The effects of micronutrient deficiencies on bacterial ... · of Medicine, St. Louis, MO 63110,...

SC I ENCE TRANS LAT IONAL MED I C I N E | R E S EARCH ART I C L E

GUT M ICROB IOTA

1Center for Genome Sciences and Systems Biology, Washington University Schoolof Medicine, St. Louis, MO 63110, USA. 2Center for Gut Microbiome and NutritionResearch, Washington University School of Medicine, St. Louis, MO 63110, USA.3A. A. Kharkevich Institute for Information Transmission Problems, Russian Acad-emy of Sciences, Moscow 127994, Russia. 4Sanford Burnham Prebys Medical Dis-covery Institute, La Jolla, CA 92037, USA. 5Chemical Sciences Division, Oak RidgeNational Laboratory, Oak Ridge, TN 37830, USA.*Corresponding author. Email: [email protected]

Hibberd et al., Sci. Transl. Med. 9, eaal4069 (2017) 17 May 2017

2017 © The Authors,

some rights reserved;

exclusive licensee

American Association

for the Advancement

of Science.

http:/D

ownloaded from

The effects of micronutrient deficiencies on bacterialspecies from the human gut microbiotaMatthew C. Hibberd,1,2 Meng Wu,1 Dmitry A. Rodionov,3,4 Xiaoqing Li,4 Jiye Cheng,1,2

Nicholas W. Griffin,1,2 Michael J. Barratt,1,2 Richard J. Giannone,5 Robert L. Hettich,5

Andrei L. Osterman,4 Jeffrey I. Gordon1,2*

Vitamin and mineral (micronutrient) deficiencies afflict 2 billion people. Although the impact of these imbalanceson host biology has been studied extensively, much less is known about their effects on the gut microbiota ofdeveloping or adult humans. Therefore, we established a community of cultured, sequenced human gut–derivedbacterial species in gnotobiotic mice and fed the animals a defined micronutrient-sufficient diet, followed by aderivative diet devoid of vitamin A, folate, iron, or zinc, followed by return to the sufficient diet. Acute vitamin Adeficiency had the largest effect onbacterial community structure andmetatranscriptome,withBacteroides vulgatus, aprominent responder, increasing its abundance in the absence of vitamin A. Applying retinol selection to a library of30,300 B. vulgatus transposon mutants revealed that disruption of acrR abrogated retinol sensitivity. Geneticcomplementation studies, microbial RNA sequencing, and transcription factor–binding assays disclosed that AcrR isa repressor of an adjacent AcrAB-TolC efflux system. Retinol effluxmeasurements inwild-type and acrR-mutant strainsplus treatmentwith a pharmacologic inhibitor of the efflux system revealed that AcrAB-TolC is a determinant of retinoland bile acid sensitivity in B. vulgatus. Acute vitamin A deficiencywas associatedwith altered bile acidmetabolismin vivo, raising the possibility that retinol, bile acid metabolites, and AcrAB-TolC interact to influence the fitness ofB. vulgatus and perhaps other microbiota members. This type of preclinical model can help to develop mechanisticinsights about the effects of, and more effective treatment strategies for micronutrient deficiencies.

/stm
by guest on M
arch 24, 2020.sciencem

ag.org/

INTRODUCTIONDietary micronutrients (vitamins and minerals) are cofactors for myriadenzymes whose functions are essential for health. The “hidden hunger”of micronutrient deficiencies represents a global health challenge,affecting 2 billion individuals, with deficiencies in iron, zinc, folate,and vitamin A representing major contributors to this problem (1, 2).Risk is compounded in low- andmiddle-income countries, where dietaryinsufficiency and lack of dietary diversity are common (3).

Vitamin A plays important roles in vision, growth, and immunefunction (4). In settings where its deficiency is a public health problem,the World Health Organization recommends high-dose vitamin Asupplementation for infants and children 6 to 59 months of age (5).Vitamin A is typically given in the form of retinyl esters, which are hy-drolyzed in the gut before uptake of retinol by enterocytes (6). Theeffectiveness of vitamin A supplementation has been confirmed in ameta-analysis of 43 studies showing a reduction inmortality in childrenunder 5 (7). However, knowledge of the short- and long-term effects ofhigh-dose supplementation of infants and children is incomplete. Giventhe large body of knowledge that has accumulated regarding the effectsof retinoids on eukaryotic cellular biology, vitamin A imbalances aretypically viewed from the perspective of their effects on the host, ratherthan on the microbiota.

Deficiencies of other micronutrients are also associated with mor-bidity in children under 5 (1). Given the prevalence of combined defi-ciencies in individuals living in low- and middle-income countries,

many studies have been conducted to examine the benefits of multiplemicronutrient powders. A meta-analysis of 16 controlled studies ofsupplementation with these powders in 6-month-old to 11-year-oldchildren revealed a reduction in anemia and improved serumhemoglobinlevels but no impact on growth (8). Therewas also evidence of increaseddiarrhea (9). Studies of weaning Kenyan infants revealed evidence ofincreased intestinal inflammation, increased enteropathogen burden,and decreases in the representation of bifidobacteria associated withadministration of micronutrient powders containing iron (10). More-over, iron supplementation may potentiate the risk for certain systemicinfections (for example, malaria) (11–14). Together, these findings raisequestions about whether current protocols for dosing and duration oftreatment of micronutrient deficiencies are optimal, and to what extentunintended deleterious effects accompany such interventions.

Recent studies have revealed a program of gutmicrobial communitydevelopment, defined by changing patterns of abundances of a group ofage-discriminatory bacterial strains, that is executed during the first 2 to3 years of postnatal life (15–17). This developmental program is sharedamong healthy, biologically unrelated infants and children living inculturally and geographically distinct low-income countries, and it isdisrupted in infants and children with undernutrition, resulting inbacterial community configurations that appear younger (more immature)compared to those encountered in chronologically age-matched in-dividuals with healthy growth phenotypes (14, 16, 18). Preclinicalevidence indicates that this immaturity is not simply an effect of under-nutrition but rather is a contributing cause. Recently weaned gnoto-biotic mice colonized with immature gut microbiota samples fromundernourishedMalawian children exhibited impaired growth com-pared to recipients of microbiota from chronologically age-matchedhealthy donors, although animals in all treatment groups consumedthe same amounts of a macronutrient- and micronutrient-deficientdiet designed to resemble the diets of the microbiota donor population.Analysis of the gut microbial communities of recipient mice identified

1 of 17

http://stm.sciencemag.org/


by guest on March 24, 2020

http://stm.sciencem

ag.org/D

ownloaded from

bacterial strains that are growth-discriminatory: They include a subsetof the age-discriminatory strains (16). These observations suggest atestable hypothesis, namely, that various types of micronutrient im-balances may disrupt various features of a developing microbiota,including the representation and expressed functions of age- andgrowth-discriminatory taxa as well as pathobionts and enteropathogens.Moreover, such disruptions, occurring during a critical period of com-munity assembly, may persist, resulting in deleterious effects on hostbiology. A corollary is that the microbiota may be a useful marker ofmicronutrient intake (19) and a means to assess the efficacy and safetyof current dosing regimens for the treatment of deficient states.

Earlier studies comparing germ-free animals and their convention-ally raised counterparts provided evidence that the gut microbiota canhave beneficial effects in the face of micronutrient deficiencies [forexample, enhanced iron uptake and storage in rats and rabbit models(20, 21)] or detrimental effects [increased mortality on vitamin A–deficient diets (22, 23) and increased dietary zinc requirements (21, 24)in rats]. The specific microbes and underlying mechanisms responsiblefor these observed effects were not defined in these reports.

There is little information about the effects of specific micronutrientimbalances on the human gut microbiota (10, 19, 25–28). A limitednumber of published reports have been descriptive, focused on com-munity structure (generally at low levels of taxonomic resolution),and are confounded by (i) the challenges of conducting randomizedcontrolled trials in this area, (ii) the fact that various combinations ofmicronutrient deficiencies can occur within at-risk populations, and(iii) the challenge of distinguishing between primary effects of dietarymicronutrient content, versus host effects, on the microbiota. Here,we examine the effects of acute dietary micronutrient deficiencies onmembers of the microbiota using gnotobiotic mice colonized with alarge and phylogenetically diverse consortium of cultured and se-quenced human gut bacterial strains, including strains representingspecies that are age- and/or growth-discriminatory in models of micro-biota development (14, 16, 17). Mice were subjected to a diet oscillationthat began with a defined micronutrient-sufficient diet followed by aderived diet with one of four types of singlemicronutrient deficiency,or a diet representing combined deficiencies, followed by return tothe original micronutrient-sufficient diet. This model of acute defi-ciency allowed us to focus on effects on the gut microbiota, ratherthan having to disentangle potentially cofounding effects of combinedcommunity and host deficiency states. Bacterial community DNAand mRNA analyses, combined with in vitro genetic, biochemical,and pharmacologic studies, allowed us to characterize the mechanismsthat underlie the pronounced effects of vitamin A, specifically retinol,deficiency on the fitness of Bacteroides vulgatus, a growth-discriminatoryspecies identified in the gnotobiotic mouse model of human gut micro-biota development described above. Our findings provide a rationaleand a preclinical method for examining the impact of current vitaminA dosing regimens, and by extension other critical micronutrients, onmembers of our microbial communities, including the developing gutmicrobiota of children with undernutrition.

RESULTSA compositionally well-defined, micronutrient-sufficient diet and a setof highly similar derivative diets devoid of one or more micronutrientswere designed (table S1). Protein was represented in all diets only byamino acids; this feature allowed us to avoid the potentially confoundingproblem of having to vary protein type due to differences in their con-


tent of bound minerals. Adult (8- to 9-week-old) germ-free C57BL/6Jmice that had been weaned onto a standardmouse chow, rich in plantpolysaccharides and low in fat, were placed on amicronutrient-sufficientdiet for 4 days before colonization. Animals then received a single oralgavage of a consortium of 92 sequenced human gut–derived bacterialtype strains, containing 348,834 known or predicted protein-codinggenes and encompassing the major phyla present in the human micro-biota. Sixteen of these strains represented species corresponding tostrains that had been identified as age- and/or growth-discriminatoryin random forests–derived models of normal gut microbiota develop-ment (table S2). Mice in each experimental group were maintainedon themicronutrient-sufficient diet for 14 days, followed by a 21-dayperiod of acute micronutrient deficiency (one of five diets: vitamin A–,folate-, iron-, zinc-, and multiple micronutrient–deficient), followed bya 14-day period of reexposure to the micronutrient-sufficient diet. Acontrol group was maintained on the micronutrient-sufficient dietthroughout the course of the experiment (Fig. 1A). All diets were pro-vided ad libitum.

Short-read shotgun sequencing [community profiling by sequenc-ing (COPRO-Seq)] of DNA prepared from fecal samples collectedover time was used to define the efficiency and reproducibility of col-onization within and across treatment groups and the relative abun-dance of each community member as a function of diet. A group of44 strains comprised a core group of organisms that was represented inthe fecal microbiota of all mice after the initial micronutrient-sufficientdiet phase; the number of additional strains found in each treatmentgroup was small (range, 0 to 3) (table S3, A and B). This similarity incommunity membership across treatment groups at the end of thisstage of the experiment was reflected in principal coordinates analysisof pairwise comparisons using the Bray-Curtis dissimilarity metric(Fig. 1B and fig. S1).We cannot rule out the possibility that othermem-bers of the consortium of 92 organisms established themselves in dif-ferent regions of the gut, although they were not detectable in feces.Investigating this possibility would require sacrifice of multiple animalsat multiple time points in each of the multiple treatment groups toperform a detailed analysis of the biogeographical features of their mi-crobial communities.

Prominent effects of dietary vitamin A deficiency oncommunity structure and metatranscriptomeWe applied mixed-effects linear models to log-transformed, rarefiedCOPRO-Seq data to identify organisms with significant interactionsbetween treatment group and diet stage. We also performed least-squares means comparisons betweenmice in the control groupmonot-onously fed the micronutrient-sufficient diet and those assigned to theexperimental treatments (table S4, A and B). Communities sampled atthe end of the initial micronutrient-sufficient diet phase (experimentalday 14), 14 days after switch to the deficient diet (day 28), and 14 daysafter return to the sufficient diet (day 49) were included in the analyses.The results revealed that among the five acute dietary deficiency statestested, vitaminAhad the greatest effect, significantly affecting the abun-dances of the largest number of organisms (tables S3 and S5). Compar-isons of Bray-Curtis dissimilarities showed that the communitystructure ofmice in the vitaminA treatment group differed significantlyfrom that of the control group during the deficient diet stage [experi-mental days 28 and 35; P < 0.01 for each experimental day based onrandomization tests and false discovery rate (FDR) correction, butwas no longer significantly different after returning to the sufficient diet(experimental day 49)] (fig. S1). The number of species representing

2 of 17




http://stm.sciencem

ag.org/D

ownloaded from

age- and growth-discriminatory strains that were affected by acute mi-cronutrient deficiency was small (range, 0 to 3 per deficiency type; seetable S4A for details and table S4B for a summary).

We subsequently used microbial RNA sequencing (RNA-seq) tocharacterize transcriptional responses to the various diets. Data gen-erated from fecal samples collected from each mouse in each treatmentgroup at the end of the micronutrient sufficiency phase (day 14), atthe end of the micronutrient deficiency phase (day 35), and 14 daysafter return to the sufficient diet (day 49) were compared. Statisticallysignificant differences in gene expression as a function of time/dietwere identified (see Materials and Methods). Responsive genes werebinned intoKyotoEncyclopedia ofGenes andGenomes (KEGG)Orthol-ogy (KO) groups. Analogous to the COPRO-Seq analysis, animals con-suming the micronutrient-sufficient diet monotonously served as areference control for temporal effects independent of diet transitions.

Table S6 describes the results of this community-wide (top-down)RNA-seq analysis for all treatment groups.VitaminAdeficiency eliciteda larger number of significant alterations in themetatranscriptome thanany of the other acute deficiency states (summarized in table S6A, withKEGG summaries of differentially expressed genes and associatedP values provided in table S6B). The two top-ranked KO groups thatincorporated transcripts whose expression changed significantly asa function of the presence and absence of vitamin A were K02014(TonB-dependent receptors) and K00936 (phosphotransferases witha nitrogenous group as acceptor) (table S6B).

B. vulgatus, a species positively correlated with host growth in pre-clinical models of gut microbiota development (16), was one of the fewage- and/or growth-discriminatory taxa that exhibited significantchanges in abundance as a function of any of the acute dietary micro-nutrient deficiencies applied; its proportional representation in thecommunity increased significantly during the vitamin A deficiencyphase and decreased significantly when mice were transitioned backto the sufficient diet (P < 0.001, one-way ANOVA, Tukey’s HSD test,FDR correction; Fig. 1C and fig. S2A). Mixed-effects linear modelingrevealed that no other single micronutrient deficiency produced astatistically significant increase in the representation of B. vulgatus(table S4). The only other single micronutrient deficiency state thataffected its representation was iron deficiency, but the change occurredin a direction opposite to that observed with vitamin A deficiency(Fig. 1C, fig. S2A, and table S4). The direction and specificity of the re-sponse to vitamin A deficiency were notable, because none of the otherBacteroides in the community exhibited this pattern (table S5).

The microbial RNA-seq data set revealed the specificity and dis-tinctive breadth of responses of B. vulgatus to vitamin A availability


(see table S7 for a KO group-level summary of significant changes inits in vivo gene expression profile in response to diet oscillations in-volving vitaminA, iron, zinc, or folate, and combined deficiency, as wellas in the control group monotonously fed the micronutrient-sufficientdiet; see table S8 for a KO group-level summary of transcriptionalresponses for each member of the gut microbial community definedas responsive to dietary vitamin A manipulation based on changes intheir relative abundance). None of the micronutrient-deficient diets

× 5C57BL/6J

C57BL/6J× 5

Gavage: 92 strains

Micronutrient– sufficient diet

Micronutrient–sufficient diet (monotonous)

Fecal sample (COPRO-Seq)Fecal sample (microbial RNA-seq)

Micronutrient– deficient diet

Micronutrient– sufficient diet

Experimentalday

–4 0 7 14 21 28 35 42 49

A

B Micronutrient–sufficient diet(experimental day 14)

Micronutrient–deficient diet(experimental day 28)Micronutrient–deficient diet(experimental day 35)

Micronutrient–sufficient diet(experimental day 49)

Vitamin A–sufficientDay 14

ControlDay 14

ControlDay 35

ControlDay 49

ControlDay 28

Vitamin A–deficientDay 28 Vitamin A–

deficientDay 35

Vitamin A–sufficientDay 49

–0.2 –0.1 0 0.1

–0.15

–0.10

–0.05

0

0.05

0.10

0.15

PCo 1 (16.7%)

PC

o 2

(5.5

%)

Micronutrient sufficient Multiple–deficientIron–deficientZinc–deficient

Vitamin A–deficient Folate–deficient

Sufficient (day 14) versusDeficient (day 35)

Deficient (day 35) versusSufficient (day 49)

C

–4–2

20

0

468

101214

–7

–5

–3

–1

1

3

5

7

Cha

nge

in %

rela

tive

abun

danc

e of

B. vulg

atus

Cha

nge

in %

rela

tive

abun

danc

e of

B. d

orei

***

**

***

**

*****

***

Folate–deficientIron–deficient

Micronutrient–sufficient (monotonous diet control)Multiple micronutrient–deficient

Vitamin A–deficient

Zinc–deficient

Fig. 1. The effect of dietary micronutrient deficiency on the configuration of adefined human gut microbiota established in gnotobiotic mice. (A) Experimentaldesign. (B) Principal coordinates analysis of pairwise comparisons of fecal microbiotausing Bray-Curtis dissimilarities ofWisconsin square root–transformed abundance dataobtained from COPRO-Seq analysis. Fecal samples were obtained from mice in theindicated treatment groups at the indicated time points. Gray shaded ellipses andspokes indicate the SEM of sample group centroids from the vitamin A–deficient andthe micronutrient-sufficient (monotonous diet control) groups in each experimen-tal phase. PCo 1, principal coordinate 1. (C) COPRO-Seq analysis of the effects of themicronutrient-deficient diets versus micronutrient-sufficient diets on the abun-dance of B. vulgatus and Bacteroides dorei in the fecal microbiota of gnotobioticmice. Means ± SEM. **P < 0.01, ***P < 0.001 [one-way analysis of variance (ANOVA),Tukey’s honest significant difference (HSD), FDR correction; n = 5 mice per treat-ment group].

3 of 17




http://stm.sciencem

ag.org/D

ownloaded from

resulted in a significant change in bodyweight in these adult mice (P > 0.05, two-way and repeated-measures ANOVA,Dunnett’s test; table S9).

Identification of a member of theTetR family of transcriptionalrepressors that mediates thesensitivity of B. vulgatus to retinolTo examine themechanismsunderlying thein vivo response ofB. vulgatus to dietary vi-taminA availability, we cultured the strainin vitro, under anaerobic conditions, in adefinedmedium,with or without additionof a range of concentrations of retinol, ret-inal, retinyl palmitate, all-trans retinoicacid, or b-carotene; the diterpene alcoholgeranylgeraniol was used as a control. Ret-inoid sensitivity was defined as the ratiobetween the time required to reach anOD600 (optical density at 600 nm) thresh-old of 0.3 for treated cultures versus controlcultures containing vehicle alone [0.02%dimethyl sulfoxide (DMSO)]. The con-centration range (0.1 to 10 mM) of retinoland other retinoids used was based on pre-vious reports of their concentrations inmouse small intestinal contents and feces,and human feces (29, 30). Treatment with10 mM retinol completely inhibited thegrowth of B. vulgatus [P < 0.0001, com-pared to control incubations containingvehicle (0.02%DMSO) alone]; retinal (P <0.0001) and retinyl palmitate (P = 0.0002)also produced significant, though muchweaker, growth inhibition compared toretinol at the same concentration. In con-trast, geranylgeraniol had no signifi-cant effect (P > 0.99, one-way ANOVA,Bonferroni multiple comparisons test;Fig. 2, A andB, and table S10A).Aprimaryisolate of B. vulgatus recovered from aMalawian child, characterized as a growth-discriminatory strain in previous gnotobi-oticmouse experiments (16), also exhibitedmarked, dose-dependent growth suppres-sion in the presence of retinol (Fig. 2C andtable S10B).

The COPRO-Seq data set revealed that
B. dorei strain DSM 17855 exhibited a response to vitamin A deficiencythat was the opposite of that manifested by B. vulgatus, namely, itincreased rather than decreased its relative abundance in these presenceof vitamin A (Fig. 1C, fig. S2B, and table S5). Consistent with these re-sponses documented in vivo, retinol produced significantly less growthinhibition of B. dorei in vitro compared to B. vulgatus (P < 0.0001 forboth 5 and 10 mM retinol compared to vehicle alone control incuba-tions, t test, Bonferroni correction; Fig. 2B and table S10A).
Whole-genome transposon (Tn) mutagenesis [insertion sequencing(INSeq) (31, 32)] was subsequently used to identify the genetic deter-


minants of the response ofB. vulgatusATCC 8482 to retinol. A libraryof 30,300 isogenic Tn mutants was generated (see Materials andMethods). Seventy-one percent (2894) of the strain’s predicted genescontained Tn mutants positioned within the first 80% of each openreading frame (ORF) (average of 10.5 Tn mutants per ORF repre-sented in the library; 1 Tn insertion per mutant bacterial strain) (fig.S3A). Simulating the number of unique mutants required to cover allnonessential ORFs (defined as genes that are not required for survival inthe medium used to generate the library) (32) revealed that the INSeqlibrary approached saturation (fig. S3B).

A

0.25

0.50

0.75

1.00

1.25

0 6 12 18 24 30 360

Gro

wth

(OD

600)

Time (hour)

Retinol

Retinyl palmitate Retinal

B

β-Carotene

DMSO (0.02%)

Geranylgeraniol

Retinoic acid

RetinolRetinalRetinyl palmitate

0

2

4

6

8

10

12

14

16

18

20

22

24

Ret

inoi

d se

nsiti

vity

(tre

ated

/con

trol)

510µM 1 510 1 510 1 510 1 510 1 510 1

B. vulgatus ATCC 8482

B. vulgatus ATCC 8482

B. dorei DSM 17855

*****

***

***C

510μMB. vulgatus

1 510 10

2

4

6

8

10

12

14

16

18

20

22

24

Ret

inol

sen

sitiv

ity (t

reat

ed/c

ontro

l)

ATCC 8482 257B_H4

Fig. 2. The distinct retinol sensitivity phenotypes of B. vulgatus strains and B. dorei in vitro. (A) Growth curves ofB. vulgatus in defined medium with and without various retinoids. The horizontal dashed line indicates the thresholdused for calculating time–to–log phase measurements. (B and C) Bar plots indicating mean (±SEM) retinoid sensitivity,calculated as time–to–log phase for treated cultures versus time–to–log phase for vehicle alone (DMSO) control culturesfor B. vulgatus ATCC 8482 versus B. dorei DSM 17855 (B) or B. vulgatus strain ATCC 8482 versus B. vulgatus strain 257_H4(C) isolated from a healthy Malawian infant (16). For example, the sensitivity value of 20.8 ± 2.1 for wild-type B. vulgatusincubated in medium containing 10 mM retinol in (B) was calculated by dividing the total incubation period (in this case,95 hours) by the time required for vehicle alone–treated control cultures of the same strain to cross the OD600 thresholdof 0.3. Means ± SEM are shown except under those conditions in (C), where the concentration of retinol tested com-pletely inhibited growth. n = 2 independent experiments, each in triplicate for (B), and 1 experiment performed intriplicate for (C). **P < 0.01, ***P < 0.001 (one-way ANOVA, Bonferroni multiple comparisons test).

4 of 17



The library of Tn mutants was subjected to in vitro selection in thepresence of 10 mM retinol. Aliquots were withdrawn from primarycultures during the long lag phase (indicating that growth ofmostmem-bers of the library was severely inhibited by retinol) and during sta-tionary phase. An aliquot from the stationary phase culture was thenreinoculated into fresh medium containing 10 mM retinol for a secondround of selection; log and stationary phase samples were withdrawnfrom these secondary cultures (n = 3 replicate primary and secondary


cultures; Fig. 3A). The selected B. vulgatus libraries contained only fourmutants (Fig. 3B). These mutants map to two adjacent genes in theB. vulgatus ATCC 8482 genome: BVU0240, which encodes a homologofEscherichia coliAcrR (17% identity and 22% similarity) (amember ofthe TetR family of transcription factors), and BVU0241, which encodesa homolog of E. coli LpxA (33% identity and 35% similarity). LpxA isa UDP-N-acetylglucosamine O-acyltransferase that functions as thefirst enzyme in the biosynthetic pathway for the lipid A moiety of


http://stm.sciencem

ag.org/D

ownloaded from

TolC

B

Per

cent

abu

ndan

ce o

f mut

ant i

n in

put l

ibra

ry

020406080

100

Per

cent

abu

ndan

ce in

sel

ecte

d lib

rary

020406080

100

020406080

100

A D

OD

600

Sub

cultu

re

Lag StationaryLog

phase Stationary

InputINSeq library

Outputselectedlibrary

Repl

icate

1Re

plica

te2

Repl

icate

3

C

BVU0245

BVU0244 BVU0241

BVU0240

BVU0239 BVU0238

BVU0236 BVU0234 BVU0232

BVU0243

AcrAB-TolC 1

BVU0242 BVU0237

BVU0235 BVU0233

lpxA_362422::IN

lpxA_362422::IN0

0.01

0.02

0.03

0.04

0.05

Input

acrR_361472::IN

acrR_361472::IN

acrR_361646::IN

acrR_361646::IN

lpxA_361958::IN

lpxA_361958::IN

LpxA AcrR TolC2 AcrA2 AcrB2

Hypotheticalprotein

Hypotheticalprotein

Hypotheticalprotein

Alginate O-acetylation protein

AcrA AcrB

Retinol (10 uM)

AcrAB-TolC 2

E

02468

1012141618

Ret

inol

sen

sitiv

ity(tr

eate

d/co

ntro

l)

WT B. dorei

WT B. vulgatus

B. vulgatus acrR_361646::IN

B. vulgatus lpxA_361958::IN

B. vulgatus acrR_361472::IN

B. vulgatus lpxA_362422::IN

Retinol (µM) 10 15 10 15 10 15 10 15 10 15 10 15

*** ******

*****

*** ******

******

COMPOUND

F

0

2

4

6

8

10

12

14

Strain WT acrR_

361472::IN

acrR_

361472::IN

+ pNBU2alone

acrR_

361472::IN

+ pNBU2_acrR

Ret

inol

sen

sitiv

ity (t

reat

ed/c

ontro

l) **

* ****

Comp. – –

Outermembrane

Innermembrane

TolC

AcrA AcrA

Periplasm

Cytoplasm

Compound

H+

AcrB

Fig. 3. Selection of retinol-resistant B. vulgatus Tnmutants. (A) Experimental design. The mutant librarywas inoculated into defined medium containing 10 mMretinol or 0.02% (v/v) DMSO (three cultures per treat-ment). In the first round of selection, mutant librarieswere allowed to grow to stationary phase and werethen passaged to fresh medium and subjected to asecond round of selection. Aliquots were withdrawnin lag and stationary phases from the primary culturesand in log and stationary phases of the secondarycultures. The site of insertion of the Tn was definedin the retinol-resistant mutants using INSeq. (B) Per-cent abundance of Tn mutants in retinol-selected B. vulgatuslibraries. The left portion of the panel indicates the abun-dance of each selected mutant in the input library. Eachset of four bars shown in the right portion of the panelindicates the abundance of the Tn mutants at the indi-cated growth phases from both primary and passagedcultures. (C) Schematic of the B. vulgatus locus containingthe retinol-resistant mutants identified from screeningthe Tn library. Annotation is based on the National Centerfor Biotechnology Information reference assemblyNC_009614.1. The genomic location of each selected Tnmutant is indicated by a downward pointing arrow anno-tated with the corresponding color from (B) and thecorresponding genome coordinate for the site of Tninsertion. (D) Schematic of components comprising theE. coli AcrAB-TolC efflux system (adapted from http://2013.igem.org/Team:Ciencias-UNAM/Project). (E) Retinolsensitivity of B. vulgatus wild-type (WT) and Tn mutantsgrown in monoculture in defined medium treated with1, 5, and 10 mM retinol versus 0.02% (v/v) DMSO as areference vehicle control. Means ± SEM of the ratio be-tween treated and control cultures for each strain areshown. The sensitive B. vulgatus WT strain and resistantB. dorei WT strain are shown as positive and negativecontrols, respectively. (F) Retinol (10 mM) sensitivity ofthe WT, acrR::IN (genome location 361472) mutant, andcomplemented B. vulgatus acrR::IN + pNBU2_acrR mutantstrains (abbreviated Comp), plus a control B. vulgatus acrR::INstrain containing the empty vector. The results shown in(E) are from two independent experiments, each per-formed in triplicate, whereas those in (F) are from threeindependent experiments, each performed in triplicateor quadruplicate. *P < 0.05, **P < 0.01, ***P < 0.001(one-way ANOVA, Bonferroni multiple comparisons test).

5 of 17

http://2013.igem.org/Team:Ciencias-UNAM/Project

http://2013.igem.org/Team:Ciencias-UNAM/Project




http://stm.sciencem

ag.org/D

ownloaded from

lipopolysaccharide [transfers (R)-2-hydroxymyristate from its acylcarrier protein thioester to the 3′-OH of UDP-N-acetylglucosamine(33)]. Control DMSO-treated cultures displayed no selection for thesemutants in either the primary or secondary cultures.

As shown in Fig. 3C, the B. vulgatus acrR ortholog is positioned inthe middle of a locus containing 12 similarly oriented ORFs. ThreeORFs located upstream of acrR and three ORFs located immediatelydownstream each encode orthologs of components of the E. coliAcrAB-TolC complex. AcrAB-TolC is the prototypic example of broad-specificitymultidrug efflux systems belonging to the resistance–nodulation–cell division superfamily (34, 35). The AcrB component of this complexis a homotrimeric integral inner membrane transporter powered bya proton gradient. TolC is also a homotrimer and resides in the outerbacterial membrane. AcrA, a homohexamer, is a periplasmic adapterprotein that bridgesAcrB andTolC. Substrates are captured in the lowercleft region of AcrB (through a process determined in part by an asso-ciated small accessory protein, AcrZ), transported through the bindingpocket, through the gate, and finally to the AcrA funnel that connectsAcrB to TolC (Fig. 3D) (36, 37). Although the transcriptional repressorAcrR is an important modulator of expression of the AcrAB-TolCsystem, this efflux pump is also subject to additional regulation by othertranscription factors, including those involved in mediating responsesto cellular stress signals (38, 39).

Monocultures of each mutant strain exhibited a marked decreasein retinol sensitivity compared to the wild-type strain (P < 0.0001 for10 mM retinol, one-way ANOVA, Bonferroni multiple comparisonstest; Fig. 3E). To confirm that theB. vulgatusAcrR ortholog was a keyregulator of the retinol sensitivity phenotype, we used the integratingexpression vector pNBU2_tetQ (40) to complement themutant contain-ing the Tn insertion at genomic location 361472 [138 nucleotides (nt)downstream of the start of the AcrR ORF]. To do so, we linked theBVU0240 (AcrR)ORFand the 21-nt intergenic regionbetweenBVU0240andBVU0241 to the promoter region of rpoD (BVU2738), assembled theminto pNBU2_acrR, and conjugated them into theB. vulgatus acrR_361472::IN strain (abbreviated acrR::IN) (see Materials andMethods and tableS11). Insertion occurred at the attBV site positioned at the 3′ end ofBVU2094 [one of two serine transfer RNAs (tRNAs) in the B. vulgatusgenome]. Complementation of acrR::IN with the vector carryingPrpoD_acrR (pNBU2_acrR) restored retinol sensitivity to that of thewild-type strain, whereas complementation of acrR::IN with the emptypNBU2_tetQ vector had no effect on retinol sensitivity (P > 0.05 andP = 0.01, respectively, one-way ANOVA, Bonferroni multiple compar-isons test; Fig. 3F and table S10, C and D).

Characterizing the regulon controlled by AcrRHaving established that acrR (BVU0240) is a key genetic determinantof retinol sensitivity in vitro, we characterized its regulon. Triplicatecultures of the wild-type, acrR::IN, and lpxA_362422::IN (abbreviatedlpxA::IN) strains were grown tomid-log phase in the absence of retinol.Microbial RNA-seq revealed that expression of the lpxA ortholog(BVU0241) was completely ablated by the Tn insertion in its ORF(lpxA::IN mutant). Low expression of acrR was detectable in theacrR::IN mutant, but all reads mapped to the area encompassed bythe 5′ 138 nt of the gene, indicating that only truncated transcriptsderived from the region of BVU0240 upstream of the Tn insertion siteat genome coordinate 361472 were produced. Transcription of the12-gene locus containing acrR and lpxA was affected in similar waysby Tn mutagenesis of either acrR (BVU0240) or lpxA (BVU0241), thatis, expression of upstreamgeneswas significantly increased (and expres-


sion of downstream genes significantly decreased, as would be antici-pated by polar effects of the upstream Tn insertion) (Fig. 4 and tableS12B). Together, these results support a conclusion that the AcrRhomolog encoded by BVU0240 acts as a transcriptional repressor.

A total of 220 genes with statistically significant differences in theirexpression were identified when comparing the isogenic wild-type andacrR::IN strains, and 165 geneswhen comparingwild-type and lpxA::INstrains, with 92 genes common to both data sets. The fold differences inexpression of these 92 genes between the wild-type versus acrR::INmutants and the wild-type versus lpxA::IN mutants were highly cor-related (Pearson’s r = 0.92, P < 0.0001); these differentially expressedgenes are functionally annotated in table S12 (A and B), which alsodescribes the fold differences in their expression in the comparisonsof wild-type and acrR::IN strains and wild-type and lpxA::IN strains.Table S12A highlights genes with shared transcriptional responses toinsertionalmutagenesis of acrR or lpxA in vitro: A number of these genesare present in clusters (putative operons) distributed throughout theB. vulgatus genome, including polysaccharide utilization loci, capsularpolysaccharide biosynthesis loci, and loci involved in carbohydrate,amino acid, and DNA metabolism, as well as drug resistance.

Inspection of the RNA-seq data sets generated from the fecal micro-biota of mice subjected to dietary vitamin A deficiency disclosed thatonly 18 genes in the putative regulon identified from the in vitro analysissatisfied our statistical threshold for significant differential regulation invivo. The log-normalized fold changes for these genes ranged from−4.9to 4.6; however, only nine of these genes displayed a transcriptionalresponse in the same direction as that expected based on the in vitrodata (table S12B).Notably, genes in theAcrAB-TolC locus did not reachthe level of statistical significance we required for designation as dif-ferentially regulated in vivo.

Identification of a candidate AcrR-binding motifComparison of the genomes of other Bacteroides strains representedin the defined community, other human gut Bacteroides, and othermembers of the family Bacteroidaceae demonstrated that acrR ortho-logs are positioned in loci containing genes encoding components ofmultidrug efflux systems belonging to the resistance–nodulation–cell division superfamily (Fig. 5A and table S13). Figure S4 presentsa phylogenetic tree of AcrR orthologs identified in these organisms(note that B. dorei has the highest degree of similarity to B. vulgatusAcrR encoded by BVU0240; table S13B).

We used comparative genomics of B. vulgatus ATCC 8482 andrelated organisms to identify a conserved 30–base pair (bp) palindromeas a candidateAcrR-bindingmotif (Fig. 5, B andC) (thismotif is locatedjust upstream of BVU0244, the first gene in the locus encoding AcrAB-TolC1 and AcrAB-TolC2 shown in Fig. 3C). Genome scans with thismotif allowed reconstruction of predicted AcrR regulons, includingorthologs of BVU0244-BVU0233 (table S13A). As noted above, inB. vulgatus ATCC 8482, this gene cluster encodes two homologousAcrAB-TolC efflux pumps; however, their respective components onlyshare 20 to 27% amino acid identity. In Bacteroides thetaiotaomicronand several other Bacteroides genomes, the orthologous AcrR-associatedgene cluster is broken into two separate loci, each encoding one paralogof the AcrAB-TolC efflux system and preceded by a candidate AcrR-binding site (Fig. 5A and table S13A), suggesting coregulation by AcrRorthologs in these genomes.

Genomic searches yielded one additional locus in B. vulgatusATCC8482 (BVU0421-BVU0415) that is preceded by ahigh-scoring candidateAcrR-binding site (Fig. 5B). This additional candidate AcrR target

6 of 17




http://stm.sciencem

ag.org/D

ownloaded from

operon contains genes encoding an uncharacterized outer membraneprotein (oma87), sodium/sulfate symporter (slt), 3′-phosphoadenosine5′-phosphosulfate (cysQ), adenylylsulfate kinase (cysC), and sulfateadenylyltransferase (cysDN). The latter enzymes are involved in thesulfate assimilation pathway. These B. vulgatus genes exhibited increasesin their in vitro expression in acrR::IN and lpxA::IN strains comparedto wild-type strains (that is, they are part of the regulon controlled byAcrR) but did notmanifest differences in vivo as a function of dietaryvitamin A content (see table S12B, which includes P values).

We subsequently used in vitro DNA binding assays to test the pre-dicted AcrR-binding site upstream of BVU0244 and determined whetherretinol affects binding of AcrR from B. vulgatus (AcrRBV) and B. dorei(AcrRBD, encoded by BACDOR00223). The predicted 30-nt binding siteupstreamof the orthologousAcrAB-TolC operon inB. doreihas a single-nucleotide variation located inside the nonconserved center of the AcrR-bindingmotif (see underlined nucleotide in Fig. 5B). AcrRBV andAcrRBDdiffer by three amino acid substitutions. Two substitutions are located inthe N-terminal DNA binding domain, whereas a single substitution ispositioned inside the effector-binding domain.We also noticed that theannotated AcrRBV ORF in B. vulgatus is 24 nt shorter than its orthologin B. dorei, which encodes an additional eight–amino acid segment at its


N terminus. This N-terminal sequence is conserved in AcrR orthologsacross all analyzed Bacteroides spp., suggesting its functional relevanceand that the site of initiation of translation of the transcript arising fromacrR in B. vulgatusmay have been previously misannotated. Therefore,we expressed the full-length (AcrRBV) and truncated (AcrR*BV) ver-sions of AcrR, as well as its B. dorei DSM 17855 ortholog (AcrRBD),each fused to a Smt3-His6 tag, in E. coli. The recombinant proteinswere purified, their tag was removed, and their ability to bind the pre-dicted DNA operator upstream of BVU0244 (acrA) was tested byelectrophoretic mobility shift assay and by fluorescence polarizationassay (Fig. 5D and fig. S5, A to C). Fluorescence polarization assaysyielded Kd (dissociation constant) values of 18.5 ± 6 nM and 25.5 ±11 nM for AcrRBV and AcrRBD, respectively (fig. S5B). In contrast, thetruncated AcrR*BV protein did not interact with the same target DNAfragment. Retinol (up to 125 mM) did not have notable effects on thebinding of either purifiedAcrR ortholog to the targetDNA in either assay(fig. S5, A and B). These findings are consistent with our analysis of the invivo transcriptional responses of B. vulgatus; that is, components of itsAcrAB-TolC efflux pump, as well as the great majority of other genesin its predicted AcrR regulon, did not show significant differences intheir expression as a function of the presence or absence of vitamin A

***

StrainWTacrR_361472::IN

lpxA_362422::IN

Nor

mal

ized

tran

scrip

t cou

nt

******

***

***

*****

****

*** ***

***

***

BVU0244 BVU0241 BVU0240 BVU0239 BVU0238 BVU0236 BVU0234 BVU0233BVU0243 BVU0242 BVU0237 BVU0235

TolC

BVU0245

BVU0244

BVU0241

BVU0240

BVU0239 BVU0238

BVU0236

BVU0234

BVU0232

BVU0243 BVU0242 BVU0237 BVU0235 BVU0233

LpxA

AcrRTolC

2AcrA

2AcrB

2

Hypoth

etica

l

protei

n

Hypoth

etica

l

protei

n

Hypoth

etica

l

protei

n

Algina

te O-

acety

lation

prote

inAcrA AcrB

0

500

1000

1500

2000

2500

3000

Fig. 4. Transcriptional response of the B. vulgatus locus containing the AcrAB-TolC efflux pump to insertional mutagenesis of acrR or lpxA. Microbial RNA-seqanalysis of gene expression in mid-log phase B. vulgatus WT, acrR::IN, and lpxA::IN (genome location 362422) strains cultured in the absence of retinol. Transcript counts,normalized by DESeq2, for each gene in the putative BVU0244-BVU0233 operon are shown. Bars indicate means ± SEM for n = 3 independent cultures of each strain.Significant differences in gene expression were defined by DESeq2 analysis. *P < 0.05; **P < 0.01; ***P < 0.001.

7 of 17





http://stm.sciencem

ag.org/D

ownloaded from

in the diet. This conclusion is also supported by the results of a high-resolution quantitative mass spectrometry (MS) analysis of the wild-type B. vulgatus proteome expressed after growth in mediumcontaining a subinhibitory concentration of retinol (1 mM) versusvehicle alone (0.02% DMSO; table S14). Finally, these binding assaysalso suggest that the differential sensitivity of the two Bacteroidesspecies cannot be ascribed to differences in the interactions of AcrRwith either retinol or the identified target DNA binding site.

Further evidence that the bacterial AcrAB-TolC efflux systemaffects retinol sensitivityWehypothesized that the AcrAB-TolC efflux system, whose expressionwas up-regulated when expression of the acrR repressor was abrogated,operated to reduce local toxic concentrations of retinol in either theperiplasm or cytoplasm. To test this hypothesis more directly, wemeasured the efflux of retinol from cultures of wild-type B. vulgatusand the isogenic acrR::IN and PrpoD_acrR complemented acrR::INmutants. Equal numbers of stationary phase cells were pelleted andresuspended in phosphate-buffered saline (PBS) containing cysteineand 10 mM retinol. Ultra-performance liquid chromatography–MS(UPLC-MS) was used to quantitate retinol in cell-free supernatantsharvested at various time points during a 2-hour incubation. We founda statistically significant increase in extracellular retinol in the acrR::INmutant, where the efflux machinery was transcriptionally up-regulated,but not in the wild-type or complemented strains (P = 0.01, acrR::INversus wild-type and acrR::IN versus complemented strains, two-wayrepeated-measures ANOVA, Tukey’s HSD test; Fig. 6A).

Phenylalanine-arginine b-naphthylamide (PAbN) is a known inhib-itor of multidrug efflux systems, including AcrAB-TolC (41). Wild-type, acrR::IN, and complemented strains of B. vulgatus were treatedwith PAbN in the presence or absence of retinol; wild-type B. doreiwas used as a reference control (unlike wild-type B. vulgatus, it isresistant to retinol-mediated growth inhibition; Fig. 2B). Incubationof theB. vulgatus acrR::IN strain (which exhibits increased expression ofits efflux system components compared to wild-type) or wild-typeB. doreiwith PAbN(25 mg/ml) in the absence of retinol did not result ina statistically significant effect on growth compared to untreated controlcultures (P > 0.99, B. vulgatus acrR::IN; P > 0.99, wild-type B. dorei,one-way ANOVA, Bonferroni multiple comparisons test; table S15A).However, addition of the efflux pump inhibitor produced a significantincrease in retinol sensitivity in the B. vulgatus acrR::IN mutant (P <0.0001) and in wild-type B. dorei (P < 0.0001) compared to cultureswith retinol alone (one-wayANOVA,Bonferronimultiple comparisonstest; Fig. 6B and table S15A).Whereas the wild-type and complementedmutant strains of B. vulgatus displayed a modest but significant in-hibition of growth in the presence of PAbN (25 mg/ml) (P < 0.0001,both strains), their growthwas completely inhibited by 10 mMretinol inthe presence and absence of the efflux pump inhibitor (one-wayANOVA,Bonferroni multiple comparisons test; Fig. 6B and table S15A).Together, these results support the notion that the AcrAB-TolC effluxpumpmediates resistance to the growth inhibitory effects of retinol. Theprecise mechanism by which retinol suppresses growth of B. vulgatusremains to be defined.

The effects of bile acids on growth of B. vulgatusUPLC-MS disclosed differences in the proportional representation ofseveral bile acid species in the fecal microbiota of gnotobiotic animals fedthe vitamin A–deficient and multiple micronutrient–deficient diets com-pared to the control group monotonously fed the micronutrient-sufficient

AcrRBV

tolC

tolC2

Bacteroides vulgatus

C

BVU0244

Bacteroides dorei

Bacteroides thetaiotaomicron

OMA87slt

cysC

cysD BVU0415

cysNcysQ

OMA87slt

cysC

cysD BVU0415

BVU0417cysNcysQ

acrA

acrA

acrB

acrB

tolC

lpxA

acrR

BVU0236

acrB2

BVU0235

BVU0234

BVU0233

acrA2

tolC2

BVU0242

BVU0243

BVU0240

BVU0241

BVU0239

BVU0238

BVU0237

acrB2

BVU0421

BVU0420

BVU0419

BVU0417

BVU0418

BVU0416

B

A

BVU0244 -79 6.57 TAAAAACTAATTGGGTTTAAAAAGTTTTCT

BVU0236 -14 5.52 TAAAAAATGGAATAATGAAATCAGTTTTCA

BVU0421 -65 6.04 TGAAAACTCATTTGCCGTAGAAAGTTTTTT

BACDOR00219 -79 6.49 TAAAAACTAATTGGGTTCAAAAAGTTTTCT

BACDOR00022 -116 6.04 TGAAAACTCATTTGCCGTAGAAAGTTTTTT

BT3339 -115 6.72 CGGAAACTTATTTCATGGAATAAGTTTCCG

BT2689 -109 7.14 AGGAAACTTGATTTGTTAATTGAGTTTTCT

BT0411 -59 6.04 GGGAAACTTTTTTCGTAAATAAAGTTTTTA

BT1162 -81 6.37 TGAAAACTAATCGAAATAAAATAGTTTCCT

Position Score SequenceLocus tag

D

2

1Bit

s

01

55 10 15 20 25 30

3

BVU0235

BVU0234

BVU0233

OMA87slt

cysC

cysD BVU0415

cysNcysQ

tolC

lpxA

acrR acrA2

acrB2

BVU0236

BVU0235

BVU0234

BVU0233

BVU0236

acrR acrA2

tolC2acrA

acrB lpxA

AcrRBD AcrRBV

0 0.2 0.5 1 0.50 1 0.5 12

Target DNA

Position

Control DNA

AcrRBD

ProteinµM

0 0.2 0.5 1 2

Fig. 5. Interactions between the AcrR transcription factor and its target DNAbinding site. (A) Predicted AcrR-regulated operons in the genomes of human gutBacteroides species. Boxes indicate clusters of coregulated genes. Filled blackcircles indicate predicted AcrR-binding sites. Orthologous gene symbols are indicatedfor each species; unnamed genes are indicated using the orthologous B. vulgatuslocus designation. (B) Sequences of predicted AcrR-binding sites. BVU, B. vulgatus;BACDOR, B. dorei; BT, B. thetaiotaomicron. (C) Consensus binding site motif. (D) Elec-trophoretic mobility shift assay of the interactions between AcrRBV and AcrRBD andtheir predicted target DNA sequences.

8 of 17




http://stm.sciencem

ag.org/D

ownloaded from

diet. For example, vitamin A deficiency was associated with a statisti-cally significant increase in tauro-b-muricholic acid sulfate at the endof the micronutrient deficiency phase at experimental day 35 (P = 0.02for both the vitamin A–deficient and multiple micronutrient–deficientdiet groups compared to micronutrient-sufficient controls, two-wayANOVA, Bonferroni multiple comparisons test; table S16). Tauro-b-muricholic acid is a potent antagonist of the farnesoid X receptor(42). Concentrations of this bile acid, and its sulfated form, correlatewith slower intestinal transit time (43).

Examination of the community metatranscriptome revealed thatvitamin A deficiency was associated with differential expression ofseveral genes involved in bile acidmetabolism, including bile salt hydro-lases (EC3.5.1.24) from B. vulgatus (BVU2699 and BVU3993), B. dorei(BACDOR00823), and B. thetaiotaomicron (Bthe7330970). Of the twoB. vulgatus bile salt hydrolase transcripts, BVU2699 was identified as amember of the acrR regulon (table S12B).

AcrAB-TolC systems have been reported to contribute to bile acidresistance in bacteria (35, 44). Therefore, we tested the in vitro sensitiv-ities of the wild-type and acrR::IN strains of B. vulgatus to six bile acidspecies (cholic, deoxycholic, glycocholic, taurocholic, b-muricholic, andtauro-b-muricholic acids; concentration range, 25 to 1000 mM) in thepresence or absence of the pharmacologic inhibitor of the efflux pump.Wild-type B. vulgatus displayed the greatest sensitivity to deoxycholicacid (table S15B). Moreover, the sensitivity of wild-type B. vulgatus to150 mM deoxycholic acid was significantly increased in the presenceof the efflux pump inhibitor (25 mg/ml) (P < 0.0001, one-way ANOVA,Bonferroni multiple comparisons test; Fig. 6C). In contrast, sensitivityto deoxycholic acid was significantly reduced in the presence of thesame concentration of the inhibitor when B. vulgatus acrRwasmutated(and expression of the efflux pumpwas increased) (P < 0.0001, one-wayANOVA, Bonferroni multiple comparisons test; Fig. 6C). The effectof the efflux pumpwas also seen with 250 mMcholic acid, glycocholicacid, and taurocholic acid, where sensitivity was significantly reducedin the mutant compared to wild-type strains in the presence of the in-hibitor (P=0.02,P=0.002, andP=0.006, respectively, t test, Bonferronicorrection; table S15B). Complementation of the B. vulgatus acrR::INmutant partially restored sensitivity to deoxycholic acid (Fig. 6C andtable S15B).

Compared to wild-type B. vulgatus, wild-type B. dorei was signif-icantly less sensitive to deoxycholic acid in the presence of PAbN (P <0.0001, one-way ANOVA, Bonferroni multiple comparisons test;Fig. 6C), just as it was significantly less sensitive to retinol in the pres-ence of the inhibitor (Fig. 6B). This reduced sensitivity to both compounds


wasmeasured in two ways: by noting the fold difference in sensitivity ofeach organism to retinol or deoxycholic acid as a function of treatmentwith the inhibitor and by noting the absolute difference in sensitivityvalues between the organisms in the presence of deoxycholic acid plusthe inhibitor or retinol plus the inhibitor. These measures provideone operational definition of the increased efflux capacity of B. doreifor these two compounds.

80

90

100

110

120

130

140

150

160

170

Ret

inol

in c

ell-f

ree

supe

rnat

ant (

% o

f ini

tial)

B. vulgatus strain WT acrR_361472::IN acrR_361472::IN

Time (hour) 0 0.5 2.0 0 0.5 2.0 0 0.5 2.0

* *A

+ pNBU2_acrR

DCA (μM)PAβN (μg/ml) 0 25 0 25 0 25 0 25

Deo

xych

olic

aci

d se

nsiti

vity

(trea

ted/

cont

rol)

0

0.5

1.0

1.5

2.5

2.0

0

2

4

6

8

10

12

> 14

Retinol (μM) 10 10 10 10 10 10 10 10PAβN (μg/ml) 0 25 0 25 0 25 0 25

B. vulgatus

acrR::IN

+ pNBU2_acrR

B. vulgatus

WTB. vulgatus

acrR::IN

B. dorei

WT

B. vulgatus

acrR::IN

+ pNBU2_acrR

B. vulgatus

WTB. vulgatus

acrR::IN

B. dorei

WT

Ret

inol

sen

sitiv

ity(tr

eate

d/co

ntro

l)***

***

***

***

***

***

C

B

***

***

150 150 150 150 150 150 150 150

Fig. 6. Roleof theAcrAB-TolCeffluxpumpinregulatingthesensitivityofB.vulgatusto retinol anddeoxycholic acid. (A) Retinol efflux assay. Stationary phase cultures ofthe WT, acrR::IN, and complemented acrR::IN + pNBU2_acrR strains were resus-pended in PBS containing cysteine and 10 mM retinol. Samples were collected overa 2-hour time period, and retinol concentrations in cell-free supernatants werequantified by UPLC-MS. Four independent experiments were performed; n = 1 to3 replicates per experiment (two-way, repeated-measures ANOVA, Tukey’s HSDtest). (B) Sensitivity of the WT, acrR::IN, and acrR-complemented strains of B. vulgatusand WT B. dorei to 10 mM retinol in the presence and absence of PAbN, a chemicalinhibitor of multidrug efflux systems (see table S15A for further details). Data repre-sent one experiment, performed in triplicate (one-way ANOVA, Bonferroni multiplecomparisons test). (C) Sensitivity of B. vulgatus and B. dorei strains to deoxycholic acid(DCA) in the presence and absence of PAbN. Data represent one experiment, per-formed in triplicate (one-way ANOVA, Bonferroni multiple comparisons test). Means ±SEM. *P < 0.05, **P < 0.01, ***P < 0.001.

9 of 17



hD

ownloaded from

Follow-up electrophoretic mobility shift assays revealed that noneof these bile acid species affected the binding of AcrR to its target DNAsequence (fig. S5A), a finding independently confirmed by fluorescencepolarization assays, which showed minimal effects on Kd (fig. S5C).Considered together, our findings indicate that these bile acids are notdirect regulators of AcrR activity. However, we cannot rule out the pos-sibility that bile acids (or retinol) are metabolized to derivatives thatoperate as AcrR effectors or on some other pathway or additionalregulator that affects AcrR. Our observations also support the notionthat in vivo dietary retinol availability and bile acid metabolites gen-erated through biotransformation by members of the gut microbiotamay interact to influence the fitness of B. vulgatus via its AcrAB-TolCefflux system. Moreover, the fact that the B. vulgatus AcrAB-TolC1/2locus did not significantly change its expression in vivo as a functionof the vitaminAmanipulations applied to our gnotobioticmousemodelof the human gut microbiota suggests that the constitutive level ofactivity of the efflux pump is a key determinant of the sensitivity ofB. vulgatus compared to other bacterial members of the community(for example, B. dorei) to changes in retinoid availability. However, ad-ditional studies are needed before any conclusions can be made aboutwhether the AcrR-mediated resistance to retinol inhibition observed invitro is a critical determinant of the broader reconfiguration of thedefined bacterial community that occurs in vivo.


ttp://stm.sciencem

ag.org/

DISCUSSIONDeliberate manipulation of dietary iron, folate, zinc, or vitamin Aproduced the unanticipated finding that vitamin A had the greatesteffect on the structure and metatranscriptome of a phylogeneticallydiverse, defined human gut bacterial community in gnotobiotic mice.Much information has accumulated about the effects of retinoids onhost rather than microbial cell biology, including their pivotal role insignal transduction. The current study provides preclinical evidencesupporting the concept that the presence and subsequent treatmentofmicronutrient imbalances need to be considered from the perspectiveof not only the human host but also the host’s gut microbiota.

As noted above, B. vulgatus is one of a number of growth-discriminatory strains identified in a preclinical gnotobiotic mousemodel of human gut microbiota development (16). The underrepre-sentation of some of these growth-discriminatory strains in the gutmicrobial communities of undernourished children provides a rationalefor developing nutritional interventions designed to increase theirabundance and expressed beneficial functions (18). Although ourresults establish that vitamin A deficiency increases, and repletiondecreases, the representation of B. vulgatus in our model community,we lack preclinical or clinical evidence of its contribution to host growthrelative to other growth-discriminatory strains in the developingmicro-biota.Hence, we cannot conclude at this time that vitaminA imbalancesinfluence host growth through their effects on B. vulgatus (or that anincrease in the abundance of this putative growth-promoting taxonin a vitaminA–deficient state would represent an adaptive response).However, our results do suggest that the impact of vitamin A doseand pharmacokinetics on this and other growth-discriminatory or-ganisms present in the developing microbiota of children at risk foror with already manifest undernutrition should be evaluated. Studiesconducted in gnotobiotic animal models where diet and microbiotacomposition can be precisely controlled and manipulated provide auseful starting point for addressing this challenging problem. Thereare formidable problems with directly proceeding to human studies


without previous knowledge gleaned from preclinical animal models.These problems include distinguishing primary effects of dietary mi-cronutrient content on the microbiota from host effects, as well as thechallenge of stratifying a target human population composed of indi-viduals of varying ages, with varying combinations of micronutrientdeficiencies andmicrobiota compositions, and with varied histories ofexposure to supplements containing various combinations and dosesof micronutrients.

The current study extends previous work performed with definedhuman gut communities composed of reference “domesticated” bac-terial strains derived from diverse human donors to characterize theinteractions of specified deliberate dietary nutrientmanipulations onthe structural and functional features of these artificial microbiota.The diversity of the community described in the present report andthe reliability of its installation in gnotobioticmice represent an advanceover our previous gnotobiotic models (32, 45–48). This capacity toreliably assemble a more complex defined model human gut micro-biota, where all component organisms and their gene content areknown, expands our capacity to (i) capture the structural and func-tional responses of a broader range of community members to a varietyof dietary manipulations (for example, by COPRO-Seq, microbialRNA-seq, and MS-based proteomic or metabolomics studies) and (ii)subsequently prioritize further analyses based on the observed effectsize and nature of the responses. These studies also illustrate how oncesuch prioritization is made, an informative next step is to constructINSeq libraries from the most responsive taxa and perform in vitroscreens with identified bioactive dietary compounds to decipher themolecular underpinnings of the observed in vivo response.Nonetheless,our experiments illustrate one challenge in characterizing the effectsof deliberate perturbations of defined artificial human gut commu-nities with increasing degrees of complexity: Whereas consistentcommunity membership was achieved across cohoused animals withinand across treatment groups based on the criterion of “presence/absence” and Bray-Curtis dissimilarity measurements, we observedchanges in relative abundance over time even in the untreated controlgroup. We accommodated this apparent stochasticity by performingseveral types of comparisons: (i) a “within-treatment group” com-parisonwhere eachmouse served as its own control, documenting com-munity structure and metatranscriptome before, during, and after asingle type of acutemicronutrient deficiency is applied, and wheremicewere also compared to one another; (ii) a between-group compari-son where the responses of a given treatment group were referencedto members of the control group that monotonously consumed amicronutrient-sufficient diet; and (iii) in the case of vitamin A, abetween-group comparison where the responses to this single dietarymicronutrient deficiency were compared to the responses to the mul-tiply deficient diet. The robustness of responses to dietary or othertypes of manipulations can be examined further in communities withthe degree of complexity described in this report, or even greaterdegrees of complexity, by performing multiple independentexperiments with cohoused coprophagic animals.

These approaches set the stage for future studies that apply speci-fied dietary micronutrient deficiencies to gnotobiotic mice of varyingages harboring (i) defined collections of cultured age- and growth-discriminatory human gut bacterial strains representing the differentstages of assembly of the human gutmicrobiota or (ii) intact, uncultured,normally developing microbiota from children with healthy growthphenotypes, or immature microbiota from those with undernutrition.The results should not only allow further dissection of the mechanisms

10 of 17



by which micronutrients interact with community members to shapemicrobiota and host development but alsomay inform new approachesfor more effectively treating (and ultimately preventing) the short- andlonger-term sequelae of deficiency states. These animal models can alsosupport tests of whether current dosing protocols for micronutrientrepletionmay have unintended and deleterious effects on the develop-ing microbiota of the very children whose healthy growth such treat-ments are intended to promote.


http://stm.sciencem

ag.org/D

ownloaded from

MATERIALS AND METHODSStudy designEach experimental group consisted of five mice housed in a single cage,with all cages housed in a single gnotobiotic isolator. Groups of micewere age- andweight-matched before colonization (see below), and diettreatments were randomly assigned to each group. Experimental dietswere custom-designed andmanufactured byHarlan Teklad/Envigo. Sixdiets were produced: four were devoid of onemicronutrient (vitaminA,iron, zinc, or folic acid), all four micronutrients were absent in another,and one contained sufficient amounts of all of these micronutrients. Todesign a consistent, defined base diet for all experimental diets, a nutri-tionally replete mixture of individual amino acids was used in place ofcomplete protein. Custom vitamin and mineral mixes containing onlythemicronutrients appropriate to each diet were then added to the basediet to generate each experimental diet. Diets weremeasured into~500-gportions, placed into 3-mm-thick vacuum-sealed bags (Uline Inc.), andthen put into a second bag that was also vacuum-sealed. Diets wereshipped overnight on ice for sterilization by g-radiation (20 to 50 kGy;STERISCorp.). Thenutritional characteristics of each irradiated dietwerecalculated on the basis of diet formulation and are reported in table S1.Investigators were not blinded to diet treatments. All animals studiedwere included in subsequent analyses.

Bacterial strains and culture conditionsReference type strains used in this study are listed in table S2. Strainswere grown in gut microbiota medium (GMM) (49) or on brain-heartinfusion agar (BHI; Becton-Dickinson) supplemented with 10% horseblood, under anaerobic conditions (atmosphere: 5% H2, 20% CO2, and75% N2) in a soft-sided plastic anaerobic chamber (Coy LaboratoryProducts). The identity of each strain was confirmed by sequencingfull-length 16S ribosomalRNA(rRNA) gene amplicons generated usingthe universal primers 8F and 1391R. Strains were arrayed into a 96-wellformat and preserved at −80°C in GMM containing 15% glycerol.Additional manipulations of the arrayed collection were performedinside the anaerobic chamber using a Precision XS liquid-handling robot(BioTek Instruments Inc.).

Aprimaryhuman isolate ofB. vulgatus (16)was cultured anaerobicallyin BHI broth supplemented with L-cysteine (0.5 g/liter), L-histidine(0.2mM), hematin (1.9 mM), and vitamin K3 (1mg/liter) (referred to asBHI+ broth) or on BHI-blood plates.E. coli S17 lpir was used for routinecloning and as a conjugation donor for genetic experiments involvingB. vulgatus; itwas grown inLBMiller broth or onLBplates (BDDifco).Anti-bioticswere added tomedia as appropriate: ampicillin (100mg/ml), eryth-romycin (25 mg/ml), tetracycline (2 mg/ml), and gentamicin (200 mg/ml).

Gnotobiotic mouse experimentsAll experiments involving mice were performed using protocols ap-proved by theAnimal StudiesCommittee of theWashingtonUniversitySchool of Medicine.


Colonization of germ-free miceA −80°C stock plate of the clonally arrayed culture collection wasthawed in the anaerobic chamber. A 96-well, deep-well plate (ThermoScientific Nunc) was filled robotically with 960 ml of GMM broth. A40-ml aliquot was withdrawn from each well of the culture collectionand inoculated into the recipient plate, which was then covered with anatmosphere-permeable seal (VWR). The inoculated platewas incubatedunder anaerobic conditions for 48 hours at 37°C, after which time analiquot of each well was assayed for growth by measuring OD600.Equal volumes of each well culture were pooled, mixed, transferredto 1.8-ml crimp seal glass vials (Wheaton), and sealed for transport tothe gnotobiotic mouse facility. Vials were immediately fogged into gno-tobiotic isolators, and 500 ml of the pooled culture was introduced intoeach recipient germ-free mouse by a single oral gavage.

Adult (8- to 9-week-old) male CF57BL/6J mice were maintainedin a flexible plastic film gnotobiotic isolator and fed a nutritionallysufficient standard diet (B&K autoclavable chow #7378000, Zeigler BrosInc.) ad libitum. Four days before gavage of the defined 92-strainculture collection, all mice were transitioned to the nutritionally suffi-cient experimental diet. On experimental day 0, mice received 500 ml ofthe strain mixture.

All mice were maintained under a strict light cycle (lights on at 0600and lights off at 1800). All diets were provided ad libitum. All animals inall treatment groupswere observed on a daily basis andweighedweekly.Autoclaved bedding (Aspen wood chips, Northeastern Products) waschanged weekly and at the beginning of each diet oscillation.

The timing of fecal sampling for COPRO-Seq andmicrobial RNA-seq analyses is described in Fig. 1A.All fecal sampleswere collected fromindividual mice into 2-ml screw cap tubes (Axygen). Once samplingof the animals in an isolator had been completed, tubes were removedpromptly, snap-frozen in liquid N2, and transferred to a −80°C freezer.

Community profiling by sequencingThe microbial community structure in each fecal sample was analyzedby COPRO-Seq (47). Briefly, DNAwas isolated by subjecting each fecalpellet (n = 5 samples per experimental group per time point) to beadbeading in a mixture containing 500 ml of buffer A (200 mM NaCl,200 mM tris, 20 mM EDTA), 210 ml of 20% SDS, 500 ml of phenol/chloroform/isoamyl alcohol (pH 7.9) (25:24:1; Ambion), and 250 mlof 0.1-mm zirconium beads (BioSpec Products) for 3 min (Mini-BeadBeater-8, BioSpec). The aqueous phase was collected after centri-fugation at 4°C for 3 min at 8000g, and nucleic acids were purified(QIAquick columns, Qiagen) and eluted into 10 mM tris.

COPRO-Seq libraries were prepared by first sonicating 100 ml of asolution of DNA (5 ng/ml) from each fecal sample (Bioruptor Pico,Diagenode) (10 cycles of 30-s on/30-s off at 4°C). Fragmented DNAwas cleaned up inMinElute 96 UF PCR Purification plates (Qiagen).The fragments were blunt-ended, an A-tail was added, and the reactionproducts were ligated to Illumina paired-end sequencing adapterscontaining sample-specific 8-bp barcodes. Size selection was per-formed (1% agarose gels); 250- to 350-bp fragments were excised,and the DNA was purified (MinElute Gel Extraction, Qiagen). Adapter-linked fragments were enriched by a 20-cycle polymerase chain re-action (PCR) using Illumina PCR Primers PE 1.0 and 2.0, followedby MinElute PCR Purification (Qiagen); if agarose gels indicatedadapter dimers, an additional size selection was performed (AMPureXP SPRI bead cleanup, Beckman Coulter). Libraries were pooled andsequenced using Illumina MiSeq or HiSeq instruments (unidirectional50-nt reads).

11 of 17




http://stm.sciencem

ag.org/D

ownloaded from

Sequence data were demultiplexed and mapped to the referencegenomes of community members plus three “distractor” genomes(Bacteroides fragilis NCTC 9343, Clostridium perfringens ATCC13124, and Shigella sp. D9). The proportion of reads mapping tothe distractor genomes was used to set a minimum count thresholdcutoff indicating the presence/absence of an organism in the commu-nity on a per-sample basis. Normalized counts for each bacterial strainin each sample were used to produce a relative abundance table (sum-marized in table S3). Before statistical analyses, the table was furtherfiltered to exclude organisms not present at ≥0.1% relative abundancein >25% of samples collected.

To identify bacterial taxawhose relative abundanceswere influencedby themicronutrient-deficient diet treatments, we rarefied the abundancetable to 7000 reads per sample and used linear mixed-effects models oflog-transformed abundances (plus one pseudocount). For each taxon,models were generated for each of the five dietary micronutrient defi-ciencies, using the micronutrient-sufficient group as a control in eachmodel. Each model included (i) experimental stage (end of first suffi-cient diet phase at experimental day 14; 14 days after initiation of themicronutrient deficient diets; 14 days after return to the sufficientdiet), (ii) treatment group (deficiency versus control), and (iii) theirinteraction as fixed effects, with individual mice treated as a randomeffect. A significant interaction term was considered evidence of a po-tentially interesting influence of the micronutrient deficiency, and testsof differences of least-squaresmeans between the control and deficiencygroups in each experimental stage, followed by P value adjustmentsusing Holm’s method, were used to further explore the effects of theexperimental treatments.

In addition, relative abundances before and after diet switch werecompared using the group_significance.py script in QIIME version1.9.0 (50). A follow-up analysis was performed in R (version 3.2.3)(51). Relative abundance data and associated metadata files were readinto R, and the change in relative abundance for each organismwithinan individual mouse between two diet phases was calculated. Thesevalues were compared across experimental groups to identify changesin relative abundance that were significantly different from relativeabundance responses in other experimental groups. For all univariateanalyses, both nonparametric and parametric statistical tests were per-formed, and the results were compared.

Microbial RNA-seqTriplicate cultures of wild-type B. vulgatus and isogenic mutants werediluted 1:100 from overnight cultures into 5 ml of fresh Bacteroidesdefined medium (BDM) [prepared by mixing equal volumes of a 2×concentrate of the carbohydrate-free medium stock with a 2× concen-trated carbon source solution, as described previously (48)] and grownto mid-log phase (OD600, 0.4 to 0.6) under anaerobic conditions insealed Balch tubes. Once cultures reached mid-log phase, they weretreated with RNAprotect Bacteria Reagent (Qiagen), vortexed, andincubated at room temperature for 5min. Cultures were then transferredto clean 15-ml tubes and centrifuged for 10 min at 3023g supernatantswere decanted, and the pellets were stored at−80°C. Both cryopreservedin vitro cultures and fecal pellets (n = 3 samples per experimental groupper time point) were thawed and resuspended in 500 ml of buffer A im-mediately before extraction of total RNA.

Microbial RNA-seqwas performed as previously described (45, 47, 48).After acid phenol extraction, precipitation with isopropanol, and tworounds of deoxyribonuclease treatment [each followed by cleanup usinga MEGAclear column (Ambion)], RNA integrity was confirmed by gel


electrophoresis, and PCR-based checks for genomic DNA contami-nation were performed. 23S rRNA, 16S rRNA, and 5S rRNA wereremoved (Ribo-Zero Kit, Illumina), and purified bacterial mRNA wasprecipitated with ethanol in the presence of GlycoBlue (Ambion; usedto ensure subsequent complete resuspension in nuclease-free H2O).Double-stranded complementary DNA was synthesized using ran-dom hexamers and SuperScript II (Invitrogen). Illumina librarypreparation was performed as described above for COPRO-Seq;however, size selection was performed in the 200- to 300-bp range.Libraries were subjected to sequencing first on the Illumina MiSeqplatform for quality control purposes, after which library balance adjust-ments weremadewhere necessary and final sequencing at greater depthwas performed using the IlluminaHiSeq platform (50-nt unidirectionalreads).Data analysisThepipelinewe used for processing short-readmetatranscriptomic datais described in a previous publication (45). Briefly, sequence data weredemultiplexed, and Bowtie version 1.1.0 (52) was used to map reads tothe genomes of community members. Raw counts were subsetted, thennormalized, and analyzed using DESeq2 (53) in R 3.2.3 using twocomplementary strategies (“top-down” and “bottom-up”). To analyzedata at the community level (top-down view of themetatranscriptome),raw count data for each comparison were filtered at a low abundancethreshold of≥3 raw reads and for consistent representation in biologicalreplicates (present in ≥2 samples in both micronutrient-sufficient andmicronutrient-deficient diet groups being compared, or present in allsamples in one group and in none of the other) and then imported intoR. Size factors and dispersions were estimated in DESeq2. Significantdifferential expression was defined using the Wald test based on nega-tive binomial model fitting. To obtain a strain-level view of transcrip-tional responses (bottom-up analysis), RNA-seq data were subsettedby strain, filtering for low abundance and sample representation asabove, and the resulting data set was analyzed in R using DESeq2.Rarefaction was used to determine the fraction of expressed protein-coding sequences in each organism that was detected across all RNA-seq samples. Examination of the saturation characteristics of per-strainrarefaction curves across all samples allowed us to stratify organisms bypredicted transcriptome saturation. Strains that colonized gnotobi-otic mice (by COPRO-Seq analysis) but for which saturation was low(Bacteroides finegoldii DSM 17565, Bacteroides ovatus ATCC 8483,Bifidobacterium adolescentis L2-32, Enterobacter cancerogenus ATCC35316, Megamonas funiformis DSM 19343, Parabacteroides distasonisATCC 8503, and Proteus penneri ATCC 35198) were excluded fromthe bottom-up analysis (all transcriptomic data were included in thetop-down community-level analysis).Functional annotation of differentially expressed genesThe general strategy and bioinformatic tools used for functional analysisof microbial RNA-seq data are described in an earlier publication (47).Predicted protein-coding genes in the genomes of communitymemberswere annotated by BLASTP query (e-value threshold of 1 × 10−5)against the KEGG database (released 4 January 2016). Annotationresults were used tomatch coding sequence locus tags to KO identifiers.KO lookup tables for each genome were used to annotate transcriptionaldata, which were then used to determine the representation of variouslevels of the KEGG hierarchy, including “General,” “Categories,”“Pathways,” “Functions,” and “Enzyme Commission numbers” in eachRNA-seq data set. A more detailed (manual) curation of functionalassignments for genes implicated in the predicted AcrR regulon wasperformed using comparative genomics tools in the SEED database

12 of 17




http://stm.sciencem

ag.org/D

ownloaded from

and RAST (Rapid Annotation of microbial genomes using SubsystemsTechnology) (54).Pathway enrichment analysesHypergeometric enrichment and gene set enrichment analysis (GSEA)were performed using the R packages clusterProfiler (55) and GAGE(56), respectively. Gene set information for both top-down (community-wide) and bottom-up (strain-level) analyses were derived from theKEGG-based functional annotations described above. For hyper-geometric enrichment tests, the set of differentially expressed genes(as defined by DESeq2) was supplied to the generalized “enricher” toolin clusterProfiler, along with the corresponding gene set information(that is, their corresponding KEGG-level functional group). For GSEA,DESeq2-normalized counts were supplied to GAGE along with thecorresponding gene set information andwith options “same.dir =F (genesallowed to change expression in different directions),” “saaTest = gs.KSTest (use non-parametric Kolmogorov-Smirnov test to order genes),”and “rank.test = F (required for gs.KSTest).” For both enrichmentanalyses, P values were adjusted to control FDR by the Benjamini-Hochberg method.

Phenotypic screen for the effects of various retinoids on thegrowth of Bacteroides spp.Stocks (50 mM) of retinol, retinal, retinoic acid, retinyl palmitate,b-carotene, and geranylgeraniol (Sigma-Aldrich) were prepared inDMSOunder low-light conditions and stored inN2-purged amber vialsat −80°C. Bacterial strains were struck from −80°C glycerol stocksonto BHI-blood plates containing antibiotics where appropriate andgrown for 48 hours at 37°C under anaerobic conditions. Single colonieswere picked into BHI+ broth and grown overnight under anaerobicconditions at 37°C. Cultures were diluted to an OD600 of 0.05 in freshBHI+ broth and grown to mid-log phase. Either retinoids or DMSO(vehicle control) was added to BDM at specified concentrations, and150 ml of the media was aliquoted into wells of a 96-well plate (TechnoPlastic Products AG) using a liquid-handling robot housed in theCoy chamber. Mid-log test cultures were subsequently diluted 1:25into 1ml of BDM/0.02% (v/v) DMSO in deep-well plates; 50 ml of thediluted cultures was transferred to recipient wells in the plate by ro-bot, yielding 1× treatment and 1:100 final dilutions of the bacterialstrains (n = 3 to 4 cultures per treatment per experiment; experimentswere performed in duplicate unless indicated). Plates were sealed withan optically clear film (Axygen UC500) and transferred to a platestacker-reader system housed in the anaerobic chamber (BioTekEon and BioStack 4). For data collection, each plate was placed in theEon plate reader and incubated at 37°C, withOD600 values determined at15-min intervals. For multiplate data collection, the anaerobic chamberwas heated to 37°C, and plates were placed in the plate-handling ro-bot and draped with laboratory diapers to achieve low-light conditions;OD600 measurements were performed for each plate at 15-min intervals.

For multidrug efflux inhibitor studies, cultures were prepared asdescribed above for retinoid sensitivity testing and were treated withPAbN (0 or 25 mg/ml) (Sigma-Aldrich), with or without 10 mM retinolin 200 ml of BDM. Plates were sealed, and OD600 was monitored.

At the conclusion of each experiment, data were exported to text file,and in-house perl scriptswere used to plot growth curves and calculategrowth rate, the time at which each growth curve crossed a user-definedOD600 threshold and the maximum OD600 that was achieved. Curveparameters were normalized to corresponding values from controlcultures of the same strain in 0.02%DMSO before performing compar-isons between strains (Prism 6.0, GraphPad Software).


High-resolution quantitative MS-based proteomicsWild-typeB. vulgatusATCC8482was cultured in BDM in the presenceof 1mMretinol or vehicle alone (0.02%DMSO) (n=2monocultures pertreatment), pelleted, and frozen for storage at −80°C. Proteins wereextracted and digestedwith trypsin, and 25 mg of peptideswasmeasuredacross 11 salt cuts of a 24-hour MudPIT LC-MS/MS analysis using anOrbitrap EliteMS (48). ResultingMS/MS spectra were searched againstthe B. vulgatus proteome database (concatenated with common con-taminants and decoy sequences to assess FDRs) using the MyriMatchv. 2.1 search algorithm (57). Peptide spectrummatches were scored andfiltered (peptide-level FDR < 1%) via IDPicker v. 3.0 (58), assignedmatched ion intensities, and peptide abundance distributions werenormalized and assembled to proteins using InfernoRDN, as describedpreviously (59, 60).

INSeq-based identification of B. vulgatus mutants that affectretinol sensitivityB. vulgatus ATCC 8482 taxon-specific barcodes were introduced intothe INSeq mutagenesis vector pSAM_Bt (31) by PCR amplification,using the primer pairs described in table S11. Amplification conditionswere as follows: initial denaturation at 94°C for 2 min, followed by25 cycles of denaturation (94°C for 15 s), annealing (58°C for 30 s),and amplification (58°C for 90 s). Vector DNAwas digested with Kpn Iand Bam HI, and the linear product was ligated to the PCR amplicon,yielding the barcoded Tn mutagenesis vector. Whole-genome Tnmutagenesis of B. vulgatus ATCC 8482 was performed using a pub-lished protocol (32).

Aliquots of themutant librarywere inoculated into BDMcontainingretinol (10 mM) or 0.02% DMSO. Triplicate, large-volume cultures(250ml each; starting OD600 of 0.05) were incubated anaerobically at37°C. Aliquots were removed during lag phase and after retinol-selectedcultures reached stationary phase. Additionally, a stationary phasealiquot from the primary culture was used to inoculate 250 ml of freshselection medium. The resulting secondary cultures were sampled inmid-log phase (OD600, 0.4 to 0.6) and at stationary phase.

DNA was isolated from all cultures/time points, and the abundanceand genome location of mutants in input, control, and selected sampleswere determined by INSeq as follows. Themariner Tn contains engi-neered Mme I sites at both of its ends; thus, DNA was digested withMme I (which cuts 20 bp distal to its recognition site), yielding productswith flanking genomic sequence tags at both ends. AMPure XP bead-based and gel-based size selection was used to isolate and purify theproducts. Custom, indexed Illumina adapters were ligated to thesefragments, which were then sequenced (Illumina HiSeq platform; 50-ntreads). INSeq reads weremapped to the B. vulgatus genome and ana-lyzed (32) to obtain the identity and abundance of each Tn mutantpresent in the input library and the selected or control libraries.

Retinol-resistant Tn mutants were isolated by plating dilutions ofcryopreserved, stationary phase, selected cultures on BHI-bloodcontaining erythromycin (25 mg/ml). Colony PCR using primer pairsthat spanned inserted Tn borders was used to confirm the identitiesof mutants. Confirmed colonies were grown overnight in BHI+ andarchived as 15%glycerol stocks at−80°C.Retinoid sensitivity experimentswere performed as described above using monocultures of isolatedTn mutant strains.

Complementation of B. vulgatus Tn mutantsTn mutants of B. vulgatus were complemented using the genomicinsertion vector pNBU2_tetQ (40). The coding sequence of acrR

13 of 17




http://stm.sciencem

ag.org/D

ownloaded from

(BVU0240) was amplified by PCR with Phusion High-Fidelity MasterMix (NewEnglandBiolabs) using purified genomicDNA fromwild-typeB. vulgatus as the template. To drive constitutive expression of comple-mented genes, a 300-bp region upstream of the B. vulgatus rpoD gene(PrpoD) was also amplified by PCR. pNBU2_tetQ was digested withXba I and Pst I; GibsonAssembly (New England Biolabs) was used to as-semblePrpoD and theB. vulgatus acrR coding sequence into the digestedvector, yielding pNBU2_tetQ_PrpoD_acrR (abbreviated pNBU2_acrR).Assembled recombinant and control vectors were transformed intoE. coli S17 lpir, and the configuration of the constructs were confirmedby junction-spanning PCR. Vectors were mobilized from the E. coli do-nor to theB. vulgatus recipient strains by conjugation. Briefly, overnightcultures of both donor and recipient were inoculated into correspondingrichmediawithantibioticswhere appropriate andgrown for16 to20hoursat 37°C (E. coli, aerobically with shaking at 225 rpm; B. vulgatus,anaerobically without shaking). Stationary phase cultures were then se-rially diluted into fresh medium and incubated for 4 hours at 37°C.Cultures of donor and recipient cells with equivalent optical densitieswere pelleted by centrifugation, resuspended as a mixture in 1 ml offresh medium without antibiotics, and plated on BHI-blood agar. Af-ter a 24-hour incubation under aerobic conditions, the surface of eachplate was scraped, resuspended in 5 ml of BHI+ liquid, and plated onBHI+ agar with tetracycline (2 mg/ml). After a 48-hour incubation underanaerobic conditions, colonies were picked and restruck on BHI+ agarwith tetracycline. The site of insertion and orientation of introduced genesin selected colonies were verified by PCR and sequencing. Confirmedcomplemented Tn mutants carrying either the empty pNBU2_tetQvector or pNBU2_acrR were subjected to retinoid sensitivity assays asdescribed above.

Transcription factor–binding site analysesAnalysis of Bacteroides AcrR regulonsWe applied an integrative comparative genomics approach to recon-struct the AcrR regulon in Bacteroides species [as implemented in theRegPredict Web server (http://regpredict.lbl.gov)] (61). This approachcombines identification of candidate regulator-binding sites withcross-genomic comparison of regulons and functional context analysisof candidate target genes (62). The upstream regions of BVU0240 andits orthologs in 11 Bacteroides genomes (representing a nonredun-dant set of species excluding closely related strains) were analyzedusing a DNA motif recognition program (the “Discover Profile”procedure implemented in RegPredict) to identify a conserved palin-dromic DNA motif. After construction of a position-weight matrixfor the candidate AcrR-binding motif, we searched for additional AcrR-binding sites in the analyzed Bacteroides genomes. Finally, we per-formed a consistency check or cross-species comparison of the predictedAcrR regulons. Scores of candidate binding sites were calculated asthe sum of positional nucleotide weights. The score threshold wasdefined as the lowest score observed in the training set. The sequencelogo for the derived DNA binding motif was drawn using the WebLogopackage (63).Cloning, expression, and protein purification of B. vulgatusand B. dorei AcrR-like regulatorsGenes encoding orthologous AcrR-like regulators from B. vulgatus(BVU0240, AcrRBV) and B. dorei (BACDOR_00223, AcrRBD) wereamplified by PCR fromgenomicDNAusing two sets of specific primerscontaining BamHI andHind III restriction sites (table S11). A truncatedvariant of theAcrRBVprotein (AcrR*BV) that lacks eightN-terminal aminoacids was generated using an alternative forward primer (table S11).


This “truncated variant” corresponds to an alternative translational startof this protein, as currently reflected in GenBank (WP_008782083.1).

Amplicons specifying the full-length AcrR orthologs from B. vulgatusand B. dorei and the truncated AcrR*BV variant were cloned into thepSMT3 expression vector. The recombinant proteins were expressed,under control of the T7 promoter, with an N-terminal His6-Smt3-tagin E. coli BL21/DE3 (64). Cells were grown in LB medium (50 ml) toan OD600 of ~1.0, and protein expression was induced with 0.2 mMisopropyl-b-D-thiogalactopyranoside. Cells were harvested after 18 hoursof additional shaking at 20°C.

To purify the recombinant AcrRBV, AcrR*BV, and AcrRBD proteins,harvested cells were first resuspended in 20 mM Hepes buffer (pH 7)containing 100 mM NaCl, 0.03% Brij-35, 2 mM b-mercaptoethanol,and 2 mM phenylmethylsulfonyl fluoride (Sigma-Aldrich). Cells werethen lysed by incubation with lysozyme (1 mg/ml) for 30 min at 4°C,followed by a freeze-thaw cycle, sonication, and centrifugation. Tris-HCl buffer (pH 8) was added to the resulting supernatant (final concen-tration, 50mM),whichwas subsequently loaded onto aNi–nitrilotriaceticacid agarose minicolumn (0.3 ml; Qiagen). After washing with thestarting buffer containing 1 M NaCl and 0.3% Brij-35, bound proteinswere eluted with 0.3 ml of the starting buffer containing 300 mM im-idazole. Protein size and purity were verified by SDS–polyacrylamidegel electrophoresis. Protein concentration was determined by usingtheQuick Start Bradford ProteinAssayKit (Bio-Rad). TheN-terminalHis6-Smt3-tag was cleaved off the purified proteins by digestion withUlp1 protease [overnight incubation at 4°C in a reaction mixturecontaining the protease (0.07 mg/ml)].DNA binding assaysInteractions between the purified recombinant transcription factors andtheir predicted DNA binding sites were assayed using two techniques:electrophoretic mobility shift assay and fluorescence polarization assay.DNA oligonucleotide targets were synthesized (table S11). 5′-biotin–labeled DNA fragments were used for electrophoretic mobility shiftassays, whereas fluorescence polarization assays used DNA frag-ments 3′-labeled with 6-carboxyfluorescein. As a negative control, weused a 41-bpDNAfragment from theBT0356geneofB. thetaiotaomicronVPI-5482; this fragment contains the verified binding site of an un-related transcriptional regulator, AraR (65).

For electrophoretic mobility shift assays, the target DNA fragment(0.25 nM)wasmixedwith increasing concentrations of the purified tag-free AcrRBV and AcrRBD proteins in a total reaction volume of 20 ml.The binding buffer contained 20mM tris-HCl (pH 8.0), 150mMKCl,5 mM MgCl2, 1 mM dithiothreitol, 0.05% NP-40, and 2.5% glycerol.After a 25-min incubation at 37°C, the reaction mixture was subjectedto electrophoresis (conditions: native 5% polyacrylamide gels in 45 mMtris, 45mMborate buffer (0.5×TB), 100-min run time at 90V, room tem-perature). DNA was electrophoretically transferred onto a Hybond-N+

membrane (Pierce) and fixed by ultraviolet cross-linking. Biotin-labeledDNAwas detected with the LightShift chemiluminescent electrophoreticmobility shift assay kit (Pierce).

For fluorescence polarization assays, fluorescently labeled double-strandedDNA fragments (3 nM)were incubated with increasing con-centrations of the purified tag-free AcrRBV and AcrRBD proteins intriplicate 100-ml reaction mixtures conducted in 96-well black plates(VWR). The binding buffer contained 20 mM tris-HCl (pH 7.5) and100 mMNaCl, and the incubation was conducted for 20 min at 24°C.Herring sperm DNA (1 mg) was added to the reaction mixture tosuppress nonspecific binding. Fluorescence polarization measurementswere made using a Beckman multimode plate reader (DTX 880) with

14 of 17

http://regpredict.lbl.gov




http://stm.sciencem

ag.org/D

ownloaded from

excitation and emission filters set at 495 and 520 nm. The fluorescencepolarization assay values were determined as described previously (66).

Bile sensitivity assaysThebile acid sensitivities of isogenicwild-type,acrR::IN, andpNBU2_acrR-complemented strains of B. vulgatus, plus wild-type B. dorei, wereassayed using methods analogous to those used for defining theirsensitivity to different retinoids. Cultures were grown to stationary phaseand then diluted to OD600 of ~0.01 in BDM containing 0, 250 mM, or1 mM of glycocholic acid, taurocholic acid, cholic acid, deoxycholicacid, b-muricholic acid, or tauro-b-muricholic acid, with or withoutPAbN (25 mg/ml) (n = 3 cultures per treatment). An additional ex-periment was performed with 150 mMdeoxycholic acid in the presenceor absence of the efflux pump inhibitor. Bile species were obtained fromSigma-Aldrich except for b-muricholic acid (Steraloids) and tauro-b-muricholic acid (Santa Cruz Biotechnology). Assays were performedin a volume of 200 ml in triplicate in 96-well plates.

Targeted UPLC-MSRetinoidsAliquots of cultures of the wild-type, acrR::IN, and acrR-complementedacrR::IN strains of B. vulgatus were diluted into supplemented BHImedium and grown to stationary phase at 37°C under anaerobic con-ditions. Cultures were then diluted to an OD600 of 0.5 in 10 ml of PBS/0.2% (w/v) cysteine, and retinol was added to a final concentration of10 mM(n = 1 to 3 cultures per treatment, 3 experiments). At indicatedtime points, a 500-ml aliquot of each culture was placed into a 1.5-mltube, and cells were pelleted by centrifugation for 3 min. The super-natant was withdrawn and transferred to a 1-ml sample vial (Waters),and deuterated (D5) retinol (Toronto Research Chemicals) was addedto a final concentration of 10mMas a spike-in control.MS analyseswereperformed using Acquity UPLC I-Class System (Waters) coupled toLTQ Orbitrap Discovery (Thermo Scientific). Mobile phases for posi-tive ionization were (i) 0.1% formic acid in water and (ii) 0.1% formicacid in acetonitrile. Retinol quantification was achieved by compar-ing measured values to standard curves generated from stocks of ret-inol and D5-retinol.Bile acidsUPLC-MS analysis of fecal bile acids was performed using protocolsdescribed in an earlier report (43).

Statistical analysesRoutine statistical analyses were performed in R (version 3.2.3) or inPrism 6.0 as indicated. P < 0.05 was considered statistically significantafter appropriate correction for multiple hypothesis testing. Specificstatistical tests and P value corrections are noted throughout the text,in figure legends, and in the Supplementary Materials.

SUPPLEMENTARY MATERIALSwww.sciencetranslationalmedicine.org/cgi/content/full/9/390/eaal4069/DC1Fig. S1. Comparisons of community structure across experimental stages.Fig. S2. Relative abundances of B. vulgatus ATCC 8482 and B. dorei DSM 17855 in gnotobioticmice across experimental stages and treatment groups.Fig. S3. Characterization of the B. vulgatus ATCC 8482 INSeq library.Fig. S4. Maximum likelihood phylogenetic tree of BVU0240/AcrR orthologs identified in humangut–associated Bacteroides and other members of the family Bacteroidaceae.Fig. S5. DNA binding characteristics of AcrRBV and AcrRBD in the presence and absence ofpossible effectors.Table S1. Nutritional characteristics of experimental micronutrient-deficient and micronutrient-sufficient diets.


Table S2. Ninety-two sequenced, human gut–derived bacterial strains.Table S3. COPRO-Seq analysis of community composition in fecal samples.Table S4. Influence of micronutrient deficiencies on the relative abundances of specific taxa.Table S5. Identification of community members that exhibit significant changes in theirabundance as a function of diet treatment and/or time.Table S6. Microbial RNA-seq analysis of changes in community metatranscriptome as afunction of diet treatment with grouping of transcripts into KO groups.Table S7. Microbial RNA-seq analysis of changes in B. vulgatus gene expression as a function ofdiet treatment with grouping of transcripts into KO groups.Table S8. Strain-level microbial RNA-seq analysis of the effects of vitamin A on gene expression(summarized at the level of KO groups).Table S9. Mouse weights as a function of diet treatment and time.Table S10. In vitro retinoid sensitivities of Bacteroides strains.Table S11. Strains, primers, and plasmids used in this study.Table S12. Microbial RNA-seq analysis of differential gene expression between wild-typeB. vulgatus and Tn mutants (DESeq2).Table S13. Bioinformatic characterization of AcrR regulons in human gut Bacteroides strains.Table S14. High-resolution quantitative MS-based proteomic analysis of wild-type B. vulgatuscultured in the presence of 1 mM retinol versus vehicle alone (0.02% DMSO).Table S15. Effects of retinol, bile acids, and PAbN on growth of wild-type and mutant strains ofB. vulgatus and wild-type B. dorei.Table S16. UPLC-MS analysis of the effects of dietary micronutrient deficiency on fecal bile acidmetabolites.

REFERENCES AND NOTES1. R. L. Bailey, K. P. West Jr., R. E. Black, The epidemiology of global micronutrient

deficiencies. Ann. Nutr. Metab. 66, 22–33 (2015).2. Institute of Medicine Committee on Micronutrient Deficiencies; C. P. Howson,

E. T. Kennedy, A. Horwitz, Eds., Prevention of Micronutrient Deficiencies: Tools forPolicymakers and Public Health Workers (National Academy Press, 1998).

3. R. E. Black, L. H. Allen, Z. A. Bhutta, L. E. Caulfield, M. de Onis, M. Ezzati, C. Mathers,J. Rivera; Maternal and Child Undernutrition Study Group, Maternal and childundernutrition: Global and regional exposures and health consequences. Lancet 371,243–260 (2008).

4. B. A. Underwood, Hypovitaminosis A: International programmatic issues. J. Nutr. 124,1467S–1472S (1994).

5. World Health Organization, Guideline: Vitamin A Supplementation in Infants and Children6–59 Months of Age (World Health Organization, 2011).

6. E. H. Harrison, Enzymes catalysing the hydrolysis of retinyl esters. Biochim. Biophys. Acta1170, 99–108 (1993).

7. E. Mayo-Wilson, A. Imdad, K. Herzer, M. Y. Yakoob, Z. A. Bhutta, Vitamin A supplements forpreventing mortality, illness, and blindness in children aged under 5: Systematic reviewand meta-analysis. BMJ 343, d5094 (2011).

8. R. A. Salam, C. MacPhail, J. K. Das, Z. A. Bhutta, Effectiveness of micronutrient powders(MNP) in women and children. BMC Public Health 3 (suppl. 13), S22 (2013).

9. T. Gera and H. P. S. Sachdev, Effect of iron supplementation on incidence of infectiousillness in children: Systematic review. BMJ 325, 1142 (2002).

10. T. Jaeggi, G. A. M. Kortman, D. Moretti, C. Chassard, P. Holding, A. Dostal, J. Boekhorst,H. M. Timmerman, D. W. Swinkels, H. Tjalsma, J. Njenga, A. Mwangi, J. Kvalsvig, C. Lacroix,M. B. Zimmermann, Iron fortification adversely affects the gut microbiome, increasespathogen abundance and induces intestinal inflammation in Kenyan infants. Gut 64,731–742 (2014).

11. S. Sazawal, R. E. Black, M. Ramsan, H. M. Chwaya, R. J. Stoltzfus, A. Dutta, U. Dhingra,I. Kabole, S. Deb, M. K. Othman, F. M. Kabole, Effects of routine prophylacticsupplementation with iron and folic acid on admission to hospital and mortality inpreschool children in a high malaria transmission setting: Community-based,randomised, placebo-controlled trial. Lancet 367, 133–143 (2006).

12. J. Veenemans, P. Milligan, A. M. Prentice, L. R. A. Schouten, N. Inja, A. C. van der Heijden,L. C. C. de Boer, E. J. S. Jansen, A. E. Koopmans, W. T. M. Enthoven, R. J. Kraaijenhagen,A. Y. Demir, D. R. A. Uges, E. V. Mbugi, H. F. J. Savelkoul, H. Verhouf, Effect ofsupplementation with zinc and other micronutrients on malaria in Tanzanian children: Arandomised trial. PLOS Med. 8, e1001125 (2011).

13. H. Drakesmith, A.M. Prentice, Hepcidin and the iron-infection axis. Science338, 768–772 (2012).14. S. Soofi, S. Cousens, S. P. Iqbal, T. Akhund, J. Khan, I. Ahmed, A. K. M. Zaidi, Z. A. Bhutta,

Effect of provision of daily zinc and iron with several micronutrients on growth andmorbidity among young children in Pakistan: A cluster-randomised trial. Lancet 382,29–40 (2013).

15. S. Subramanian, S. Huq, T. Yatsunenko, R. Haque, M. Mahfuz, M. A. Alam, A. Benezra,J. DeStefano, M. F. Meier, B. D. Muegge, M. J. Barratt, Q. Zhang, M. A. Province,W. A. Petri Jr., T. Ahmed, J. I. Gordon, Persistent gut microbiota immaturity inmalnourished Bangladeshi children. Nature 509, 417–421 (2014).

15 of 17

http://www.sciencetranslationalmedicine.org/cgi/content/full/9/390/eaal4069/DC1




http://stm.sciencem

ag.org/D

ownloaded from

16. L. V. Blanton, M. R. Charbonneau, T. Salih, M. J. Barratt, S. Venkatesh, O. Ilkaveya,S. Subramanian, M. J. Manary, I. Trehan, J. M. Jorgensen, Y.-M. Fan, B. Henrissat, S. A. Leyn,D. A. Rodionov, A. L. Osterman, K. M. Maleta, C. B. Newgard, P. Ashorn, K. G. Dewey,J. I. Gordon, Gut bacteria that prevent growth impairments transmitted by microbiotafrom malnourished children. Science 351, aad3311 (2016).

17. J. D. Planer, Y. Peng, A. L. Kau, L. V. Blanton, I. M. Ndao, P. I. Tarr, B. B. Warner, J. I. Gordon,Development of the gut microbiota and mucosal IgA responses in twins and gnotobioticmice. Nature 534, 263–266 (2016).

18. L. V. Blanton, M. J. Barratt, M. R. Charbonneau, T. Ahmed, J. I. Gordon, Childhoodundernutrition, the gut microbiota, and microbiota-directed therapeutics. Science 352,1533 (2016).

19. S. Mandal, K. M. Godfrey, D. McDonald, W. V. Treuren, J. V. Bjørnholt, T. Midtvedt,B. Moen, K. Rudi, R. Knight, A. L. Brantsæter, S. D. Peddada, M. Eggesbø, Fat andvitamin intakes during pregnancy have stronger relations with a pro-inflammatorymaternal microbiota than does carbohydrate intake. Microbiome 4, 55 (2016).

20. B. S. Reddy, J. R. Pleasants, D. R. Zimmerman, B. S. Wostmann, Iron and copper utilizationin rabbits as affected by diet and germfree status. J. Nutr. 87, 189–196 (1965).

21. B. S. Reddy, J. R. Pleasants, B. S. Wostmann, Effect of intestinal microflora on iron andzinc metabolism, and on activities of metalloenzymes in rats. J. Nutr. 102, 101–107(1972).

22. J. G. Bieri, E. G. McDaniel, W. E. Rogers Jr., Survival of germfree rats without vitamin A.Science 163, 574–575 (1969).

23. W. E. Rogers Jr., J. G. Bieri, E. G. McDaniel, Vitamin A deficiency in the germfree state.Fed. Proc. 30, 1773–1778 (1971).

24. J. C. Smith, E. G. McDaniel, L. D. McBean, F. S. Doft, J. A. Halsted, Effect of microorganismsupon zinc metabolism using germfree and conventional rats. J. Nutr. 102, 711–719(1972).

25. H. K. Biesalski, Nutrition meets the microbiome: Micronutrients and the microbiota.Ann. N Y. Acad. Sci. 1372, 53–64 (2016).

26. J. M. Carrothers, M. A. York, S. L. Brooker, K. A. Lackey, J. E. Williams, B. Shafii,W. J. Price, M. L. Settles, M. A. McGuire, M. K. McGuire, Fecal microbial communitystructure is stable over time and related to variation in macronutrient andmicronutrient intakes in lactating women. J. Nutr. 145, 2379–2388 (2015).

27. T. Lee, T. Clavel, K. Smirnov, A. Schmidt, I. Lagkouvardos, A. Walker, M. Lucio, B. Michalke,P. Schmitt-Kopplin, R. Fedorak, D. Haller, Oral versus intravenous iron replacementtherapy distinctly alters the gut microbiota and metabolome in patients with IBD. Gut 66,863–871 (2017).

28. T. Werner, S. J. Wagner, I. Martínez, J. Walter, J.-S. Chang, T. Clavel, S. Kisling,K. Schuemann, D. Haller, Depletion of luminal iron alters the gut microbiota and preventsCrohn’s disease-like ileitis. Gut 60, 325–333 (2011).

29. L. Liu, X.-H. Tang, L. J. Gudas, Homeostasis of retinol in lecithin: Retinol acyltransferasegene knockout mice fed a high retinol diet. Biochem. Pharmacol. 75, 2316–2324(2008).

30. E. Hernandez-Alvarez, B. I. Pérez-Sacristán, I. Blanco-Navarro, E. Donoso-Navarro,R. A. Silvestre-Mardomingo, F. Granado-Lorencio, Analysis of microsamples of humanfaeces: A non-invasive approach to study the bioavailability of fat-soluble bioactivecompounds. Eur. J. Nutr. 54, 1371–1378 (2015).

31. A. L. Goodman, N. P. McNulty, Y. Zhao, D. Leip, R. D. Mitra, C. A. Lozupone, R. Knight,J. I. Gordon, Identifying genetic determinants needed to establish a human gut symbiontin its habitat. Cell Host Microbe 6, 279–289 (2009).

32. M. Wu, N. P. McNulty, D. A. Rodionov, M. S. Khoroshkin, N. W. Griffin, J. Cheng, P. Latreille,R. A. Kerstetter, N. Terrapon, B. Henrissat, A. L. Osterman, J. I. Gordon, Geneticdeterminants of in vivo fitness and diet responsiveness in multiple human gutBacteroides. Science 350, aac5992 (2015).

33. D. N. Crowell, M. S. Anderson, C. R. Raetz, Molecular cloning of the genes for lipid Adisaccharide synthase and UDP-N-acetylglucosamine acyltransferase in Escherichia coli.J. Bacteriol. 168, 152–159 (1986).

34. D. Ma, D. N. Cook, M. Alberti, N. G. Pon, H. Nikaido, J. E. Hearst, Molecular cloning andcharacterization of acrA and acrE genes of Escherichia coli. J. Bacteriol. 175, 6299–6313(1993).

35. H. I. Zgurskaya, H. Nikaido, Bypassing the periplasm: Reconstitution of the AcrABmultidrug efflux pump of Escherichia coli. Proc. Natl. Acad. Sci. U.S.A. 96, 7190–7195(1999).

36. D. Du, Z. Wang, N. R. James, J. E. Voss, E. Klimont, T. Ohene-Agyei, H. Venter, W. Chiu,B. F. Luisi, Structure of the AcrAB–TolC multidrug efflux pump. Nature 509, 512–515(2014).

37. J.-S. Kim, H. Jeong, S. Song, H.-Y. Kim, K. Lee, J. Hyun, N.-C. Ha, Structure of the tripartitemultidrug efflux pump AcrAB-TolC suggests an alternative assembly mode. Mol. Cells 38,180–186 (2015).

38. D. Ma, M. Alberti, C. Lynch, H. Nikaido, J. E. Hearst, The local repressor AcrR plays amodulating role in the regulation of acrAB genes of Escherichia coli by global stresssignals. Mol. Microbiol. 19, 101–112 (1996).


39. A. Raczkowska, J. Trzos, O. Lewandowska, M. Nieckarz, K. Brzostek, Expression of theAcrAB Components of the AcrAB-TolC multidrug efflux pump of Yersinia enterocolitica issubject to dual regulation by OmpR. PLOS ONE 10, e0124248 (2015).

40. E. C. Martens, H. C. Chiang, J. I. Gordon, Mucosal glycan foraging enhances fitness andtransmission of a saccharolytic human gut bacterial symbiont. Cell Host Microbe 4,447–457 (2008).

41. T. E. Renau, R. Léger, E. M. Flamme, J. Sangalang, M. W. She, R. Yen, C. L. Gannon,D. Griffith, S. Chamberland, O. Lomovskaya, S. J. Hecker, V. J. Lee, T. Ohta, K. Nakayama,Inhibitors of efflux pumps in Pseudomonas aeruginosa potentiate the activity of thefluoroquinolone antibacterial levofloxacin. J. Med. Chem. 42, 4928–4931 (1999).

42. S. I. Sayin, A. Wahlström, J. Felin, S. Jäntti, H.-U. Marschall, K. Bamberg, B. Angelin,T. Hyötyläinen, M. Orešič, F. Bäckhed, Gut microbiota regulates bile acid metabolism byreducing the levels of tauro-beta-muricholic acid, a naturally occurring FXR antagonist.Cell Metab. 17, 225–235 (2013).

43. N. Dey, V. E. Wagner, L. V. Blanton, J. Cheng, L. Fontana, R. Haque, T. Ahmed, J. I. Gordon,Regulators of gut motility revealed by a gnotobiotic model of diet-microbiomeinteractions related to travel. Cell 163, 95–107 (2015).

44. D. G. Thanassi, L. W. Cheng, H. Nikaido, Active efflux of bile salts by Escherichia coli.J. Bacteriol. 179, 2512–2518 (1997).

45. F. E. Rey, J. J. Faith, J. Bain, M. J. Muehlbauer, R. D. Stevens, C. B. Newgard, J. I. Gordon,Dissecting the in vivo metabolic potential of two human gut acetogens. J. Biol. Chem.285, 22082–22090 (2010).

46. J. J. Faith, N. P. McNulty, F. E. Rey, J. I. Gordon, Predicting a human gut microbiota’sresponse to diet in gnotobiotic mice. Science 333, 101–104 (2011).

47. N. P. McNulty, T. Yatsunenko, A. Hsiao, J. J. Faith, B. D. Muegge, A. L. Goodman,B. Henrissat, R. Oozeer, S. Cools-Portier, G. Gobert, C. Chervaux, D. Knights,C. A. Lozupone, R. Knight, A. E. Duncan, J. R. Bain, M. J. Muehlbauer, C. B. Newgard,A. C. Heath, J. I. Gordon, The impact of a consortium of fermented milk strains on the gutmicrobiome of gnotobiotic mice and monozygotic twins. Sci. Transl. Med. 3, 106ra106 (2011).

48. N. P. McNulty, M. Wu, A. R. Erickson, E. C. Martens, N. A. Pudlo, B. D. Muegge,B. Henrissat, R. L. Hettich, J. I. Gordon, Effects of diet on resource utilization by adefined model human gut microbiota containing Bacteroides cellulosilyticus WH2, asymbiont with an extensive glycobiome. PLOS Biol. 11, e1001637 (2013).

49. A. L. Goodman, G. Kallstrom, J. J. Faith, A. Reyes, A. Moore, G. Dantas, J. I. Gordon,Extensive personal human gut microbiota culture collections characterized andmanipulated in gnotobiotic mice. Proc. Natl. Acad. Sci. U.S.A. 108, 6252–6257 (2011).

50. J. G. Caporaso, J. Kuczynski, J. Stombaugh, K. Bittinger, F. D. Bushman, E. K. Costello,N. Fierer, A. G. Peña, J. K. Goodrich, J. I. Gordon, G. A. Huttley, S. T. Kelley, D. Knights,J. E. Koenig, R. E. Ley, C. A. Lozupone, D. McDonald, B. D. Muegge, M. Pirrung, J. Reeder,J. R. Sevinsky, P. J. Turnbaugh, W. A. Walters, J. Widmann, T. Yatsunenko, J. Zaneveld,R. Knight, QIIME allows analysis of high-throughput community sequencing data.Nat. Methods 7, 335–336 (2010).

51. R Development Core Team, R: A Language and Environment for Statistical Computing (RFoundation for Statistical Computing, 2015).

52. B. Langmead, C. Trapnell, M. Pop, S. L. Salzberg, Ultrafast and memory-efficient alignmentof short DNA sequences to the human genome. Genome Biol. 10, R25 (2009).

53. M. I. Love, W. Huber, S. Anders, Moderated estimation of fold change and dispersion forRNA-seq data with DESeq2. Genome Biol. 15, 550 (2014).

54. R. Overbeek, R. Olson, G. D. Pusch, G. J. Olsen, J. J. Davis, T. Disz, R. A. Edwards,S. Gerdes, B. Parrello, M. Shukla, V. Vonstein, A. R. Wattam, F. Xia, R. Stevens, The SEEDand the rapid annotation of microbial genomes using subsystems technology (RAST).Nucleic Acids Res. 42, D206–D214 (2013).

55. G. Yu, L.-G. Wang, Y. Han, Q.-Y. He, clusterProfiler: An R package for comparing biologicalthemes among gene clusters. OMICS 16, 284–287 (2012).

56. W. Luo, M. S. Friedman, K. Shedden, K. D. Hankenson, P. J. Woolf, GAGE: Generallyapplicable gene set enrichment for pathways analysis. BMC Bioinformatics 10, 161 (2009).

57. D. L. Tabb, C. G. Fernando, M. C. Chambers, MyriMatch: Highly accurate tandem massspectral peptide identification by multivariate hypergeometric analysis. J. Proteome Res.6, 654–661 (2007).

58. Z.-Q. Ma, S. Dasari, M. C. Chambers, M. D. Litton, S. M. Sobecki, L. J. Zimmerman,P. J. Halvey, B. Schilling, P. M. Drake, B. W. Gibson, D. L. Tabb, IDPicker 2.0: Improvedprotein assembly with high discrimination peptide information filtering. J. Proteome Res.8, 3872–3781 (2009).

59. Q. Xu, M. G. Resch, K. Podkaminer, S. Yang, J. O. Baker, B. S. Donohoe, C. Wilson,D. M. Klingeman, D. G. Olson, S. R. Decker, R. J. Giannone, R. L. Hettich, S. D. Brown, L. R. Lynd,E. A. Bayer, M. E. Himmel, Y. J. Bomble, Dramatic performance of Clostridium thermocellumexplained by its wide range of cellulose modalities. Sci. Adv. 2, e1501254 (2016).

60. T. Taverner, Y. V. Karpievitch, A. D. Polpitiya, J. N. Brown, A. R. Dabney, G. A. Anderson,R. D. Smith, DanteR: An extensible R-based tool for quantitative analysis of -omics data.Bioinformatics 28, 2404–2406 (2012).

61. P. S. Novichkov, D. A. Rodionov, E. D. Stavrovskaya, E. S. Novichkova, A. E. Kazakov,M. S. Gelfand, A. P. Arkin, A. A. Mironov, I. Dubchak, RegPredict: An integrated system for

16 of 17



Dow

n

regulon inference in prokaryotes by comparative genomics approach. Nucleic Acids Res.38, W299–W307 (2010).

62. D. A. Rodionov, Comparative genomic reconstruction of transcriptional regulatorynetworks in bacteria. Chem. Rev. 107, 3467–3497 (2007).

63. G. E. Crooks, G. Hon, J.-M. Chandonia, S. E. Brenner, WebLogo: A sequence logo generator.Genome Res. 14, 1188–1190 (2004).

64. E. Mossessova, C. D. Lima, Ulp1-SUMO crystal structure and genetic analysis revealconserved interactions and a regulatory element essential for cell growth in yeast.Mol. Cell 5, 865–876 (2000).

65. C. Chang, C. Tesar, X. Li, Y. Kim, D. A. Rodionov, A. Joachimiak, A novel transcriptionalregulator of L-arabinose utilization in human gut bacteria. Nucleic Acids Res. 43,10546–10559 (2015).

66. D. A. Ravcheev, X. Li, H. Latif, K. Zengler, S. A. Leyn, Y. D. Korostelev, A. E. Kazakov,P. S. Novichkov, A. L. Osterman, D. A. Rodionov, Transcriptional regulation of centralcarbon and energy metabolism in bacteria by redox-responsive repressor Rex. J. Bacteriol.194, 1145–1157 (2012).

Acknowledgments: We thank D. O’Donnell, M. Karlsson, and S. Wagoner for their assistancewith gnotobiotic mouse husbandry; B. Mickelson at Envigo for her guidance in designingexperimental diets; and A. Hsaio and E. Martens for providing suggestions and reagents forgenetic manipulation of B. vulgatus. Funding: This work was supported in part by a grant fromthe NIH (DK30292). D.A.R. was supported by the Russian Science Foundation (grant 14-14-00289). Author contributions: M.C.H., A.L.O., and J.I.G. designed the experiments.


Experiments were performed by M.C.H. (generation of gnotobiotic mouse model; COPRO-Seqand microbial RNA-seq analyses of microbial communities harvested from these mice; andgrowth, INSeq, MS, and pharmacologic studies of B. vulgatus and B. dorei in vitro), M.W.(construction of B. vulgatus INSeq library), D.A.R. and X.L. (expression and purification ofB. vulgatus and B. dorei AcrR expressed in E. coli and in vitro assays of AcrR binding to targetDNA), R.J.G. (MS-based proteomic studies), and J.C. (targeted MS of retinol in efflux assays).M.C.H., M.W., D.A.R., N.W.G., R.J.G., R.L.H., A.L.O., and J.I.G. analyzed the data. M.C.H., M.J.B,A.L.O., and J.I.G. wrote the paper. Competing interests: J.I.G. is a co-founder of Matatu Inc.,a company characterizing the role of diet-by-microbiota interactions in animal health. Theother authors declare that they have no competing interests. Data and materials availability:COPRO-Seq, microbial RNA-seq, and INSeq data sets have been deposited in the EuropeanNucleotide Archive (accession number PRJEB15673). All of the bacterial strains used in thiswork were purchased from American Type Culture Collection (ATCC) or Deutsche Sammlungvon Mikroorganismen und Zellkulturen GmbH (DSMZ).

Submitted 15 November 2016Accepted 14 March 2017Published 17 May 201710.1126/scitranslmed.aal4069

Citation: M. C. Hibberd, M. Wu, D. A. Rodionov, X. Li, J. Cheng, N. W. Griffin, M. J. Barratt,R. J. Giannone, R. L. Hettich, A. L. Osterman, J. I. Gordon, The effects of micronutrient deficiencieson bacterial species from the human gut microbiota. Sci. Transl. Med. 9, eaal4069 (2017).
loa
17 of 17


http://stm.sciencem

ag.org/ded from


microbiotaThe effects of micronutrient deficiencies on bacterial species from the human gut

Richard J. Giannone, Robert L. Hettich, Andrei L. Osterman and Jeffrey I. GordonMatthew C. Hibberd, Meng Wu, Dmitry A. Rodionov, Xiaoqing Li, Jiye Cheng, Nicholas W. Griffin, Michael J. Barratt,

DOI: 10.1126/scitranslmed.aal4069, eaal4069.9Sci Transl Med

the human host and the gut microbiota they possess.system. These results suggest that micronutrient imbalances should be considered from the perspective of both

fitness through the activity of the bacterial AcrAB-TolC effluxB. vulgatusindicated that retinol treatment affected vitamin A deficiency, exhibiting an increase in its abundance. Genetic, multi-omic, and pharmacologic analysesgrowth in gnotobiotic mouse models of postnatal human microbiota development, had the biggest response to

, a bacterial species positively correlated with hostBacteroides vulgatusbacterial community and gene expression. harboring bacterial strains common in the human gut. Vitamin A had the greatest effect on the structure of the

. compare the effects of acute dietary deficiency of vitamin A, folate, iron, or zinc in gnotobiotic miceet alHibberd Deficiencies in vitamins and minerals (micronutrients) are a global health challenge. In a new study,

A gut bacterial view of micronutrient deficiency

ARTICLE TOOLS http://stm.sciencemag.org/content/9/390/eaal4069

MATERIALSSUPPLEMENTARY http://stm.sciencemag.org/content/suppl/2017/05/15/9.390.eaal4069.DC1

CONTENTRELATED

http://stm.sciencemag.org/content/scitransmed/11/518/eaaw3680.fullhttp://stm.sciencemag.org/content/scitransmed/11/507/eaau9356.fullhttp://science.sciencemag.org/content/sci/356/6344/eaag2770.fullhttp://science.sciencemag.org/content/sci/362/6413/453.fullhttp://science.sciencemag.org/content/sci/360/6391/eaan5931.fullhttp://science.sciencemag.org/content/sci/360/6390/795.fullhttp://science.sciencemag.org/content/sci/359/6380/1156.fullhttp://science.sciencemag.org/content/sci/359/6380/1151.fullhttp://science.sciencemag.org/content/sci/357/6353/802.fullhttp://science.sciencemag.org/content/sci/357/6354/912.fullhttp://science.sciencemag.org/content/sci/357/6351/570.fullhttp://science.sciencemag.org/content/sci/359/6372/210.fullhttp://science.sciencemag.org/content/sci/358/6369/1390.fullhttp://science.sciencemag.org/content/sci/358/6361/eaan6619.fullhttp://science.sciencemag.org/contenthttp://science.sciencemag.org/content/sci/357/6353/754.fullhttp://science.sciencemag.org/content/sci/357/6353/806.fullhttp://science.sciencemag.org/content/sci/357/6351/548.fullhttp://science.sciencemag.org/content/sci/357/6346/39.full

Terms of ServiceUse of this article is subject to the

registered trademark of AAAS. is aScience Translational MedicineScience, 1200 New York Avenue NW, Washington, DC 20005. The title

(ISSN 1946-6242) is published by the American Association for the Advancement ofScience Translational Medicine

Copyright © 2017, American Association for the Advancement of Science


http://stm.sciencem

ag.org/D

ownloaded from

http://stm.sciencemag.org/content/9/390/eaal4069

http://stm.sciencemag.org/content/suppl/2017/05/15/9.390.eaal4069.DC1

http://science.sciencemag.org/content/sci/357/6346/39.full




http://science.sciencemag.org/content

http://science.sciencemag.org/content/sci/358/6361/eaan6619.full









http://science.sciencemag.org/content/sci/360/6391/eaan5931.full


http://science.sciencemag.org/content/sci/356/6344/eaag2770.full

http://stm.sciencemag.org/content/scitransmed/11/507/eaau9356.full

http://stm.sciencemag.org/content/scitransmed/11/518/eaaw3680.full

http://www.sciencemag.org/about/terms-service


REFERENCES

http://stm.sciencemag.org/content/9/390/eaal4069#BIBLThis article cites 63 articles, 25 of which you can access for free

PERMISSIONS http://www.sciencemag.org/help/reprints-and-permissions

Terms of ServiceUse of this article is subject to the

registered trademark of AAAS. is aScience Translational MedicineScience, 1200 New York Avenue NW, Washington, DC 20005. The title

(ISSN 1946-6242) is published by the American Association for the Advancement ofScience Translational Medicine

Copyright © 2017, American Association for the Advancement of Science


http://stm.sciencem

ag.org/D

ownloaded from

http://stm.sciencemag.org/content/9/390/eaal4069#BIBL

http://www.sciencemag.org/help/reprints-and-permissions

http://www.sciencemag.org/about/terms-service


The effects of micronutrient deficiencies on bacterial ... · of Medicine, St. Louis, MO 63110,...

Documents

Transcript of The effects of micronutrient deficiencies on bacterial ... · of Medicine, St. Louis, MO 63110,...