The effect of ascorbic acidand retinoic acid onelastin and collagen

gene expression in monolayers

Internship

S. RonkenIdentity number: 0527700

BMTE 07.19

June 2007

Abstract

To increase the strength and the elasticity of an engineered tissue, it is important to promotethe collagen and elastin synthesis. Collagen production is ensured by adding ascorbic acid to theculture medium. By adding TGF-β1, insulin, calcitriol or retinoic acid to the culture medium,elastin production is ensured. The effects of ascorbic acid and retinoic acid on the gene expressionof collagen and elastin in human myofibroblasts were compared, using real-time polymerase chainreaction. Ascorbic acid and retinoic acid have no effect on the collagen mRNA levels, neitherhas ascorbic acid on the elastin gene expression. However, retinoic acid has a declining effect onelastin synthesis. Elastin synthesis was halved after a 24 hour treatment with retinoic acid.

CONTENTS

Contents

1 Introduction 3

2 Materials and Methods 42.1 Cell culture . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 42.2 Treatment with retinoic acid and ascorbic acid . . . . . . . . . . . . . . . . . . . . 42.3 RNA isolation and cDNA synthesis . . . . . . . . . . . . . . . . . . . . . . . . . . . 42.4 Primer design . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 52.5 Primer testing . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 52.6 Real-time polymerase chain reaction . . . . . . . . . . . . . . . . . . . . . . . . . . 52.7 Data post-processing . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 62.8 Statistics . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 6

3 Results 73.1 Treatment with RA and AA . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 73.2 Primer testing . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 73.3 Influence of RA and AA treatment on gene expression . . . . . . . . . . . . . . . . 8

4 Discussion and Conclusion 10

References 11

A Protocols IA.1 Culturing human vena saphena cells . . . . . . . . . . . . . . . . . . . . . . . . . . I

A.1.1 Medium . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . IA.1.2 Thawing the cells . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . IA.1.3 Medium change . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . IA.1.4 Subculturing the cells . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . IIA.1.5 Counting the cells . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . IIIA.1.6 Freezing the cells . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . III

A.2 Treatment with RA and AA . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . IVA.2.1 Thawing the cells . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . IVA.2.2 Medium change . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . IVA.2.3 Subculturing the cells . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . IVA.2.4 Treatment with RA and AA . . . . . . . . . . . . . . . . . . . . . . . . . . . VA.2.5 Saving samples . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . VI

A.3 RNA isolation . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . VIIA.3.1 Notes before starting . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . VIIA.3.2 RNA isolation . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . VIIA.3.3 Control and measurements . . . . . . . . . . . . . . . . . . . . . . . . . . . VIII

A.3.3.1 Quality control of RNA sample . . . . . . . . . . . . . . . . . . . . VIIIA.3.3.2 Measuring of RNA concentration on spectrophotometer . . . . . . VIII

A.4 cDNA synthesis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . IX

1

CONTENTS

A.5 Primer Design with Beacon Designer Software . . . . . . . . . . . . . . . . . . . . . XA.6 Conventional PCR . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . XIA.7 Real-time PCR . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . XIIA.8 Agarose gel electroforesis . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . XIV

2

CHAPTER 1. INTRODUCTION

Chapter 1

Introduction

In cardiovascular tissue engineering, collagen production is ensured by adding ascorbic acid tothe culture medium to increase the strength of the engineered tissue [1]. However, the engineeredtissues should not only have sufficient strength, but also have certain elastic properties. Elastinfacilitates the tissue with elasticity, preventing dynamic tissue creep by stretching under load andrecoiling to their original configurations after the load is released. In order to resemble the humantissue, the engineered constructs have to produce elastin besides collagen. Methods to ensure thatcells produce elastin are summarized by Patel et al. [2]. These methods include static stretchingand environmental factors, such as scaffold composition, a collagen scaffold inhibits elastin morethan a fibrin scaffold; or medium composition, TGF-β1, insulin, calcitriol and retinoic acid areknown to promote elastogenesis.

Retinoic acid induces elastin synthesis, however, it has also been shown that retinoic acid in-hibits ascorbate-induced collagen synthesis [3].

The goal of this study is to investigate the effect of retinoic acid and ascorbic acid on elastinand collagen synthesis in monolayer human fibroblast cell cultures. To obtain a fast impressionof collagen and elastin production real time PCR is used to quantify the gene expression as anindicator of produced collagen and elastin.

3

CHAPTER 2. MATERIALS AND METHODS

Chapter 2

Materials and Methods

2.1 Cell culture

Human vena saphena cells were cultured in DMEM Advanced (Gibco, New York, NY) supple-mented with 10% fetal bovine serum (Biochrom, Berlin, Germany), 1% GlutaMax (Gibco) and0.1% gentamycin (Biochrom). Cell cultures were incubated at 37◦C. Media was changed everythree to four days. Cultures were subcultured using trypsin at a seeding density of 0.7×106 to1.0×106 cells per T150 flask (Appendix A.1).

2.2 Treatment with retinoic acid and ascorbic acid

To study the effect of retinoic acid (RA; Sigma,St. Louis, Mo) and ascorbic acid (AA; Sigma) onthe gene expression, cells were cultured until the 6th passage and subcultured in T25 flasks witha seeding density of 1.1×105 cells per flask. Media was changed after 3 days into different mediaper flask in triplicate (Table 2.1). After 24 hours the cells were photographed, harvested usingtrypsin, and stored at -80◦C in RTL buffer (Appendix A.2).

Table 2.1: Medium with additives

Group Medium with additional:

AA&RA 260 mg/ml AA & 30 mg/ml RAAA 260 mg/ml AARA 30 mg/ml RAO no additives

2.3 RNA isolation and cDNA synthesis

Total RNA was isolated from cultured cells using the RNeasy RNA isolation kit (Qiagen) accord-ing to the protocol in Appendix A.3. Any genomic DNA present on the column is digested bythe DNAse mix (Qiagen). The integrity and purity of the RNA was determined using gel elec-trophoresis, and by measuring the absorption with the photospectrometer (Appendix A.3). RNAwas reverse transcribed by M-MLV reversed transcriptase according to the protocol in AppendixA.4.

4

CHAPTER 2. MATERIALS AND METHODS

2.4 Primer design

The elastin and collagen primers for real-time PCR were designed using Beacon Design Software(Appendix A.5). The primers were selected, based on the following requirements: primer meltingtemperature of approximately 60◦C, GC content of approximately 55%, preferably no G at the5’ end, no runs of more than three identical nucleotides, amplicon length of approximately 100nucleotides. Specificity was checked with the Basic Local Alignment Search Tool (BLAST: http://www.ncbi.nlm.nih.gov/BLAST). Cyclophilin and β-actin, designed by Thijssen et al. [4], wereused as an internal standard to determine the relative expression of collagen and elastin. Allprimers (Table 2.2) were synthesized by Sigma.

Table 2.2: Primer sequences and GenBank accession no.

Target GenBank Direction Sequence of primeraccession no.

β-Actin [4] NM 001101 Forward 5’ CCTGTGCTACGTCGCCCTG 3’Reverse 5’ GGAGGAGCTGGAAGCAGCC 3’

Collagen NM 000088 Forward 5’ GGCTCCTGCTCCTCTTAGCG 3’Reverse 5’ CATGGTACCTGAGGCCGTTC 3’

Cyclophilin [4] NM 203430 Forward 5’ CTCGAATAAGTTTGACTTGTGTTT 3’Reverse 5’ CTAGGCATGGGAGGGAACA 3’

Elastin NM 000501 Forward 5’ TCCTGGAATTGGAGGCATCG 3’Reverse 5’ CTCCTGGGACACCAACTACTC 3’

2.5 Primer testing

To ensure that the primers only duplicate the gene of interest, conventional PCR is performed(Appendix A.6). The PCR product is visualized using gel electrophoresis, to inspect if the primersproduce a single band and if the length of the amplicon is correct.

If the result of the conventional PCR is satisfactory, a dilution serie (1, 1:10, 1:100, 1:1000and 1:10000) is tested using real-time PCR (Section 2.6) to obtain a standard curve. A tenfolddecrease of the amount of cDNA added, results theoretically in an increase of the Ct-value with3.32. When the Ct-value is plotted as a function of the dilution, a linear regression line is drawnthrough the plot. The slope of this regression line has to be approximately -3.32.

2.6 Real-time polymerase chain reaction

A single color real-time PCR detection system (MyiQTM Optical Module; Bio-Rad, Hercules,CA, USA) was used to perform real-time PCR amplification products (Appendix A.7). It wasperformed in a 25 µl reaction mixture containing 12.5 µL iQ SYBRr Green Supermix (Bio-Rad),6.5 µl ddH2O, 0.5 µl of each primer (20 µM) and 5 µl cDNA. The real-time PCR conditions were:denaturation at 95 ◦C for 3 minutes; followed by 40 cycles at 95 ◦C for 10 s, 60 ◦C for 30 s, and72 ◦C for 30 s; followed by 95 ◦C for 1 min and 65 ◦C for 1 min; and followed by 61 cycles of 10 sat 65 ◦C to obtain a melting curve. Each sample was measured in duplo.

5

CHAPTER 2. MATERIALS AND METHODS

2.7 Data post-processing

The data interpretation of the real-time PCR measurements in this study is based on the methodof Livak et al.[5].

The amount of mRNA per sample, normalized to the internal standard (cyclophilin and β-actin), can be calculated with Equation 2.1:

N1 = 2−∆Ct1 (2.1)

With:* N1 = Normalized amount of mRNA in sample 1* ∆Ct = Ct1 - Ctβ−actin/cyclophilin

(the ∆Ct value corresponds to the normalized threshold cycle)

The fold change in mRNA target gene expression between two samples can be calculated withEquation 2.2:

FoldChange = 2−∆∆Ct (2.2)

With:* ∆∆Ct = ∆Ct1 - ∆Ct2

(∆∆Ct corresponds to the difference in normalized threshold cycles between sample 1 and 2)

- The ∆Ct value was calculated per sample- Mean ∆Ct values were determined per group- ∆∆Ct and fold change were calculated with the mean ∆Ct’s

In this study the fold change is used to determine the difference in expression between Group Oand Group AA, Group RA and Group AA&RA.

2.8 Statistics

To test the primers, a regression line is drawn through the experimental data. To determine howwell the regression line fits the experimental data, the coefficient of determination, R2, is calculatedusing Microsoft Excel. This value is between 0 (very bad fit) and 1 (very good fit) and should belarger than 0.980 [6].

The average of the duplo real-time PCR Ct-values were used for data post-processing (section2.7). To determine the normalized amount of mRNA per test group, the triplicate measurementsof each group were averaged. The standard deviation is calculated with Equation 2.3.

σ =

√nΣx2 − (Σx)2

n(n− 1)(2.3)

Fold changes (Equation 2.2) are considered to be significant when smaller than 0.5 or largerthan 2.

6

CHAPTER 3. RESULTS

Chapter 3

Results

3.1 Treatment with RA and AA

In the photographs made before and after treatment with AA and/or RA, it is seen that themorphology of the cells does not change due to treatment. Figure 3.1 shows the cells before andafter AA treatment.

Figure 3.1: Myofibroblast cells before (left) and after (right) treatment with AA

3.2 Primer testing

Gel electrophoresis of the conventional PCR shows that the primers only duplicate one ampliconand that it has the expected length (data not shown). In Figure 3.2, the standard curves of eachprimer are shown. Also the regression line is shown and it is seen that it fits quite well to thepoints (R2 > 0.980). The slopes of these regression curves are approximately -3.32, and the R2

for all curves is larger than 0.980 (Table 3.1).

7

CHAPTER 3. RESULTS

Figure 3.2: Ct-values as a function of the dilution. Experimental data and regression line of thedilution serie per primer

Table 3.1: Slope and R2 of the regression line per primer shown in Figure 3.2

Primer Slope R2

β-actin -3.31 0.9841Collagen -3.2125 0.9997Cyclophilin -2.987 0.9999Elastin -3.355 0.9883

3.3 Influence of RA and AA treatment on gene expression

The gene expression of collagen and elastin, normalized by β-actin and cyclophilin, of the differenttest groups are plotted in Figure 3.3. Halving the concentration of AA gives comparable resultswith group AA (data not shown). It is seen that the expression of collagen does not change withdifferent media. It is also seen that the expression of elastin does change with different media.The elastin expression is halved in medium with additional RA and in medium with additionalAA&RA compared with regular medium.

8

CHAPTER 3. RESULTS

Figure 3.3: Normalized amount of mRNA per group (1 = Group O, 2 = Group AA, 3 = GroupRA, 4 = Group AA & RA) for collagen and elastin, normalized to β-actin and cyclophilin

Figure 3.4: Fold changes per group with respect to group O, 1 = Collagen versus β-actin, 2 =Collagen versus cyclophilin, 3 = Elastin versus β-actin, 4 = Elastin versus cyclophilin

9

CHAPTER 4. DISCUSSION AND CONCLUSION

Chapter 4

Discussion and Conclusion

Ascorbic acid is known to promote the collagen production [1]. However, the gene expression ofcollagen does not show an increased expression after addition of AA to the culture medium. Thismight be explained by the mechanisms for AA stimulation of collagen synthesis in vascular smoothmuscle cells, including post-translational hydroxylation of proline and lysine necessary for intraand intermolecular protein stabilization. Literature describes a possible increased transcription ofcollagen after AA treatment [3], although no increased collagen mRNA level is observed in thisstudy.

When cells are treated with RA, results show a slight decrease in elastin expression. In contrast,Hayashi [7] found an increase in elastin synthesis when cells are treated with RA, being the largestafter treatment with RA for 24 hours. These contradictory results may be explained by thedifference in cell passage used (freshly isolated versus seventh passage), since elastin synthesisdecreases with increasing number of cell passages. Additionally the cell source is different: Hayashiuses smooth muscle cells from aortas of 18-day-old chick embryos versus the human myofibroblastcell cultures used in this study. Furthermore the method used to obtain the results is different.Hayashi uses SDS-Polyacrylamide gel electrophoresis and northern blot analysis in combinationwith a densitometer while I used real-time PCR. An interesting experiment can be the investigationof the effect of the duration and concentration of AA and RA treatment on the collagen and elastinproduction. Also the influence of the cell passage number might be interesting to investigate.

There should not be a difference between the expression of elastin compared to the two ref-erence genes, since it is assumed that the gene expression of a reference gene stays constant percell. The degree of expression of the reference gene is therefore a control for the number of cells.There is a deviation in elastin expression between the two reference genes, which can be causedby the β-actin mRNA level decrease when smooth muscle cells cease to grow and enter the G0

phase. Because of the deviation in the relative expression between the two reference genes, it isrecommended to try other reference genes, to take a closer look at the influence of the referencegene.

The gene expression of collagen does not change after treatment with AA or RA, the geneexpression of elastin on the other hand, seems to slightly decrease after treatment with RA.

10

BIBLIOGRAPHY

Bibliography

[1] A. Mol, M. C. M. Rutten, N. J. B. Driessen, C. V. C. Bouten, G. Zund, F. P. T. Baaijens, andS. P. Hoerstrup, “Autologous human tissue-engineered heart valves: Prospects for systemicapplication,” Circulation, vol. 114, pp. I–152 – I–158, 2006.

[2] A. Patel, B. Fine, M. Sandig, and K. Mequanint, “Elastin biosynthesis: The missing link intissue-engineered blood vessels,” Cardiovasc Res, vol. 71, pp. 40–49, 2006.

[3] B. M. Ogle and D. L. Mooradian, “Manipulation of remodeling pathways to enhance themechanical properties of a tissue engineered blood vessel,” J Biomech Eng, vol. 124, pp. 724–733, 2002.

[4] V. Thijssen, R. Brandwijk, R. Dings, and A. Griffioen, “Angiogenesis gene expression profilingin xenograft models to study cellular interactions,” Exp Cell Res, vol. 299, pp. 286–293, 2004.

[5] K. J. Livak and T. D. Schmittgen, “Analysis of relative gene expression data using real-timequantitative pcr and the 2−∆∆CT method,” Methods, vol. 25, pp. 402–408, 2001.

[6] Real-time PCR Applications Guide. Biorad, 2005.

[7] A. Hayashi, T. Suzuki, and S. Tajima, “Modulations of elastin expression and cell proliferationby retinoids in cultured vascular smooth muscle cells,” J. Biochem., vol. 117, pp. 132–136, 1995.

11

APPENDIX A. PROTOCOLS

Appendix A

Protocols

A.1 Culturing human vena saphena cells

A.1.1 Medium

- DMEM Advanced (500 ml)- 10% FBS (50 ml)- 1%Glutamax (5 ml)- 0.1% Gentamycin (0.5 ml)

A.1.2 Thawing the cells

Normally the cells are frozen in an amount of ∼ 2 × 106 cells per vial. This is a good amountto start with in a T150 flask. The passage that is on the vial is the passage at which they werefrozen, so add a passage when you set up the cells.

- Take a vial out of the liquid nitrogen- Warm up between your hands- Carefully open the vial to let N2 escape- Put 10 ml PBS in a 50 ml centrifuge tube- Transfer the contents of the vial (2 × 106 cells) to the centrifuge tube with the PBS- Rinse the vial with PBS and add to the centrifuge tube- Centrifuge 7 minutes at 1000 rpm- Discard the supernatant and resuspend the cells in 10 ml medium- Transfer the cells to a T150 flask- Rinse the centrifuge tube with another 15 ml of medium and add this to the T150 flask- Mix the cells with the medium gently and place the flask in the incubator (always check the

water level in the incubator)

A.1.3 Medium change

The medium should be changed every three to four days. Most convenient is to do this everyTuesday and Friday or every Monday and Thursday.

- Discard the medium- Rinse the cells once with PBS- Add new medium up to 25 ml per flask

I

A.1.4 Subculturing the cells

? First subculturing after thawingIt will take about 7-10 days to grow confluent. Subculture the cells (you will have about 5-6 ×106 cells) at a seeding density of 1.0 × 106 cells per new flask.

? Further subculturingIt will take about 7-14 days before they frow 80-90% confluent. Subculture them (you will thenhave about 5 × 106 cells per flask) at a seeding density of 1.0 × 106 cells per new flask.

- Discard the medium- Rinse the cells twice with PBS- Add trypsin (2.5 ml per T150 flask) and distribute evenly over the bottom of the flask- Place the vial in the incubator for 7 minutes- Check wether all the cell are rounded up and de-attached. If not place the flask back into the

incubator for a few more minutes- Add 5 ml of medium to the flask and mix the medium with the cells and the trypsin- Transfer the medium to a centrifuge tube- Add 10 ml of PBS to the flask and pipet up and down to the walls of the flask to get all the

leftover cells transferred into the centrifuge tube- Check the flask microscopically for leftover cells. If there are still many cells in there rinse the

flask again with PBS and add this to the centrifuge tube- Centrifuge 7 minutes at 1000 rpm- Discard the supernatant and resuspend the cells in 1 ml medium for counting- Count the cells (described seperately)- Calculate the amount of new flasks needed to get a seeding density of 0.7-1.0 × 106 cells per

new flask- Add medium to the cells and resuspend- Divide the cells over the desired amount of new flasks- Fill each flask up to 25 ml with medium and place the flasks in the incubator

* Note: You can continu the subculturing procedure up to passage 8-9, after that passage theywill not be the same cells anymore as you can notice in a changed morphology and differentgrowth speed.

* Note: Best is to count the cells every time you transfer them to keep track of their growingspeed. Prepare a growth curve and check whether the speed does not change over the cultureperiod.

A.1.5 Counting the cells

Important for the counting procedure is to think of the amount of cells you expect to have in yourflasks to calculate the right dilution factor and to prevent that you will have too less or too manycells in your counting window. Always try to have 100-150 cells in your counting window for areliable counting.

- Prepare the counting window: clean, put the cover glass on top and check for dust- After resuspending the cells in 1 ml medium, take out 50 µl of the suspension and transfer this

to a small centrifuge tube, which will be your counting tube- Calculate the dilution factor for counting: For example if you would expect 15 × 106 cells, you

should dilute 10 times to get 150 cells in your counting window: 15 × 106 (expected amount)/ 10.000 (factor of the Neubauer counting window) / 150 (desired amount of cells to count)

- Add PBS to the counting tube to obtain the desired dilution and resuspend the cells in PBS- Put 11 µl of the counting solution at each side of the counting window- Count the cells and check the viability (living cells appear as round cells with a white edge,

dead cells are dark and have irregular edges- Calculate the amount of cells in your suspension: Counted cells × dilution factor × 10.000- Discard the counting solution

A.1.6 Freezing the cells

? What you need for freezing:- Normal Human Vena Saphena Cells culture medium- DMSO- Nalgene Cryovials- Cryocontainer filled with isopropanol- Ice

? How to freeze Human Vena Saphena Cells:- Prepare freezing medium: a solution of 10:1 medium:DMSO. For example 10 ml HVS medium

+ 1 ml DMSO, resulting in a±10% DMSO/medium solution- Discard the medium from the cells- Rinse the cells twice with PBS- Add trypsin (2.5 ml per T150 flask) and distribute evenly over the bottom of the flask- Place the vial in the incubator for 7 minutes- Check wether all the cell are rounded up and de-attached. If not place the flask back into the

incubator for a few more minutes- Add 5 ml of medium to the flask and mix the medium with the cells and the trypsin- Transfer the medium to a centrifuge tube- Add 10 ml of PBS to the flask and pipet up and down to the walls of the flask to get all the

leftover cells transferred into the centrifuge tube- Check the flask microscopically for leftover cells. If there are still many cells in there rinse the

flask again with PBS and add this to the centrifuge tube- Centrifuge 7 minutes at 1000 rpm- Discard the supernatant and resuspend the cells in 1 ml freezing medium- Count the cells, in the mean time keep the rest of the cells on ice as DMSO is toxic to the cells- Dilute the cell suspension up to a concentration of 2 × 106 cells per ml in freezing medium- Fill out 1 ml per Nalgene cryovial (equals 2 × 106 cells per vial), label the vials and place the

vials in the cryocontainer- Place the cryocontainer in -80◦C for about 24 hours and then transfer the vials to the liquid

nitrogen container- Fill out a freezing form and note in the database at what spots you have placed the cells in the

liquid nitrogen

A.2 Treatment with RA and AA

A.2.1 Thawing the cells

- Take two vials out of the liquid nitrogen- Warm up between your hands- Carefully open the vial to let N2 escape- Put 10 ml PBS in a 50 ml centrifuge tube- Transfer the contents of one vial (2 × 106 cells) to the centrifuge tube with the PBS- Rinse the vial with PBS and add to the centrifuge tube- Centrifuge 7 minutes at 1000 rpm- Discard the supernatant and resuspend the cells in 10 ml medium- Transfer the cells to a T150 flask- Rinse the centrifuge tube with another 15 ml of medium and add this to the T150 flask- Mix the cells with the medium gently and place the flask in the incubator (always check the

water level in the incubator)

A.2.2 Medium change

The medium was changed after three days.

- Discard the medium- Rinse the cells once with PBS- Add new medium up to 25 ml per flask

A.2.3 Subculturing the cells

Six days after thawing, the cells were subcultured into several T25 flasks.

- Discard the medium- Rinse the cells twice with PBS- Add trypsin (2.5 ml per T150 flask) and distribute evenly over the bottom of the flask- Place the vial in the incubator for 7 minutes- Check wether all the cell are rounded up and de-attached. If not place the flask back into the

incubator for a few more minutes- Add 5 ml of medium to the flask and mix the medium with the cells and the trypsin- Transfer the medium to a centrifuge tube- Add 10 ml of PBS to the flask and pipet up and down to the walls of the flask to get all the

leftover cells transferred into the centrifuge tube- Check the flask microscopically for leftover cells. If there are still many cells in there rinse the

flask again with PBS and add this to the centrifuge tube- Centrifuge 7 minutes at 1000 rpm- Discard the supernatant and resuspend the cells in 1 ml medium for counting- Count the cells

? Take out 50 µl of the cell suspension and transfer this to an eppendorf tube? Add 50µl Reagent A and 50 µl Reagent B (mix well)? Fill the NucleoCassette (Chemometec) mixture and let the NucleoCounter (Chemometec)

count the cells × 3 = number of cells/ml- Add medium to the cells and resuspend- Divide the cells over nine T25 flasks, each with approximately 110.000 cells- Fill each flask up to 4 ml with medium and place the flasks in the incubator

A.2.4 Treatment with RA and AA

Four days after subculturing, the cells were treated with RA and AA.

- Take three T25 flasks from incubator- Take a picture of each flask to compare the cells before treatment- Discard medium- Rinse the cells with PBS- Add 4.5 ml medium AA&RA (Table 2.1)- Place the flasks in the incubator for approximately 24 hours

- Take three T25 flasks from incubator- Take a picture of each flask to compare the cells before treatment- Discard medium- Rinse the cells with PBS- Add 4.5 ml medium AA (Table 2.1)- Place the flasks in the incubator for approximately 24 hours

- Take three T25 flasks from incubator- Take a picture of each flask to compare the cells before treatment- Discard medium- Rinse the cells with PBS- Add 4.5 ml medium RA (Table 2.1)- Place the flasks in the incubator for approximately 24 hours

- Take three T25 flasks from incubator- Take a picture of each flask to compare the cells before treatment- Discard medium- Rinse the cells with PBS- Add 4.5 ml medium O (Table 2.1)- Place the flasks in the incubator for approximately 24 hours

- Take the remaining T25 flasks from incubator (for primer testing)- Take a picture of each flask to compare the cells before treatment- Discard medium- Rinse the cells with PBS- Add 4.5 ml medium O (Table 2.1)- Place the flasks in the incubator for approximately 24 hours

A.2.5 Saving samples

After 24 hours:

- Take a picture of each flask- Add 1.0 ml Trypsine- Place the flask in the incubator for 10 minutes- Add 3 ml medium and transfer the medium with the cells to a centrifuge tube- Add 10 ml of PBS to the flask and pipet up and down to the walls of the flask to get all the

leftover cells transferred into the centrifuge tube- Centrifuge 7 minutes at 1000 rpm- Resuspend the cells in 350µl RTL buffer (for RNA isolation)- Freeze cells

Continue with protocol RNA isolation step 3 (Appendix A.3.2)

A.3 RNA isolation

A.3.1 Notes before starting

RNA is highly unstable and very sensitive to degradation by specific enzymes, the RNases. It istherefore important that you work neatly and fast. Change your gloves regularly and keep yoursamples frozen and on ice as long as possible.When you want to isolate multiple samples in one run, you can keep your samples for some time onice after the cell lysis and homogenisation procedure. The lysis buffer contains RNase inhibitorsthat protect your samples from degradation. Before starting the isolation procedure, put allsamples at room temperature for 15 minutes (the binding capacity of the column is improved at20◦C). The RNA isolation procedure should be performed quickly and at constant temperature(do not put your samples on ice in between the steps). Therefore, it is important to first collectall your lysated and homogenized samples before running them through the columns.

A.3.2 RNA isolation

1. Harvest cellsCells grown in a monolayer (do not use more than 1 x 107 cells). Cells grown in a monolayerin cell-culture flasks should always be trypsinized.Note: Incomplete removal of the cell-culture medium will inhibit lysis and dilute the lysate,affecting the conditions for binding of RNA to the RNeasy silica-gel membrane. Both effectsmay reduce RNA yield.

2. Disrupt cells by addition of Buffer RLT and homogenizeFor pelleted cells, loosen the cell pellet thoroughly by flicking the tube. Add the appropriatevolume of Buffer RLT (Table A.1). Vortex or pipet to mix, and proceed to step 3.Note: Incomplete loosening of the cell pellet may lead to inefficient lysis and reduced yields.Ensure that ß-ME is added to Buffer RLT before use.

Table A.1: Amount of RLT Buffer per amount of cells

Number of pelleted cells Buffer RLT

< 5 × 106 350 µl5 × 106 - 1 × 107 600 µl

3. Add 1 volume (usually 350 µl or 600 µl) of 70% ethanol to the homogenized lysate, and mix wellby pipetting. Do not centrifuge. If some lysate is lost during homogenization, adjust volumeof ethanol accordingly.Note: Visible precipitates may form after the addition of ethanol when preparing RNA fromcertain cell lines, but this will not affect the RNeasy procedure.

4. Apply up to 700 µl of the sample, including any precipitate that may have formed, to an RNeasymini column placed in a 2 ml collection tube (supplied). Close the tube gently, and centrifugefor 15 s at =8000 × g (=10,000 rpm). Discard the flow-through. Reuse the collection tube instep 5. If the volume exceeds 700 µl, load aliquots successively onto the RNeasy column, andcentrifuge as above. Discard the flow-through after each centrifugation step.

5. Add 700 µl Buffer RW1 to the RNeasy column. Close the tube gently, and centrifuge for 15 sat =8000 × g (=10,000 rpm) to wash the column. Discard the flow-through.

6. DNase treatment: Per sample add 10 µl DNase in 70 µl of Dnase-buffer. Pipet this mixture onthe column and incubate for 15 minutes at RT.

7. Wash the column by adding 350 µl of buffer RW1 to the column and centrifuge for 15 s at=8000 × g (=10,000 rpm)

8. Transfer the RNeasy column into a new 2 ml collection tube (supplied). Pipet 500 µl BufferRPE onto the RNeasy column. Close the tube gently, and centrifuge for 15 s at =8000 × g(=10,000 rpm) to wash the column. Discard the flow-through. Reuse the collection tube instep 9.Note: Buffer RPE is supplied as a concentrate. Ensure that ethanol is added to Buffer RPEbefore use.

9. Add another 500 µl Buffer RPE to the RNeasy column. Close the tube gently, and centrifugefor 2 min at =8000 × g (=10,000 rpm) to dry the RNeasy silica-gel membrane. Continuedirectly with step 10, or, to eliminate any chance of possible Buffer RPE carryover, continuefirst with step 9a.It is important to dry the RNeasy silica-gel membrane since residual ethanol may interferewith downstream reactions. This centrifugation ensures that no ethanol is carried over duringelution. Note: Following the centrifugation, remove the RNeasy mini column from the collectiontube carefully so the column does not contact the flow-through as this will result in carryoverof ethanol.

9a. Discard the flow-through and centrifuge in a micro centrifuge at full speed for 1 min.

10. To elute, transfer the RNeasy column to a new 1.5 ml collection tube (supplied). Pipet 30-50µl RNase-free water directly onto the RNeasy silica-gel membrane. Close the tube gently, andcentrifuge for 1 min at =8000 × g (=10,000 rpm) to elute.

A.3.3 Control and measurements

A.3.3.1 Quality control of RNA sample

Load 1-10 µl RNA on a 1% agarosegel and run this gel at 120 V for about 15 minutes (AppendixA.8). There have to be two bands visible, namely the 18 S and the 28 S bands. The 28S has tobe as twice as thick as the 18S band.

A.3.3.2 Measuring of RNA concentration on spectrophotometer

- Dilute 2 µl of RNA in 100 µl double autoclaved MilliQ water. Do not forget to prepare a blanc(only water).

- Choose the program ”Absorption Ratio” and change the amount of samples you want to mea-sure (minimal 1, maximal 5).

- After running the meter shows OD 260, OD 280 and ratio OD260/OD280. This ratio shouldbe above 1.6. Above 1.8 the sample is pure.

- Calculate the concentration (µg/ml): OD260 × 40 × dilution factor (in this case: 51).

A.4 cDNA synthesis

Using thermoblocks: Before starting the procedure switch on the first thermoblock at 72oC, notshaking and the second one at 37oC, not shaking.

1. Prepare Buffer/Primer mix according to the number of samples + blanc + 1 extra and mixwell.Per reaction:- 2.5 µl Random Primer- 2.5 µl dNTP’s 5mM- 5.0 µl 5×First-Strand Buffer

Total 10 µl mix per reaction

Aliquot mix in 1,5 ml eppendorf tubes and add 11 µl (RNA + ddH2O) corresponding with 500ng RNA or 11 µl only ddH2O for the blanc. Carefully add a drop of mineral oil on the surfaceof the mixture to prevent evaporation during the program.

2. Total program:a. 72 ◦C, 6 min, first thermoblockb. 37 ◦C, 5 min, second thermoblock

Then add 4 µl of Enzyme Mix (see step 3)c. 37 ◦C, 1 hr, second thermoblockd. 95 ◦C, 5 min, first thermoblocke. 4 ◦C, cooling down on ice

3. During step a. and b. the Enzyme Mix is prepared according to the number of samples +blanc + 1 extra.Per reaction:- 0.5 µl ddH2O- 2.5 µl DTT- 0.5 µl RNasin- 0.5 µl M-MLV enzym

Total 4 µl mix

After step 2b. add Enzyme Mix, then go further with the rest of the program

Store cDNA samples at 4 ◦C

A.5 Primer Design with Beacon Designer Software

Notes to ‘Quick Guide to Using Beacon Designer Software’

? Creating a Project:- Take care of using the right assay (Sybr R© Green Design)

? Opening a Sequence:- To open a sequence from Entrez or from dbSNP:

Enter mRNA sequence in Fasta form (vb. NM 001101). Make sure that capitals, underscoreetc are typed correct. Fasta numbers can be found on Entrez Pubmed - Nucleotide.

- Select View → Sequence Details:This gives the complete information in a new window, for instance CDS (coding sequence).

? Designing Primers for Molecular Beacons:- Select Options → Beacon Design:

Choose Sybrr Green Design- Template Structures:

Open a sequence, choose Analyze → Template Structures Search. Define search parameters(which part of the sequence is coding) and press search. Founded review gives hairpins forinstance.

- Blast Search:Open a sequence, choose Analyze → BLAST. Define search parameters and press search.This is to prevent that the primer found, matches another part of the DNA sequence. Inthe tabel with the ‘search status’ it can be seen if the BLAST and / or Template Search arecompleted.

- Primer Search:Choose Analyze → Primer Search and define primer parameters like Tm (60 ± 4), ampliconlength (75-200 bp, for real-time PCR), Alternate Primer Pairs (2 is sufficient for a review)and press search

- Known primer sequence:If your primer sequence is known, you can check them through Analyze → PredesignedPrimers

A.6 Conventional PCR

? SolutionsTo have not the risk of cross-contaminations, each person should prepare his/her own workingsolutions!

- Double autoclaved Ultrapure water (ddH2O) or nuclease-free water- Primers are delivered in dry form. According to the delivery form dissolve each primer to

a stock concentration of 100 µM with ddH2O, store 40 µl aliquots at -20 C. Before use inPCR prepare a working solution of 20 µM: dilute 5 × by adding 160 µl of ddH2O and storeat 4 ◦C. This working solution can be used a several times, but prepare new after a coupleof months.

- dNTP Set consists of 100 mM aquaous solutions of dATP, dCTP, dGTP and dTTP each ina separate vial. Prepare a mix of 5 mM by adding same amounts of each dNTP, dilute 20×with ddH2O and store alliquots in the freezer. Working solution can be stored at 4◦C. Forexample 50 µl of each dNTP + 800 µl ddH2O.

? Procedure1. In general prepare a mix according to the number of samples + blanc + 1 extra (if more

than 20 reactions 2 extra, more than 40 reactions 3 extra, etc.).Standard mix per reaction:

18.2 µl ddH2O0.5 µl forward primer 20 µM (end concentration 400 nM)0.5 µl reverse primer 20 µM (end concentration 400 nM)2.5 µl 10×PCR buffer II1.5 µl MgCl2 25 mM (end concentration 1.5 mM)0.5 µl dNTP’s 5 mM (end concentration 0.1 mM)0.3 µl AmpliTaq DNA polymerase 5 U/ul (end concentration 60 mU/µl)Total 24.0 l mix per reaction

Prepare mix, aliquot and add 1 µl cDNA (sample) or 1 µl ddH2O (blanc).

2. PCR program:a. pre-denaturation: 94 ◦C, 1 minb. denaturation: 94 ◦C, 1 minc. annealing: 55-66 ◦C, 1 min (temperature depends on used primer set)d. elongation: 72 ◦C, 1 min

repeat step 2-4 in number of cyclese. 72 ◦C, 10 minf. 4 ◦C for ever

? Registration of resultsPCR-products can be visualized on a 2% agarose gel + EtBr in 0.5× TBE buffer (AppendixA.8). Load 5 µl sample + 2 µl 10× ficoll orange on a medium or large gel with a 20-comb.Load in another well 10 µl DNA ladder. Run the gel at 100-120 V, vizualize with a UV-lampand make an image with the Biorad Versadoc software.

A.7 Real-time PCR

? PrincipleNucleic acid amplification and detection are among the most valuable techniques used in bio-logical research today. Real-time detection of PCR products is made possible by including inthe reaction a fluorescent chemistry that reports an increase in the amount of DNA with a pro-portional increase in fluorescent signal. The fluorescent chemistries employed in this protocolinclude the DNA-binding dye SYBRGreen.

Figure A.1: Binding of SYBRGreen to dsDNA

SYBRGreen can be used with different primer combinations, but is not specific for gene ofinterest, it binds to all dsDNA.

Real-Time analysis of PCR enables truly quantitative analysis of starting template copy num-ber with accuracy and high sensitivity over a wide dynamic range. Specialized thermal cyclersequipped with fluorescence detection modules are used to monitor the fluorescence as amplifi-cation occurs, here the MyiQ Single Color Real Time PCR Detection System is build on theiCyclerrThermal Cycler.

The MyiQ optical design supports the use of a single filter pair optimized for excitation andemission of green fluorescent dyes, resulting in excellent sensitivity for the detection of fluo-rophores such as FAM and SYBR Green I. In both systems a CCD detector captures a simul-taneous image of all 96 wells. This results in a comprehensive data set illustrating the kineticbehavior of the data during each cycle.

Simultaneous image collection insures that well-to-well data may reliably be compared. The iQ5software reports data on the PCR in real time, allowing immediate feedback on reaction success.

? SolutionsTo have not the risk of cross-contaminations, each person should prepare his/ her own workingsolutions!

- Double autoclaved Ultrapure water (ddH2O) or nuclease-free water- Primers are delivered in dry form. According to the delivery form dissolve each primer to

a stock concentration of 100 µM with ddH2O, store 40 µl aliquots at -20 ◦C. Before use inPCR prepare a working solution of 20 µM: dilute 5× by adding 160 µl of ddH2O and storeat 4 ◦C. This working solution can be used a several times, but prepare new after a coupleof months.

- The iQ SYBR Green Supermix is a 2× mix for real-time PCR applications. It is a ready-made mixture of the hot-start enzyme iTaq DNA Polymerase, dNTP’s, buffer, SYBR GreenI, fluorescein.

? Procedure

1. Switch on:a. Biorad Thermal Cyclerb. MyiQ Single Color Real Time Detection Upgradec. computer iQsoftware

2. Generate with the iQsoftware in Workshop: Protocol and Plate (see for more details Help→ Quick Guide or the paper manual)

3. Calculate and prepare the SybrGreenI/Primermix according to the number of samples +blanc + 1 extra (if more than 15 reactions 2 extra,if more than 30 reactions 3 extra, etc.).Mix per reaction:

12.5 µl iQ SYBR Green Supermix6.5 µl ddH2O0.5 µl forward primer 20 µM (end concentration 400 nM)0.5 µl reverse primer 20 µM (end concentration 400 nM)

Total 20,0 µl mix per reaction

Prepare mix, aliquot and add 5 µl cDNA (sample) or 5 µl ddH2O (blanc). Use PCR tube-strips (less samples) or a 96-wells PCR plate (large amount of samples).

4. Put the prepared samples into the Thermal Cycler

5. Start the PCR in Software→Workshop→ Run. Before it starts running fill in (if necessary)some notes. Press oke, the run will start and data will be saved.

A.8 Agarose gel electroforesis

? Solutions:- 0.5 M EDTA, pH 8.0: 186.12 g EDTA/l, adjust pH to 8.0 with sodium hydroxide, before

dissolving (EDTA will not dissolve below pH 8!)- 10×TBE: 108 g Tris/l + 55 g boric acid/l + 40 ml 0.5 M EDTA pH 8.0/ l. Autoclave 2x.- 0.5×TBE : dilute 50 ml 10×TBE to 1 l with Ultrapure water- 10× Ficoll Orange: 40 mg Orange G/10 ml + 2.5 g Ficoll 400/10 ml. Store aliquots at -20◦C, working solution in the fridge.

- DNA ladder, concentration 0,07 µg/µl: 100 µl stock + 285,7 µl 10× Ficoll Orange + 1042.9µl ddH2O. Store aliquots at -20 ◦C.

? Preparation of samples:Mix sample with 10xFicoll Orange (10xFO). For example: for a 20-comb in the medium geltray:2 µl 10× FO + 5 µl PCR product.

? Procedure:Be aware that ethidium bromide is very carcinogenic! So directly after adding the chemical andpouring the gel, get rid of everything what could be in contact with it, like gloves, pipettips,tissues etc.. Don’t touch anything before you have done that and do not walking around withthe same gloves where you add the EtBr with!

1. Prepare agarosegel: Percentage of the agarose gel depents on sample, 1% agarose gel forRNA, 2% agarose gel for PCR products. Dissolve agarose (for example 2% in medium tray:2 gram per 100 ml buffer) in 0.5× TBE in a microwave. Cool the solution under running tapwater until approximately 50 ◦C and add 5 µl of ethidium bromide/100 ml gel. Pour the gelin a gel tray with comb and allow the gel to coagulate.

2. Fill electrophoresis system with 0.5/times TBE. Place gel tray with agarose gel in the system(comb on negative/black site), remove comb and be aware the gel is covered by the buffer.

3. Load the agarose gel with the samples and DNA ladder (per lane 10 µl using 15-wells-comb,7 µl using 20-wells-comb).Run at desired voltage (100-120 Volt).

4. Visualize bands in the gel on a UV tray. Save and/or print an image with software connectedto the Biorad Versadoc system.