E L S E V I E R

Genetic Analysis: Biomolecular Engineering

13 (1996) 25-31 Blomolecular Engineering

The construction of novel mobilizable YAC plasmids and their behavior during trans-kingdom conjugation between bacteria and

yeasts

Arshad Mahmood, Tsuyoshi Kimura, Masanori Takenaka, Kazuo Yoshida*

Laboratory of Molecular Biology and Bioinformatics, Department of Biological Science, Faculty of Science, Hiroshima University, Higashi-Hiroshima 739, Japan

Received 10 October 1995; revised 29 February 1996; accepted 10 March 1996

Abstract

Trans-kingdom conjugation is an easy and efficient method for gene transfer from prokaryotes to eukaryotes since it does not require DNA extraction and purification. We constructed novel mobilizable plasmids pAY-YAC-B and pAY-YAC-E. The origin of conjugal transfer (oriT) was inserted at two different positions, pAY-YAC-B contains oriT region in between two telomeres whereas pAY-YAC-E has oriT at the cloning site of pYAC4. By conjugation, both plasmids were successfully transferred from E. coli to S. cerevisiae and S. kluyveri yeasts with the aid of helper plasmid pRH220 which harbors mob and tra genes. The plasmids were transferred more efficiently in S. cerevisiae compared to S. kluyveri. The analyses by restriction enzyme digestion and Southern hybridization indicated that both plasmids maintained their original structure and size in transconjugant yeasts, therefore, reflecting the faithful nicking and subsequent resealing of plasmids during conjugation. The comparison between conjugative transfer and transformation has also been performed and discussed.

Keywords: Trans-kingdom conjugation; Mobilizable YACs; Telomere

I. Introduction

Trans-kingdom conjugation has proven to be a useful and successful direct gene transfer system from prokaryotic bacteria to eukaryotic yeast. Recently, sev- eral studies have reported on conjugation between Es- cherichia coli and Saceharomyces cerevisiae [1-4] and conjugative transfer from E. coli to a fission yeast Schizosaccharomyces pombe [5]. More recently, Sawasaki et al. reported conjugation between Agrobac- terium tumefaciens and S. cerevisiae [6].

The mechanism of coniugative transfer of plasmid during trans-kingdom conjugation is not well known but it is probably similar to that of bacterial conjuga- tion. Among the bacterial conjugation, the conjugation

* Corresponding author.

1050-3862/96/$15.00 © 1996 Elsevier Science B.V. All rights reserved

PH S1050-3862(95)00146-5

system of IncFI plasmid has been most extensively studied [7-10]. According to the recent model of bacte- rial conjugation, the transfer process involves nicking of the duplex DNA at a particular site located in the origin of transfer (oriT) and subsequently, transfer of single strand of plasmid DNA heading 5' terminus into the recipient cell. Thereafter, the complementary DNA synthesis occurs both in donor and recipient cells. The proteins responsible for processing are encoded by con- jugative plasmid and after accomplishing successful transfer, it has been suggested that the same protein is involved in ligating the nicked ends, thus re-circulariz- ing the transferred DNA molecule in the recipient [11-13].

To investigate plasmid DNA processing during trans- kingdom conjugation, particularly, nicking and religa- tion, we constructed pAY-YACs mobilizable plasmids by inserting oriT fragment into pYAC4 [14] at two

26 A. Mahmood et al. / Genetic Analysis: Biomolecular Engineering 13 (1996) 25 31

different positions, between the telomeres (pAY-YAC- B) and into EeoRI cloning site (pAY-YAC-E). pAY- YAC-B is expected to be a linear form if after nicking it does not religate. Although conjugative transfer re- quires oriT, mob (mobilization) and tra (transfer) genes, the latter two genes are transacting, therefore, they are also functional even when present on a separate helper plasmid [12]. Both pAY-YACs plasmids were mobilized by a helper plasmid pRH220 from E. coli into S. cerevisiae and S. kluyveri. We also compared the con- jugative behavior of these plasmids with transformation using the same recipient yeast.

and transformants were selected on media lacking ei- ther uracil (SC-ura) or tryptophan (SC-trp).

2.2. Conjugation and transformation

The conjugation conditions were essentially the same as described elsewhere [2,3]. Phenotypical stability of yeast cells harboring pAY-YACs plasmids was exam- ined by the conventional replica method [15]. Transfor- mation of E. coli was carried out according to the rubidium chloride method [16]. Transformation of yeast was carried out by a modification of lithium acetate method [17] as described previously [2].

2. Materials and methods 2.3. Structural analyses and Southern hybridization

2. I. Strains and plasmids

All strains and plasmids are listed in Table 1. Bacte- ria were grown in Luria broth (LB) or Luria agar plates at 37°C. According to the requirement for selection, antibiotics were added at the following concentrations: ampicillin (Ap), 50 lag/ml; chloramphenicol (Cm), 30 ~tg/ml; and kanamycin (Km), 50 ~tg/ml. Yeast cells were cultured in YPD broth at 28°C. Yeast transconjugants

Table 1 Strains and plasmids

Strains and plasmids Relevent characteristics Reference

S. cerevisiae MATa trpl-Aura3-52 YGSC a ade2-1 lys2-801 his3-A200 LEU2

S. kluyveri Dl-15 MATa ura3 his [25]

E. coli HBI01 F- recAt3 pro rsPL200 [26]

Plasmids pGEM.7zf(+) lacZ' Ap r, multiple Promega

cloning sites pGEM.7zf(+)R lacZ' Ap r, modified This study

cloning sites pGEM.7zf( + )ori lacZ' Apr oriT This study pKT230 oriV-Q oriT-Q mob-Q [21]

Km r pYAC4 TRP1 ARS1 CEN4 [14]

SUP4 URA3 TEL, Apr pRH220 oriV-pSClO1 oriT-P b

mob-P tra-P, Cm r pAY-YAC-B pYAC4 containing This study

oriT in between telom- eres

pAY-YAC-E pYAC4 containing This study oriT at EcoRI site of SUP4 gene

ayGSC, Yeast Genetic Stock Center, Berkeley, CA. bprovided by Nishikawa M.

In order to recover transferred pAY-YACs, total DNA was extracted from yeast transconjugants accord- ing to the method of Suzuki and Yoshida [18]. Isolation of plasmids from E. coli and other standard techniques were performed according to Sambrook et al. [19].

Electrophoretically separated DNA was transferred onto nitrocellulose filter from agarose gel and hy- bridization was carried out according to Southern [20]. The blot was hybridized with 32p labelled probe of pBR322 PvuII and PstI small fragment. Hybridization was carried out at 60°C overnight (12-16 h) and wash- ing was as follows: 2 x SSC, 1% SDS for 10 min followed by 10 min wash with 0.5 x SSC, 1% SDS. The signal detection was performed with a Fuji image analyzer (BAS2000).

2.4. Construction of novel mobilizabIe pA Y- YACs

The construction strategy is shown in Fig. 1. After digesting with BamHI and EcoRI, linearized cloning vector pGEM-7zf( + ) was closed with a synthetic DNA containing multiple cloning sites and it has been named pGEM-7zf( + )R. Plasmid pKT230 [21] containing oriT (2.8 kb) region was then digested with EcoRV and cloned into pGEM-7zf(+)R. The resultant vector pGEM-7zf( + )oriT was digested either with BamHI or EcoRI and then oriT region was inserted into pYAC4 [14] at two different positions. As a result, the two new plasmids were constructed; pAY-YAC-B (12.4 kb) con- taining oriT in between two telomeres whereas pAY- YAC-E (14.2 kb) contains oriT at the cloning site (EcoRI) of pYAC4. The purpose of inserting oriT at two different specific positions was to investigate the nicking and resealing process during conjugative trans- fer. Particularly, if pAY-YAC-B does not religate then it can assume a linear form of artificial chromosome after degradation of remaining oriT region by exonucle- ases of host. Therefore, telomeres at both arms of the plasmid may lead to the linearization of plasmid.

A. Mahmood et al. / Genetic Analysis: Biomolecular Engineering 13 (1996) 25-31 27

~ ~ = = ~ .EcoR I lacZ ~ BamH I

;EM-7zf(+) I

~ EcoR I and BamH I digestion

~ ~ E c o R V

onT ~_ EcoR V

5 '

Custom DNA AATTCGGATCCGATATCGAATTCAA 3'

GC CTAG GCTATAGCTTAAGTT.CCTAG EcoR I BamH I EcoR V EcoR I BamH I

I ~ g a t i o n ~ . ~ oRV

Eco R V digestion and ligation

EcoR I

:n ti°n

BamH I

Fig. 1. Construction of pAY-YACs. Ap r and Km r, genes that confer resistance to ampicillin and kanamycin, respectively, oriT, origion of transfer; TEL, telomere sequence; CEN4, centromere 4; ARS1, autonomous replication sequence 1; TRP1, URA3 and HIS3, yeast marker genes for selection of tryptophan, uracil and histidine auxotrophy; SUP4, ocher-suppressing allele of tRNA tyr gene; B1, BamHI; El, EcoRI; EV, EcoRV.

28 A. Mahmood et al. / Genetic Analysis: Biomolecular Engineering 13 (1996) 25 31

3. Results and discussions

3.1. Transfer of p A Y - Y A C s from E. coli into yeasts

The transmission of mobilizable plasmid from E. coli to yeast requires cell to cell contact which eventually leads to the transfer of plasmid. However, the presence of helper plasmid carrying mob and tra genes is essen- tial for conjugative transfer. Table 2 shows the conjuga- tive transfer of pAY-YACs from E. coli to S. cerevisiae and S. kluyveri. It is evident that only helper plasmid could mediate the transfer of mobilizable pAY-YACs plasmids whereas in the absence of helper conjugative transfer did not occur. The frequency of transconju- gants yeild, calculated as colony per recipient, was 4.4 x 10 - 6 and 2.3 x 10 6 for pAY-YAC-B and pAY-

YAC-E respectively, when S. cerevisiae was used as a recipient. Whereas, when S. kluyveri was used as recip- ient, the conjugal frequency dropped to 2.4 x 10 7 and 2.2 x 10 -7 for pAY-YAC-B and pAY-YAC-E, respectively. In both S. cerevisiae and S. kluyveri, these results suggest that tra and mob genes on helper plas- mid had played an important role in conjugal transfer of pAY-YACs. In bacterial conjugation, the products of mob are responsible for specific single strand nicking at oriT and then both mob and tra genes products carry out transfer of the nicked strand into recipient cell [12,13]. The variation in conjugal frequencies in both recipients may be due to the fact that both recipients are relatively distant species [22] and ARS1 derived from S. cerevisiae is, although functional in S. kluyveri, not as strong as in S. cerevisiae. Moreover, transfer frequencies were higher when mating was performed on nitrocellulose filter for about 12 h at a donor:helper:recipient ratio of 1:1:1.

Table 2 Conjugative transfer of pAY-YACs from E. coli into S. cerevisiae and S. kluyveri yeasts

No. Crosses

Donor Helper Recipient

Colonies per recipient

E. coli x S. cerevisiae 1. HB101(pAY-YAC-B) x 4.4 x 10 -6

HB101(pRH220) x YNN281 2 HB101(pAY-YAC-E) x 2.3 X 1 0 - 6

HB101(pRH220) x YNN281 E. coli × S. kluyveri 3. HB101(pAY-YAC-B) x 2.4 × 10 7

HB101(pRH220) x DI 15 4. HB101(pAY-YAC-E) x 2.2 x 10 7

HB101(pRH220) × D l - 1 5

Transconjugants were selected on SC-ura. Plasmid's name is given in brackets. No transconjugant was detected in absence of helper plasmid (<10 9).

! ~ i i ¸

2"8 k b

M 1 2 3 4 5 6 7 8

9-6 kb

iii(/

Fig. 2. The restriction map and Southern analyses of plasmid DNA recovered from four S. eerevisiae YNN281 transconjugants (TCB 1001 1004) induced by pAY-YAC-B. The D N A s were digested with BamHI and separated by agarose gel electrophoresis (Lanes 1-4). Lanes 5 8 show the Southern blot which was hybridized with 32p labelled PstI-PvuII small fragment of pBR322. M, lambda DNA digested with HindIII.

3.2. Analyses of pA Y-YACs yeast transconjugants

Transconjugants were initially selected on SC-ura plates and subsequently transferred onto SC-trp plates to make sure that transmitted plasmids had both yeast markers genes. However, in the case of S. kluyveri, only SC-ura selection was performed.

The phenotypic stability of transconjugants harbor- ing pAY-YACs was investigated by conventional replica method [15]. The curing results indicated that almost all transconjugants had tendency to lose their plasmid at a slow rate under non-selective conditions. The conjugal transfer is not directly involved in ho- mologous recombination. As both plasmids and host chromosomes have homologous sequences, recombina- tion causes uncurable transconjugants [3] but not by the mitotic stability of the plasmids.

For further analyses, DNA was extracted from six to eight independent transconjugants. The transmitted plasmids were rescued upon back transformation into E. coli. The plasmids recovered from S. cerevisiae transconjugants maintained their original structure and size, pAY-YAC-B 12.4 kb and pAY-YAC-E 14.2 kb, as confirmed by the restriction enzyme digestion and Southern hybridization (Figs. 2 and 3). The presence of pAY-YAC-B as a linear plasmid was not detected. Since a linear plasmid cannot, or very poorly, replicate in E. coli, so pAY-YAC-B as a linear form cannot back-transform E. coli succesfully. Moreover, all the studied yeast transconjugants were able to transform E. coli. These results suggest that nicking and resealing of plasmid during conjugal transfer are very specific events. Therefore, the fundamental mechanism of trans-

A. Mahmood et al. / Genetic Analysis: Biomolecular Engineering 13 (1996) 25-31 29

kingdom conjugation seems to follow the similar course as in bacterial conjugation. Despite these similarities, the question "what is the nature of the DNA transport bridge in bacteria-bacteria and bacteria-yeast conjuga- tion?" is yet to be answered. Further, a bacterial conju- gation model alone does not explain how the plasmid crosses the yeast cell wail, cell membrane and nuclear envolpe. One possibility is that the yeast nucleus may be fused with the bacterial cell wall. During bacterial conjugation, it has been suggested that the religation takes place in the conjugation pore [12]. However, how does the religating protein(s) determine exactly a unit length of transferred plasmid? If this process is not specific then quite obviously the transmitted plasmids could be of different lengths or sizes.

Similarly, the genornic DNA from S. kluyveri transconjugants was used to recover transmitted plas- mids after back transfo~aation into E. coli. The recov- ered plasmids were digested with restriction enzymes and then subjected to Southern hybridization. Fig. 4 shows that transmitted plasmids maintained their origi- nal size, pAY-YAC-B (12.4 kb) and pAY-YAC-E (14.2 kb). Previously, it has been shown that the transmitted plasmids in S. kluyveri had undergone structural change during trans-kingdom conjugation [23]. The major dif- ference in the components of pAY-YACs plasmids were telomeres. Therefore, one plausible explanation of this integrity of pAY-YACs in S. kluyveri may be telomeres. It has been reported that telomeres derived Tetrahy- mena rDNA termini also function as ARS in yeast [24]. As pAY-YACs plasmids has S. cerevisiae ARS1 but

1 2 31 4 5 6 7 8

8 .7 k b

4 .7 k b

0.7 kb

m w . ~ m

Fig. 3. The restriction enzyme digestion and Southern analyses of pAY-YAC-E plasmids recow,'red from S. cerevisiae YNN281 transconjugants (TCE 2001-2004)• DNA were digested with BgllI and subjected to agarose gel electophoresis (Lanes 1-4). Lanes 5-8 show the Southern blot.

kb

23.1 9"4 6"5 4.3

2.3 2.0

0 . 5

o ~ 1 1.1 , q . ¢ l ~ . ~ ~ 0 ~ , ~ , q .

L • . . . . '.

' " . , , ' . ] . . , ,

• , , . . , ,

Fig. 4. The restriction enzyme digestion and Southern analyses of pAY-YAC-s plasmids recovered from S. kluyveri Dl-15 transconju- gants (TCB 9001-9008 and TCE 9050-9053). The recovered pAY- YAC-B (Lanes 1-8) and pAY-YAC-E (Lanes 9-12)• Plasmids were digested with BgllI. Lanes 13-20 (pAY-YAC-B) and lanes 21 24 (pAY-YAC-E) show the Southern blot. M, marker lambda DNA digested with HindlII.

lack S. kluyveri ARS, therefore, it could be possible that telomeres together with ARS1 provided strong enough ARS activity in S. kluyveri and thus enabled the plasmid to replicate.

3.3. Transformation of pA Y-YACs into S. cerevisiae

The pAY-YACs can also be introduced into yeast by conventional transformation like other yeast plasmids. Generally, pYACs are introduced into yeasts as linear yeast artificial chromosome containing large fragments of exogeneous DNA [14]. Although the mechanism of conjugation is different from transformation, for better understanding of the integrity of these mobilizable plas- mids, the pAY-YACs were introduced both as linear and circular form into S. cerevisiae. Although the accu- rate comparison is difficult, the transformation effi- ciency per cell was higher than conjugal frequency per cell (see Table 2, and Table 3). To ascertain the struc- tural stability of the newly constructed plasmids in the yeast cell, the plasmids were recovered via back-trans- formation against E. coli. Analysis by restriction en- zymes and Southern hybridization showed that the recovered pAY-YACs retained their original size, pAY- YAC-B 12.4 kb and pAY-YAC-E 14.2 kb, and struc- ture (see Fig. 5). However, when pAY-YAC-B plasmid that was digested with BamHI, but not treated with alkaline phosphatase, was introduced into yeast by transformation, we found only the circular plasmid without oriT (designated pAY-YAC-B1). This indicates that they are maintained as circular plasmids. Although they have inverted repeat of TEL sequences, their struc- tural stability has been assured in yeast cells. It is important, for this type of circularization, to preserve the Bam HI site between two closed inverted repeats of TEL sequence. This indicates that pAY-YAC-B 1 is also structurally stable in yeast cells.

30 A. Mahmood et al. / Genetic Analysis: Biomolecular Engineering 13 (1996) 25-31

Table 3 Transformation of S. cerevisiae by pAY-YACs

No. Plasmid DNA Competent yeast cells Transformation frequency per ~tg Colonies per competent cell

1. pAY-YAC-B YNN281 0.41 x 103 2.01 × 10 -5 2. pAY-YAC-E YNN281 0.25 x 103 1.14 x 10 -5 3. pAY-YAC-B (BamHI digested) YNN281 0.12 x 103 0.52 x 10 5 4. No DNA YNN281 ND ND

Transformants were selected on SC-ura. ND, not detected (< 10-8).

kb

2 3 . 1 9.4 6 .5 4 ' 3

2-3 2 .0

0 . 5

Fig. 5. The restriction map and Southern hybridization of plasmids recovered from S. cerevisiae YNN281 transformants. The recovered pAY-YAC-B (Lanes 1-4) and pAY-YAC-B digested with BamHI (Lanes 5-8). Plasmids DNAs were digested with BamHI. Lanes 9-12 show the pAY-YAC-E plasmids digested with BgllI. Lanes 13-16 (pAY-YAC-B) and lanes 17-20 (pAY-YAC-B digested with BamHI) show the Southern blotting of recovered plasmids. Lanes 21-24 show the Southern blot of pAY-YAC-E plasmid DNAs recovered from transformants and digested with BgllI. M, lambda DNA digested with Hindlll as a marker.

T h e p re sen t s tudy p r o v i d e d an ins igh t in to the f u n d a -

m e n t a l m e c h a n i s m o f t r a n s - k i n g d o m c o n j u g a t i o n , pa r -

t icular ly , n i ck ing a n d r e l i ga t i on processes . H o w e v e r , the

f u n d a m e n t a l q u e s t i o n as to the exac t m e c h a n i s m o f

c o n j u g a t i v e t r ans fe r f r o m p r o k a r y o t e s to e u k a r y o t e s

a n d the ab i l i ty o f Te t rahymena t e l o m e r e s to f u n c t i o n in

yeas t r equ i r e m e t i c u l o u s s tudy.

Acknowledgements

A. M a h m o o d du ly a c k n o w l e d g e s the M i n i s t r y o f

E d u c a t i o n , Science a n d C u l t u r e ( M o n b u s h o ) G o v t . o f

J a p a n fo r a w a r d i n g cu l tu ra l s cho la r sh ip fo r h ighe r

s tudies a n d M. N i s h i k a w a fo r he lp fu l d iscuss ions . Th i s s tudy was also s u p p o r t e d in p a r t by a g r a n t f r o m

M i n i s t r y o f E d u c a t i o n , Science a n d Cu l tu re , J a p a n to

K . Y .

References

[1] Heinemann JA, Sprague GFJ. Bacterial conjugative plasmids mobilize DNA transfer between bacteria and yeast. Nature 1989; 340:205 209.

[2] Nishikawa M, Suzuki K, Yoshida K. Structural and functional stability of IncP plasmids during stepwise transmission by trans- kingdom mating: promiscuous conjugation of Escherichia coli and Saccharomyces cerevisiae. Jpn J Genet 1990; 65: 323-334.

[3] Nishikawa M, Suzuki K, Yoshida K. DNA integration into recipient yeast chromosomes by trans-kingdom conjugation be- tween Escherichia coli and Saccharomyces cerevisiae. Curr Genet 1992; 21: 101-108.

[4] Nishikawa M, Inomata K, Sekito T, Suzuki K, Yoshida K. Trans-kingdom conjugation as a symbiotic plasmid transfer be- tween bacteria and yeast. In Sato S, Ishida M and Ishikawa H (eds.) Endocytobiology V. Tubingen, Germany: Tubingen Uni- versity Press, 1993; 537-544.

[5] Sirkorski RS, Michaud W, Levin HL, Boeke JD, Hieter P. Trans-kingdom promiscuity. Nature 1990; 345: 581-582.

[6] Sawasaki Y, Inomata K, Yoshida K. Trans-kingdom conjuga- tion between Agrobacterium tumefaciens and Saccharomyces cerevisiae, a Bacterium and a Yeast. Plant Cell Physiol 1996; 37: 103-106.

[7] Frost LS, Ippen-Ihler K, Skurray RA. Analysis of the sequence and gene products of the transfer regon of the F sex factor. Microbiol Rev 1994; 58: 162-210.

[8] Ippen-Ihler K, Minkley EG. The conjugation system of F, the fertility factor of Escherichia coli. Annu Rev Genet 1986; 20: 593-624.

[9] Willets NS, Wilkins B. Processing of plasmid DNA during bacterial conjugation. Micribiol Rev 1984; 48: 24-41.

[10] Willets NS, Skurray R. Structure and function of the F factor and mechanism of conjugation. In Neidhardt FC, Ingraham JL, Low KB, Magasanik M, Schaechter M and Umbarger HE (eds.), Escherichia coli and Salmonelia typhimurium. Vol. 2 Washington, DC: American Society for Microbiology, 1987; 1110-1133.

[11] Bhattacharjee MK, Meyer RJ. A segment of a plasmid gene required for conjugal transfer encodes a site-specific, single- strand DNA endonuclease and ligase. Nucleic Acids Res 1991; 19: 1129-1137.

[12] Clewell DB. Bacterial conjugation. New York: 1993; Plenum Press.

[13] Sherman JA, Matson SW. Escherichia coli DNA helicase I catalyzes a sequence specific cleavage/ligation reaction at the F plasmid origin of transfer. J Biol Chem 1994; 269: 26220-26226.

[14] Burke DT, Carle GF, Olson MV. Cloning of large segments of exogenous DNA into yeast by means of artificial chromosome vectors. Science 1987; 236: 806-812.

[15] Sherman F, Fink GR, Hicks JB. Methods in yeast genetics. Cold Spring Harbor, NY: Cold Spring Harbor Laboratry, 1983.

[16] Hanahan D. Techniques for transformation of E. coli. In Glover E (ed.) DNA cloning. Vol. 1. Oxford: IRL Press, 1989; 109-135.

A. Mahmood et al. / Genetic Analysis: Biomolecular Engineering 13 (1996) 25-31 31

[17] Ito H, Fukuda Y, Murata K, Kimura A. Transformation of intact yeast cells treated with alkali cations. J Bacteriol 1983; 153: 163-168.

[18] Suzuki K, Yoshida K. Plant Cell Physiol. Stepwise transforma- tion in Saccharomyces cerevisiae yeast: construction of strains for transformation and subsecluent cytoductive transfer of plasmid DNA with mitochondria. 1986; 27: 801-808.

[19] Sambrook J, Fritsch EF, Maniatis T. Molecular cloning: a laboratory mannual. 2nd ed. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory, 1989.

[20] Southern EM. Detection of specific sequences among DNA fragments separated by gel electrophoresis. J Mol Biol 1975; 98: 503-517.

[21] Bagdasarian M, Lurz R, Rackert B, Franklin FCH, Bagdasarian MM, Frey J, Timmis KN. Specific purpose plasmid cloning vectors: broad host range, high copy number, RSF1010 derived vectors and a host-vector system for gene cloning in Pseu- domonas. Gene 1981; 16: 237-247.

[22] Okamoto K, Suzuki K, Yoshida K. Physical mapping and RFLP analysis of MtDNAs from the ascosporogeneous yeasts: Saccharomyces exiguus, Saccharomyces kluveri and Hansenula wingei. Jpn J Genet 1991; 66: 709-718.

[23] Inomata K, Nishikawa M, Yoshida K. The yeast Saccaromyces kluveri as a recipient eukaryote in trans-kingdom conjugation: Behavior of transmitted plasmids in transconjugants. J Bacteriol 1994; 176: 4770-4773.

[24] Kiss GB, Amin AA, Perlman RE. Two separated regions of extra-chromosomal ribosomal DNA of Tetrahymena thermophila enable autonomous replication of plasmids in S. cerevisiae. Mol Cell Biol 1981; 1: 535-543.

[25] Fujimura H. Transformation of yeast Saceharomyces kluveri by Saccharomyces cerevisiae-based plasmids. FEMS Microbiol Lett 1991; 82:149 152.

[26] Boyer HW, RouUand-Dussoix D. A complementation analysis of the restriction and modification of DNA in Escheriehia coli. J Mol Biol 1969; 41: 459-472.