuclear experiments lose sensitivity in proteinsas large as Hb, because of rapid transverse relaxation. This problem can besomewhat alleviated by 2H labeling, which lengthens 13C relaxation times byreducing the 13C-1H dipolar interactions. The efficiency of heteronuclearNMR in high-field spectrometers has been significantly improved by the re-cent development of transverse relaxation-optimized spectroscopy (TROSY)(17). TROSY-based experiments are now being applied to Hb in order toassign the backbone resonances, and to determine the structure and dynamicbehavior of the protein in solution.

260 Lukin and Ho

2. MaterialsThe materials used in bacterial growth and purification of Hb are given in

the original references (14,15). Here, we list the buffers and gases commonlyused for NMR samples of Hb. Buffers, obtained from Sigma-Aldrich, includesodium phosphate, HEPES and Bis-Tris. The preparation of chloride-freeHEPES at different pH values is described in Busch et al. (18). D2O (99.9% indeuterium content) is purchased from Cambridge Isotope. Once opened, abottle of D2O should be reclosed as soon as possible and stored in a desiccator.Hb in deoxy, oxy, and carbonmonoxy forms is prepared using N2, O2, and COgas, respectively. The application of CO to Hb samples should be carried out ina fume hood, with an external CO detector installed.

3. Methods3.1. Sample Preparation

The development of a bacterial expression system for the growth and purifi-cation of unmodified HbA has been described previously (14,15). This systemhas enabled the expression of recombinant HbA (rHbA) as well as mutant rHbsin quantities sufficient for study by a number of biophysical methods, includ-ing NMR. While 1H NMR spectroscopy is a powerful technique for investiga-ting both normal and mutant Hbs, the amount of information available fromNMR is greatly increased when samples can be isotopically labeled with 15N,2H and/or 13C. However, a great deal of resonance overlap remains in the 2D(15N,1H) correlation spectrum of 15N-labeled HbA, because of the similarity ofthe α- and β- chains. This degeneracy can be reduced through the use of chain-selectively labeled samples of Hb. Detailed protocols for such labeling haverecently been described (19); the basic procedure is to express and purify uni-formly 15N-, 2H-, and/or 13C-labeled rHbA; separate the α- and β-subunits; andrecombine them with the complementary subunits (β and α, respectively) ofunlabeled HbA. Samples of rHbs from our bacterial expression system aresubjected to an oxidation-reduction procedure to ensure that the hemes areinserted correctly into their native conformation (14,15,20). The resultingsamples are subjected to heteronuclear-edited NMR experiments as describedin Subheading 3.3.

Following the oxidation-reduction procedure, the rHb samples are furtherpurified through a fast protein liquid chromatography Mono-S column (14);they are subsequently handled in the same way as samples obtained from blooddonors. HbCO samples are exchanged into the desired buffer using a Centriconcentrifugal concentrator with a membrane cutoff of 30 kDa. An HbCO samplecan be converted to HbO2 by passing a stream of oxygen over the sample in arotary flask under bright light in an ice-water bath for 45 min. If a deoxyHb


sample is desired, the oxygen ligand is removed by filling the rotary flask withpure N2 gas for another 45 min. DeoxyHb samples are transferred from therotary flask to an NMR tube previously flushed with N2, under pressure of thesame gas. HbO2 and HbCO samples may be pipeted directly into the NMRtube. HbCO samples are prevented from becoming O2 liganded by blowingCO gas into the tube, over the surface of the sample, for a few minutes.

NMR samples of proteins are commonly kept sterile with ≈0.2 mM sodiumazide; however, the use of azide is not recommended with Hb, because its pres-ence in solution will convert MetHb to the azidomet form. Instead, Hb samplesare sterilized by filtering through a 0.22-µm membrane. NMR tubes and capscan be sterilized by overnight exposure to ultraviolet light, while other acces-sories used in sample handling can be autoclaved. NMR samples of Hb gener-ally consist of 0.4–0.6 mL of 3–7% Hb (about 0.5–1.0 mM) that have beentransferred to a clean, dry, scratch-free NMR tube of 5 mm outer diameter.Smaller quantities of Hb (≈0.3 mL) are adequate, if a Shigemi tube is used. Assoon as the NMR sample is prepared, a 1D 1H-NMR spectrum with a spectralwidth of about 200 ppm should be obtained, to check the purity of the desiredligation state. The presence of met-Hb is indicated by the appearance of sev-eral broad peaks between 30 and 70 ppm from DSS. The oxidation of HbO2 toMetHb can be inhibited by the use of a basic buffer (pH ≥ 8.0) and by runningthe NMR experiments at or below room temperature. A barely resolved dou-blet of peaks at –1.8 ppm originates from the E11Val methyl protons of HbCOA; the corresponding signals of HbO2 A appear at –2.4 ppm. Therefore, a weakresonance at –2.4 ppm in the spectrum of a (nominal) sample of HbCO A indi-cates the presence of O2, which can be eliminated by blowing CO gas over thesample.

3.2. Spectrometer Setup

The first step in setting up the spectrometer (after loading the sample)involves tuning the probe. Each rf channel of the probe may be thought of as aresonant circuit, which must be tuned to the desired observed frequency andmatched to the network impedance. Recently manufactured spectrometersinclude a “wobble generator,” which sweeps the transmitter frequency backand forth while displaying the reflected power vs frequency on the workstationmonitor. The user must adjust the “matching” and “tuning” capacitors so as tominimize the reflected power as the probe’s resonant frequency matches theobserve frequency. This condition is indicated by the appearance of a sharpV-shaped dip centered horizontally on the display.

As noted in Subheading 1. high-resolution NMR requires a strong appliedmagnetic field B0, provided by a superconducting solenoid. With the exceptionof hyperfine-shifted resonances in paramagnetic proteins, the spectral resolu-

262 Lukin and Ho

tion increases linearly with B0, while the sensitivity is proportional (3) to B03/2.

Thus, a high-field spectrometer operating at 500 MHz or higher is desirable formost NMR studies of Hb. To detect narrow resonance lines and carry out mul-tidimensional NMR experiments over several days, the static field must beextremely homogeneous and stable. The stability of the applied field is main-tained by the deuterium field-frequency lock. A separate, dedicated channel ofthe spectrometer continuously monitors the resonance of 2H in the sample andforms part of a feedback loop. Any drift of B0 will cause a change in the 2Hresonance frequency, which activates a current in an auxiliary electromagnet(coaxial with the superconducting solenoid) so as to compensate for the drift.Meanwhile, the amplitude of the 2H absorption signal is displayed on theworkstation monitor. The integrated intensity of the lock signal will be con-stant, so if the 2H line can be made narrower by increasing the homogeneityof the field, the signal amplitude will increase. Thus, the level of the 2H lockis usually monitored while the homogeneity of the field is optimized, in aprocess called shimming. This involves adjusting the current in a set of roomtemperature coils. These shim coils create magnetic field gradients propor-tional to z, z2, z3, x, xz, xy, and so on that can compensate for the residualinhomogeneity of the superconducting magnet. State-of-the-art NMR spec-trometers are equipped with pulsed-field gradients, which can be used to mapthe static field and adjust the shims automatically. Less advanced instrumentsmust be shimmed manually, by adjusting the shim currents in an iterativefashion (3,5). In the absence of 2H in the sample, the FID is monitored, andthe shim currents as adjusted to produce a smooth exponential decay in theenvelope of the FID.

After the probe has been tuned and the magnet shimmed, the next step is tocalibrate the 90° pulse width for protons. At a given power level, the 90° pulsewidth will be the duration of the rf pulse that results in an FID of maximumamplitude. Rather than repeat the one-pulse experiment while varying the pulsewidth to search for the maximum signal, it is more convenient to search for thenull signal resulting from a 360° pulse, and to divide the pulse width by four.The experiment can be repeated several times in quick succession without wait-ing for longitudinal relaxation to occur, since a 360° pulse returns the magne-tization to equilibrium. The NMR signal of a sample of Hb in water will bedominated by the protons in the solvent, which are present at a concentrationof 110 M, while the concentration of the protein is only ≈1 mM. This repre-sents a problem for the dynamic range of the spectrometer. If the receiver gainis set too high, then the intense signal at the beginning of the FID will overloadthe digitizer. The resulting “clipping” of the FID causes severe distortion of theFourier-transformed NMR spectrum. On the other hand, if the gain is lowenough that the full FID is within the range of the digitizer, then the small


fraction (≈10–5) of the signal that originates from the protein will be coarselydigitized by a few least-significant bits. Additionally, many protein resonanceswill be obscured by the enormous water peak.

To alleviate these problems, several methods of water suppression havebeen developed. In general, the rf carrier frequency is set at the water reso-nance. The simplest solvent suppression technique is presaturation of thewater resonance by a weak rf field applied during the recycle delay. This hasthe disadvantage of reducing the intensities of exchangeable proton reso-nances (such as amide protons) through saturation transfer with water. A use-ful alternative is the jump-and-return pulse sequence (21), which consists ofa 90° pulse followed by a short precession period τ and then another 90°pulse of opposite phase. Since the water line is on resonance, it undergoes noprecession (in the rotating frame) during τ, so that the second pulse returns itto the z-axis and it does not contribute to the FID. However, all off-resonancespins retain a component in the x-y plane. The signal amplitudes change signdepending on whether they are upfield or downfield of the water resonance.This method of water suppression was used to obtain the spectra shown inFigs. 2 and 3.

To accurately represent the NMR spectrum over a given range of frequen-cies, it is necessary to set the sampling rate at which the digitizer (ADC) recordsdiscrete points of the FID. Note that the signal reaching the receiver from theprobe consists of a superposition of harmonic components with frequenciesνi = ν0(1 + 10–6δi), in which ν0 is the Larmor frequency of the reference com-pound (e.g., DSS) and δi is the chemical shift of spin i. This signal is split intotwo separate channels. The high-frequency (megahertz) signals in the two chan-nels are modulated by the carrier (reference) frequency νref to generate audio(kilohertz) signals with frequencies νi – νref. Thus, we detect the signal relativeto the rotating frame of reference. The reference signals in the two channels are90° out of phase; therefore, the output consists of cosine- and sine-modulatedFIDs, referred to as the real and imaginary parts of the spectrum, respectively.This quadrature detection scheme allows us to determine the sign of the fre-quency offset with respect to νref. In the following discussion, we refer to thefrequency offset νi – νref simply as the frequency.

The range of frequencies that we can detect is determined by the timeinterval between sampling points, called the dwell time. To uniquely represent asinusoidal signal, it must be sampled at least twice per cycle. Therefore, adwell time, DW, will yield an accurate representation of frequencies within aspectral width SW = 1/(2DW). A frequency ν0 outside this range will appearat an aliased frequency νa = mSW + ν0, in which m is an integer such that νa

appears within the spectral width. In modern NMR spectrometers, the userspecifies the spectral width, SW, and the computer calculates DW. For

264 Lukin and Ho

example, consider a 300-MHz NMR spectrum of HbCO A taken with thecarrier frequency set at the water resonance (4.76 ppm) and a SW = 4680 Hz,or 15.6 ppm. This will provide an accurate picture of peaks that resonate inthe range 4.76 ± (15.6/2 ppm), i.e., from –3.04 to +12.56 ppm. The peak at12.9 ppm will be aliased to 12.9 – 15.6 = –2.7 ppm.

The digital resolution of the Fourier-transformed spectrum depends on theamount of computer memory used to record the FID. If the memory size is SI,then SI/2 real and SI/2 imaginary points are obtained in the spectrum. The fre-quency separation between these data points is given by the digital resolutionDR = 2SW/SI, in which SW (as earlier) is the spectral width in hertz. The totalacquisition time, AQ, for a single FID is the product of the DW and the numberof points collected: AQ = DW × SI = 1/(2SW) × (2SW/DR) = 1/DR. Thus, thedigital resolution is simply the reciprocal of the acquisition time. This impliesthat if all of the resonances are broader than 2 Hz, it is useless to acquire theFID for much longer than (0.5 s—the signal will have decayed by this time,and continued acquisition will only add noise to the spectrum. On the otherhand, if the acquisition time is too short, a meaningful portion of the FID willbe truncated, leading to artifacts in the Fourier-transformed spectrum. As notedin Subheading 1., the NMR pulse sequence is repeated several times, and theFIDs are added cumulatively in computer memory. Thus, the last two param-eters to be set are the recycle delay between transients and the number of scans,Ns. The signal-to-noise ratio of the summed spectrum is proportional to √Ns .As a compromise between waiting long enough to achieve complete recoveryof the longitudinal magnetization and acquiring more transients in a given time,the recycle delay is usually set at 1 to 2 s.

3.3. 2D Heteronuclear NMR: HSQC and HMQC

As already noted, resonances which overlap in the 1D proton spectrum ofHb can be resolved through the application of 2D heteronuclear NMR to isoto-pically labeled samples. A full description of the theory and experimentalaspects of 2D NMR is beyond the scope of this chapter. However, several ofthe spectral parameters for the 15N dimension of a (1H,15N) correlation experi-ment are analogous to those of a 1D 1H spectrum. The duration of a 90° pulsefor the 15N channel can be calibrated by maximizing the signal of a 1D versionof the 15N-edited HSQC spectrum. The carrier frequency, spectral width, andnumber of time domain points acquired are set independently for the 15N and 1Hdimensions. The 2D (1H,15N) HSQC spectra of chain-selectively (2H,13C,15N)edited samples of HbCO A (19) are shown in Fig. 5. It is clear that a significantdegeneracy of chemical shifts would occur in the 2D spectrum of fully labeledHb. However, by labeling the α- and β-chains in different samples, most ofthe resonances can be resolved. Note that only 15N labeling is required for the


Fig. 5. The 600-MHz HSQC spectra of chain-selectively labeled HbCO A in 95%H2O/5% D2O with 0.1 M phosphate at pH 7.0 and 29°C is shown. (A) Spectrum of asample of tetrameric HbA with (2H,15N,13C)-labeled α-chains and natural-abundanceβ-chains; (B) spectrum of a sample with natural abundance α-chains and (2H,15N,13C)-labeled β-chains. Both spectra were acquired with a proton acquisition size of 2048points and spectral width of 20 ppm. Two hundred fifty-six complex points wereacquired in the indirect 15N dimension, with the 15N carrier frequency and spectralwidth set at 118 and 50 ppm, respectively. Signal averaging was carried out over 16 scans.Light gray contours indicate cross-peaks that are folded in the 15N dimension.

266 Lukin and Ho

HSQC experiment, although 2H labeling leads to narrower line widths. Thespectra of Fig. 5 were obtained after the samples had been left in 95% H2O/5%D2O solution for several months. By this time, all but a few deeply buriedbackbone amides are expected to have exchanged their original 2H atoms withsolvent protons, which would yield cross-peaks in the spectrum. On the otherhand, NH groups that undergo fast exchange on the millisecond time scale donot exhibit cross-peaks, since their resonances are broadened beyond detec-tion or eliminated by water suppression. Some side-chain NHs are protectedby hydrogen bonding from rapid exchange and thus exhibit cross-peaks inFigs. 5A,B. These include a few Asn, Gln, and Arg side chains as well as thethree nonequivalent Trp residues in HbA, the proximal histidines of the α- andβ-chains, and two histidines (α103His and α122His) that participate inH-bonds in the α1β1 interface.

Additional His and Trp side-chain resonances are revealed by a 2D HMQCexperiment performed without 15N decoupling during acquisition. The echoantiecho HMQC pulse sequence uses pulsed-field gradients for coherenceselection, suppressing the solvent signal while preserving nearby proteinresonances (10,22). In the spectrum, broad doublet cross-peaks appear fordirectly bonded (H,N) groups, while sharp cross-peaks originate from pro-tons coupled to 15N through two or three bonds. Thus, for Trp residues, cross-peaks appear correlating Nε1 with both Hε1 and the carbon-bound Hδ1.Histidine imidazole side-chain resonances appear in a characteristic region,with 15N chemical shifts >150 ppm. In these side chains, the coupling of bothcarbon-bound protons to both nitrogens creates a rectangular pattern of fourcross-peaks, as shown in Fig. 6. A weak or missing cross-peak is diagnosticof the weak three-bond (Hδ2, Nδ1) coupling. The C2 proton (Hε1) resonatesat a higher chemical shift than the C4 proton (Hδ2), whereas the protonated15N of the imidazole ring resonates at a lower chemical shift than the barenitrogen (23). Thus, the appearance of the pattern of cross-peaks allows theidentification of both protons and nitrogens, as well as the tautomeric state ofthe histidine. The HMQC spectra of chain-selectively labeled samples havebeen used to confirm and extend the assignments of all 38 histidines in HbCOA. These residues are of particular interest because of their importance to theBohr effect in Hb. Each histidine’s contribution to the Bohr effect can becalculated from the difference in its pK between deoxy and oxy (or carbon-monoxy) Hb. Accurate pK values are determined from a nonlinear least-squares fit of the chemical shift of each C2 proton as a function of pH. NMRmeasurements have established that a global network of electrostatic interac-tions plays a dominant role in the Bohr effect, with some histidyl residuesopposing the net Bohr effect (18,20,24,25). These results illustrate the use-


fulness of NMR techniques in elucidating the relationship between structureand function in Hb.

AcknowledgmentsWe thank Nancy T. Ho and Virgil Simplaceanu for helpful discussions. Our

Hb research is supported by a grant from the National Institutes of Health(R01HL-245215).

Fig. 6. Surface histidine region of the 600-MHz echo antiecho HMQC spectrum ofHbCO A in water with 0.1 M phosphate at pH 6.86 and 29°C. Lines connect cross-peaks originating from the same residue; solid and dashed lines are used for α- andβ-chain residues, respectively. For this experiment, the proton time-domain acquisi-tion size was 8192 points, and the 1H spectral width was 22 ppm. Eighty scans wereaveraged for each of 256 complex points in the 15N dimension. To cover both thebackbone amides and histidine side-chain resonances without folding, the 15N spectralwidth was set at 240 ppm and the carrier at 160 ppm. (From Fig. 4 of ref. 19.)

268 Lukin and Ho

References1. Atta-ur-Rahman and Choudhary, M. I. (1996) Solving Problems with NMR Spec-

troscopy, Academic, San Diego.2. Becker, E. D. (2000) High Resolution NMR: Theory and Chemical Applications,

Academic, San Diego.3. Cavanagh, J., Fairbrother, W. J., Palmer, A. G., III, and Skelton, N. J., (1996)

Protein NMR Spectroscopy Principles and Practice, Academic, San Diego.4. Croasmun, W. R. and Carlson, R. M. K. (eds.) (1994) Two-Dimensional NMR

Spectroscopy: Applications for Chemists and Biochemists, VCH, New York.5. Derome, A. E. (1987)Modern NMR Techniques for Chemistry Research, Pergamon,

Oxford, UK.6. Freeman, R. (1997) Spin Choreography: Basic Steps in High Resolution NMR,

Spektrum, Oxford, UK.7. Sanders, J. K. M. and Hunter, B. K. (1993) Modern NMR Spectroscopy, A Guide

for Chemists, Oxford University Press, Oxford, UK.8. van de Ven, F. J. M. (1995) Multidimensional NMR in Liquids, VCH, New York.9. Ho, C. (1992) Proton nuclear magnetic resonance studies on hemoglobin:

cooperative interactions and partially ligated intermediates. Adv. Protein Chem.43, 153–312.

10. Simplaceanu, V., et al. (2000) Chain-selective isotopic labeling for NMR studies oflarge multimeric proteins: application to hemoglobin. Biophys. J. 79, 1146–1154.

11. Dickerson, R. E. and Geiss, I. (1983) Hemoglobin: Structure, Function, Evolu-tion, and Pathology., Benjamin/Cummings, Menlo Park, CA.

12. La Mar, G. N., Satterlee, J. D., and De Ropp, J. S. (2000) Nuclear magnetic reso-nance of hemoproteins, in The Porphyrin Handbook, vol. 5 (Kadish, K. M., Smith,K. M., and Guilard, R., eds.), Academic, New York, pp. 185–298.

13. Neuhaus, D. and Williamson, M. P. (1989) The Nuclear Overhauser Effect inStructural and Conformational Analysis, VCH, New York.

14. Shen, T.-J., Ho, N. T., Simplaceanu, V., et al. (1993) Production of unmodifiedhuman adult hemoglobin in Escherichia coli. Proc. Natl. Acad. Sci. USA 90,8108–8112.

15. Shen, T.-J., Ho, N. T., Zo, M., et al. (1997). Production of human normal adultand fetal hemoglobins in Escherichia coli. Protein Eng. 10, 1085–1097.

16. Ikura, M., Kay, L. E., and Bax, A. (1990) A novel approach for sequential assign-ment of 1H, 13C, and 15N spectra of proteins: heteronuclear triple-resonancethree-dimensional NMR spectroscopy. application to calmodulin. Biochemistry29, 4659–4667.

17. Salzmann, M., Pervushin, K., Wider, G., Senn, H., and Wuthrich, K. (1998)TROSY in triple-resonance experiments: new perspectives for sequential NMRassignment of large proteins. Proc. Natl. Acad. Sci. USA 95, 13,585–13,590.

18. Busch, M. R., Mace, J. E., Ho, N. T., and Ho, C. (1991) Roles of β146 histidylresidue in the molecular basis of the bohr effect of hemoglobin: a proton nuclearmagnetic resonance study. Biochemistry 30, 1865–1877.


19. Simplaceanu, V., Lukin, J. A., Fang, T. Y., Ho, N. T., and Ho, C. (2000) Chain-Selective Isotopic Labeling for NMR Studies of Large Multimeric Proteins: Appli-cation to Hemoglobin. Biophys. J. 79, 1146–1154.

20. Sun, D. P., Zou, M., Ho, N. T., and Ho, C. (1997) The contribution of surfacehistidyl residues in the α-chain to the bohr effect of human adult normal hemoglo-bin: roles of global electrostatic effects. Biochemistry 36, 6663–6673.

21. Plateau, P. and Gueron, M. (1982) Exchangeable proton NMR without base-linedistortion, using new strong-pulse sequences. J. Am. Chem. Soc. 104, 7310–7311.

22. Lukin, J. A., Simplaceanu, V., Zou, M., Ho, N. T., and Ho, C. (2000) NMR revealshydrogen bonds between oxygen and distal histidines in oxyhemoglobin. Proc.Natl. Acad. Sci. USA 97, 10354–10358.

23. Pelton, J. G., Torchia, D. A., Meadow, N. D., and Roseman, S. (1993) Tautomericstates of the active-site histidines of phosphorylated and unphosphorylated IIIGlc,a signal-transducing protein from Escherichia coli, using two-dimensional NMRtechniques. Protein Sci. 2, 543–558.

24. Ho, C., and Russu, I. M. (1987) How much do we know about the Bohr effect ofhemoglobin? Biochemistry 26, 6299–6305.

25. Fang, T. Y. et al. (1999) Assessment of roles of surface histidyl residues in themolecular basis of the Bohr effect and of β143 histidine in the binding of 2,3-bisphosphoglycerate in human normal adult hemoglobin. Biochemistry 38,13,423–13,432.

270 Lukin and Ho

Solubility of Sickle Polymer 271

16

271


Solubility Measurement of the Sickle Polymer

Mary E. Fabry, Seetharama A. Acharya,Sandra M. Suzuka, and Ronald L. Nagel

1. IntroductionIn sickle hemoglobin (HbS), a valine is substituted for glutamic acid in the sixth

codon of the globin chain. This change endows deoxyHbS, but not oxyHbS, with anew property: the capacity to polymerize. This new property reduces the pliabilityof the red cell, an indispensable property to navigate the microcirculation.

The polymerization of deoxyHbS is the primary and indispensable (but notsufficient) event in the molecular pathogenesis of sickle cell disease. Follow-ing deoxygenation, HbS-containing cells assume a variety of distorted shapesreadily appreciated by light microscopy and even more clearly by scanningelectron microscopy (1). Studies at higher resolution using transmission elec-tron microscopy have provided information concerning the structure and pack-ing of the sickle fiber (2).

1.1. Polymer Structure

The structure of Hbs has been ascertained from X-ray diffraction studiesthat subsequently refined the structure to a resolution of 0.2 nm (2.0 Å) andprovided information on molecular orientation and contacts sites (3–5). Stud-ies of the solubility of mixtures of HbS with Hbs A, A2, F, and α- and β-globinmutants (6,7), and more recently, using genetically engineered site-directedglobin mutants (8–11) have provided further evidence on the contact sites criti-cal for the formation of polymer.

The basic polymer structure is a double-stranded filament. Each strand is astring of deoxyHbS beads aligned in a head-to-tail (or axial) array. Seven fila-ments combine into a fiber organized such that adjacent double strands haveantiparallel orientation. The twisted structure is composed of an inner core of

272 Fabry et al.

4 strands surrounded by a sheath of 10 strands (12). Individual fibers have anelliptical cross-section of about 23 by 18 nm (11). The helix has a high pitchwith a periodicity of about 300 nm.

The double strands are slightly twisted in the fiber. Stretching of the outerstrands in the fiber limits its size to seven pairs. Identification of the doublestrands (of the HbS crystal) as assembly units of the sickle fiber (6,7) wasdefined by the use of naturally occurring mutants in hybridized copolymeriza-tion experiments (binary mixtures), first involving β mutants (13) and laterextended to α mutants (14,15).

1.2. Intermolecular Bonding

More important, the 6 Val of the β1-subunit does not participate in intermo-lecular bonding, a feature predicted by binary mixtures involving the β6 andβ2 sites (Hbs Leiden, Makassar and Deer Lodge) determining that only oneβ-chain in the HbS tetramer was involved in a contact area of the fiber, sincetheir mutations did not affect polymerization (16,17). Furthermore, the contactbetween the β2 β6 Val and an acceptor site on the partner strand is only pos-sible when HbS is in the T or deoxy conformation. R or oxygenated moleculescannot fit into the polymeric structure.

1.3. Other Amino Acid Residues Also Affect Bondingand Polymerization

First, the β-globin mutants that alter gel formation tend to be on the β1 or“trans” subunit and involve either lateral contacts between partners of thedouble strand or axial contacts between members of a single strand. The α-chaincontacts, which are fewer, are predominantly axial but sometimes lateral. Sec-ond, the amino acid residue β6 Val is not indispensable for polymerization.Replacement of β6 Glu (in HbA) by another hydrophobic residue, isoleucine,results in an abnormal Hb that polymerizes even more readily than HbS (18).Third, the double mutant β6 Val, β121 Gln polymerizes much more readilythan does HbS (17). This finding fully supports the earlier observation ofenhanced polymerization in a mixture of HbS and Hb O-Arab (β121 Gln) con-firming this as a site of contact in the fiber. Finally, interactions involving theamino acid residues of proline at α114 and threonine at β87 also appear to beimportant for polymerization (9). As with other contacts that stabilize the poly-mer, amino acid replacement results in a marked decrease in polymerization,which has important implications for gene therapy. Although β87 threoninedoes not directly interact with the β6 Val in deoxyHbS polymers (10), it does,however, play a critical role in formation of the hydrophobic acceptor pocketthat then promotes protein-protein interactions facilitating the formation ofstable nuclei and polymers of deoxyHbS.


1.4. Sickle Hb Polymerization

The polymerization of sickle Hb involves the self-association of identicalmolecules; no accessory molecules are involved. As a result, the assembly pro-cess obeys classic chemical rules of kinetics and thermodynamics (19–21).

1.5. Solubility of HbS (CSAT)

The CSAT, or the Hb concentration at saturation, is the concentration ofdeoxyHb in equilibrium with the polymer phase. The polymerization of HbS isa simple phase change from solution to gel. When a gelled solution ofdeoxyHbS is examined, large polymers (fibers) and free tetramers can bereadily demonstrated, but species of intermediate size cannot be detected. Thus,the equilibrium between solution and gel can be studied by measuring the con-centration of free Hb in solution after separating the phases by centrifugation(19–21).

For pure deoxyHbS at pH 7.0 and 20°C, the solubility is 20 g/dL, significantlyless than the concentration of Hb inside the red cell. The rate of polymerizationof deoxyHbS is dependent on the HbS concentration. Polymerization-inducedactivation of volume-regulating transport systems (22,23) leading to enhanceddehydration results in the presence of a substantial population of very dense cellsthat have a very high intracellular Hb concentration or mean corpuscular Hbconcentration (MCHC). This dehydration of sickle erythrocytes involvesincreased activity of the membrane K-Cl cotransporter and the calcium-dependent (Gardos) potassium channel.

1.6. Solubility of HbS Is Also Affected by Several ParametersOther Than Concentration

1.6.1. Other Hbs

Of particular and practical importance are the effects of coexistent Hbs F, A,and C. Information on the copolymerization of HbS with these Hbs has pro-vided important insights into the pathogenesis and clinical severity of the vari-ous sickle syndromes (SS) including SS with increased levels of HbF, S-βo

thalassemia, S-β+ thalassemia, sickle cell (SC) disease, and AS (sickle trait).The solubility of a mixture of equal amounts of HbS and HbA (and that of

HbS and HbC) is only about 40% higher than that of HbS alone. In this mix-ture, half of the Hb comprises asymmetric hybrid tetramers (α2βSβA). Sinceonly one of the two β6 valines is engaged in an intermolecular contact, there isa 50% chance that the hybrid tetramer will enter the polymer in such a way thatall the proper contacts are made. Incorporation of HbA into the sickle polymerhas been experimentally documented (24). By contrast, the HbA tetramers(α2β2), which comprise 25% of the mixture, fail to be incorporated into the

274 Fabry et al.

polymer. Nevertheless, by virtue of their excluded volume, the solubility isfurther lowered (25).

In contrast to HbA and HbC, HbF and HbA2 inhibit polymerization (7).Thus, the hybrid tetramers α2βSγ and α2βδ fail to be incorporated into thesickle polymer. Since HbF (α2γ2) affects polymerization by means of theasymmetrical hybrid α2βSγ (16), the inhibition is trans to the β6 Val contact(24,26). γ87 is one of the important inhibitory sites for both HbF and HbA2(7). This residue constitutes one of the lateral contacts in the double strand ofthe sickle fiber.

1.6.2. pH

The solubility of deoxyHbS is lowest between pH 6.0 and 7.2 and risessharply at higher and lower pH values (27). Thus, in the extraerythrocytic pHrange of 7.5–7.2 (corresponding to intracellular pHs of ~pH 7.2 and 7.0), thealkaline Bohr effect is enhanced in concentrated solutions of HbS and in SSred cells (27). Alkalosis, by shifting the equilibrium toward the oxy conforma-tion, tends to retard sickling but also impairs oxygen release. The significantdifference in the slope of the Bohr effect in sickle cells means that a drop in SSblood pH below 7.4 in tissue capillaries yields twice the normal decrease inoxygen affinity and a large release of oxygen from red cells, increasing signifi-cantly their risk of sickling. Clinically, even mild transient acidosis (with thecorresponding drop of intracellular pH) would be hazardous for patients withsickling disorders. The latter was actually experimentally and unethically dem-onstrated when patients with sickle cell anemia were infused with low pH iso-tonic solutions, and painful crises ensued.

1.6.3. Temperature

The polymerization of HbS is an endothermic process consistent with theimportance of hydrophobic interactions (28–30). Polymer formation is there-fore entropically driven, resulting from the release of ordered water mol-ecules from the surface of free Hb. Sickle polymers are melted by cooling.Thus, a temperature jump is a simple and effective way of initiating polymer-ization, thereby enabling kinetic measurements. Although low temperaturesdo inhibit sickle polymerization, the use of cooling therapeutically is notadvisable since vasoconstriction and other effects that are provasoocclusionmight predominate.

1.6.4. Ionic Strength

The solubility of deoxyHbS is altered by salt and buffer conditions. At saltconcentrations spanning the physiological range, solubility increases with ionicstrength but decreases markedly at high ionic strength (31,32).


1.6.5. Organic Phosphates

The primary modulator of O2 affinity in the red cell is 2,3-diphosphoglycerate(DPG). An increase in red cell DPG favors HbS polymerization in three ways:lowered O2 affinity, a reduction in intracellular pH (both of which increasedeoxyHbS), and a direct effect on the conformation of deoxyHbS (33,34).

1.6.6. Kinetics

The polymerization of sickle Hb is a remarkably dynamic event. Measure-ments of the kinetics of polymer formation, both in pure HbS solutions and insickle erythrocytes, have contributed to the understanding of the pathogenesisof vasoocclusive crises (35,36). These studies led directly to information onthe nucleation mechanism responsible for fiber formation, and studies on intactred cells have provided an explanation at the molecular level of the morpho-logical changes that are observed following the deoxygenation of cells, both invitro and in vivo. Understanding the kinetics of polymerization has provided anovel and workable approach to the assessment of new antisickling therapies.

1.6.7. HbS Solution Studies

The time course for polymerization of a concentrated solution of HbS can bemonitored after either rapid removal of ligand (e.g., by photolysis) or by rapidlyincreasing the temperature of deoxyHbS, taking advantage of the markedly endo-thermic nature of the process. The formation of sickle fibers can be documentedby a variety of physicochemical techniques including turbidity, light scattering,calorimetry, and nuclear magnetic resonance spectroscopy. The subsequentalignment of fibers is best monitored by measurement of birefringence.

Following ligand removal or a temperature jump, there is a clearly measur-able lag or delay time before a signal reflecting the presence of detectable poly-mer is detected. After the delay time, the progress of polymer formation isexponential. During the delay time nucleation occurs. Nucleation is a neces-sary first step in polymer formation.

The number of molecules in the nucleus appears to be proportional to theslope of the concentration dependence of the delay time (19). When molecularcrowding (nonideality) is taken into account, the slope of the concentrationdependence of the delay time predicts a nucleus of about 15 molecules (19).Aggregates smaller than the critical nucleus are thermodynamically notfavored. By contrast, once the nucleus is formed, subsequent addition of mol-ecules is highly favored and fiber growth becomes very rapid (approx 250 Hbtetramers) (37).

Studies using statistical thermodynamic modeling have suggested that there aretwo pathways for the nucleation of sickle Hb fibers (36,38): (1) Homogeneous

276 Fabry et al.

nucleation refers to nucleation of individual fibers occurring in the bulk solu-tion phase; (2) heterogeneous nucleation refers to nucleation occurring on thesurface of existing polymers, which leads to the autocatalytic formation offibers, and therefore the delay period.

In highly concentrated solutions of deoxyHbS, homogeneous nucleation isfavored. Polarizing microscopy reveals multiple domains of polymers givingrise to birefringent spherulites. These are probably the tactoids first observedin solutions of deoxyHbS (39).

In less concentrated solutions of deoxyHbS, heterogeneous nucleation pre-dominates, leading to fewer domains of aligned sickle fibers. Studies withvideo-enhanced differential interference contrast microscopy show that fibersoriginate both from centers that produce many radially distributed fibers andon the surface of preexisting fibers (37).

1.6.8. Intracellular Studies

Extension of the equilibrium and kinetic studies of polymerization to erythro-cytes is greatly complicated by marked heterogeneity of SS cells, owing to awide range of oxygen affinity, an even wider distribution of intracellular Hbconcentration (20–50 g/dL), and the heterogeneous distribution of DPG and HbF.However, when these variables are taken into account, the delay times of SS redcells and the amount of polymer per cell at equilibrium are remarkably close towhat is encountered in Hb solutions, indicating that the cytosolic surface of thered cell membrane has no significant effect on the delay time (40,41).

The kinetics of polymerization plays a critical role in the rheology and mor-phology of circulating red cells (42). Because the range of transit times in themicrocirculation is short relative to the range of delay times of SS red cells, thegreat majority (perhaps 95%) of cells fail to form polymers during their flowthrough arterioles and capillaries (42). By contrast, if these cells were equili-brated at the oxygen tensions in the microcirculation, virtually all of themwould contain polymer and, as a result, would have markedly decreaseddeformability. Thus, kinetics is the critical determinant of cell shape and mor-phology (19). The mechanisms by which red cells containing sickle polymercan induce pathology are complex (interacting with other pleiotropic effects ofsickle cells, such as endothelial adhesion of young sickle cells, regulation ofrheological changes, and regulation of shunting), and organ-by-organ varia-tions in vascular activity, particularly when lung, retina, and brain circulationare compared with other microcirculatory beds, play an important role in deter-mining pathology.

First, when SS red cells are deoxygenated slowly, they form classic elon-gated (sickle) shapes. This is the result of homogeneous nucleation in whichone domain propagates by fiber growth and aligns to distort the cell into the


classic sickle shape. With somewhat more rapid deoxygenation, several inde-pendent domains form and will induce a more irregular shape (43).

Second, when deoxygenation is rapid, multiple spherulitic domains result ina granular or cobblestone texture (sack-of-potatoes aspect) with no gross dis-tortion of cell shape. Because the shape of the sickled cell is so dependent onthe number of independent polymer domains, it is possible to convert a hollyleaf cell into an elongated sickle shape by partial reoxygenation (44). The dis-tortion of cell shape by projections of aligned HbS fibers plays a critical role inthe pathogenesis of the membrane lesion.

2. Materials and Methods

2.1. Classic CSAT: The Reference Method

The CSAT or solubility is the concentration of deoxy HbS in equilibriumwith the polymerase phase. The reference method for determining CSATrequires several hundred microliters of concentrated Hb solution that iscompletely deoxygenated and then centrifuged to separate the solution andpolymer phases. The concentration of Hb in the solution phase and, in somecases, the Hb composition of the supernatant are then determined.

Since complete deoxygenation using nitrogen is difficult in concentrated,viscous Hb solutions, diothionite is often used to ensure that the sample is fullydeoxygenated. This frequently results in a low-pH solution (6.8 or lower), and,as a consequence, the CSAT is decreased; that is, the Hb concentration in thesolution phase is reduced. A common type of experiment mixes HbS with otherHbs to determine whether these have an inhibitory effect on polymer forma-tion that is evidenced by an increase in the Hb in the solution phase, i.e., anincrease in the CSAT.

CSAT values are determined by preparing Hb samples in a 0.1 M potassiumphosphate buffer, pH 7.35 at 25°C (see Note 1). Deoxygenation is accom-plished in a mixing tube by the addition of enough Na dithionite solution toequal three times the final concentration of Hb (see Notes 2 and 3). Samplesare transferred to the tube in which they will be centrifuged and allowed to gelovernight at 25°C (see Notes 4 and 5). They are centrifuged the next day at25°C 2 h at 140,000g. Purified HbS in the same buffer is always run as a con-trol. The supernatants are removed anaerobically, and concentrations and deoxypHs are determined (see Notes 6 and 7). Gradients in concentration or pH abovethe polymer phase are a potential source of error. The solution phase should becompletely removed and mixed prior to measurement of concentration or pH.

To eliminate the problems inherent with dithionite, some CSATs are runwithout it. The Hb samples are prepared as before in 0.1 M potassium phos-phate, pH 7.35 at 25°C. The samples are then placed in stoppered vials and

278 Fabry et al.

deoxygenated on ice by N2 flow overnight and are then transferred anaerobi-cally to CSAT tubes and allowed to gel overnight at 25°C. The Hb samples arethen centrifuged for 2 h at 140,000g at 25°C. Purified HbS is used as a control.The supernatants are removed anaerobically, and concentrations and deoxypHs are determined.

2.1.1. Preparation of Dithionite

Sodium dithionite (sodium hydrosulfite, Na2S2O4) solutions deteriorate rap-idly, owing to interaction with oxygen, and should be freshly prepared daily.Failure to do so is a major cause of irreproducible results. Material from com-mercial sources can vary considerably in quality because of deterioration frommoist air during manufacture, packaging, and storage. As soon as it is received,the fine granular powder without lumps should be divided into 5- to 10-g por-tions under a nitrogen atmosphere. Small airtight bottles are useful for thispurpose and may be kept in a desiccator also flushed with nitrogen.

Without specialized glassware, we have found that it is convenient to use twosmall bottles connected in series (Fig. 1). The first bottle contains dithionite, andits stopper is pierced by a needle to allow the passage of nitrogen. Its outlet is fedinto 5–20 mL of solvent in a second bottle, and the gas is released through anotherneedle. Bubbling is allowed to take place for 30–60 min, after which the directionof gas flow is reversed: nitrogen is introduced through the second bottle to drivethe liquid back into the first (with dithionite). To take aliquots of this solution foruse, an airtight, glass syringe is first flushed with nitrogen gas and then a sampleis withdrawn, the first portion of which may be discarded.

2.2. CSAT by P50 for Solutions

The CSAT method described in Subheading 2.1. is regarded as the referencemethod (29,45). Relatively large amounts of Hb are required, the final pH is

Fig. 1. Two-bottle system for preparation of dithionite.


low (about 6.8, compared with the intracellular pH of sickle cells of about 7.2in the venous circulation), and the measurement is made under fully deoxygen-ated conditions in the presence of dithionite. Other methods requiring smalleramounts of Hb are also in use, such as the high phosphate method developedby Adachi and Asakura (46,47) and the dextran method developed by Bookchinet al. (48). Although these methods have the advantage of consuming smalleramounts of Hb, they deviate even further from physiological conditions and,particularly for the high phosphate method, may systematically deviate fromvalues obtained with the CSAT method. In solution studies of HbS, Benesch etal. (49) demonstrated that p50, the point at which Hb is half saturated withoxygen, is proportional to the amount of polymer formed and could be used tomeasure CSAT. The method requires very small amounts of concentrated Hb(about 2 µL for each point) and can also be applied to intact red cells by vary-ing extracellular osmolarity, which, in turn, varies intracellular Hb concentra-tion (MCHC).

Benesch et al. (49) demonstrated that in HbS solutions, the p50 is propor-tional to the amount of polymer formed because polymer has a much loweroxygen affinity than HbS tetramer (49). In the Benesch method, p50 is mea-sured for a series of Hb concentrations with values below and above theexpected CSAT, the Hb concentration at which polymer formation begins canbe detected by the onset of rapidly, linearly increasing p50s in a plot of p50 vsHb concentration. The concentration at which the break in the plot occurs isthe CSAT. It is the CSAT because it is the maximum concentration of Hb that canexist without polymer formation. The increase in p50 is linear because, underconditions in which polymer is formed, the concentration of Hb in both thesolution and polymer phases is constant and the variable is the proportion ofHb in these phases. Correlation of the CSAT determined by p50 with that deter-mined by the centrifugation method has been demonstrated to be good for awide range of samples.

Note that using the p50 method for determining CSAT and extending it tomodified forms of HbS involves the assumption that polymers of modifiedHbS have exactly the same structure as those of unmodified HbS, and that theinfluence of the polymer’s structure on the oxygen affinity for all forms of HbSis nearly the same. Under these ideal conditions, the slope of the second phaseof the oxygen affinity vs protein concentration curves for modified forms ofHbS would be the same as that of HbS. However, this has not been the case forall of the various mutant and/or modified forms of HbS that have been exam-ined. The slopes of the oxygen affinity vs concentration for some of the modi-fied forms of HbS may exhibit significant differences in slope when comparedwith that of HbS, although many modified forms exhibit similar slopes.

280 Fabry et al.

This method is particularly useful for measuring CSAT of Hbs that have avery high solubility and hence require a very high Hb concentration to detectpolymerization. Under these circumstances, the classic CSAT becomes difficultto execute owing to high solution viscosity. The method is also useful whenonly small amounts of the Hb can be obtained. In a classic CSAT, about 200 mgof protein is needed for each measurement. If a Hemoscan (Aminoco, SilverSpring, MD) is used to determine p50, one needs only 2 µL for each determina-tion, and 40–50 µL of a 40 g/dL solution of the sample (about 10–20 mg) issufficient for the entire analysis.

Hb samples are prepared in 100 mM phosphate buffer at pH 6.8. Since thesolubility of a given sample will be unknown, samples are generally concen-trated to about 40 g/dL. Centricon microconcentrators from Millipore areuseful for this purpose. Oxygen affinity of samples is tested in the range of6–40 g/dL. Generally, in the range of 6–16 g/dL, two or three points arechosen that will give the slope of the curve in the nonpolymerizing phase ofthe sample. In the range of 30–40 g/dL, another three points are selected togive the slope of the line in the polymerizing phase (see Note 8). For eachconcentration, about 10 µL of the diluted stock solution is prepared by mix-ing with buffer; two microliters are used for the Hemoscan measurement, 2 µLare used to determine the concentration of the solution by diluting 1/100 withthe buffer and obtaining a spectrum from which the concentration is deter-mined by the optical density (OD) at 540 nM, and the percentage of meth-emoglobin (MetHb) is determined by the OD at 630 nM. If the percentage ofMetHb exceeds 4 to 5%, the entire sample is reduced with dithionite, thedithionite is removed by column chromatography, and the sample is recon-centrated. Hemoscan measurements are made by deoxygenating the sample,waiting 7 min, and then slowly reoxygenating the sample; this protocol mini-mizes the kinetic effects associated with polymerization.

The approximate point at which p50 begins to increase rapidly is estimatedvisually. Data below this point are fitted by linear least squares regression, anddata above this point are similarly fitted using a linear regression program. Theintersection of the two lines is the concentration at which onset of polymerformation occurred and is hence the CSAT.

2.3. CSAT by P50 for Intact Red Cells

Because CSAT is a measure of the onset of polymer formation, it may becorrelated with the probability of vasoocclusion in humans and transgenic mice.However, not only is CSAT usually measured under nonphysiological condi-tions, but these measurements are also not sensitive to other important in vivofactors such as red cell MCHC and DPG content. Intracellular components thateither do or may affect polymerization are generally not present because they


have been removed by dialysis. They can, of course, be added back, but accu-rate replication of intracellular conditions is difficult.

To use the p50 method to measure CSAT in red cells, intracellular Hb con-centration (MCHC) is varied by changing extracellular osmolarity (50). TheMCHC at which onset of polymer formation occurs (the intracellular CSAT) isthe point at which p50 begins to rapidly increase in a plot of p50 vs osmolarity.This is an estimate of the polymer-forming tendency of the Hbs in the red cellwith all red cell components (such as DPG, antisickling Hbs, or addedantisickling agents) present.

Make high- and low-osmolarity buffers containing 10 mM HEPES, 5 mM KCl,and 5 mM glucose, and add NaCl to adjust the osmolarity to 160 or 450 mOsm.Titrate the buffers to pH 7.4 at 37°C and prepare intermediate osmolarities bymixing the two buffers and measuring osmolarity with a MicroOsmette (Preci-sion Systems, Natick, MA) (see Note 9). Begin with 200–300 µL of cells sus-pended in isotonic buffer at hematocrit 50. This is the cell stock solution. Add30 µL of the cell stock to 300 µL of buffer at the desired osmolarity. Centrifugegently and suspend thoroughly. After the third wash remove 230 µL and setaside for the osmolarity measurement (see Notes 10 and 11). Remove aliquotsfor measurement of p50 using a Hemoscan (Aminoco) (see Note 12) on theslowest change in percent oxygen program to allow equilibration of polymerand solution phases. Hemoscan measurements are made by deoxygenating thesample, waiting 7 min, and then slowly reoxygenating the sample; this proto-col minimizes the kinetic effects associated with polymerization. Three aliquotsare also removed for determination of MCHC by measurement of hematocritusing a microhematocrit centrifuge (MicroHematocrit, Damon/IEF Division,Needham Heights, MA) and Hb concentration with Drabkin’s reagent (Sigma,St. Louis, MO).

The approximate point at which p50 begins to increase rapidly is estimatedvisually. Data below this point are fitted by linear least squares regression, anddata above this point are similarly fitted using the program Statgraphics Plus(Manugistics, Rockville, MD). The intersection of the two lines is the osmolar-ity at which onset of polymer formation occurred. This osmolarity is correlatedwith MCHC measured on cells equilibrated in the same buffer.

2.3.1. Interpretation of Measurements

These measurements yield two values: the osmolarity and MCHC at which poly-mer formation begins. The latter is a measure of the effect of cell contents onpolymer formation while the former relates both whole-animal physiology (plasmaand renal osmolarity) and red cell physiology (factors affecting red cell density/MCHC) to polymer formation. The onset of polymer formation in AS cells(Fig. 2) occurs at an osmolarity (330 mOsm) that is higher than physiological

282 Fabry et al.

(280–300 mOsm), but within the range found in kidney. This is consistent withthe relative clinical severity of AS (AS has only a urine-concentrating defect).

Red cell heterogeneity is a potential complication for these measurements;however, because each cell acts like an independent container of well-definedsolution, the effective 50 in the presence of red cell heterogeneity (MCHC orHbF) is a linear combination of all cell types present and therefore yields anaverage value for all cells present. This technique may be particularly suitablefor measuring relative CSATs for evaluation of antisickling agents with mul-

Fig. 2. MCHC and p50 for representative AA, AS, and SS patients. (A) Measure-ment of intracellular CSAT by plotting p50 versus extracellular osmolarity for AA, SS,and AS red cells. (B) Determination of MCHC at the onset of polymer formation forSS red cells by plotting MCHC vs extracellular osmolarity. As expected, patient-to-patient variation is observed (data not shown). The CSAT for SS red cells can also beestimated from the intersection of the SS p50 line with the horizontal line since thep50s of HbA and HbS are the same in the absence of polymer formation. The intracel-lular CSAT for this patient who had 9.7% HbF is 18.2 g/dL. The AS patient did not haveα-thalassemia trait and had an estimated CSAT of 32.2 g/dL. Under fully deoxygenatedconditions, the traditional method of measuring CSAT yields values of 15.8 g/dL forpurified SS (5).


tiple effects and comparing different strains of transgenic mice that may expresscomplex mixtures of Hbs.

3. Notes1. Use a final concentration of HbS that will be just sufficient to gel (e.g., 22 g/dL

for the HbS standard). If the concentration is too high, there will not be enoughsupernatant to measure the pH and concentration. If the concentration is too low,it will not gel.

2. Since deoxyHbS at high concentrations will gel under the right conditions, youmust keep everything ice cold at all times. Low temperature melts the polymer.The syringes used to measure the volumes of Hb to be added to the mixing tubesmust be wrapped in small bags filled with ice. The tubes also must be on ice (cut-off fingers from disposable gloves work well for this purpose). Do not touch thetubes after chilling; the warmth may be sufficient to initiate polymer formation.If localized polymer formation occurs, it will not be possible to properly mix inall of the components. In general, it is not be possible to salvage samples thathave gelled prematurely.

3. After filling the mixing tubes with Hb, buffer, or another component other thandithionite, they must be capped with a tight-fitting rubber stopper (cut off theexcess sleeve part of the stopper to make it easier to work with). The space abovethe solution must be displaced with nitrogen or argon gas to get rid of any oxygenbefore the addition of dithionite. The gas should flow for 2 min through a 20-gageneedle and flow out through a 23-gage needle. Always pull out the outlet needlebefore pulling out the gas needle. Immediately add the dithionite solution andmix the tube—which is kept in its ice “finger”—vigorously. Keep on ice untilyou can transfer the contents to the CSAT tubes.

4. The CSAT tubes should be filled with paraffin oil and the deoxy Hb added underthe oil to prevent oxygen from getting in. The tubes should be placed in a con-tainer, capped with a rubber stopper and flushed with nitrogen, then stored over-night at the temperature you need until you can centrifuge them.

5. Quartz Electron Paramagnetic Resonance (EPR) tubes cut short are suitable forCSAT determinations.

6. To facilitate removal of the solution phase for concentration determinations, youmust distinguish it clearly from the gel phase. To visualize the solution phase vsthe gel phase, cut a slit about 1 mm wide in a white index card. Hold it against theCSAT tube with a high-intensity lamp behind it. This will make it easier to distin-guish between the two phases.

7. Use positive displacement pipets for determining concentration. Use airtight gassyringes for measuring volumes of deoxyHb, buffer, and so on. Since Hb in solu-tions containing dithionite is converted to the met form on exposure to oxygen,exposure to oxygen after the sample has been centrifuged is avoided unlessaliquots are taken for determination by the cyanmet method (Drabkin’s reagent).

8. Measurements made near the CSAT are frequently unreliable, owing to the longdelay times at this concentration. Once the probable location of the CSAT has

284 Fabry et al.

been found, it is best to cluster the points at concentrations above the CSAT.9. By measuring hematocrit, Hb, pH, and osmolarity while the next sample is equili-

brating and scanning, it is possible to measure five to six osmolarities in a day.Intermediate points can be measured on the same blood sample that has beenpreserved in plasma on the next day; however, reliable measurements usuallycannot be made on the third day. This is particularly true of red cells with pathol-ogy of any kind.

10. A stock solution of whole blood in isotonic buffer is maintained on ice and thecells are washed with the desired osmolarity just before use. Keeping cells forextended and variable periods of time under nonisotonic conditions may lead toother changes in the red cell. The cells in buffer can only be used for 1 d. Thevery small (2 µL) sample of red cells quickly reaches thermal equilibrium in theHemoscan.

11. This value should be used rather than the nominal value of the buffer used to washthe cells, since it represents the final osmolarity in equilibrium with the cells.

12. Although a Hemoscan, an instrument no longer in commercial production, wasused for these measurements and is very convenient because of the small samplesize, any instrument capable of measuring p50, in a user-specified buffer, wouldbe suitable; however, sample sizes would need to be scaled accordingly.

References1. White, J. W. (1974) Ultrastructural features of erythrocyte and hemoglobin sick-

ling. Arch. Intern. Med. 133, 545–562.2. White, J. G. (1968) The fine structure of sickled hemoglobin in situ. Blood 31,

561–579.3. Wishner, B. C., Ward, K. B., Lattman, E. E., and Love, W. E. (1975) Crystal struc-

ture of sickle-cell deoxyhemoglobin at 5 Å resolution. J. Mol. Biol. 98, 179–194.4. Padlan, E. A. and Love, W. E. (1985) Refined crystal structure of deoxyhemo-

globin. S. I. Restrained least-squares refinement at 3.0-A resolution. J. Biol. Chem.260, 8272–8279.

5. Harrington, D. J., Adachi, K., and Royer, W. E. Jr. (1997) The high resolutioncrystal structure of deoxyhemoglobin S. J. Mol. Biol. 272, 398–407.

6. Nagel, R. L., Johnson, J., Bookchin, R. M., Garel, M. C., Rosa, J., Schiliro, G.,Wajcman, H., Labie, D., Moo-Penn, W., and Castro, O. (1980) β chain contactsites in the hemoglobin S polymer. Nature 283, 832–834.

7. Nagel, R. L., Bookchin, R. M., Johnson, J., Labie, D., Wajcman, H., Isaac-Sodeye,A. W., Honing, G. R., Schiliro, G., Crookston, J. H., and Matsutomo, K. (1979)The structural bases of the inhibitory effects of Hb F and Hb A2 on the polymer-ization of Hb S. Proc. Natl. Acad. Sci. USA 76, 670–672.

8. Adachi, K., Kim, J., Ballas, S., Surrey, S., and Asakura, T. (1988) Facilitation ofHb S polymerization by the substitution of Glu for Gln at beta 121. J. Biol. Chem.263, 5607–5610.

9. Ho, C., Willis, B. F., Shen, T. J., et al. (1996) Roles of alpha114 and beta 87amino acid residues in the polymerization of hemoglobin S: implications for genetherapy. J. Mol. Biol. 263, 475–485.


10. Reddy, L. R., Reddy, K. S., Surrey, S., and Adachi, K. (1997) Role of beta87 Thrin the beta6 Val acceptor site during deoxy Hb S polymerization. Biochemistry36, 15,992–15,998.

11. Li, X., Mirza, U. A., Chait, B. T., and Manning, J. M. (1997) Systematic enhance-ment of polymerization of recombinant sickle hemoglobin mutants: Implicationsfor transgenic mouse model for sickle cell anemia. Blood 90, 4620–4627.

12. Edelstein, S. J., Telford, J. N., and Crepeau, R. H. (1973) Structure of fibers ofsickle cell hemoglobin. Proc. Natl. Acad. Sci. USA 70, 1104–1107.

13. Nagel, R. L. and Bookchin, R. M. (1978) Areas of interaction in the HbS polymer,in Biochemical and Clinical Aspects of Hemoglobin Abnormalities (Caughey, W.S., ed.), Academic, New York, pp. 195–203.

14. Benesch, R. E., Kwong, S., and Benesch, R. (1982) The effects of alpha chainmutations cis and trans to the beta6 mutation on the polymerization of sickle cellhaemoglobin. Nature 299, 231–234.

15. Crepeau, R. H., Edelstein, S. J., Szalay, M., Benesch, R. E., Benesch, R., Kwong,S., and Edalji, R. (1981) Sickle cell hemoglobin fiber structure altered by alpha-chain mutation. Proc. Natl. Acad. Sci. USA 78, 1406–1410.

16. Bookchin, R. M. and Nagel, R. L. (1973) Molecular interactions of sickling hemo-globins, in Symposium on Sickle Cell Disease (Abramson, H., Bertles, J., andWethers, D., eds.), CV Mosby, St. Louis.

17. Nagel, R. L. and Bookchin, R. M. (1975) Mechanism of hemoglobin S gelation:structural restrictions to supramolecular models of the polymerization of hemo-globin S., in Sickle Cell Anemia and Other Hemoglobinopathies (Levere, R. D.,ed.), Academic, New York, pp. 51–66.

18. Baudin-Chich, V., Pagnier, J., Marden, M., Bohn, B., Lacaze, N., Kister, J., Schaad,O., Edelstein, S. J., and Poyart, C. (1990) Enhanced polymerization of recombinanthuman deoxyhemoglobin beta 6 Glu→Ile. Proc. Natl. Acad. Sci. USA 87, 1845–1849.

19. Eaton, W. A. and Hofrichter, J. (1990) Sickle cell hemoglobin polymerization.Adv. Protein Chem. 40, 63–279.

20. Eaton, W. A. and Hofrichter, J. (1987) Hemoglobin S gelation and sickle celldisease. Blood 70, 1245–1266.

21. Briehl, RW. (1991) Sickle-cell hemoglobin. Encyclopedia Hum. Biol. 7, 1.22. Canessa, M., Romero, J. R., Lawrence, C., Nagel, R. L., and Fabry, M. F. (1994)

Rate of activation and deactivation of K:Cl cotransport by changes in Cell volumein hemoglobin SS, CC and AA red cells. J. Memb. Biol. 142, 349–362.

23. Brugnara, C. and Tosteson, D. C. (1987) Cell volume, K transport, and cell den-sity in human erythrocytes. Am. J. Physiol. 252, C269–C276.

24. Goldberg, M. A., Husson, M. A., and Bunn, H. F. (1977) Participation of hemo-globins A and F in polymerization of sickle hemoglobin. J. Biol. Chem. 252,3414–3421.

25. Minton, A. P. (1977) Non-ideality and the thermodynamics of sickle-cell hemo-globin gelation. J. Mol. Biol. 110, 89–103.

26. Bookchin, R. M., Nagel, R. L., and Balazs, T. (1975) Role of hybrid tetramerformation in gelation of haemoglobin S. Nature 256, 667–668.

286 Fabry et al.

27. Ross, P. D., Hofrichter, J., and Eaton, W. A. (1977) Thermodynamics of gelationof sickle cell deoxyhemoglobin. J. Mol. Biol. 115, 111–134.

28. Ross, P. D., Hofrichter, J., and Eaton, W. A. (1975) Calorimetric and optical char-acterization of sickle cell hemoglobin gelation. J. Mol. Biol. 96, 239–253.

29. Magdoff-Fairchild, B., Poillon, W. N., Li, T., and Bertles, J. F. (1976) Thermody-namic studies of polymerization of deoxygenated sickle cell hemoglobin. Proc.Natl. Acad. Sci. USA 73, 990–944.

30. Adachi, K., Ozguc, M., and Asakura, T. (1980) Nucleation-controlled aggre-gation of deoxyhemoglobin S: participation of hemoglobin A in the aggrega-tion of deoxyhemoglobin S in concentrated phosphate buffer. J. Biol. Chem.255, 3092–3099.

31. Poillon, W. N. and Bertles, J. F. (1979) Deoxygenated sickle hemoglobin: Effectsof lyotropic salts on its solubility. J. Biol. Chem. 254, 3462–3467.

32. Ueda, Y., Nagel, R. L., and Bookchin, R. M. (1979) An increased Bohr effect insickle cell anemia. Blood 53, 472–480.

33. Swerdlow, P. H., Bryan, R. A., Bertles, J. F., et al. (1977) Effect of 2, 3-diphospho-gylcerate on the solubility of deoxy sickle hemoglobin. Hemoglobin 1, 527–537.

34. Poillon, W. N., Kim, B. C. (1990) 2,3-Diphosphoglycerate and intracellular pH asinterdependent determinants of the physiologic solubility of deoxyhemoglobin S.Blood 76, 1028–1036.

35. Hofrichter, J., Ross, P. D., and Eaton, W. A. (1974) Kinetics and mechanism ofdeoxyhemoglobin S gelation: a new approach to understanding sickle cell dis-ease. Proc. Natl. Acad. Sci. USA 71, 4864–4868.

36. Hofrichter, J. (1986) Kinetics of sickle hemoglobin polymerization. III. Nucle-ation rates determined from stochastic fluctuations in polymerization progresscurves. J. Mol. Biol. 189, 553–571.

37. Samuel, R. E., Salmon, E. D., and Briehl, R. W. (1990) Nucleation and growth offibres and gel formation in sickle cell haemoglobin. Nature 345, 833–835.

38. Ferrone, F. A., Hofrichter, J., Sunshine, H. R., and Eaton, W. A. (1980) Kineticstudies on photolysis- induced gelation of sickle cell hemoglobin suggest a newmechanism. Biophys. J. 32, 361–380.

39. Harris, J. W. (1950) Studies on the destruction of red blood cells. VII. Molecularorientation in sickle cell hemoglobin solutions. Proc. Soc. Exp. Biol. Med. 75,197–201.

40. Coletta, M., Hofrichter, J., Ferrone, F. A., and Eaton, W. A. (1982) Kinetics ofsickle haemoglobin polymerization in single red cells. Nature 300, 194–197.

41. Goldberg, M. A., Lalos, A. T., and Bunn, H. F. (1981) The effect of erythrocytemembrane preparations on the polymerization of sickle hemoglobin. J. Biol.Chem. 256, 193–197.

42. Mozzarelli, A., Hofrichter, J., and Eaton, W. A. (1987) Delay time of hemoglo-bin S polymerization prevents most cells from sickling in vivo. Science 237,500–506.

43. Horiuchi, K., Ballas, S. K., and Asakura, T. (1988) The effect of deoxygenationrate on the formation of irreversibly sickled cells. Blood 71, 46–51.


44. Horiuchi, K. and Asakura, T. (1989) Oxygen promotes sickling of SS cells. Ann.NY Acad. Sci. 565, 395–397.

45. Hofrichter, J., Ross, P. D., and Eaton, W. A. (1976) Supersaturation in sickle cellhemoglobin solutions. Proc. Natl. Acad. Sci. USA 73, 3035–3039.

46. Adachi, K. and Asakura, T. (1979) The solubility of sickle and non-sickle hemo-globins in concentrated phosphate buffer. J. Biol. Chem. 254, 4079–4084.

47. Adachi, K. and Asakura, T. (1979) Nucleation-controlled aggregation of deoxy-hemoglobin S: Possible difference in the size of nuclei in different phosphate con-centrations. J. Biol. Chem. 254, 7765–7771.

48. Bookchin, R. M., Balazs, T., Wang, Z., Josephs, R., and Lew, V. L. (1999) Poly-mer structure and solubility of deoxyhemoglobin S in the presence of high con-centrations of volume-excluding 70-kDa dextran. J. Biol. Chem. 274, 6689–6697.

49. Benesch, R. E., Edalji, R., Kwong, S., and Benesch, R. (1978) Oxygen affinity asan index of hemoglobin S polymerization: a new micromethod. Anal. Biochem.89, 162–173.

50. Fabry, M. E., Desrosiers, L., and Suzuka, S. M. (2001) Direct intracellular mea-surement of deoxygenated HbS solubility (CSAT). Blood 98, 883–884.

288 Fabry et al.

Index 289

289

Index

A

Adult hemoglobin (HbA),abundance in red blood cells, 31crystallization,

high-salt crystallization ofR-state HbCO A, 7, 11, 12,14, 16

high-salt crystallization ofT-state deoxyHbA, 6, 10,11, 15, 16

materials, 6, 7precautions, 15

proton NMR spectra,deoxyhemoglobin, 255, 256HbCO A, 254, 255oxyhemoglobin, 255

AFM, see Atomic force microscopyAmidation, HbS analysis by high-

performance liquidchromatography, 33, 39,40, 46

Amplification refractory mutationsystem (ARMS),

hemoglobin variants, 108hemoglobinopathy diagnosis

overview, 101, 102materials, 108, 109, 112prenatal diagnosis,

amniotic fluid collection,120, 121

chorionic villi sampling, 121fetal cells in maternal blood,

121, 122

historical perspective, 117maternal DNA contamination

analysis with VNTRanalysis, 128, 129

peripheral fetal bloodcollection, 120

precautions, 128, 130preimplantation diagnosis

samples, 122primers, 122

protocol, 110, 111, 114β-thalassemia diagnosis, 106,

107, 112, 113ARMS, see Amplification refractory

mutation systemAtomic force microscopy (AFM),

HbC crystallization in redblood cells,

applications, 162, 163cell adherence to scanning disk,

172, 173data collection, 162, 163materials, 167

B

Bezafibrate, red blood cell oxygenaffinity effects,60, 61

Bio-Rad variant hemoglobin testingsystem, 22, 23

Bohr effect,nuclear magnetic resonance, 266red blood cell oxygen affinity

assay parameters, 58, 59

290 Index

C

Carbon monoxide binding,hemoglobin,

assigning rate constants to T- andR-forms, 80

association rate constantdetermination, 69, 70

complex accelerating behavior,70, 71

dimers and monomers, 72, 73dissociation rate constant

determination, 73, 74flash photolysis, 71, 72geminate rebinding, 71history of study, 65kinetic schemes and equations,

66–68oxyhemoglobin binding, 78rate constants for human T- and

R-state hemoglobins andsubunits, 68, 69

time resolution of rapid mixingversus flash photolysis, 68, 69

two-state analysis, 72CC disease, see HbCCellulose acetate electrophoresis,

globin chains, 97, 99hemoglobin variants, 94, 96, 97, 99transgenic mouse screening,

227, 230Citrate agar electrophoresis,

hemoglobin variants, 94,96, 99

Clark electrode, see Oxygen affinityassay, red blood cells

Crosslinking, hemoglobin analysisusing size-exclusion high-performance liquidchromatography, 40–42

Crystallization,HbC in red blood cells,

atomic force microscopy,applications, 162, 163cell adherence to scanning

disk, 172, 173data collection, 162, 163materials, 167

batch nucleation studies in vitro,CO HbC crystal preparation,

170–173co-habitating hemoglobin

effects, 156–158, 165crystal growth, 169, 170–173materials, 166

hemoglobin purification, 165,168, 169

impurity effects, 163–165overview, 155, 156photoinhibition, 161solubility studies in vitro,

158–162, 167video-enhanced DIC

microscopy, 161, 166,167, 172

X-ray crystallography, see X-raycrystallography, hemoglobin

CSAT, see Sickle cell hemoglobinCyanosis, oxygen equilibrium

curve, 62

D

Denaturing gradient gelelectrophoresis (DGGE),

hemoglobinopathy diagnosisoverview, 101, 102

α-thalassemia diagnosis, 104β-thalassemia diagnosis, 106, 107

DGGE, see Denaturing gradient gelelectrophoresis

Index 291

2,3-Diphosphoglycerate, red bloodcell oxygen affinity assayeffects, 59, 60

Dithionite,cyanomet hemoglobin reduction,

189oxyhemoglobin reaction, 76–78preparation for CSAT

determination, 278

E

Electrophoresis, see Celluloseacetate electrophoresis;Citrate agar electrophoresis;Denaturing gradient gelelectrophoresis; Isoelectricfocusing; Polyacrylamidegel electrophoresis

Epistasis,definition, 213, 232humans versus mice, 213, 232transgenic mice, 232

F

Fetal hemoglobin (HbF),composition analysis with high-

performance liquidchromatography, 28

persistence disorders anddiagnosis, 107, 108

sickle cell disease modulation, 200transgenic mice and malaria

resistance, 221, 222Fluorescence, hemoglobin,

extrinsic fluorescence studies,covalent modification with

probes, 148overview, 146, 147

front-face fluorometry,advantages, 134, 135

applications, 139, 140concentration-independent

plateau, 135instrumentation, 136–139polarization measurements, 139time-resolved fluorescence, 139

hemoglobin purification, 147, 148inner-filter effects, 133, 134intrinsic fluorescence, 133, 140materials, 147temperature dependence, 149tertiary and quaternary structure

sensitivity,dissociation of subunits, 146ligand binding and quaternary

structure changes, 141–145oxidation studies, 145tryptophan emission spectrum

shifts, 140, 141Front-face fluorometry, see

Fluorescence, hemoglobin

G

Gap-PCR, see Polymerase chainreaction

Globin chains,haplotyping, see Haplotypinghemoglobinopathies, see specific

diseasespreparation from hemoglobin,

acid acetone precipitation,184, 191

CM-52-cellulose-ureachromatography, 184, 185

recombinant hemoglobin productionin Escherichia coli,

characterization of chains,247, 248

α-globin chains,expression, 246

292 Index

purification, 246, 247β-globin chains,

expression, 246purification, 246

γ-globin chains,expression, 247purification, 247

overview, 243, 244plasmid generation, 244, 245

transgenic mice, see Transgenicmice

H

Haplotyping,β-globin-like gene clusters,

applications, 197genomic DNA extraction,

agarose gel electrophoresis,202

ethanol precipitation, 202,204, 207

octanol extraction ofchloroform, 201

phenol-chloroformextraction, 201

quantification, 202red blood cell lysis, 201RNA and protein removal,

202white blood cell lysis, 201

haplotype/phenotypecorrelations, 198, 199

materials, 200polymerase chain reaction,

primers, 203, 206, 207principles, 203reaction mix, 204restriction enzyme digestion

and gel electrophoresis ofproducts, 204, 207

sickle cell anemia patients,geographic distribution,African origins of Sicily

mutation, 198expansion in Middle East

during Sassanian empire,198

overview, 196, 197slave-trade-based gene flow

to America, 197, 198HbC origins in Africa, 199HbG mutations, 199HpaI linkage disequilibrium, 195sickle cell disease,

HbF modulation, 200insulin-like growth factor axis,

199, 200β-thalassemia prenatal diagnosis,

124–127HbA, see Adult hemoglobinHbC,

crystallization, red blood cells,atomic force microscopy,

applications, 162, 163cell adherence to scanning


batch nucleation studies invitro,co-habitating hemoglobin

effects, 156–158, 165CO HbC crystal preparation,

170–173crystal growth, 169, 170–173materials, 166


impurity effects, 163–165

Index 293

overview, 155, 156photoinhibition, 161solubility studies in vitro, 158–

162, 167video-enhanced DIC

microscopy, 161, 166, 167,172

crystallization, structure solution,162

origins in Africa, 199transgenic mouse expression,

219, 221HbE,

mutation detection, 108α-thalassemia, 118, 119

HbF, see Fetal hemoglobinHbG, mutations, 199HbS, see Sickle cell hemoglobinHEM-O-SCAN,

absorbance measurement, 52, 53Clark electrode system, 52gas purging, 52limitations, 53principles, 51sample preparation, 51

HEMOX ANALYZER,absorbance measurement, 55data presentation,

cooperativity representationand interpretation, 58

Hill plot, 58linear representation, 57

instrumentation, 54oxygen equilibrium curve, 54, 55principles, 53, 54sample preparation, 54

High-performance liquidchromatography (HPLC),hemoglobin,

anion-exchange chromatography,HbS amidation analysis, 33,

39, 40, 46materials, 32, 46preparative-scale purification,

32, 34, 35, 46small-scale purification, 32,

34, 46cation-exchange chromatography,

Bio-Rad variant hemoglobintesting system, 22, 23

clinical applications, 21PolyCat A columns, 23, 27rechromatography of anion-

exchange chromatographyfraction, 32, 36, 46

recombinant protein analysisexpressed from transgenicswine, 33, 37, 38

scale-up for chain separation,26, 27

chain analysis,HbF composition analysis, 28reverse-phase chromatography

analysis, 25, 26, 28, 33,43–45

reverse-phase perfusionchromatography,materials, 24, 25running conditions, 25, 28sample preparation, 24, 25

scale-up for chain separation, 26overview, 31, 32reverse-phase versus ion-

exchange, 21, 27transgenic mouse screening, 230,

231, 234HPLC, see High-performance liquid

chromatography

294 Index

I

IGF, see Insulin-like growth factorInsulin-like growth factor (IGF),

sickle cell diseaseinteractions, 199, 200

Ion-exchange chromatography, seeHigh-performance liquidchromatography,hemoglobin

Isoelectric focusing,agarose gels, 94, 95hemoglobin variants, 93, 94polyacrylamide gels, 95, 96, 98, 99preparative electrophoresis, 98transgenic mouse screening,

230, 234

K

K:Cl cotransport, elevation inhemoglobinopathy, 221

M

Malaria, HbF transgenic mice andresistance, 221, 222

Mass spectrometry (MS),mutation validation in transgenic

mice, 226, 227recombinant globin chains, 248

MS, see Mass spectrometryMWC model, tense and relaxed

states, 1, 2

N

Nitric oxide binding, hemoglobin,assigning rate constants to T- and

R-forms, 80association rate constant, 81autoxidation of nitrosylglobins,

84, 85

dioxygenation of nitric oxide byoxyhemoglobin, 85–87

dissociation rate constantdetermination, 81, 82, 84, 85

history of study, 65kinetic schemes and equations,

66–68pentacoordinate complex, 85rate constants for human T- and


reactions, 81rebinding measurement with flash

photolysis, 82, 83time resolution of rapid mixing

versus flash photolysis,68, 69

NMR, see Nuclear magneticresonance

Nuclear magnetic resonance (NMR),hemoglobin,

heteronuclear spectra,HMQC, 266, 267HSQC, 264, 266principles, 258, 259

instrumentation,computer memory, 264probe tuning, 261pulse width calibration,

262, 263sampling rate and dwell time,

263, 264sensitivity, 261, 262shimming, 262signal-to-noise ratio, 264

materials, 260proton spectra of HbA,

deoxyhemoglobin, 255, 256HbCO A, 254, 255

Index 295

oxyhemoglobin, 255sample preparation, 260, 261theory, 251–253two-dimensional spectra,

COSY, 258NOESY, 257, 258nuclear Overhauser effect, 257spin-spin coupling, 256

water suppression, 263

O

Oxygen affinity assay, red bloodcells,

allosteric modifier studies, 60, 61binding parameters, 51Bohr effect parameters, 58, 592,3-diphosphoglycerate variation

assay, 59, 60discontinuous versus continuous

methods, 50, 51hemoglobin variants, 49HEM-O-SCAN,

absorbance measurement, 52, 53Clark electrode system, 52gas purging, 52limitations, 53principles, 51sample preparation, 51

HEMOX ANALYSER,absorbance measurement, 55data presentation,

cooperativity representationand interpretation, 58

Hill plot, 58linear representation, 57

instrumentation, 54oxygen equilibrium curve,

54, 55principles, 53, 54

sample preparation, 54indications, 49overview of assays, 49, 50oxygen equilibrium curve,

construction, 50cyanosis, 62polycythemia, 61sickle cell disease, 62

Oxygen binding, hemoglobin,assigning rate constants to T- and

R-forms, 80association rate constant

determination, 74–76dissociation rate constant

determination, 76–78dithionite reaction, 76–78flash photolysis, 74–76history of study, 65kinetic schemes and equations,

66–68rapid mixing experiments, 76–78rate constants for human T- and


red blood cell assays, see Oxygenaffinity assay, red blood cells

subunit differences, 78–81time resolution of rapid mixing

versus flash photolysis,68, 69

P

PAGE, see Polyacrylamide gelelectrophoresis

PCR, see Polymerase chain reactionPEG, see Polyethylene glycolPolyacrylamide gel electrophoresis

(PAGE),globin chains, 97–99

296 Index

hemoglobin variants, 94isoelectric focusing, see

Isoelectric focusingPolyCat A, columns, 23, 27Polycythemia, oxygen equilibrium

curve, 61Polyethylene glycol (PEG),

hydrodynamic volumedetermination for size-enhanced hemoglobins, 42

Polymerase chain reaction (PCR),see also Amplificationrefractory mutation system,

gap-PCR protocol, 109, 110, 114β-globin-like gene cluster

haplotyping,primers, 203, 206, 207principles, 203reaction mix, 204restriction enzyme digestion

and gel electrophoresis ofproducts, 204, 207


materials, 108, 109α-thalassemia diagnosis with

gap-PCR, 102, 103β-thalassemia diagnosis, 104–106δβ-thalassemia diagnosis with

gap-PCR, 107, 108transgenic mouse screening,

227, 233Polymerization, see Sickle cell

hemoglobinPolymorphism, definition, 213, 232Prenatal diagnosis, see specific

hemoglobinopathies andtechniques

R

RBC, see Red blood cellRecombinant hemoglobin, see

Globin chainsRed blood cell (RBC),

CSAT determination using p50,280–284

genomic DNA extraction, 201,202, 204

HbC crystallization in red bloodcells,

atomic force microscopy,applications, 162, 163cell adherence to scanning


batch nucleation studies invitro,CO HbC crystal preparation,

170–173co-habitating hemoglobin

effects, 156–158, 165crystal growth, 169, 170–173materials, 166


impurity effects, 163–165overview, 155, 156photoinhibition, 161solubility studies in vitro,

158–162, 167video-enhanced DIC

microscopy, 161, 166,167, 172

hemoglobin purification, see X-ray crystallography,hemoglobin

Index 297

hemoglobin variants, 31oxygen affinity assay, see

Oxygen affinity assay, redblood cells

storage and shipping, 227Restriction fragment length

polymorphism (RFLP), seealso Haplotyping,

hemoglobin variants, 108,111, 113


prenatal diagnosis,amniotic fluid collection,

120, 121chorionic villi sampling, 121fetal cells in maternal blood,

121, 122haplotype analysis, 124–126historical perspective, 117maternal DNA contamination




samples, 122primers, 127

Reverse-phase chromatography, seeHigh-performance liquidchromatography,hemoglobin

RFLP, see Restriction fragmentlength polymorphism

S

Semisynthetic hemoglobin,assembly and purification,

alloplex intermediatepreparation, 188

chromatography, 190cyanomet form,

dithionite reduction, 189generation, 189

heme addition, 188, 191materials, 182sulfhydryl group regeneration,

188chains, 179, 180characterization, 182, 190covalent semisynthesis, 178, 179α-globin semisynthesis,

α1–30 and α31–141 preparation,181, 185, 186

chemical synthesis of α1–30, 186chromatography of spliced

product, 183, 187, 188HbA, 182, 183HbS, 182, 183ligation of fragments with V8

protease, 181, 182, 186, 187overview, 179removal of unspliced

fragments, 187reverse-phase high-

performance liquidchromatography offragments, 185

V8 protease digestion, 185materials, 180–182, 190, 191native α- and β-chain

preparation,acid acetone precipitation,

184, 191CM-52-cellulose-urea

chromatography, 184, 185noncovalent semisynthesis, 178

298 Index

recombinant DNA versuschemical synthesis ofproteins, 177, 190

Sickle cell hemoglobin (HbS),amidation analysis by high-

performance liquidchromatography, 33, 39,40, 46

haplotyping applications,geographic distribution,

African origins of Sicilymutation, 198

expansion in Middle Eastduring Sassanian empire,198

overview, 196, 197slave-trade-based gene flow

to America, 197, 198HbF modulation, 200insulin-like growth factor axis,

199, 200oxygen equilibrium curve, 62polymerization,

amino acid residues affectingbonding and polymerization,272

intermolecular bonding, 272intracellular studies, 276, 277kinetics, 275nucleation pathways, 275, 276pathogenesis, 271solution studies, 275, 276structure of polymer, 271, 272

purification for crystallization, 9solubility,

CSAT determinations,dithionite preparation, 278interpretation, 281–283

p50 for intact red bloodcells, 280–284

p50 for solutions, 278–280,283, 284

reference method, 277, 278,283

hemoglobin concentration atsaturation, 273

hemoglobin type mixtureeffects, 273, 274

ionic strength dependence, 274pH dependence, 274phosphate effects, 275temperature dependence, 274

transgenic mice, see alsoTransgenic mice,

applicability to human studies,219

Berkeley mouse, 217, 218Birmingham mouse, 217breeding, 226, 233characteristics, 228, 229early models, 214humanized hemoglobin

expression, 216, 217NY1DD model, 215NY1KO mouse, 218S+S-Antilles model, 215, 216SAD mouse, 214, 215

Size-exclusion chromatography, seeX-ray crystallography,hemoglobin

Solubility, see HbC; Sickle cellhemoglobin

Southern blot,hemoglobinopathy diagnosis

overview, 101, 102α-thalassemia diagnosis, 104, 106

Index 299

T

α-Thalassemia,diagnosis,

denaturing gradient gelelectrophoresis, 104

gap-PCR, 102, 103Southern blot, 104, 106

HbH disease, 118, 119interactions with hemoglobin

variants, 119, 120β-Thalassemia,

diagnosis,amplification refractory

mutation system, 106, 107,112, 113

denaturing gradient gelelectrophoresis, 106, 107

polymerase chain reaction,104–106

mutation types, 119prenatal diagnosis,

amniotic fluid collection,120, 121

chorionic villi sampling, 121fetal cells in maternal blood,

121, 122haplotype analysis, 124-127historical perspective, 117maternal DNA contamination




samples, 122δβ-Thalassemia,

diagnosis with gap-PCR, 107, 108

interactions with hemoglobinvariants, 119, 120

Transgenic mice,balanced α- and β-globin

expression, 224, 233breeding,

backcrossing, 232choice of breeders, 231, 235, 236founder effects, 232

construct design,large constructs, 225LCR derivatives, 223position effects, 223, 224, 233short constructs, 222, 223

embryonic stem cell modificationof endogenous locus,224, 233

β-globin gene regulation, 222,223, 233

HbC expression, 219, 221HbF mice and malaria resistance,

221, 222knockout of globin genes,

225, 226lentiviral vectors, 224, 225mutation validation, 226, 227nomenclature, 220record keeping, 232screening,

electrophoresis,cellulose acetate

electrophoresis, 227, 230isoelectric focusing,

230, 234overview, 227, 233

high-performance liquidchromatography, 230,231, 234

300 Index

polymerase chain reaction,227, 233

refinement, 231, 234, 235storage and shipping of red

blood cells and hemoglobin,227

sickle cell disease, see Sickle cellhemoglobin

V

V8 protease semisynthetic ligation,see Semisynthetic hemoglobin

X

X-ray crystallography, hemoglobin,crystal preparation and mounting,

cryogenic temperature datacollection,R-state HbCO, 8, 14T-state deoxyHbA, 8, 14, 17

materials, 8room temperature data

collection, 7, 13, 14, 16, 17crystallization conditions and

structural properties, tables,artificial mutant human

hemoglobins, 5human hemoglobins with

various ligands, 3mutant human hemoglobins, 4

crystallization of humanhemoglobin,

HbC, 162high-salt crystallization of R-state

HbCO A, 7, 11, 12, 14, 16

high-salt crystallization ofT-state deoxyHbA, 6, 10,11, 15, 16

low-salt crystallization ofT-state deoxyHbS, 7, 12,13, 16

materials, 6, 7precautions, 15

historical perspective, 1, 2horse hemoglobin, 2methemoglobin, 1oxyhemoglobin, 2purification of human

hemoglobin forcrystallization,

cell lysis, 8, 14, 15centrifugation and dialysis, 8,

9, 15concentrating, 9, 15HbS, 9ion-exchange chromatography,

9, 15materials, 6, 14storage, 9

size-exclusion chromatography,analytical chromatography,

crosslinking analysis, 40–42hydrodynamic volume

determination for size-enhanced hemoglobins, 42

materials, 33, 46semipreparative

chromatography ofoligomeric forms, 33, 43


Series Editor: John M. Walker

Contents

Features

Methods in Molecular Medicine™ISSN 1543–1894Hemoglobin Disorders: Molecular Methods and ProtocolsISBN: 0-89603-962-5 E-ISBN: 1-59259-373-9humanapress.com 9 780896 039629

9 0 0 0 0

Hemoglobin DisordersMolecular Methods and Protocols

Edited by

Ronald L. Nagel, MDAlbert Einstein College of Medicine, Bronx, NY

• Cutting-edge experimental and clinicaltechniques for studying hemoglobindisorders

• State-of-the-art uses of X-ray crystallog-raphy, HPLC, electrophoresis, and NMR

• Molecular tools for diagnostic analysis ofhemoglobin disorders

The recent announcement that sickle-cell anemia and thalassemia have been corrected by thetransplantation of stem cells bodes well for the future of gene therapy in hemoglobinopathies. InHemoglobin Disorders: Molecular Methods and Protocols, Ronald Nagel, MD, has assembled acollection of readily reproducible techniques essential to the continued advance of our molecularunderstanding of these diseases. The book’s richly experienced authors detail methods utilizing awide variety of the latest analytical techniques, including X-ray crystallography, high performanceliquid chromatography, electrophoresis, and nuclear magnetic resonance. Additional methods areoffered for prenatal diagnostic analysis, the DNA diagnosis of hemoglobin mutations, hemoglobinfluorescence, and the semisynthesis of hemoglobin. Each protocol includes an introduction ex-plaining the basic science, step-by-step instructions for its successful execution, notes on pitfallsto avoid, and tips on how to employ it effectively with novel systems and conditions.

State-of-the-art and highly practical, Hemoglobin Disorders: Molecular Methods and Protocolsreviews all the basic topics and techniques in this critically important field, and offers today’s mostcomprehensive set of proven protocols for successful experimental and clinical work on hemoglo-bin diseases.

• Step-by-step instructions to ensuresuccessful results

• Notes on pitfalls to avoid and using thetechniques in novel conditions

X-ray Crystallography of Hemoglobins. Analysis ofHemoglobins and Globin Chains by High-PerformanceLiquid Chromatography. Purification and MolecularAnalysis of Hemoglobin by High-Performance LiquidChromatograpy. Oxygen Equilibrium Measurements ofHuman Red Blood Cells. Measurement of Rate Con-stants for Reactions of O2, CO, and NO with Hemoglobin.Electrophoretic Methods for Study of Hemoglobins. DNADiagnosis of Hemoglobin Mutations. Methods for

Analysis of Prenatal Diagnosis. Hemoglobin Fluores-cence. Nucleation and Crystal Growth of Hemoglobins:The Case of HbC. Semisynthesis of Hemoglobin. β-Globin-like Gene Cluster Haplotypes in Hemoglobinopa-thies. Transgenic Mice and Hemoglobinopathies. Recombi-nant Single Globin-Chain Expression and Purification.Nuclear Magnetic Resonance of Hemoglobins. SolubilityMeasurement of the Sickle Polymer. Index.

The Eyethe-eye.eu/public/Books/BioMed/Hemoglobin Disorders... · 89. The Blood and Brain Barrier:...

Documents

Transcript of The Eyethe-eye.eu/public/Books/BioMed/Hemoglobin Disorders... · 89. The Blood and Brain Barrier:...