University of Veterinary Medicine Hannover

Department of Physiological Chemistry

The concerted action of multiple post-translational

events regulates the trafficking and function of wild

type and mutant disaccharidases

INAUGURAL DOCTORAL THESIS

in partial fulfillment of the requirements of the degree of Doctor

of Natural Sciences

-Doctor rerum naturalium-

(Dr. rer. nat.)

submitted by

Lena Diekmann, M.Sc.

Bünde, Germany

Hannover 2016

Supervisor: Prof. Dr. phil. nat. Hassan Y. Naim

Department of Physiological Chemistry

Institute for Biochemistry

University of Veterinary Medicine Hannover, Germany

Supervision group: Prof. Dr. phil. nat. Hassan Y. Naim

Department of Physiological Chemistry

Institute for Biochemistry

University of Veterinary Medicine Hannover, Germany

Prof. Dr. rer. nat. Georg Herrler

Department of Infectious Diseases

Institute of Virology

University of Veterinary Medicine Hannover, Germany

1st Evaluation: Prof. Dr. phil. nat. Hassan Y. Naim

Department of Physiological Chemistry

Institute for Biochemistry

University of Veterinary Medicine Hannover, Germany

2nd Evaluation: Prof. Dr. rer. nat. Rita Gerardy-Schahn

Institute for Cellular Chemistry

Hannover Medical School, Germany

Date of the final exam: 19.04.2016

Dedicated to

my family

Table of contents I

Table of contents

Table of contents ....................................................................................................... I

List of publications .................................................................................................. III

Abbreviations ........................................................................................................... IV

List of tables ........................................................................................................... VII

List of figures .......................................................................................................... VII

Abstract .................................................................................................................. VIII

Zusammenfassung ................................................................................................... X

Introduction ............................................................................................................... 1

Types of lactase deficiencies .................................................................................. 2

Symptoms of lactose intolerance and secondary associated disorders .......................... 7

Diagnosis of lactose malabsorption and lactose intolerance ........................................... 8

Treatment of lactose intolerance in infants, children and adults .....................................10

Lactase-phlorizin hydrolase (LPH) ........................................................................ 10

Biosynthesis and intracellular processing ......................................................................12

Polarized sorting ...........................................................................................................14

Protein modifications, folding and quality control in the ER ................................... 15

Aim of the dissertation ........................................................................................... 22

Publications ............................................................................................................ 23

Congenital lactose intolerance is triggered by severe mutations on both alleles of

the lactase gene .................................................................................................... 25

The Diverse Forms of Lactose Intolerance and the Putative Linkage to Several

Cancers ................................................................................................................. 27

Structural Determinants for transport of a multi-domain membrane glycoprotein in

the early secretory pathway .................................................................................. 28

II Table of contents

Discussion .............................................................................................................. 66

Difficulties in the diagnosis and possible molecular causes of the low lactase

activity in CLD patients .......................................................................................... 66

Identification and molecular analysis of two novel mutations of the LCT gene

causing CLD .......................................................................................................... 68

Characterization and implication of the subdomains of LPH, a multi-domain protein,

on its function and folding ...................................................................................... 74

Conclusion .............................................................................................................. 79

References .............................................................................................................. 80

Acknowledgements .............................................................................................. 106

Eidesstattliche Erklärung ..................................................................................... 107

List of publications III

List of publications

Parts of this thesis were already published/are under revision

Diekmann L., Pfeiffer K., and Naim H. Y., Congenital lactose intolerance is triggered

by severe mutations on both alleles of the lactase gene. BMC Gastroenterol. 2015

Mar 21;15:36. DOI: 10.1186/s12876-015-0261-y.

Amiri M.*, Diekmann L.*, von Köckritz-Blickwede M. and Naim H. Y., The Diverse

Forms of Lactose Intolerance and the Putative Linkage to Several Cancers.

Nutrients. 2015 Aug 28;7(9):7209-30. DOI: 10.3390/nu7095332.

Diekmann L.*, Behrendt M.*, Amiri M. and Naim H. Y., Structural determinants for

transport of a multi-domain membrane glycoprotein in the early secretory pathway, J

Biol Chem., under revision

Publication (not relevant for this thesis)

Maria Henström*, Lena Diekmann*, … , Hassan Y. Naim° Mauro and D’Amato°,

Functional variants in the sucrase-isomaltase gene associate with increased risk of

irritable bowel syndrome, NEJM, in progress

*° Authors contributed equally

Conference contributions regarding this thesis

Lena Diekmann, Katrin Pfeiffer, and Hassan Naim, Compound heterozygous

mutations elicit congenital lactase deficiency in a Japanese infant, FASEB J April

2015 29:596.5

IV Abbreviations

Abbreviations

ATH adult type of hypolactasia

ATP adenosine triphosphate

BiP binding immunoglobulin protein

bp base pairs

BSA bovine serum albumin

°C degree Celsius

cDNA complementary DNA

CLD congenital lactase deficiency

CNX calnexin

COS-1 african green monkey kidney fibroblast-like cells

CRT calreticulin

CSID ongenital sucrase-isomaltase deficiency

DEAE diethyle-amino-ethyle

del deletion

DMEM Dulbecco´s modified Eagle Medium

DNA desoxyribonucleid acid

DTT dithiothreitol

e.g. (exempli gratia) for example

EDEM ER degradation-enhancing α-mannosidase-like protein

endo H endo-β-N-acetylglucosaminidase H

ER endoplasmic reticulum

ERAD ER-associated degradation

et al. et alii (and others)

FCS fetal calf serum

fs frameshift

x g acceleration of gravity

GABA γ-aminobutyric acid

GH glycoside hydrolase

GlcNAc N-acetylglucosamine

GPI glycosylphosphatidylinositol

Abbreviations V

h hour/hours

Hsp70 heat shock protein 70

IBS irritable bowel syndrome

IP immunoprecipitation

kbp kilobase pair

kDa kilo Dalton

KLD Kongenitale Laktase Defizienz

LCT lactase gene

LPH lactase-phlorizin hydrolase

m milli (10-3)

M molar mass

µ micro (10-6)

mAbs monoclonal antibodies

MEM methionine-free minimum essential medium

MGAM maltase-glucoamylase

min minute/minutes

mRNA messenger RNA

NMD nonsense-mediated mRNA decay

PDI protein disulfide isomerase

PNGase F peptide-N-Glycosidase F

RNA ribonucleic acid

RT room temperature

SDS sodium dodecyl sulfate

SERCA sarco(endo)plasmic reticulum Ca2+ ATPase

SI sucrase-isomaltase

SDS-PAGE sodium dodecylsulfate-polyacrylamide gel electrophoresis

sec seconds

SGLT1 sodium/glucose co-transporter 1

SNPs single nucleotide polymorphisms

TEMED tetramethylethylenediamine

TGN trans-Golgi network

VI Abbreviations

TRIS Tris(hydroxymethyl)aminomethan

UGGT UDP-glucose:glycoprotein glucosyltransferase

UPF1 up-frameshift protein 1

UPR unfolded protein response

w/v weight/volume

X stop codon

Amino acid Three letter code One letter code

alanine ala A

arginine arg R

asparagine asn N

aspartic acid asp D

asparagine or aspartic acid asx B

cysteine cys C

glutamic acid glu E

glutamine gln Q

glutamine or glutamic acid glx Z

glycine gly G

histidine his H

isoleucine ile I

leucine leu L

lysine lys K

methionine met M

phenylalanine phe F

proline pro P

serine ser S

threonine thr T

tryptophan trp W

tyrosine tyr Y

valine val V

List of tables VII

List of tables

Table 1: Different types of lactase deficiencies ........................................................... 3

Table 2: Reported CLD patients with mutations in the LCT gene ............................... 6

List of figures

Figure 1: Maturation steps of LPH in the intestinal epithelial cells. ........................... 14

Figure 2: Structure of the N-linked core glycan. ........................................................ 17

Figure 3: Quality control of newly synthesized proteins in the endoplasmic reticulum.

................................................................................................................................. 19

Figure 4: Potential requirements for heterodimerization of LPH wild type with a

pathogenic mutant. ................................................................................................... 73

VIII Abstract

Abstract

Lena Diekmann

The concerted action of multiple post-translational events regulates the

trafficking and function of wild type and mutant disaccharidases

Lactose is the main carbohydrate of mammalian milk. For its uptake into the cell

previous hydrolysis into the monosaccharides glucose and galactose is required,

which is mediated by lactase-phlorizin hydrolase (LPH). LPH, the only β-

galactosidase of the brush border membrane in the small intestine, is a membrane

glycoprotein, which is post-translationally modified along the secretory pathway by N-

and O-glycosylation, dimerization and proteolytic cleavage steps.

Defects of intestinal lactose digestion due to insufficient lactase activity result in

gastrointestinal symptoms characteristic for lactose intolerance. Congenital lactase

deficiency (CLD) is the severe form of lactose intolerance, which is caused by

mutations in the coding region of the LPH gene.

The first part of this thesis investigated two novel mutations in the gene of LPH,

which were detected in a Japanese infant in a compound heterozygous inheritance

pattern. The influence of both mutations, Y1473X and D1796fs, on the structure,

biosynthesis and function of LPH was assessed by transient expression in COS-1

cells. Both mutants are mannose-rich N-glycosylated, misfolded and enzymatically

inactive proteins, which are retained in the endoplasmic reticulum (ER). Interestingly,

none of those anchorless pathogenic mutant forms undergo heterodimer formation

with the wild type, concluding that the transmembrane domain might be one

requirement for heterodimerization of LPH.

The second part of this thesis elucidated structural determinants of the multi-domain

membrane glycoprotein LPH for its transport and maturation along the secretory

pathway. By utilizing deletion variants, the role of the stretch region in domain II of

the ectodomain was determined as an important structural element. A possible

interaction of a potential N-glycosylation site in this stretch region with the ER-

resident chaperone calnexin (CNX) was confirmed by co-immunoprecipitation. The

constructs containing the stretch in domain II show an increased interaction with

CNX. The biochemical analyses of those constructs offered that domain I and III of

Abstract IX

the ectodomain of LPH act as intramolecular chaperones, while domain II and IV are

not essential for transport competence.

Taken together, the present thesis provides insights into the pathophysiology of CLD

causing LPH mutations and complements the knowledge of the structural

determinants for post-translational events of the multi-domain glycoprotein LPH.

X Zusammenfassung

Zusammenfassung

Lena Diekmann

Das Zusammenspiel von verschiedenen post-translationalen Ereignissen

reguliert den Transport und die Funktion von Wildtyp und Mutanten

Disaccharidasen

Laktose ist das häufigste Kohlenhydrat in der Milch von Säugetieren. Für die

Aufnahme in das Zellinnere ist eine vorherige Hydrolyse von Laktose in die

Monosaccharide Glukose und Galaktose notwendig, welche durch das Enzym

Laktase-Phlorizin Hydrolase (LPH) katalysiert wird. LPH ist die einzige β-

Galaktosidase der Bürstensaummembran im Dünndarm und gehört zur Proteinklasse

der membranständigen Glykoproteine. Während des Transports entlang des

sekretorischen Weges innerhalb der Zelle wird LPH post-translational durch N- und

O-Glykosylierung, Dimerisierung und proteolytische Spaltungsprozesse modifiziert.

Defekte im intestinalen Laktoseverdau, die durch unzureichende Laktase-Aktivität

ausgelöst werden, führen zu gastrointestinalen Symptomen, welche charakteristisch

für eine Lactoseintoleranz sind. Kongenitale Laktase Defizienz (KLD) ist die

schwerwiegendste Form von Laktoseintoleranz und wird durch Mutationen in der

kodierenden Sequenz des LPH Gens ausgelöst.

Im ersten Teil der vorliegenden Arbeit wurden zwei neue Mutationen im Gen von

LPH untersucht, welche in einem kombinierten heterozygoten Vererbungsmuster bei

einem japanischen Säugling entdeckt wurden. Der Einfluss von beiden Mutationen,

Y1473X und D1796fs, auf die Struktur, die Biosynthese und die Funktion von LPH

wurde mittels transienter Expression in COS-1 Zellen analysiert. Beide mutierten

Proteine sind mannosereich N-glykosyliert, falsch gefaltet, enzymatisch inaktiv und

werden im endoplasmatischen Retikulum (ER) zurückgehalten. Interessanterweise

interagiert keines der mutierten Proteine mit dem Wildtyp-Protein. Daher kommt es

nicht zur Bildung von Heterodimeren. Daraus lässt sich schließen, dass die

Transmembrandomäne, welche bei beiden Mutanten fehlt, eine notwendige

Voraussetzung für die Heterodimerisierung von LPH-Proteinen im ER darstellen

könnte.

Zusammenfassung XI

Im zweiten Teil der These wurden die strukturellen Determinanten, die für den

Transport und die Reifung von LPH entlang des sekretorischen Weges in der Zelle

wichtig sind, detaillierter untersucht. Durch Deletionsmutanten konnte gezeigt

werden, dass die Stretchregion in Domäne II der Ektodomäne ein wichtiges

Strukturelement darstellt. Eine mögliche Interaktion mit dem ER-ständigen Chaperon

Calnexin (CXN) durch die N-Glykosylierungssequenz in exakt dieser Stretchregion

konnte durch ein Co-Immunpräzipitationsexperiment (IP) bewiesen werden. Die

eingesetzten Konstrukte, welche die Stretchregion in Domäne II enthalten, zeigten

eine verstärkte Interaktion mit Calnexin (CXN). Mit Hilfe dieser verschiedenen

Konstrukte konnte des Weiteren gezeigt werden, dass Domäne I und III der

Ektodomäne von LPH als intramolekulare Chaperone dienen, während Domäne II

und IV keine essentielle Rolle für die Transportkompetenz aufweisen.

Die vorliegende Arbeit bietet fundamentale Einblicke in die Pathophysiologie von

Mutationen im Gen von LPH, die KLD verursachen und komplementiert das Wissen

über strukturelle Determinanten, die wichtig sind für post-translationale Ereignisse

des Multidomänen-Glykoproteins LPH.

Introduction 1

Introduction

The primary distinguishing characteristic of the class Mammalia, to which humans

belong, is the presence of the mammary glands on females, in order to secrete milk

and nurse the offspring. Milk is composed of lactose, fat, proteins and crucial

electrolytes (Brussow, 2013). In mammalian milk, the lactose concentration is 7.2

mg/100 ml, whereas cow´s milk only contains 4.7 mg/100 ml (Solomons, 2002). Dairy

products made out of milk, like butter, yoghurt, cheeses and sour cream, contain

lower amounts of lactose due to its manufacturing process. Nowadays lactose is also

used as a commercial food additive, which is found in foods like processed meats,

margarines, sliced bread, breakfast cereals, potato chips, medications or protein

supplements. Lactose is the main energy source for infants and provides almost half

of their total energy supply (Vesa et al., 2000). Despite this important role, lactose

may enhance divalent cation uptake in the intestine, like calcium, and functions as an

immune-stimulant through its role as a substrate for the gut microbiome (Kwak, 2012;

Venema, 2012; Savaiano, 2014). Lactose also shows direct cellular effects on the

generation of antimicrobial peptides (AMP) such as cathelicidins (Cederlund et al.,

2013).

Lactose is a disaccharide that is formed in the mammary glands from the

monosaccharides glucose and galactose by the action of lactase synthase (Kuhn and

White, 2009). Glucose is the key source of energy for the human body. Through

glycolysis or later in the reactions of the citric acid cycle or oxidative phosphorylation,

glucose is needed to generate ATP. The availability of glucose also influences

physiological processes by providing almost all energy for the brain (Pramoud, 1997).

In eukaryotes, Galactose plays an important role in the biosynthesis of glycoproteins,

glycolipids and complex carbohydrates (Varki et al., 2009). Due to its conversion to

N-acetylgalactosamine, galactose is also used for the formation of gangliosides,

which play a central role in the immunity and signal transduction (Wang and Brand-

Miller, 2003).

2 Introduction

In order to digest and absorb lactose from the digestive system, it must be

hydrolyzed by a β-D-galactosidase located at the enterocytes of the small intestine

(Hauri et al., 1985; Naim et al., 1987). This β-galactosidase, called lactase-phlorizin

hydrolase (LPH, EC 3.2.1.23/108/62), belongs to the class of disaccharidases, which

are all located at the brush border membrane of enterocytes in the small intestine

(Naim et al., 1987; Naim et al., 1988; Naim et al., 1988). LPH is responsible for the

hydrolysis of lactose and the cleavage of glycosylceramides (Leese and Semenza,

1973; Semenza, 1986; Zecca et al., 1998). Besides the β-galactosidase, the two α-

glucosidases sucrase-isomaltase (SI) and maltase-glucoamylase (MGAM) are

required for the final hydrolysis of di- and oligosaccharides. While MGAM essentially

cleaves maltose, SI is responsible for the breakdown of the disaccharides sucrose,

isomaltose and partially maltose (Sim et al., 2010). The activities of the

disaccharidases are not equally distributed along the small intestine. LPH and SI

exhibit their highest activities in the proximal intestine, while MGAM reaches its

maximal activity in the ileum (Triadou et al., 1983). The area of the small intestine of

an adult human is 30 m2 (Helander and Fandriks, 2014). It is build up by microvilli

which lead to an increase in the cell surface to fulfill its function by absorbing the

digestive products into the blood stream. The hydrolysis of the di- and

oligosaccharides is indispensable to the absorption of monosaccharides across the

brush border membrane into the cell interior. The uptake of glucose and galactose is

mediated through SGLT1 transporters in the membrane of the epithelial cells

(Ferraris, 2001).

Absent or reduced activity of LPH leads to lactose malabsorption and in the presence

of gastrointestinal symptoms to lactose intolerance.

Types of lactase deficiencies

Three different forms of lactase deficiencies are known in humans (Table 1). The

primary lactase deficiency, also called adult type of hypolactasia (ATH) or lactase

Introduction 3

non-persistence, is a normal, developmental downregulation of lactase activity after

weaning (Sahi, 1994). The secondary or acquired lactase deficiency is induced by

gastrointestinal diseases causing (partial) atrophy of the small bowel villi (Heyman,

2006). Congenital lactase deficiency is a rare, but severe disease with absent lactase

activity in infants from birth on (Kuokkanen et al., 2006). Developmental lactase

deficiency is a disorder in preterm infants due to the fact that lactase activity is not

optimally developed before week 35-38 of gestation (Antonowicz and Lebenthal,

1977; Erasmus et al., 2002; Heyman, 2006).

Table 1: Different types of lactase deficiencies

Type Pathogenesis Prevalence

Primary lactase

deficiency

developmental downregulation of

the lactase activity after weaning

~ 60-70% worldwide (Holden and

Mace, 1997);

varies from less than 5% to almost

100% (Sahi, 1994)

Secondary

lactase

deficiency

reduced lactase activity due to an

injury of the gastrointestinal tract

variable;

e.g. ~ 60% of postinfectious IBS

patients (Ruchkina et al., 2013)

Congenital

lactase

deficiency

absent lactase activity from birth

on

really rare disease (Savilahti et al.,

1983);

1:60000 in Finland (Kuokkanen et

al., 2006)

Two-thirds of the world population is affected by the developmental downregulation

of the lactase activity level to 5%-10% of the level at birth during childhood and

adolescence (Sahi, 1994). The prevalence of adult type of hypolactasia (ATH) varies

between different populations, but appears to be more frequent in populations with a

history of dairying (Simoons, 1969; Simoons, 1970; Holden and Mace, 1997). In

Europe the frequency is between 2% in Scandinavia and 70% in some regions of

4 Introduction

Italy, while in Asia the incidence of ATH is nearly 100% (Scrimshaw and Murray,

1988; Sahi, 1994; Ozdemir et al., 2009). Lactase persistence appears due to a

polymorphism of a single autosomal gene, which leads to the failure to repress the

synthesis of lactase (Sahi, 1994; Harvey et al., 1995). Initially, a genotype/phenotype

study detected the two single nucleotide polymorphisms (SNPs) C/T−13910 and

G/A−22018 in the LCT gene, but nowadays other SNPs are known to be associated

with lactase persistence (Enattah et al., 2002; Ingram et al., 2007; Tishkoff et al.,

2007; Coelho et al., 2009; Ingram et al., 2009; Jensen et al., 2011). The molecular

mechanism is not completely understood, but it is established that all SNPs activate

the promotor of the LCT gene with a similar cis-acting effect (Olds and Sibley, 2003;

Lewinsky et al., 2005; Ingram et al., 2007; Ingram et al., 2009; Jensen et al., 2011).

Recently, Dzialanski et al. suggested an intermediate phenotype, because the

heterozygote CT−13910 and homozygote TT−13910, determined as lactase persistent,

differ in their physiological response to lactose intake (Dzialanski et al., 2015).

Secondary or acquired lactase deficiency is caused by a decrease in lactase

production after a gastrointestinal disease, an injury or a surgery. Examples of such

gastrointestinal diseases are gastroenteritis, celiac disease or inflammatory bowel

disease (Usai-Satta et al., 2012). Clinically, secondary lactase deficiency occurs after

small bowel injury, such as viral or parasitic infections. Giardia infections are

described to be associated with lactose intolerance (Gendrel et al., 1992), as well as

the human immunodeficiency virus (HIV) (Miller et al., 1991). Secondary lactase

deficiency is only a temporally disorder, which can be completely overcome after a

few months.

Congenital lactase deficiency (CLD) leads to a complete elimination of lactase

activity from birth on and represents a very severe disorder in infants due to the life-

threatening dehydration and loss of electrolytes (Holzel et al., 1962; Holzel, 1967).

Un- or misdiagnosis of CLD can lead to developmental disorders and to defects of

Introduction 5

the liver and the brain (Berg et al., 1969; Hoskova et al., 1980). The prevalence of

CLD is very low. Until now, only a few cases are described so far (Savilahti et al.,

1983; Kuokkanen et al., 2006; Torniainen et al., 2009; Uchida et al., 2012; Sala

Coromina et al., 2014; Fazeli et al., 2015). Small intestinal biopsies reveal normal

histological characteristics but low or completely absent lactase activity (Asp et al.,

1973; Freiburghaus et al., 1976). The lack of lactase activity is associated with

mutations in the coding region of LPH, which are inherited in an autosomal recessive

way. The most common types of mutations result in a truncated protein as a result of

frameshifts or stop codons (Kuokkanen et al., 2006; Torniainen et al., 2009; Uchida

et al., 2012; Sala Coromina et al., 2014; Fazeli et al., 2015) (Table 2, 9 out of 13

belong to these types). The other mutations lead to an amino acid exchange, which

affects the function of LPH (Kuokkanen et al., 2006; Torniainen et al., 2009). All of

the mutations appear in a homozygous or compound heterozygous pattern of

inheritance (Table 2). The origin of the genetic background is probably located in

Finland, because five mutations were detected in a study with 32 Finnish patients

and additional two mutations were also found in Finnish patients in another study

(Kuokkanen et al., 2006). Out of the five mutations in the first study, the mutation

Y1390X, also called the Finmajor, had the highest prevalence with 84%. This result

could be confirmed in a screening of 556 anonymous blood donors in Finland

(Kuokkanen et al., 2006). The other four mutations were only detected in the first

study, except the G1363S mutation, which was also found in another study in two

siblings of Turkish origin (Enattah et al., 2008). This study also detected two

mutations in an Italian patient. Recently, four other mutations were detected in

patients from Japan, Spain and Turkey (Uchida et al., 2012; Sala Coromina et al.,

2014; Fazeli et al., 2015).

On the protein level only the G1363S-, the Y1473X- and D1796fs-mutant were

analyzed in more detail. The G1363S-mutant resulted in a misfolded protein that was

blocked in the ER and was enzymatically inactive (Behrendt et al., 2009).

6 Introduction

Table 2: Reported CLD patients with mutations in the LCT gene

Author/year Ethnic

origin

Inheritance

pattern Mutation Effect Domain

Kuokkanen

2006 Finland homozygous c.4170T > A p.Y1390X III

Finland compound

heterozygous c.4998_5001delTGAG p.S1666KfsX58 IV

Finland compound

heterozygous c.653_654delCT p.S218CfsX6 I

Finland compound

heterozygous c.804G > C p.Q268H I

Finland compound

heterozygous c.4087G > A p.G1363S III

Torniainen

2009 Italian

compound

heterozygous c.2062T > C p.S688P II

Italian compound

heterozygous c.4834G > T p.E1612X IV

Finland compound

heterozygous c.1692_1696delAGTGG p.V565LfsX3 II

Finland compound

heterozygous c.4760G > A p.R1587H IV

Turkish homozygous c.4087G > A p.G1363S III

Uchida

2012 Japanese

compound

heterozygous c.4419C > G p.Y1473X IV

Japanese

compound

heterozygous c.5387delA p.D1796AfsX18 IV

Coromina

2015 Spanish homozygous c.2232 2253dup22 p.L752KfsX18 II

Fazeli

2015 Turkish homozygous c.3448delT p.1150PfsX19 III

Introduction 7

Symptoms of lactose intolerance and secondary associated disorders

Typical symptoms are generated by the undigested and non-absorbed lactose, which

is fermented by the gastrointestinal microbiota. Products of the fermentation are short

fatty acid, hydrogen, carbon dioxide and methane (Matthews et al., 2005). Typical

gastrointestinal symptoms of lactose intolerance are abdominal pain, cramps,

borborygmi, bloating and flatulence, watery and acidic diarrhea, nausea and vomiting

(Vesa et al., 2000). The pathophysiological mechanisms causing these symptoms

are the production of gas and the osmotic change due to the undigested lactose in

the colon. The severity of the symptoms due to lactose intolerance is dependent on

whether small intestinal lactase activity is present (Swallow, 2003), the ingested

lactose load, the distribution of lactose intake across the day (Lomer et al., 2008),

associated food and nutrient properties (Shaukat et al., 2010), intestinal microbiota

(Zhong et al., 2004) and gut motility (Wahlqvist, 2015). Furthermore prior infection,

the usage of antibiotics and other gastrointestinal disorders (Zhao et al., 2010) such

as irritable bowel syndrome (Yang et al., 2013) have to be taken under consideration

in regard to the origin of the gastrointestinal symptoms. Due to these different factors

affecting the appearance of symptoms, it might be explicable, why the association of

self-reported lactose intolerance and the occurrence of symptoms after lactose

ingestion is very poor (Suarez et al., 1995) even in patients with lactase deficiency

(Zheng et al., 2015). One possible explanation for this lack of symptoms may be the

adaptation of the colonic microbiome in lactose intolerant persons or as a result of

the inheritance pattern of pathogenic mutations in CLD.

Reduced consumption of dairy products in lactose intolerant persons may lead to

higher risk of secondary disorders due to the reduced intake of milk and dairies

ingredients. Some studies reported that the risk of bone loss might be increased due

to the restriction of dairy products, which are the major source of calcium in many

individuals (Obermayer-Pietsch et al., 2004; Laaksonen et al., 2009). Calcium

absorption in the intestine and the incorporation of calcium into the bones are

facilitate by casein, a prominent component of the milk (Scholz-Ahrens and

Schrezenmeir, 2000). Conversely, another study could not detect any evidence of a

8 Introduction

detrimental effect of lactase deficiency on adult bone mass, but they suggested

changes in the activity of bacterial anaerobes in the intestine (Slemenda et al., 1991).

Lactose and milk consumption is reported to have a protective effect on the risk of

developing colon or colorectal cancer (Jarvinen et al., 2001). One possible

explanation for this phenomenon is that butyrate, a product of the lactose

fermentation in the colon, reduces the central cell proliferation of cancer cells in

culture (Jarvinen et al., 2001). Another explanation is that galactose, a product of the

lactose hydrolysis in the intestine, can bind and thereby block lectins, which stimulate

monolayer proliferation (Evans et al., 2002). The effect of milk and dairy products on

the development of ovarian cancer has not yet been conclusively determined. While

some studies support the view that high doses of lactose and dairy products lead to

an increased risk of ovarian cancer (Rock, 2011; Lerchbaum et al., 2012), others do

not advocate the correlation of milk consumption and ovarian cancer (Herrinton et al.,

1995).

Diagnosis of lactose malabsorption and lactose intolerance

Nowadays, there are various methods available to diagnose lactose malabsorption

and lactose intolerance (Misselwitz et al., 2013). Testing of lactase activity in

duodenal biopsies is regarded as the reference standard (Newcomer et al., 1975).

Thereby the minimal normal lactase activity in infants is defined to 11 U/g (Nichols et

al., 2002). The advantage of this method is the direct testing of the enzymatic activity

per se without any influencing factors, like the intestinal microbiota. Limitations of the

biopsy activity measurement include the inhomogeneous expression of lactase

(Maiuri et al., 1994) and the invasiveness of the procedure, which is especially

problematic for infants with suspected CLD. Another possibility to test lactose

malabsorption is the genetic test, which is useful for identifying the known

polymorphisms that are connected to lactase non-persistence (Rasinpera et al.,

Introduction 9

2004). In case of CLD, the genetic test is really useful because it is most harmless for

the infant who suffer from severe gastrointestinal symptoms.

Lactose maldigestion and the associated symptoms can be assessed by the lactose

tolerance test (Arola, 1994) and the hydrogen-breath test (Metz et al., 1975). During

the lactose tolerance test the changes of glucose levels in the blood are monitored

after ingestion of lactose. The test principle is based on an increase of blood sugar

after lactose challenge due to its hydrolysis in the intestine. Logically, individuals who

maldigest lactose do not have an increase in their blood glucose levels. The

disadvantage of this method is the fluctuations of postprandial blood sugar, which

can lead to false-negative outcomes. The hydrogen breath test displays the changes

in the H2-levels in the exhaled air after lactose intake. The test principle is the

increase of H2-levels in respiratory air after lactose challenge due to bacterial

degradation of lactose in the colon. Individuals who maldigest lactose have an

increase in H2-levels of the exhaled air, while lactose tolerant persons lack this

increase due to normal lactose hydrolysis. False-negative tests may occur due to the

presence of hydrogen non-producing bacteria in the colon (2%-43%) (Gasbarrini et

al., 2009). Both test principles, the lactose tolerance test and the hydrogen-breath

test, may lead to false-negative results due to the increased rapid gastrointestinal

transit triggered by the lactose intolerance.

Other methods to prove if lactose intolerance is the reason for gastrointestinal

symptoms are the fecal reducing substances test, which relies on the presence of

undigested lactose in the stool due to the failed hydrolysis (Caballero et al., 1983)

and the fecal pH test, which measures the changes in the pH due to fermentation of

lactose (Maffei et al., 1984). Individuals who maldigest lactose are identified by a

colour change in the fecal reducing substances test or by a decrease in the stool pH

of 6 or lower in the fecal pH test (Tomar, 2014).

10 Introduction

Treatment of lactose intolerance in infants, children and adults

The treatment strategy is based on the form of lactase deficiency, the age and the

general state of health of the patient. Milk containing lactose is the major source of

energy and nutrients of infants, which is the reason why lactose intolerance has such

severe consequences for the patients, if it remains mis- or undiagnosed. The

treatment of these patients is a lactose-free diet. Later in life, dairy products form an

essential component of the human diet in many cultures. Children who are lactose

intolerant should not avoid milk and dairy products, because of the recommended

amount of calcium needed for normal calcium accretion and bone mineralization

especially during their development (Stallings et al., 1994). In general it is

recommended not to restrict milk and dairy products completely from the diet,

because of their calcium and vitamin D contents. Otherwise supplementation of those

components is required. Patients with self-reported lactose intolerance can digest up

to 12 g lactose without any symptoms (Savaiano et al., 2006). One approach in the

management of lactose intolerance is therefore the steadily increase of the lactose

load in the diet, giving the colon time to adapt, which in turn may lead to a reduction

in symptoms. To avoid high contents of lactose there is lactose-hydrolyzed or

lactose-reduced milk available or simply milk-derived products containing less

lactose, such as yoghurt. Other main pharmacological approaches are the use of

lactase replacement supplements and the involvement of probiotics. Lactase

obtained from Kluyveromyces lactis represents a valid therapeutic strategy (Montalto

et al., 2005), while in the choice of probiotics Lactobacillus casei Shirota and

Bifidobacterium breve Yakult reach the best effects (Almeida et al., 2012).

Lactase-phlorizin hydrolase (LPH)

LPH is a β-galactosidase of the brush border membrane, which comprises two main

catalytic activities: the lactase activity in domain IV at position Glu1749 and the

phlorizin hydrolase activity in domain III at position Glu1273 (Zecca et al., 1998). Due

Introduction 11

to its lactase activity, LPH is able to cleave lactose, the main carbohydrate in

mammalian milk and based on its phlorizin hydrolase activity LPH has a wide

specificity of substrates like glycosyl-N-acylspingosines, phlorizin and flavonoid

glycosides, which are present in many fruits and vegetables and are known for their

anticarcinogenic and antiantherogenic activities (Day et al., 2000; Nemeth et al.,

2003). The expression of LPH is barely detectable in the crypts, but its expression

reaches its maximum between the lower and midvilli and decreases at the villus tip

(Hauri et al., 1985; Rings et al., 1992). During development, the expression of LPH

follows a similar pattern at the protein and mRNA levels (Fajardo et al., 1994). The

gene of human LPH is located on chromosome 2, is approximately 55 kb in size and

comprises 17 exons (Kruse et al., 1988; Boll et al., 1991). Furthermore, the gene

contains binding sites for transcription factors such as CTF/NF-1 and AP2 (Boukamel

and Freund, 1992; Troelsen et al., 1994). The regulation of lactase levels within the

cell is probably due to a nuclear protein (NF-LPH1) that binds upstream from the

transcription site (Troelsen et al., 1992; Troelsen et al., 1994; Troelsen et al., 1997).

Another regulatory mechanism of lactase levels at the cell surface is glycosylation.

LPH is highly N- and O-glycosylated, which is important for correct folding of the

protein and thereby for its enzymatic activity. It is known that reduced glycosylation

leads to reduced lactase activity and reduced levels of LPH at the cell surface (Naim

and Lentze, 1992; Jacob et al., 2000). These co-and post-translational events are

discussed in more detail in the paragraphs about biosynthesis and intracellular

processing and protein modification, folding and quality control in the ER. The cDNA

of LPH is built of 6274 bp and encodes a 1927 amino acid long protein (Mantei et al.,

1988). LPH, as a type I membrane glycoprotein, consists of an N-terminal

extracellular domain and a C-terminal cytosolic domain. LPH is composed of different

protein domains and is therefore a multi-domain protein, but the role of each single

domain has not been determined so far. The N-terminal domain consists of a 19

amino acid long signal sequence that is needed for the translocation of newly

synthesized LPH proteins into the ER-lumen, followed by an ectodomain that

consists of four homologous domains with 38% - 55% identity to each other (Mantei

et al., 1988). Those four domains are highly conserved, which led to the hypothesis

12 Introduction

that LPH might have arisen from two subsequent duplications (Wacker et al., 1992).

Domains I and II are described as the profragment that is cleaved off during the

transport of LPH to the cell surface. The mature LPH consists only of domains III and

IV, which comprise the catalytic sites of LPH. The anchoring of LPH is mediated

through 19 hydrophobic amino acids, while the cytosolic domain is built of 26 amino

acids, which are highly hydrophilic (Mantei et al., 1988).

Biosynthesis and intracellular processing

LPH is synthesized as a monomeric pro-LPH molecule with a molecular weight of

215 kDa in the ER (Naim et al., 1991). In this organelle, the first co- and post-

translational modifications take place before LPH is further transported to the Golgi

apparatus along the secretory pathway. In the ER, during its synthesis, LPH is co-

translationally modified by N-glycosylation, which leads to the formation of the

mannose-rich N-glycosylated form of the protein. This modification of proteins is

experimentally detectable by the usage of endo-β-N-acetylglucosaminidase H (endo

H), that only cleaves mannose-rich and some hybrid N-glycans between the two N-

acetylglucosamines. The N-glycosylation in the ER plays an indispensable role in the

folding of LPH, which consists of 15 potential N-glycosylation sites. The correct

folding of the protein is monitored by the quality control system of the ER, which is

explained in more detail in the paragraph about protein modification, folding and

quality control in the ER. Before LPH is further transported, another requirement, that

is important for its function has to be fulfilled. This is the dimerization step of two pro-

LPH molecules, which is mediated through the presence of the transmembrane

domain and is dependent on a stretch of 87 amino acids in the ectodomain between

position 1646 and position 1559 at the C-terminus of domain IV (Danielsen, 1990;

Naim and Naim, 1996; Panzer et al., 1998). After successful exit out of the ER, LPH

is transported to the Golgi apparatus, where complex N-glycosylation and O-

glycosylation occur. Thereby a pro-LPH molecule with a molecular weight of 230 kDa

is generated (Hauri et al., 1985; Naim et al., 1991). Complex N-glycans are

Introduction 13

experimentally detectable by the usage of Peptide-N-Glycosidase F (PNGase F),

which cleaves all forms of N-glycans, except the fucosylated ones. This post-

translational modification is crucial for the correct folding, the transport and the

enzymatic activity of LPH (Naim, 1992; Naim and Lentze, 1992; Jacob et al., 2000).

The importance of O-glycosylation for its enzymatic function was shown in a previous

study due to the 4-fold increased activity of the N-and O-glycosylated form compared

to the N-glycosylated form of the protein (Naim and Lentze, 1992).

The intracellular processing of LPH is mediated through two proteolytic cleavage

steps, which take place in the trans-Golgi network (TGN) and at the cell surface

(Naim et al., 1987; Jacob et al., 1996; Wuthrich et al., 1996). The first cleavage at

position Arg734/Leu735 leads to the conversion of pro-LPH to LPHβinitial by the cut-off

of domain I and most of domain II that, together, form the profragment LPHα (Figure

1). After further transport of LPH to the apical membrane of the epithelial cell, the

second proteolytic cleavage occur by a pancreatic trypsin at position Arg868/Ala869

leading to the mature form of LPH, called LPHβfinal. The molecular weight LPHβfinal is

160 kDa (Danielsen et al., 1984; Naim et al., 1987).

The profragment LPHα is directly involved in the folding of the protein and functions

thereby as an intramolecular chaperone (Jacob et al., 2002). LPHα, despite its five

potential N-glycosylation sites, is neither N- nor O-glycosylated and is directly

degraded after the cleavage (Naim et al., 1994). Another intramolecular chaperone of

LPH is domain III, which is important for the correct folding of LPH. Its deletion leads

to a misfolded protein in the ER, which is probably degraded (Behrendt et al., 2010).

14 Introduction

Figure 1: Maturation steps of LPH in the intestinal epithelial cells. (A) The protein is

synthesized as a monomeric pro-LPH molecule by translocation in the ER. LPH consists of a

luminal C-terminus, a membrane anchor and an ectodomain with four highly-conserved

structural and functional domains and an extracellular N-terminus. (B) Prior to its exit from

the ER, pro-LPH molecules form homodimers. (C) In the Golgi apparatus, pro-LPH is

cleaved in the trans-Golgi network, which leads to the removal of LPHα, leaving LPHβinitial.

(D) After proper sorting of the protein to the apical membrane, LPHβinitial is cleaved by

pancreatic trypsin in the intestinal lumen to generate the mature form of the protein, called

LPHβfinal, consisting only of domains III and IV (Taken from Amiri and Diekmann et al. (Amiri

et al., 2015)).

Polarized sorting

LPH has to be transported to the apical membrane of epithelial cells to fulfill its

physiological functions. This sorting process is achieved by a number of sorting

signals within the protein or by cellular components, which interact with those signals.

One example of such a signal is the glycophosphatidylinositol (GPI) anchor, which

mediates apical sorting by interacting with membrane microdomains enriched in

glycospingolipids and cholesterol (Brown and Rose, 1992; Danielsen, 1995; Simons

and Ikonen, 1997). LPH does not interact with these membrane microdomains

(Naim, 1994; Danielsen, 1995; Jacob et al., 1999). Another common sorting signal of

apical sorting is mediated through N- and O-glycans by interacting with cellular

components. One example for this mechanism is SI, which requires O-glycosylation

Introduction 15

for its association with membrane microdomains and thereby for correct apical

sorting (Alfalah et al., 1999; Jacob et al., 2000). Previous studies have shown that N-

and O-glycosylation are not required for correct sorting of LPH (Naim, 1994;

Danielsen, 1995; Jacob et al., 1999) and that neither the proteolytic cleavage step is

implicated into the sorting nor does the profragment contain any sorting signals

(Grunberg et al., 1992; Jacob et al., 1994). One requirement for correct sorting of

LPH is the presence of the transmembrane domain and it is strongly suggested that

domain IV contains a sorting signal for apical sorting (Jacob et al., 1997; Panzer et

al., 1998).

In general the transport of apical membrane proteins after the TGN is mediated by

distinct vesicles called SI-associated vesicels and LPH-associated vesicles (Jacob

and Naim, 2001; Jacob et al., 2003). In the past, research had unravelled interactions

of different galectins with lipids and glycoproteins in in the secretory pathway of cells.

They stabilize transport platforms for apical trafficking or sort apical glycoproteins into

specific vesicle populations (Delacour et al., 2009). Galactin-3 has been identified to

play an important role in this process by functioning as a sorting receptor (Delacour

et al., 2006; Delacour et al., 2007; Delacour et al., 2009).

Protein modifications, folding and quality control in the ER

The biosynthesis of proteins is comprised of a complex set of cellular events that are

strictly regulated to ensure the functionality of the end products. In eukaryotic cells up

to 30% of all proteins are targeted to the secretory pathway (Lemus and Goder,

2014). The folding status of nascent polypeptides is indicated by multiple post-

translational modifications that are added to the primary structure. Currently, more

than 200 forms of post-translational modifications are known, ranging from chemical

modifications such as phosphorylation or acetylation, to the addition of saccharides in

case of glycosylation or the addition of complete proteins like ubiquitin in the process

of ubiquitylation (Minguez et al., 2012). The biological role of glycans can be divided

16 Introduction

into two groups: I) the recognition of glycans by other molecules, which is important

for cell-cell interaction, detection of microbial adhesions, agglutinins or toxins and II)

the structural and modulatory properties, which are crucial for protective, stabilizing,

organizational and barrier functions e.g. proteoglycans in the maintenance of tissue

structure, porosity and integrity (Varki and Lowe, 2009).

The most common modification of proteins is the glycosylation (Apweiler et al.,

1999). During this process certain oligosaccharides are co- or post-translationally

attached to the polypeptide or later modified by trimming or adding further

oligosaccharides (Varki and Lowe, 2009). These glycans can be detected by

chaperones and other proteins that assist in their folding and transport to their final

intra- and extracellular destinations. In the ER, glycoproteins are modified by

mannose-rich N-glycosylation and later, along the secretory pathway, further

complex N-glycosylation and O-glycosylation in the Golgi apparatus take place.

Changes in the glycosylation state of proteins can lead to several genetic and chronic

diseases, like cancer (Saldova et al., 2011; Miwa et al., 2012; Bull et al., 2013;

Balmana et al., 2016), inflammation (Gornik and Lauc, 2008), Alzheimer’s disease

(Schedin-Weiss et al., 2014), diabetes (Thanabalasingham et al., 2013; Zurawska-

Plaksej et al., 2015) and metabolic disorders such as cystic fibrosis (Rhim et al.,

2004).

Membrane glycoproteins, like LPH, or secretory glycoproteins are synthesized at the

ribosomes and translocated into the ER. During the translocation, N-linked

glycosylation may cotranslationally occur on the nascent protein if the tripeptide

sequence Asn-X-Ser or Asn-X-Thr is present (Kornfeld and Kornfeld, 1985; Petrescu

et al., 2004). The asparagine residue of this consensus sequence is rapidly modified

through a pre-assembled oligosaccharide, which is built on a dolichol phosphate, a

lipid anchor in the membrane of the ER. The pre-assembled oligosaccharide is

composed of three glucose residues, nine mannoses and two N-acetylglucosamines

(Glc3Man9GlcNAc2) ((Ferris et al., 2014), Figure 2). The oligosaccharides attached

to glycoproteins seem to play an important role in the correct folding and the stability

of many proteins in the ER (Helenius and Aebi, 2004). The transfer of the pre-

Introduction 17

assembled oligosaccharide on the newly synthesized protein is catalyzed by an

oligosaccharyltransferase, an ER-membrane bound protein complex (Dejgaard et al.,

2010; Mohorko et al., 2011; Pfeffer et al., 2014). Further modifications by trimming

the oligosaccharides are mediated through two glucosidases: glucosidase I, a type II

membrane glycoprotein, which cleaves the terminal glucose residue and glucosidase

II, a soluble heterodimeric enzyme, which removes sequentially the next two glucose

residues ((Hirschberg and Snider, 1987; Shailubhai et al., 1991; Pelletier et al.,

2000), Figure 2). During these modifications an important quality control of the newly

synthesized protein takes place.

Figure 2: Structure of the N-linked core glycan. The triantennary

tetradecaoligosaccharide is assembled on the ER membrane and is covalently linked to the

Asn side chains in the context of the N-glycosylation consensus sequence of newly

translocated proteins. The 14-sugar form, starting from the Asn residue, contains two N-

acetylglucosamine (GlcNAc, squares), nine mannose (circles) and three glucose (triangles)

residues (modified from (Ferris et al., 2014)).

After the first trimming step of glucosidase II, the Ca2+-dependent lectin chaperones

calnexin (CNX) and calreticulin (CRT) recognize the maturing polypeptide by its

monoglucosylated glycans (Hammond et al., 1994). Calnexin is a type I membrane

protein and calreticulin is its soluble paralog that is localized in the ER-lumen. Both

proteins function in conjunction with ERp57, an ER-resident oxireductase, as the

major chaperone complex in the CNX/CRT cycle (Williams, 2006). The N-terminal

18 Introduction

domain of calnexin or calreticulin interacts with the monoglucosylated glycans on the

nascent protein, while ERp57 builds transient mixed disulfide bonds with the

polypeptide to improve its folding (Hebert and Molinari, 2007).

The second trimming step of glucosidase II releases the protein from the lectin

chaperones due to their low affinity to glycans lacking the terminal glucose residue

and leads to the exit of the native glycoprotein from the ER and its transit through the

secretory pathway. The UDP-glucose:glycoprotein glucosyltransferase (UGGT),

which can re-attach the last glucose of the N-linked glycan of improperly folded

glycoproteins and allows the re-entering into the CNX/CRT cycle, plays an essential

role in the quality control (Trombetta and Parodi, 2003; Hebert et al., 2005).

Besides calnexin and calreticulin, there are additional ER-resident chaperones

involved in protein folding, including an immunoglobulin binding protein (BiP) and a

protein disulfide isomerase (PDI) (Fink, 1999; Braakman and Hebert, 2013). BiP, a

member of the Hsp70 family, consists of a C-terminal substrate-binding domain and

an N-terminal nucleotide-binding domain (Munro and Pelham, 1986; Flynn et al.,

1991). BiP can either increase or decrease the protein folding rate in an ATP-

dependent way (Bukau et al., 2006). While BiP binds the substrate to allow

accomplishment of the native confirmation, other chaperones like PDI may generate

or rearrange disulfide bonds within the substrate that are properly paired (Freedman

et al., 1989).

The accumulation of misfolded proteins leads to the activation of the unfolded protein

response (UPR) (Zhang and Kaufman, 2006). The activation of the UPR results in

reduced total protein expression, upregulated expression of ER chaperones and

increased ER-associated degradation (Travers et al., 2000; Schroder, 2008). In case

the homeostasis situation is not restored or if the conditions become more severe,

UPR can lead to the induction of apoptosis (Oyadomari et al., 2002; Briant et al.,

2015; Lobo et al., 2016). Several transmembrane proteins are involved in UPR, such

as activating transcription factor 6, protein-kinase RNA-like ER kinase and inositol-

requiring protein 1 (Cox et al., 1993; Harding et al., 1999; Ye et al., 2000; Ron and

Walter, 2007). Unsurprisingly, many human diseases like lysosomal storage

Introduction 19

diseases, myelination diseases, cystic fibrosis, systemic amyloidoses such as light

chain myeloma, and neurodegenerative diseases including Alzheimer's disease have

recently been linked to ER stress or to misfolding and/or misassembly of membrane

proteins (Hutt et al., 2009; Ng et al., 2012). The accumulation of misfolded proteins

leads to a disruption of the ER function. Therefore it is essential that those misfolded

proteins are quickly and efficiently removed from the ER.

Figure 3: Quality control of newly synthesized proteins in the endoplasmic reticulum.

Glycoproteins first enter the CNX/CRT cycle after removal of the two terminal glucose

residues of the attached N-glycan by glucosidases I and II. The resulting monoglucosylated

N-glycan binds to the ER-resident chaperones CNX and CRT, which associate with ERp57

supporting the catalysis of disulfide-bond formation. The substrate dissociates from

CNX/CRT upon glucosidase II-mediated removal of the terminal glucose residue from the N-

20 Introduction

glycan. At this point, the folding status of the glycoprotein is controlled by the UGGT, which

specifically binds nearly-native folding forms and reglucosylates them. Correctly folded

proteins are allowed to exit the ER. Reglucosylated substrates enter again the CNX/CRT

cycle. Substrates eventually exit the CNX/CRT cycle upon demannosylation of N-glycans.

The mechanism for permanent removal of misfolded proteins from the cycle involves active

recognition of demannosylated forms by ERAD components for proteasomal degradation

(adapted by (Ellgaard and Helenius, 2003)).

The removal of misfolded proteins from the ER occurs via the ER-associated

degradation (ERAD) (Olzmann et al., 2013). ERAD is initiated by the ER

degradation-enhancing α-mannosidase-like protein (EDEM) that is able to recognize

and modify the misfolded proteins by trimming the mannose residue of the core

glycan (Ninagawa et al., 2014). Mannose removal requires several proteins, including

ER-α1,2-mannosidase, EDEM 1,2,3 and Golgi-resident mannosidase I (Hosokawa et

al., 2003; Hosokawa et al., 2007; Avezov et al., 2008; Aikawa et al., 2012). ERAD is

a process whereby misfolded proteins are retranslocated back to the cytosol where

they undergo ubiquitination and later degradation by the 26S proteasome (Vembar

and Brodsky, 2008; Christianson and Ye, 2014). These steps are mediated by a

variety of ER and cytoplasmic factors which are organized around the membrane-

embedded E3 ubiquitin ligase complex (Ruggiano et al., 2014). It has been shown

that the location of the folding defect determines the initial site of ubiquitination and

thereby the specific ERAD-degradation pathway (Briant et al., 2015). Currently, three

different ERAD pathways are described, depending on the ligases and the

chaperone requirements that are necessary during the retranslocation and the

degradation of the misfolded domain (Carvalho et al., 2006).

Correctly folded glycoproteins that pass the ER quality control system, are able to

exit the ER and are further transported to the Golgi apparatus. This process is

mediated by the Golgi-resident mannosidases: Golgi mannosidase I and Golgi

mannosidase II demannosylate the arriving glycoproteins (Moremen, 2002). Only

natively folded glycoproteins are further glycosylated and transported to their final

destinations. Misfolded glycoproteins are recognized by the quality control system of

21

the Golgi apparatus and degraded through lysosomal degradation (Arvan et al.,

2002).

The complex N-glycosylation in the Golgi apparatus is initiated by the

demannosylation of up to 3 mannoses, followed by defined elongation and branching

of the core glycan by using N-acetylglucosamine, galactose and sialic acid

monomers (Stanley et al., 2009). In the Golgi apparatus, O-glycosylation may also

take place. Generally, mucin and mucin-like glycoproteins are heavily O-

glycosylated, but there are also several types of nonmucin O-glycans, including α-

linked O-fucose, β-linked O-xylose, α-linked O-mannose, β-linked O-GlcNAc (N-

acetylglucosamine), α- or β-linked O-galactose, and α- or β-linked O-glucose glycans

(Brockhausen et al., 2009). LPH belongs to the class of mucin or mucin-like

glycoprotein. Mucin O-glycans start with a covalently α-linked N-acetylgalactosamine

residue linked to serine or threonine of the nascent protein. In contrast to the N-

glycosylation, the target sites for O-glycosylation are not located in a determinate

consensus sequence (Jensen et al., 2010). This reaction is catalyzed by a

polypeptide-N-acetyl-galactosaminyltransferase. The N-acetylgalactosamine may be

extended with sugars including galactose, N-acetylglucosamine, fucose, or sialic acid

in a non-specified way and form thereby, in contrast to the N-glycosylation, a very

heterogeneous population by the different branching and different sequences of the

monosaccharides (Brockhausen et al., 2009). In contrast to the initial reactions of N-

glycosylation, no pre-assembled core oligosaccharide is involved in the O-glycan

biosynthesis, and no glucosidases appear to be involved in the processing of O-

glycans within the Golgi apparatus.

Introduction

22 Aim of the dissertation

Aim of the dissertation

The first aim of this dissertation is the biochemical analysis of two novel mutations in

the LCT gene, which were found in a Japanese infant with suspected CLD. Both

mutations, c.4419C>G (p.Y1473X) in exon 10 and c.5387delA (p.D1796fs) in exon

16, are located in domain IV of the extracellular domain of LPH. Furthermore, the

determination of the influence of these pathogenic mutations concerning to the wild

type is of great interest, because the parents of the Japanese infant, suffering from

severe gastrointestinal symptoms, were described as symptom-free.

The second aim is to analyze the structural features of LPH in more detail, because

LPH is a multi-domain protein and the specific function of each domain is not known

yet. This structural analysis is also important in regard to the pathogenesis of certain

mutations, which are associated with CLD. If the role of each domain regarding

function and processing of LPH is understood, it would be much easier to estimate

the severity of certain mutations.

The specific aims of this dissertation are the following two points:

1) Investigation of the influence of two novel mutations in the coding region of

LPH found in a CLD patient on the structure, biosynthesis and function of

LPH.

2) Elucidation of the structural determinants for the transport of the multi-domain

membrane glycoprotein LPH in the early secretory pathway.

Publications 23

Publications

This thesis was prepared as a cumulative dissertation comprising two original articles

and one review article.

Authors´contributions

1) Diekmann, L., Pfeiffer, K., and Naim, H. Y., Congenital lactose intolerance is

triggered by severe mutations on both alleles of the lactase gene. BMC

Gastroenterol. 2015 Mar 21;15:36. DOI: 10.1186/s12876-015-0261-y.

LD and KP performed the experiments and analyzed the data. LD drafted a

first version of the manuscript. HYN designed the study, analyzed the data

and wrote the final version of the manuscript. All authors read and approved

the final manuscript.

2) Amiri M.†, Diekmann L.†, von Köckritz-Blickwede M. and Naim H. Y., The

Diverse Forms of Lactose Intolerance and the Putative Linkage to Several

Cancers. Nutrients. 2015 Aug 28;7(9):7209-30. DOI: 10.3390/nu7095332.

†These authors contributed equally to this work

MA, LD and MKB drafted a first version of the manuscript. HYN wrote the final

version of the manuscript. All authors read and approved the final manuscript.

3) Diekmann L.+, Behrendt M.+, Amiri M. and Naim H. Y., Structural

determinants for transport of a multi-domain membrane glycoprotein in the

early secretory pathway, J Biol Chem., under revision.

+Authors contributed equally

24 Publications

LD and MB performed the experiments, analyzed the data and drafted a first

version of the manuscript. MA designed the study, analyzed the data and

contributed to drafting the manuscript. HYN designed the study, analyzed the

data and wrote the final version of the manuscript. All authors read and

approved the final manuscript.

Publications 25

Congenital lactose intolerance is triggered by severe mutations on

both alleles of the lactase gene

Diekmann, L., Pfeiffer, K., and Naim, H. Y., Congenital lactose intolerance is

triggered by severe mutations on both alleles of the lactase gene. BMC

Gastroenterol. 2015 Mar 21;15:36. DOI: 10.1186/s12876-015-0261-y.

Abstract

Background: Congenital lactase deficiency (CLD) is a rare severe autosomal

recessive disorder, with symptoms like watery diarrhea, meteorism and malnutrition,

which start a few days after birth by the onset of nursing. The most common

rationales identified for this disorder are missense mutations or premature stop

codons in the coding region of the lactase-phlorizin hydrolase (LPH) gene. Recently,

two heterozygous mutations, c.4419C>G (p.Y1473X) in exon 10 and c.5387delA

(p.D1796fs) in exon 16, have been identified within the coding region of LPH in a

Japanese infant with CLD.

Methods: Here, we investigate the influence of these mutations on the structure,

biosynthesis and function of LPH. Therefore the mutant genes were transiently

expressed in COS-1 cells.

Results: We show that both mutant proteins are mannose-rich glycosylated proteins

that are not capable of exiting the endoplasmic reticulum. These mutant proteins are

misfolded and turnover studies show that they are ultimately degraded. The

enzymatic activities of these mutant forms are not detectable, despite the presence

of lactase and phlorizin active sites in the polypeptide backbone of LPH-D1796fs and

LPH-Y1473X respectively. Interestingly, wild type LPH retains its complete enzymatic

activity and intracellular transport competence in the presence of the pathogenic

mutants suggesting that heterozygote carriers presumably do not show symptoms

related to CLD.

26 Publications

Conclusions: Our study strongly suggests that the onset of severe forms of CLD is

elicited by mutations in the LPH gene that occur in either a compound heterozygous

or homozygous pattern of inheritance.

Publications 27

The Diverse Forms of Lactose Intolerance and the Putative Linkage

to Several Cancers

Amiri M.†, Diekmann L.†, von Köckritz-Blickwede M. and Naim H. Y., The Diverse

Forms of Lactose Intolerance and the Putative Linkage to Several Cancers.

Nutrients. 2015 Aug 28;7(9):7209-30. DOI: 10.3390/nu7095332.

†These authors contributed equally to this

Abstract

Lactase-phlorizin hydrolase (LPH) is a membrane glycoprotein and the only β-

galactosidase of the brush border membrane of the intestinal epithelium. Besides

active transcription, expression of the active LPH requires different maturation steps

of the pro-peptide through the secretory pathway, including N- and O-glycosylation,

dimerization and proteolytic cleavage steps. The inability to digest lactose due to

insufficient lactase activity results in gastrointestinal symptoms known as lactose

intolerance. In this review, we will concentrate on the structural and functional

features of LPH protein and summarize the cellular and molecular mechanism

required for its maturation and trafficking. Then, different types of lactose intolerance

are discussed, and the molecular aspects of lactase persistence/non-persistence

phenotypes are investigated. Finally, we will review the literature focusing on the

lactase persistence/non-persistence populations as a comparative model in order to

determine the protective or adverse effects of milk and dairy foods on the incidence

of colorectal, ovarian and prostate cancers.

28 Publications

Structural Determinants for transport of a multi-domain membrane

glycoprotein in the early secretory pathway

Lena Diekmann+, Marc Behrendt+, Mahdi Amiri and Hassan Y. Naim*

Department of Physiological Chemistry, University of Veterinary Medicine Hannover,

Hannover, Germany.

+Authors contributed equally.

*To whom correspondence should be addressed: Department of Physiological

Chemistry, University of Veterinary Medicine Hannover, Bünteweg 17, D-30559

Hannover, Germany,

Tel.: 49 511 9538780, Fax: 49 511 9538585, E-mail: Hassan.Naim@tiho-

hannover.de

Abstract

LPH is a membrane anchored type I glycoprotein of the intestinal epithelium that is

composed of four homologous structural domains. The role of each distinct domain in

the intramolecular organization and function of LPH is not completely understood.

Here, we analyzed the early events of LPH biosynthesis and trafficking by directed

restructuring of the domain compositions. Removal of domain I (LPH∆1) results in a

malfolded ER-localized protein. By contrast, LPH without domain II (LPH∆2) is

normally transported along the secretory pathway, but does not dimerize nor is

enzymatically active. Interestingly a polypeptide stretch in domain II between L735-

R868 exerts an intriguing role in modulating the trafficking behavior of LPH and its

biological function. In fact, association of this stretch with transport-competent LPH

chimeras results in their ER-arrest or aberrant trafficking. This stretch harbors a

unique N-glycosylation site that is responsible for LPH retention in the ER via

association with calnexin and facilitates proper folding of domains I and III before ER

Publications 29

exit of LPH. Notably, a similar N-glycosylation site is also found in domain IV with

comparable effects on the trafficking of LPH-derived molecules. Our study provides

novel insights into the intramolecular interactions and the sequence of events

involved in the folding, dimerization and transport of LPH. Furthermore, these

findings can explain the phenotypic diversity of clinical symptoms in congenital

lactase deficiency, particularly in the heterozygote cases where heterodimerization

can influence the trafficking and function of LPH.

Introduction

Many secreted and membrane proteins are synthesized with prodomains that appear

as clearly outlined regions with distinct boundaries (1,2). Prodomains can be

compact globule modules or linking domains (3) and are proteolytically cleaved along

the secretory pathway, oftentimes in the Golgi apparatus (1). The removal of the

prodomains can be implicated in the functional activation, intracellular trafficking and

sorting of the final mature protein product (2). In addition, it has been postulated that

they can also act as intramolecular chaperones (4), which support or regulate the

folding process of other domains (5,6). Prodomains with assigned intramolecular

chaperone function can be part of the mature protein (7) or can be cleaved from the

maturing protein to yield the final functionally active form of the protein (4) The

immature form of human small intestinal lactase-phlorizin hydrolase (LPH), an

essential brush border enzyme, comprises an N-terminal cleavable signal peptide,

four homologous domains, a transmembrane domain and a cytoplasmic domain ((8)

and Fig. 1A). The pro-peptide Ser20-Arg734 (LPHα) comprising the entire

homologous domain I and more than two thirds of domain II is proteolytically

removed in the trans-Golgi network (TGN) by a trypsin-like protease (9) LPHα is

subsequently degraded (6) and the remaining protein, indicated LPHβinitial, is targeted

to the apical surface of intestinal epithelial cells. In the intestinal lumen pancreatic

trypsin generates the mature form of the polypeptide (LPHβfinal) via removal of the

polypeptide stretch Leu735-Arg868 (indicated LPHstretch) (10).

30 Publications

LPHα is devoid of sorting signals and catalytic activity (11,12) as well as detectable

complex N- or O-glycans (6); however it is rich in cysteine and hydrophobic amino

acid residues suggesting a rapid folding to a compact globular domain that is

stabilized by disulfide bonds (13) and facilitates the formation of a correctly folded

LPHβinitial domain. The chaperone function of LPHα is a particular event in the folding

events of LPH that cannot be compensated by ER-molecular chaperones such as

calnexin or BiP (13). Together with LPHα it can be postulated that the LPHstretch

(Leu735-Arg868) exerts an important role in the correct folding of the pro-LPH.

Recently, we analyzed the roles of homologous domains comprised by mature

LPHβfinal (domains III and IV) (14). Surprisingly, domain III per se revealed transport-

and sorting-competence without the need for the remaining domains. By contrast,

homologous domain IV is neither properly transported nor enzymatically active per

se. Nevertheless, open questions remain to be answered concerning the role of the

synthesized part of nascent LPH, its profragment, in the context of topological

organization, folding cooperativity, and function of the whole protein (15). Moreover,

the fact that the theoretical boundary between homologous domains I and II revealed

by intramolecular sequence alignment and in silico analysis does not correspond to

the cleavage site between LPHα and LPHβinitial (Arg734/Leu735) (8) suggests that

the folding of the LPH profragment is not a simple linear process. Therefore, we set

forth to decipher the impact of homologous domains I and II on the generation of a

transport-competent and enzymatically active configuration of LPH as well as to

study the contribution of each domain to the folding process.

Experimental procedures

Materials and Reagents – DEAE-dextran, pepstatin, leupeptin, antipain, aprotinin,

trypsin inhibitor, phenylmethanesulfonyl fluoride, trypsin, Triton X-100, sodium

dodecyl sulfate (SDS), molecular weight standards for SDS-PAGE, Dulbecco’s

modified Eagle’s medium (DMEM), minimum essential medium (MEM), streptomycin,

penicillin, glutamine, fetal calf serum (FCS), and trypsin-EDTA were acquired from

Publications 31

Sigma-Aldrich (Munich, Germany). Isis DNA polymerase was purchased from

Qbiogene (Heidelberg, Germany). Tissue culture dishes were obtained from Sarstedt

(Nümbrecht, Germany). L-[35S] methionine (>1000 Ci/mmol) and protein A-

Sepharose were obtained from Amersham Biosciences Inc. (Freiburg, Germany).

Acrylamide, N,N’-methylenebisacrylamide, TEMED, ammonium persulfate, and

dithiothreitol were purchased from Carl Roth GmbH (Karlsruhe, Germany).

Restriction enzymes, secondary horseradish peroxidase-conjugated anti-mouse

antibody/Streptavidin were purchased from Thermo Fisher Scientific (Bonn,

Germany). The secondary antibodies coupled to Alexa Fluor® dyes were obtained

from Invitrogen (Karlsruhe, Germany).

Construction of cDNA clones – pΔ1, pΔ2, pLPHβinitial, pLPHβfinal, pDomain-3stretch,

pLPH-N821Q, pLPH-N1340Q and pLPH-N1814Q were generated by loop-

out/mutagenesis PCR using pSG5-LPH and pcDNA3-LPH (14) plasmids as the

template. LPH domains were dissected as described previously (14). The applied

oligonucleotides were obtained from Sigma-Aldrich and are listed in Table 1.

Transient Transfection of COS-1 Cells, Metabolic Labeling,

Immunoprecipitation and SDS-PAGE – COS-1 cells were cultured and transfected

using DEAE-dextran as described previously (14). When indicated the cells were

biosynthetically labeled with [35S] methionine as described previously (14).

Immunoprecipitation and Western Blotting of LPH or the deletion variants from

detergent extracts of the cells was performed according to Naim et al. (16). Co-

immunoprecipitation of LPH with calnexin was performed as reported previously (17).

A panel of monoclonal antibodies (mAbs) against human intestinal LPH (HBB 1/909

(18) and mLac1, mLac2, mLac4, mLac6 and mLac10 (19) was used to detect

different conformations of LPH (6). Where indicated treatment with endoglycosydase

H (endo H) or Peptide -N-Glycosidase F (PNGase F) (both from Roche Diagnostics,

Mannheim, Germany) was performed according to Naim et al. (16), and followed by

32 Publications

SDS-PAGE analysis. The protein bands were visualized using BioRad Molecular

Imager® FX facility. Tryptic protein structure analysis was performed as described

previously (20).

Cell Lysate Fractionation on Sucrose Density Gradients – In order to investigate

the quaternary structure of wild type and variants LPH, fractionation of cell lysates on

sucrose gradients was performed as described previously (14). Transiently

transfected COS-1 cells expressing wild type LPH or chimeric variants were labeled

with [35S] methionine for 6 h, solubilized in 50 mM Tris-HCl buffer pH 7.5 containing

6 mM n-Dodecyl β-D-maltoside, 150 mM NaCl, and protease inhibitors. After pre-

centrifugation, the supernatant was loaded on a 10-30% (w/v) continuous sucrose

gradient and subjected to ultracentrifugation at 100000 x g for 18 h at 4°C.

Afterwards 18 fractions were collected, LPH was immunoprecipitated and analyzed

by SDS-PAGE.

Immunofluorescence and Confocal Fluorescence Microscopy – Subcellular

localization of LPH in transiently transfected COS-1 cells was determined using

indirect immunofluorescence as described previously (21). The primary antibody was

HBB 1/909 for LPH. Detection of the cell surface localized LPH was achieved by

treatment of the live cells with the primary antibody on 4°C, followed by extensive

wash, fixation and exposure to the Alexa Fluor® -coupled secondary antibody.

Confocal laser microscopy was performed with the Leica TCS SP5 microscope using

the 63x oil planachromat lens (Leica Microsystems, Germany).

Biotin assay – Transiently transfected COS-1 cells were treated with Sulfo-NHS-LC-

Biotin (1.5 mg/ ml) for 30 min at 4°C and quenched two times with 0.1% BSA for 10

min at 4°C. The cells were then solubilized with 1% Triton X-100 and LPH was

immunoprecipitated. Each immunoprecipitate was equally splitted into two parts, one

Publications 33

for immunoblotting against total LPH and the other for immunoblotting in non-

reducing conditions followed by detection of the biotin-labeled LPH by the

horseradish peroxidase-conjugated streptavidin. The amount of quantified

biotinylated LPH was related to the amount of total LPH on the corresponding blot.

In silico analysis, quantifications and statistical analysis – Homology-based

multiple sequence alignment of the primary structure of LPH domain was performed

with PRALINE (22). The quantification of the protein bands was performed by

Quantity One® software (BioRad, Munich, Germany). Statistical significance was

determined according to student’s t-test, paired, one-directional with * p ≤ 0.05, ** p ≤

0.01 and *** p ≤ 0,001. Error bars are represented as SEM.

Results

The presence of homologous domain I is crucial for the attainment of transport

competence - To investigate the role of LPH pro-fragment on its folding and

transport events we aimed to construct a deletion variant by removing this part from

the wild-type LPH (Fig. 1). To achieve this purpose, an in silico analysis was

conducted to determine the potential domain boundaries as basis for site-directed

loop-out PCR. cDNA constructs, each lacking the coding region of one homologous

domain (LPHΔ1 and LPHΔ2), were generated (Fig. 2A) and expressed in COS-1

cells. The contribution of each of the two homologous domains was then deciphered

by comparing the outcome of their deletion on the structure, enzymatic function and

trafficking of the truncated protein forms (Fig. 2). The trafficking competence of the

variants from ER to Golgi was assessed by the acquisition insensitivity towards endo

H. As shown in Fig. 2B, LPHΔ2 acquired endo H-resistance indicating that this

deletion variant is properly transported from ER to the Golgi apparatus with a

processing rate comparable to the wild type. Likewise the turnover rates of both LPH

forms were similar as demonstrated in pulse-chase experiments up to 42h (Fig. 2C).

By contrast, truncation of the homologous domain I (LPHΔ1) elicited substantial

34 Publications

effects on the trafficking kinetics and behavior of the variant, which persisted as an

endo H-sensitive ER arrested and transport-incompetent form (Fig. 2B-2C). To

substantiate the biochemical data we addressed the cellular localization of the LPH

variants by indirect immunofluorescence under permeabilized and non-permeabilized

conditions. Fluorescence images obtained by confocal microscopy shown in Fig. 3A

demonstrate an exclusive intracellular localization of LPHΔ1, while LPHΔ2 was

detected intracellularly as well as at the cell surface. We further compared the level

of cell surface expression of the deletion variants versus that of the wild type protein

by cell surface biotinylation of COS-1 cells expressing these proteins. Western

blotting revealed that LPHΔ2 was found at almost similar expression levels at the cell

surface as its wild type counterpart, while LPH∆1 was not detected at the cell surface

(Fig. 3B). Collectively, these data indicate that the presence of the homologous

domain I is essential for the trafficking of LPH, since its deletion resulted in a

transport-incompetent ER-arrested immature protein. On the other hand, domain II is

neither rate-limiting along the early secretory pathway nor decisive in the maturation

of LPH in the Golgi apparatus.

Altered quaternary structure and folding of LPHΔ1 and LPHΔ2 relative to wild

type LPH - We have previously shown that homodimerization of LPH takes place

before LPH exits the ER and matures in the Golgi apparatus (20). Given that the

trafficking and maturation of the truncated form LPHΔ2 are essentially similar to

those of wild type LPH (vide supra), we asked whether LPHΔ2 acquires a quaternary

structure similar to the wild type. For this purpose, cell lysates from transiently

expressing COS-1 cells were subjected to sucrose density gradient followed by

immunoprecipitation and SDS-PAGE analysis and the band intensities were

quantified. As shown in Fig. 4A the mannose-rich form of LPHΔ2 was detected

predominantly as a monomeric form which apparently does not require dimerization

prior to ER egress, where the majority of the complex glycosylated molecules were

mainly found in the denser gradient fractions. The control wild type LPH displayed

two major peaks revealing the mannose-rich form in both of them, while the complex

Publications 35

glycosylated protein was found mainly in the peak that corresponds to the denser

fractions of the gradient. This is in accordance with previous data (20,23). LPHΔ1,

which persists as a mannose-rich glycoprotein in the ER, was found to be exclusively

detected in the lighter fractions of the gradient consistent with its retention in the ER

as a monomeric protein.

Assessment of the folding and functional structure of the deletion variants were

compared to the wild type protein using tryptic structural analysis and measurement

of the enzymatic activities. In tryptic analysis properly folded wild type LPH presents

normally two cleavage sites for trypsin at R734/L735 and R868/A869 positions (Fig.

1) which are subjected to sequential cleavage events during LPH maturation and cell

surface expression. (12,24). As shown in Fig. 4B the digestion profile of LPHΔ2 with

trypsin differed from that of the wild type during the early digestion time points. Here,

a smear of bands appeared that gradually converted to a predominant double band.

Given that both exposed trypsin-cleavage sites in the wild type LPH are located

within the homologous domain II and are thus eliminated in LPHΔ2 (compare Fig.

2A) we conclude that the new trypsin cleavage sites presented in LPHΔ2 are

concomitant with an altered folding pattern than the wild type LPH. Persistence of a

trypsin-resistant domain in both wild type and LPHΔ2 may indicate presence of an

autonomously folded region in both forms, fitting the most to the properties of the

domain III of LPH (14). LPHΔ1, by contrast to wild type LPH and LPHΔ2, was

completely degraded by trypsin already after 1 min of treatment reflecting exposure

of multiple trypsin cleavage sites and causal altered folding in comparison to wild

type LPH and LPHΔ2 (Fig. 4B).

We further determined the enzymatic activities of the immunoprecipitated variants

towards lactose and phlorizin in comparison to the wild type activities. The lactase

activity was not detectable in LPHΔ1 and LPHΔ2. Phlorizin hydrolase activity was

only detectable in LPHΔ2, albeit at substantially reduced levels of 4.3% (Fig. S1,

supplementary data). Since both catalytic sites are present in LPHΔ1 and LPHΔ2,

absence of the enzyme activities in line with the tryptic structural analyses indicate

36 Publications

altered folding of these two isoforms in such a way that affects the functional

domains.

Influence of LPHstretch on the transport competence of LPHβ and domain III -

The transport-competence of LPHΔ2 clearly indicates that domain II of pro-LPH is

not an essential component in the context of trafficking and efficient maturation of

LPH. However, the persistence of LPHΔ2 as a monomeric protein in its mannose-rich

and mature glycoforms, proposes a role for domain II in the dimerization event of

LPH. Of particular interest is a small domain that is composed of 134 amino acids,

later referred to as stretch that corresponds to the difference between LPHβ initial and

LPHβfinal and spans residues L735 to R868. The first of these two forms, LPHβinitial, is

generated from pro-LPH by proteolytic cleavage in the Golgi apparatus after its

complete maturation. The second form, LPHβfinal, is cleaved from LPHβinitial by trypsin

at the apical surface and represents the enzymatic active form of LPH that is

implicated in its digestive function. The role and the requirement for the 134 residues

stretch in the trafficking and function of LPH has not been resolved yet. We

compared the biosynthesis and processing of LPHβinitial, with LPHβfinal (Fig. 5A). As

shown in Fig. 5B, LPHβfinal acquires endo H-resistant complex glycosylated form in a

similar way compared to its wild type counterpart indicating that it is trafficked at

nearly the same rate. However, LPHβinitial appears exclusively as a mannose-rich

protein (see also (13)). Immunofluorescence labeling revealed exclusive localization

of LPHβinitial in the ER and cell surface biotinylation confirmed that LPHβinitial is not

expressed the cell surface (Fig. 6A, 6B). LPHβfinal on the other hand was additionally

localized in the Golgi apparatus and at the cell surface (Fig. 6A, 6B), yet to a lesser

extent as compared to pro-LPH. Interestingly, the cell surface form of LPHβfinal had a

higher molecular weight than expected and even higher than the wild type (Fig. 6B).

The dimerization of pro-LPH has been shown to precede its exit from the ER (20).

We therefore investigated the potential dimerization of these LPH variants as a

potential mechanism responsible for their different trafficking behavior. Fig. 7

demonstrates that the mannose-rich forms of both LPHβinitial and LPHβfinal were

Publications 37

predominantly retained in gradient fractions that peaked in fractions 9. Besides the

peak of the band intensities for the dimeric LPH at fraction 12 (Fig. 4A), identification

of another peak for mature LPH at fraction 14 suggests presence of LPHβfinal in

oligomeric form at the cell surface (Fig. 6B). Overall, the results demonstrate that

both forms do not dimerize in the ER excluding therefore dimerization as a

prerequisite for ER exit of LPH. Given that the sequence difference between the two

LPH forms is limited to the L735-R868 stretch we assumed that this stretch contains

signals that retain LPHβinitial in the ER. To address this possibility we fused the stretch

to the transport-competent and autonomously folded core domain of LPH (LPH-D3)

(14) and examined the trafficking and functional properties of this chimera (LPH-

D3stretch)(Fig. 8A). As demonstrated in Fig. 8B the presence of the LPHstretch in LPH-

D3stretch resulted in a substantial reduction in the trafficking and maturation behavior

of this chimera. In fact, only a small proportion of a mature endo H-resistant LPH-

D3stretch was secreted into the cell culture medium.

The trafficking competence of LPH forms lacking domain II, such as LPH∆2, LPHβfinal

and LPH-D3 supports the view that this domain contains proteinaceous signals that

lead to the retention of LPH or its trafficking delay when made accessible. On the

other hand, wild type LPH and LPH∆4 (14) contain domain II and yet both of them

are transport-competent. We assumed therefore that domain I and domain II could

form pseudodimers within the LPH molecule that mask potential retention signals in

domain II enabling thus LPH to exit the ER. This can explain why those LPH forms or

chimeras that contain domains I and II (wild type LPH, LPH∆3, LPH∆4 (14) or those

that are devoid of domain II (LPH∆2, LPHβfinal) are trafficking-competent. However,

the transport-competence of LPHβfinal is slightly reduced compared to the wild type,

despite the absence of domain II. It is likely that domain IV itself is rate-limiting in the

trafficking of this chimera, given that domain III per se is transport-competent and its

deletion elicits transport block of LPH (14). Moreover, deletion of domain IV

generates a protein that is more rapidly trafficked from the ER (14). Previous studies

have shown that deletion of the membrane domain while keeping the entire

homologous domains results in a transport-incompetent LPH (20).

38 Publications

Influence of LPHstretch on the interaction of different LPH variants with the ER-

localized chaperone calnexin - The observed ER retention led us to explore the

potential retention signal within the stretch of LPH and its counterpart in domain IV. In

silico analysis and sequence alignments predicted a unique and highly potent N-

glycosylation site at Asn821 of domain II and Asn1814 of domain IV that is present in

a conserved region between these two domains (Fig. 9A). Based on the homological

sequence alignment, the equivalent position in domain III is Asp1338. N-glycosylation

at these sites can potentially trigger association of ER chaperone calnexin with

domains II and IV, providing a specific checkpoint for the quality control of the LPH

folding state before leaving the ER. To assess this hypothesis, LPH in wild type or

chimeric forms was immunoprecipitated from transiently transfected COS-1 cell

lysate and the ratio of co-immunoprecipitated calnexin in each sample was

determined by Western blot analysis. As shown in Fig. 9B, LPHβinitial that lacks

domain I and a major part of domain II except the stretch region associates with

calnexin to a comparable extent as the wild type LPH. On the other hand, the

absence of the stretch region in LPH∆2 and LPHβfinal results in a clear reduction in

the association with calnexin in these variants supporting the notion that at least one

calnexin binding site does exist within this stretch region. Altogether, the association

with calnexin reveals an immediate reverse correlation with the maturation rate of the

LPH-derived molecules, so that less transport-competent LPH forms associate more

avidly with calnexin (Fig. 9B). A similar experiment was performed using LPH-N821Q

and LPH-N1814Q variants which lack the hypothesized N-glycosylation site in the

domains II and IV respectively as well as LPH-N1340Q in which the closest potential

N-glycosylation site to Asp1338 is removed. The results clearly indicate that both

mutants, LPH-N821Q and LPH-N1814Q, interact to a lesser extent with calnexin

compared to the wild type, but yet are blocked in the ER likely due to misfolding (Fig.

9C). The mutation N1340Q in domain III results in a similar interaction of LPH with

calnexin compared to the wild type, indicating that this position is not implicated in

the interaction of LPH with calnexin (Fig. 9C).

These findings establish a hierarchical trafficking pattern between wild type LPH and

several non-trafficked chimeras. Thus, wild type LPH, LPH∆2, and LPH-D3 are

Publications 39

transport-competent proteins in contrast to LPH∆1 and LPHβinitial, while only a small

proportion of LPH-D3stretch is transported and secreted into the external medium.

Together with the data on the association of wild type LPH wild type and the various

LPH chimeras with calnexin, we can conclude that exposure or masking of certain N-

glycosylation sites within the LPH act as a quality control measure and can regulate

further trafficking. In the partially folded wild type LPH these glycosylation sites in

domains II and IV are accessible for association with calnexin in order to ensure

proper folding of the entire protein. In the correctly folded protein these sites are

possibly masked by the neighboring domain.

Discussion

Folding of multi-domain proteins is achieved by synchronized interactions established

among different structural domains with each other and with the molecular

chaperones in order to obtain the native functional conformation (14). The capability

of actual advanced methods including ultrafast NMR (25) for studying the structure

and dynamics of nascent proteins is restricted to small soluble proteins and cannot

be applied to multi-domain gross proteins. Therefore, other approaches are needed

to elucidate early events in the biosynthesis of more complex proteins.

With its unique β-galactosidase function, LPH has an indispensable role in the

maintenance of the normal intestinal function. This protein is a multi-domain

membrane anchored glycoprotein for which functional expression at the intestinal

lumen requires proper post-translational modifications, including N- and O-

glycosylation, dimerization and proteolytic cleavage, a complex intramolecular

organization and a targeted apical sorting. Intracellular maturation of LPH illustrates a

high order of domain-domain interactions. Firstly, two domains (LPHα and domain III)

act as intramolecular chaperones for the folding of the entire protein (13,14).

Secondly, the membrane anchor, the cytoplasmic domain and a stretch in domain IV

contribute to attainment of a transport-competent enzyme by contributing to the dimer

formation in the ER (19,20). And thirdly, despite a very high homology to the

40 Publications

functional domains, LPHα consisting of domain I and a major part of domain II has no

enzymatic activity, is cleaved off and ultimately is degraded in the Golgi apparatus.

With the lack of three dimensional structural analysis of LPH we generated a library

of LPH-derived proteins with the ultimate goal of elucidating the domains interaction

and identification of key elements in the overall LPH structure. A central piece of

knowledge that came out of these studies is that domain II contains potential

retention signals that prevent LPH from exiting the ER until it has acquired its proper

folding. This notion is supported by the observations that fusion of domain II or the

LPHstretch to any transport-competent LPH domain renders the generated chimeras

either transport-incompetent (e.g. LPHβinitial) or reduces substantially their trafficking

efficiency (LPH-D3stretch). Along supportive lines is that elimination of domain II from

LPH (LPHΔ2) has no marked effects on the transport of this LPH form out of the ER.

A similar retention mechanism is also detectable for domain IV, so that the single

expressed fully transport competent domain III has a substantially higher trafficking

rate in comparison to the domain III-domain IV chimera. When expressed collaterally,

domain I has the capability to suppress potential retention signals in domain II. The

presence of domain I is sufficient to restore trafficking of chimeras that contained

domain II and are arrested in the ER. Domain I is a part of the intramolecular

chaperone LPHα and its deletion in LPHΔ1 results in a malfolded protein that has lost

its enzymatic activity and is not transported out of the ER. A scenario of the

trafficking of pro-LPH proposes that (a) the correct folding of homologous domain I is

an early and crucial step for the attainment of the profragment chaperone function

and (b) homodimerization, the late ER event, is a crucial step in acquisition of the

functional capacity of LPH. Interestingly, LPHΔ2 is trafficked with almost similar

efficiency to the cell surface as wild type pro-LPH, but without acquisition of a dimeric

form in the ER clearly indicating that this event in contrast to pro-LPH is not required

for ER-exit. Furthermore, it proposes that domain II, perhaps in association with

domain I, contributes to the dimeric formation, otherwise LPHΔ2 would also form

dimers as pro-LPH. Indeed none of the transport-competent deletion variants or

chimeras acquires a dimeric structure. However, neither one of these monomeric and

Publications 41

transport-competent LPH forms are enzymatically-active. In light of all these findings

a new role of dimerization in the function and life cycle of LPH can be proposed.

The view that dimerization is a necessary and sufficient condition for pro-LPH to exit

the ER (20,26) is absolutely valid when the membrane anchoring domain, domain I,

domain II and domain IV are present to establish the dimerization event (14,20). In

fact, deletion of domain II or IV leads to an increased trafficking rate of the LPH

chimera without dimerization in the ER. Higher order multimeric forms can be

detected for the mature LPH (14). It is obvious therefore that these forms which all

are correctly trafficked and folded require all three domains for dimerization. Despite

the strong structural homologies and the anticipated autonomous nature of each of

the domains, their interaction creates a trafficking behavior of the various chimeras

that can be accommodated within a hierarchical concept. Our results suggest that

Asn821 in domain II and Asn1814 in domain IV are potential interaction sites of LPH

with the ER chaperone calnexin. These interactions promote folding of the partially

folded pro-LPH molecule on the expense of a longer processing and residence time

in the ER. We propose a model in which the folding and assembly of pro-LPH occurs

through two similar phases implicating domains I and II on one hand and III and IV on

the other (Fig. 10). Along this, domains II and IV through their potential retention

signals retain pro-LPH until domains I and III have properly folded and are thereafter

capable of interacting simultaneously with domains II and IV. Domains II and IV, now

in their proper conformation facilitate together with the membrane anchoring domain

the dimerization of pro-LPH.

Elucidation of the structural-functional relevance of the domains in pro-LPH is crucial

in unravelling and understanding the molecular basis of carbohydrate malabsorption

disorders that are associated with lactase deficiency or lactase malfunction.

Nevertheless, the concept that emerges from these studies is that the unique

structural arrangement of the homologous domains in pro-LPH may be immediately

associated with the pathogenesis of congenital lactase deficiency. The requirements

for the formation of homodimerization of LPH wild type molecules in the ER are

important to further investigate the possibility of heterodimer formation in a

42 Publications

heterozygote inheritance trait. Thus, the elucidation of the early events in the

biosynthesis of nascent LPH is not only of crucial relevance to intestinal cell

physiology, but it also provides an example on how the interaction of homologous

and autonomous domains affects the functional and trafficking properties of multi-

domain membrane-anchored proteins.

Acknowledgments

The authors thank Dr. Hans-Peter Hauri, formerly University of Basel, Switzerland,

Dr. Erwin Sterchi, formerly University of Bern, Switzerland, and Dr. Dallas Swallow,

University College London, UK, for generous gifts of monoclonal anti-LPH antibodies.

This work has been supported by SFB 621 (HYN).

Conflict of interest

The authors confirm that they have no conflict of interest.

Author contribution

LD and MB performed the experiments, analyzed the data and drafted a first version

of the manuscript. MA designed the study, analyzed the data and contributed to

drafting the manuscript. HYN designed the study, analyzed the data and wrote the

final version of the manuscript. All authors read and approved the final manuscript.

Publications 43

References

1. Reines, A., Bernier, L. P., McAdam, R., Belkaid, W., Shan, W., Koch, A. W.,

Seguela, P., Colman, D. R., and Dhaunchak, A. S. (2012) N-cadherin

prodomain processing regulates synaptogenesis. J Neurosci 32, 6323-6334

2. Ozawa, M., and Kemler, R. (1990) Correct proteolytic cleavage is required for

the cell adhesive function of uvomorulin. J Cell Biol 111, 1645-1650

3. Brunger, A. T. (2001) Structure of proteins involved in synaptic vesicle fusion

in neurons. Annu Rev Biophys Biomol Struct 30, 157-171

4. Inouye, M. (1991) Intramolecular chaperone: the role of the pro-peptide in

protein folding. Enzyme 45, 314-321

5. Oberholzer, T., Mantei, N., and Semenza, G. (1993) The pro sequence of

lactase-phlorizin hydrolase is required for the enzyme to reach the plasma

membrane. An intramolecular chaperone? FEBS Lett 333, 127-131

6. Naim, H. Y., Jacob, R., Naim, H., Sambrook, J. F., and Gething, M. J. (1994)

The pro region of human intestinal lactase-phlorizin hydrolase. J Biol Chem

269, 26933-26943

7. Jacob, R., Purschel, B., and Naim, H. Y. (2002) Sucrase is an intramolecular

chaperone located at the C-terminal end of the sucrase-isomaltase enzyme

complex. J Biol Chem 277, 32141-32148

8. Mantei, N., Villa, M., Enzler, T., Wacker, H., Boll, W., James, P., Hunziker, W.,

and Semenza, G. (1988) Complete primary structure of human and rabbit

lactase-phlorizin hydrolase: implications for biosynthesis, membrane anchoring

and evolution of the enzyme. Embo J 7, 2705-2713

9. Naim, H. Y. (1992) Processing of human pro-lactase-phlorizin hydrolase at

reduced temperatures: cleavage is preceded by complex glycosylation.

Biochem J 285 ( Pt 1), 13-16

44 Publications

10. Jacob, R., Radebach, I., Wuthrich, M., Grunberg, J., Sterchi, E. E., and Naim,

H. Y. (1996) Maturation of human intestinal lactase-phlorizin hydrolase:

generation of the brush border form of the enzyme involves at least two

proteolytic cleavage steps. Eur J Biochem 236, 789-795

11. Jacob, R., Brewer, C., Fransen, J. A., and Naim, H. Y. (1994) Transport,

function, and sorting of lactase-phlorizin hydrolase in Madin-Darby canine

kidney cells. J Biol Chem 269, 2712-2721

12. Grunberg, J., Luginbuhl, U., and Sterchi, E. E. (1992) Proteolytic processing of

human intestinal lactase-phlorizin hydrolase precursor is not a prerequisite for

correct sorting in Madin Darby canine kidney (MDCK) cells. FEBS Lett 314,

224-228

13. Jacob, R., Peters, K., and Naim, H. Y. (2002) The prosequence of human

lactase-phlorizin hydrolase modulates the folding of the mature enzyme. J Biol

Chem 277, 8217-8225

14. Behrendt, M., Polaina, J., and Naim, H. Y. (2010) Structural hierarchy of

regulatory elements in the folding and transport of an intestinal multidomain

protein. J Biol Chem 285, 4143-4152

15. Wu, L., Li, W. F., Liu, F., Zhang, J., Wang, J., and Wang, W. (2009)

Understanding protein folding cooperativity based on topological

consideration. J Chem Phys 131, 065105

16. Naim, H. Y., Sterchi, E.E., Lentze, M.J. (1987) Biosynthesis and maturation of

lactase-phlorizin hydrolase in the human small intestinal epithelial cells.

Biochemical Journal 241, 427-434

17. Amiri, M., and Naim, H. Y. (2014) Long term differential consequences of

miglustat therapy on intestinal disaccharidases. J. Inherit. Metab. Dis. 37, 929-

937

Publications 45

18. Ouwendijk, J., Peters, W. J., van de Vorstenbosch, R. A., Ginsel, L. A., Naim,

H. Y., and Fransen, J. A. (1998) Routing and processing of lactase-phlorizin

hydrolase in transfected Caco-2 cells. J Biol Chem 273, 6650-6655

19. Panzer, P., Preuss, U., Joberty, G., and Naim, H. Y. (1998) Protein domains

implicated in intracellular transport and sorting of lactase-phlorizin hydrolase. J

Biol Chem 273, 13861-13869

20. Naim, H. Y., and Naim, H. (1996) Dimerization of lactase-phlorizin hydrolase

occurs in the endoplasmic reticulum, involves the putative membrane

spanning domain and is required for an efficient transport of the enzyme to the

cell surface. Eur J Cell Biol 70, 198-208

21. Behrendt, M., Keiser, M., Hoch, M., and Naim, H. Y. (2009) Impaired trafficking

and subcellular localization of a mutant lactase associated with congenital

lactase deficiency. Gastroenterology 136, 2295-2303

22. Simossis, V. A., and Heringa, J. (2005) PRALINE: a multiple sequence

alignment toolbox that integrates homology-extended and secondary structure

information. Nucleic Acids Res 33, W289-294

23. Jacob, R., Weiner, J. R., Stadge, S., and Naim, H. Y. (2000) Additional N-

glycosylation and its impact on the folding of intestinal lactase-phlorizin

hydrolase. J Biol Chem 275, 10630-10637

24. Jacob, R., Bulleid, N. J., and Naim, H. Y. (1995) Folding of human intestinal

lactase-phlorizin hydrolase. J Biol Chem 270, 18678-18684

25. Hsu, S. T., Fucini, P., Cabrita, L. D., Launay, H., Dobson, C. M., and

Christodoulou, J. (2007) Structure and dynamics of a ribosome-bound nascent

chain by NMR spectroscopy. Proc Natl Acad Sci U S A 104, 16516-16521

26. Danielsen, E. M. (1990) Biosynthesis of intestinal microvillar proteins.

Dimerization of aminopeptidase N and lactase-phlorizin hydrolase.

Biochemistry 29, 305-308

46 Publications

Footnotes

This work was funded by the German Research Foundation (DFG) (SFB 621 to

HYN).

Abbreviations: PNGase F, Peptide -N-Glycosidase F; endo H, endoglycosidase H;

ER, endoplasmic reticulum; LPH, lactase-phlorizin hydrolase (all forms); LPHh,

mannose-rich precursor; LPHc, complex glycosylated precursor; TGN, trans-Golgi

network

Figure legends

Fig. 1: Schematic presentation of wild type and LPH deletion variants. A) Main

features of intestinal LPH structure. pro-LPH consists of a cleavable signal sequence

(SS; Met1-Gly19) and an extracellular region comprising homologous domains I–IV

(Ser20-Thr1882). The initial cleavage step takes place between Arg734 and Leu735

generating LPHβinitial; removal of the polypeptide stretch Leu735/Arg868 occurs by

luminal trypsin creating LPHβfinal. Cleavage sites are indicated by asterisks; location

of the phlorizin hydrolase (E1273) and lactase (E1749) activities, respectively, are

indicated by triangles. MA refers to the membrane anchor and Cyt refers to the

cytoplasmic tail.

Fig. 2: Glycosylation pattern and trafficking of LPH wild type and domain

deletion variants in COS-1 cells. A) Schematic representation of the domain

deletion variants generated by loop-out mutagenesis. B) Transiently transfected

COS-1 cells were biosynthetically labeled for 6 h, LPH was immunoprecipitated and

treated with/without endo H. Quantification of four independent experiments is

Publications 47

presented. C) Turnover of LPH variants determined by biosynthetic labelling of

transiently expressing COS-1 cells for 2 h (pulse) followed by chase time points as

indicated periods (in hours) with cold methionine.

Fig. 3: Subcellular distribution and cell surface localization of LPH wild type

and domain deletion variants in COS-1 cells. A) Indirect immunofluorescence for

transiently transfected COS-1 cells with permeabilization for intracellular staining or

without permeabilization for extracellular staining. B) COS-1 cells transiently

expressing LPH were treated with biotin, lysed and immunoprecipitated.

Immunoprecipitates were divided into two equal aliquots and used for LPH or

Streptavidin blotting.

Fig. 4: Structural features of LPH deletion variants in COS-1 cells. A) For

assessment of the quaternary structure of LPH, transiently transfected COS-1 cells

were biosynthetically labeled for 6 h and solubilized by n-Dodecyl β-D-maltoside. Cell

lysates were fractionated on a sucrose density gradient, immunoprecipitated and

analyzed by SDS-PAGE. For quantification the intensities of all bands of one gradient

were set as 100% and each band is diagrammed as a percentage value compared to

the total protein amount. B) Trypsin sensitivity assay of wild type and LPH variants

from transiently transfected COS-1 cells after biosynthetic labelling and

immunoprecipitation. 100 BAEE units of trypsin were used for different time points.

Fig.5: Glycosylation pattern, structural features and subcellular distribution of

LPH wild type, LPHβinitial and LPHβfinal in COS-1 cells. A) Schematic presentation

of the LPHβfinal and LPHβinitial generated by loop-out mutagenesis. B) Transiently

transfected COS-1 cells were biosynthetically labeled for 6 h, immunoprecipitated

and resolved on SDS-PAGE. Intensities of mannose-rich and complex N- and O-

glycosylated forms are calculated from three independent experiments. C) Turnover

48 Publications

of LPH variants determined by biosynthetic labelling of transiently expressing COS-1

cells for 2 h (pulse) followed by chase time points (in hours) as indicated with cold

methionine.

Fig. 6: Subcellular distribution and cell surface localization of LPHβinitial and

LPHβfinal in COS-1 cells. A) Indirect immunofluorescence for transiently transfected

COS-1 cells with permeabilization for intracellular staining or without permeabilization

for extracellular staining. B) COS-1 cells transiently expressing LPH were treated

with biotin, lysed and immunoprecipitated. Immunoprecipitates were divided into two

equal aliquots and used for LPH or Streptavidin blotting.

Fig. 7: Structural features of LPHβinitial and LPHβfinal in COS-1 cells. For

assessment of the quaternary structure of LPH, transiently transfected COS-1 cells

were biosynthetically labeled for 6 h and solubilized by n-Dodecyl β-D-maltoside. Cell

lysates were fractionated on a sucrose density gradient, immunoprecipitated and

analyzed by SDS-PAGE. For quantification, intensities of all bands of one gradient

were set as 100% and each band is diagrammed as a percentage value compared to

the total protein amount.

.

Fig. 8: Expression of LPH-D3 and LPH-D3stretch in COS-1 cells. A) Schematic

representation of the LPH-D3 and LPH-D3stretch constructs. B) COS-1 cells were

biosynthetically labeled for 6 h, proteins were immunoprecipitated from cell lysates

and - where indicated - from cell culture media, treated with endo H or PNGase F, or

not treated and analyzed by SDS-PAGE.

Fig. 9: Comparison of a potential calnexin binding motif within different

domains of LPH. A) Homology-extended multiple sequence alignment of domains II,

Publications 49

III and IV of LPH. The arrow shows the position of Asn821 in domain II and Asn1814

in domain IV of LPH. Asn1340 in domain III is indicated by an asterisk. B) To

determine the ratio of calnexin association with different LPH variants, COS-1 cells

transiently expressing LPH-WT, LPH∆2, LPHβinitial and LPHβfinal were lysed, LPH was

immunoprecipitated and subjected to anti-LPH and anti-Calnexin immunoblotting.

The ratio of calnexin association with each variant was rated by the amount of co-

immunoprecipitated calnexin versus the mannose-rich glycosylated ER form of LPH.

Quantification is presented from three independent experiments. C) Calnexin

associated with LPH-N821Q, LPH-N1340Q and LPH-N1814Q was similarly detected.

As a control untransfected COS-1 cells were used. The ratio of calnexin association

with each mutant was rated by the amount of co-immunoprecipitated calnexin versus

the mannose-rich glycosylated ER form of LPH. Quantification is presented from four

independent experiments.

Fig. 10: Proposed model for the folding events of nascent LPH. In the ER,

partially folded LPH is interacting with calnexin/calreticulin chaperone system at

domains II and IV. This interaction promotes functional folding of the whole protein

which can then be arranged in a dimeric conformation mediated by regions in

cytoplasmic and transmembrane sections as well as domains II and IV. The dimeric

structure will then leave the ER to the Golgi apparatus.

50 Publications

Tables

Table I. A list of the wild type and variant constructs used in this study

Protein Plasmid for

biochemical/

confocal analysis

Oligonucleotides 5’-3’

LPH-WT pcDNA3-LPH

(Behrendt et al.,

2010)

-

LPHΔ1 pΔ1 ctaagtttttcatgctgggggttcctgcaggatactttccctg*

LPHΔ2 pΔ2 gtccagggcggaaagggatgccttctaccacgggacgtttcgg*

LPHβfinal pJB20-LPHβfinal

(Jacob et al.,

2002)

-

LPHβinitial pLPHβinitial gctaagtttttcatgctgggggtcactgttgcagtttgtatccctgg*

LPH-D3 pD3 (Behrendt et

al., 2010)

-

LPH-

D3stretch

pDomain-3stretch gctaagtttttcatgctgggggtcactgttgcagtttgtatccctgg*

LPH-D123 pDomain-123 gccactggccagggaggatgagtgagaattctttctgtacggacggtttcctg*

LPH-D1234 pDomain-1234 ggcaccacagaagcacagacatgaattcgctttgtacgttctcttttctc*

LPH-D23 pDomain-23 gccactggccagggaggatgagtgagaattctttctgtacggacggtttcctg*

*Forward mutagenesis primer. The reverse primer is the complementary sequence of the

forward primer.

Publications 51

Figures Figure 1

Figure 2A

Figure 2B

52 Publications

Figure 2C

0

20

40

60

80

100

LPH-WT LPH∆1 LPH∆2

rela

tive p

rote

in a

mount %

complex

mannose-rich

Publications 53

Figure 3A

Figure 3B

54 Publications

Figure 4A

Publications 55

0

5

10

15

20

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18

perc

enta

ge %

fractions

LPH-WT

mannose-rich

complex-glycosylated

0

5

10

15

20

25

30

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18

perc

enta

ge %

fractions

LPH∆1

mannose-rich

0

5

10

15

20

25

30

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18

perc

enta

ge %

fractions

LPH∆2

mannose-rich

complex glycosylated

56 Publications

Figure 4B

Publications 57

Figure 5A

Figure 5B

58 Publications

Figure 5C

0

20

40

60

80

100

LPH-WT LPHβinital LPHβfinal

rela

tive p

rote

in a

mount %

complex

mannose-rich

Publications 59

Figure 6A

Figure 6B

60 Publications

Figure 7A

0

5

10

15

20

25

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18

perc

enta

ge %

fractions

LPHβinitial

mannose-rich

0

5

10

15

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18

perc

enta

ge %

fractions

LPHβfinal

mannose-rich

complex glycosylated

Publications 61

Figure 8A

Figure 8B

62 Publications

Figure 9A

Figure 9B

*

*

Publications 63

Figure 9C

64 Publications

Publications 65

Figure 10

66 Discussion

Discussion

Difficulties in the diagnosis and possible molecular causes of the low lactase

activity in CLD patients

Congenital lactase deficiency is an autosomal recessive inherited disease of infants.

The patients suffer from severe gastrointestinal symptoms, due to the lack of lactase

activity (0-10 U/g) shortly after breast-feeding or the introduction of lactose-containing

formulas (Holzel, 1968; Savilahti et al., 1983). Un- or misdiagnosis of CLD is life-

threatening, because the osmotic diarrhea leads to dehydration, acidosis and weight

loss after a few weeks of life. However, duodenal biopsies could show that the

histological characteristics such as microvilli morphology and the activities of the

other disaccharidases, SI and MGAM, are totally normal (Savilahti et al., 1983). After

correctly diagnosis, infants get a lactose-free diet and the children are able to follow

their normal developmental processes (Launiala et al., 1966; Savilahti et al., 1983).

One possible disease that might be associated with CLD is nephrocalcinosis, which

is characterized by elevated calcium concentrations in the blood and low excretion

with urine (Saarela et al., 1995; Fazeli et al., 2015). After the correction of

dehydration and beginning of lactose-free diet it takes months until the problems fully

disappear.

The diagnosis of CLD is difficult, because the gastrointestinal symptoms in infants

can have other causes. Different bacterial infections of the gastrointestinal tract can

cause similar symptoms or the infection with rotavirus or adenovirus. Such

gastrointestinal symptoms can also be caused by cow’s milk protein allergy or by

congenital diarrheal disorders.

There are several congenital diarrheal disorders that manifest in the first few weeks

of life with chronic diarrhea after ingestion. The etiology of these disorders is diverse

including dysregulation of the intestinal immune response, defects in the

enteroendocrine cells or in the predominant intestinal epithelial cells, the enterocytes

(Canani et al., 2015). Examples for the last type are the microvillus inclusion disease,

Discussion 67

congenital tufting enteropathy, familial hemophagocytic lymphohistiocytosis type 5

and trichohepatoenteric syndrome (Muller et al., 2008; Sivagnanam et al., 2008; zur

Stadt et al., 2009; Hartley et al., 2010; Fabre et al., 2012; Wiegerinck et al., 2014).

Those congenital diarrheal disorders are caused by autosomal recessive mutations

in genes of the brush-border enzymes, like LPH or SI in case of CLD/CSID (Ritz et

al., 2003; Kuokkanen et al., 2006) or in genes of transporter proteins, like SLGT1 that

encodes the Na+/glucose cotransporter, which is responsible for the uptake of the

monosaccharides glucose and galactose (Martin et al., 1996). Other mutations

causing congenital diarrhea lead to defects in the intracellular protein or lipid

transport, the lipid metabolism and intestinal barrier function (Overeem et al., 2016).

The identification of these mutations, which are all autosomal recessive inherited, is

important for genetic counseling and prenatal diagnosis for heterozygote carriers.

Most of the diseases causing congenital diarrhea are diagnosed by an intestinal

biopsy to determine the histological characteristics and the enzymatic activities of the

brush border membrane disaccharidases. Such a surgery is an invasive event for an

infant, who suffers from severe gastrointestinal symptoms. Therefore the

identification of genetic defects by sequencing assays is a better and faster

differential diagnostic tool, because the result of the genetic test describes the basic

defect and excludes secondary effects. This test should be used generously in

suspected cases by gastroenterologists, neonatologists and pediatricians. Basic

research is needed to identify further mutations which are associated with the

development of congenital diarrheal disorders.

The origin of CLD is most likely in Finland, because until now 7 out of the 13 known

mutations causing CLD were detected in Finnish patients (Kuokkanen et al., 2006;

Torniainen et al., 2009) and Finland has the highest incidence of CLD with 1:60000

(Peltonen et al., 1999; Norio, 2003; Norio, 2003). In the last few years also cases of

CLD have been reported somewhere else in the world (Uchida et al., 2012; Sala

Coromina et al., 2014; Fazeli et al., 2015), indicating that CLD is not only a Finnish

disease, despite it is one of the rare monogenic disorders, which are enriched in the

Finnish population (Peltonen et al., 1999). Besides CLD, there is another lactase

68 Discussion

deficiency, called adult-type of hypolactasia (ATH), which is also a recessively

inherited disorder and is related to DNA variants affecting the LCT gene. The

molecular mechanisms are very different. CLD is caused by mutations in the LCT

gene, which lead to low activity. One possible explanation for the low or absent

lactase activity is the effect of the mutation on the protein itself by e.g. resulting in

misfolded protein that is ultimately degraded. Another explanation is the nonsense-

mediated mRNA decay (NMD), a surveillance pathway leading to degradation of

mRNA, induced by premature termination codons, to eliminate the production of

harmful truncated proteins (Maquat, 2005). Previous studies could show that the

NMD modulates human disease phenotypes (Baserga and Benz, 1988; Frischmeyer

and Dietz, 1999; Inoue et al., 2004; Gorbenko del Blanco et al., 2012). In contrast the

molecular mechanism of ATH phenotype is caused by nucleotide variants

representing distal enhancer polymorphisms, which down-regulate developmentally

the transcript levels of the LCT gene. One known polymorphism leading to the

developmental down-regulation of lactase levels is C/T−13910 (Enattah et al., 2002;

Rasinpera et al., 2005). The C−13910 allele typically accounts for 8% of expressed LCT

mRNA (Kuokkanen et al., 2003). Interestingly, one study could show in a duodenal

biopsy from a patient, who was heterozygous for the CLD nonsense mutation

Y1390X and also heterozygous for the ATH SNP C−13910, that both alleles had the

same levels of LCT transcripts (Kuokkanen et al., 2003), confirming the idea that

mRNA, induced by premature termination codons, leads to NMD. This discovery

facilitates a direct genetic test as the best diagnosis of suspected CLD patients.

Previously the diagnosis based on the symptoms and low lactase activity in enzyme

assays from duodenal biopsies.

Identification and molecular analysis of two novel mutations of the LCT gene

causing CLD

The two novel mutations in the LCT gene c.4419C>G (p.Y1473X) in exon 10

transmitted from the mother and c.5387delA (p.D1796fs) in exon 16 transmitted from

Discussion 69

the father were found in a Japanese female infant. Both mutations are located in

domain IV of the extracellular domain of LPH and result in a truncation of domain IV

and complete elimination of the transmembrane domain and the cytosolic tail. The

girl suffered from severe watery diarrhea from the age of two days on breast feeding

and lactose containing cow´s milk formula and lost 13% of her birth weight during two

days. After the implementation of a lactose-free diet, the diarrhea stopped and her

overall condition improved remarkably. At the age of 4 month a lactose challenge test

was performed. The blood glucose level showed no increase during 120 min,

indicating that the suspected CLD could be confirmed (Uchida et al., 2012).

The biochemical analysis of the two mutations in the LCT gene discovered two

mutated proteins, which are blocked in the ER. Determination of the type of N-

glycosylation indicated that both mutants are mannose-rich N-glycosylated and

exclusively endo H-sensitive. The cellular localization was confirmed by

immunofluorescent analysis. Both mutants are predominantly localized in the ER as

assessed by the ER net-like structures. Further, it could be proven that the mutated

proteins are enzymatically inactive, despite of the presence of the lactase activity site

in the mutant LPH-D1796fs and both are degraded in the ER, probably due to the

ERAD pathway. These results support the view that the lack of lactase activity in

CLD patients is due to the effect of the mutation of the protein itself and disagree with

the opinion that NMD is responsible for the absent lactase activity. Previous studies

suggested that the mutation Finmajor (Y1390X) induces NMD and lead thereby to a

decrease of ~90% of the transcript levels of LCT (Kuokkanen et al., 2006). It is

known that intron-less cDNA normally used in in vitro systems is insensitive to NMD

(Gorbenko del Blanco et al., 2012), therefore biopsy samples from patients would be

needed to clarify the role of NMD in the pathogenesis of CLD. Recently, one study

could prove NMD as a mechanism for protein C deficiency caused by two nonsense

mutations (Luan et al., 2015). Surprisingly, they used recombinant plasmids

expressing the cDNA of the mutant or wild type protein in a transient transfection

system. The increased mRNA levels of the mutants after treatment with UPF1 siRNA,

70 Discussion

which should inhibit NMD, lead to the conclusion that NMD is involved in this

process. These results disagree with previous findings that intron-less cDNA

normally used in in vitro systems is insensitive to NMD (Gorbenko del Blanco et al.,

2012). The biochemical results of the two mutants LPH-Y1473X and LPH-D1796fs

show that the transcriptional products are detectable by immunoprecipitation.

Fluctuations might be possible due to the different binding affinities of the proteins to

the monoclonal antibodies or the utilized transient transfection method. The pulse

chase experiment clearly indicates that the mutants are ultimately degraded in the

ER mostly within the first 4 h of chase, while the wild type is still detectable after 12 h

of chase. The intensity of the fluorescent signal 48 h post transfection confirm that

the mutant proteins have similar protein levels within the cell compared to the wild

type. To definitely prove the hypothesis that the protein levels of the mutants and the

wild type are comparable, it would need the generation of stable cell lines to avoid

the overexpression system in COS-1 cells. One possible experiment to clarify if

degradation takes place via the ERAD pathway would be the usage of a proteasomal

inhibitor.

The results of the biochemical analysis of the two mutants are similar to a previous

study, which analyzed the mutation G1363S that was found in two cases of CLD with

Finnish and Turkish origin (Kuokkanen et al., 2006; Torniainen et al., 2009). This

mutation results also in an ER-blocked and mannose-rich N-glycosylated protein,

which has no detectable lactase activity (Behrendt et al., 2009). The LPH-G1363S

mutant is a temperature-sensitive protein, which exits the ER to the Golgi apparatus

by lowering the temperature to 20°C (Behrendt et al., 2009). This effect could be

detected in several protein folding diseases that are caused by mutations in the

respective proteins (Cheng et al., 1990; Propsting et al., 2003). The mutants LPH-

Y1473X and LPH-D1796fs are also blocked in the ER by 20°C, which usually leads

to a accumulation of the proteins in the Golgi apparatus (Mottet et al., 1986).

Interestingly, the protein amounts of the mutated proteins are detectable after 18 h of

Discussion 71

chase. This result can be a result of improved folding of the mutants in the ER via

chaperones or due to a reduced degradation ratio at lower temperatures.

In general, it is strikingly that 9 out of 13 known mutations in the LCT gene causing

CLD are either frameshift- or nonsense-mutations, which introduce a premature

truncation of the protein (Table 2). Taken together with the results of the biochemical

analysis of the mutation Y1390X, it can be hypothesized that premature truncation of

LPH leads to a mannose-rich N-glycosylated protein that is enzymatically inactive. A

previous study could define the presence of the transmembrane domain as a crucial

criterion for the maturation of LPH. While the construct containing the

transmembrane domain was normally glycosylated and transported along the

secretory pathway, its anchorless counterpart was blocked in the ER as a monomeric

mannose-rich N-glycosylated protein (Panzer et al., 1998). Not only mutations in the

lactase gene lead to gastrointestinal disorders by disrupting the normal trafficking

and function of an enzyme of the brush border membrane. CLD belongs to the

congenital diarrheal disorders, a group of enteropathies with a typical onset early in

life and with similar gastrointestinal symptoms, often caused by autosomal recessive

mutations. Besides the brush border membrane enzymes, transporter proteins,

proteins which are important for protein or lipid transport, lipid metabolism or

intestinal barrier function can be affected (Overeem et al., 2016). Among the brush

border membrane enzymes, sucrase-isomaltase (SI) and maltase-glucoamylase

(MGAM) are well-characterized proteins that are associated to congenital sucrase-

isomaltase deficiency and congenital maltase-glucoamylase deficiency, respectively

(Terrin et al., 2012). Pathogenic mutations causing CSID have been analyzed in

more detail and one of the identified phenotypes, phenotype 1, also lead to a

retention of SI in the ER (Naim et al., 2012). These results are in line with the

biochemical results for the mutants LPH-Y1473X and LPH-D1796fs.

The final experimental setup for the complete biochemical analysis was the

investigation of the potential effects of the pathogenic mutants LPH-Y1473X and

LPH-D1796fs on the function of the wild type LPH in a heterozygote background,

72 Discussion

mimicking the situation in the parents of the compound heterozygous CLD patient.

The above mentioned study only obtained a monomeric mannose-rich N-

glycosylated protein in case of anchorless expressed protein (Panzer et al., 1998).

The question is whether the fulfillment of minimal folding requirements, such as

correct folding of the domains, which are important for dimerization, is sufficient for

the formation of heterodimers. The dimerization step of LPH takes place in the ER

and it is known that the presence of the transmembrane domain and the stretch

region of 87 amino acids in the ectodomain between position 1646 and position 1559

in domain IV are required for the formation of homodimers (Danielsen, 1990; Naim

and Naim, 1996; Panzer et al., 1998). The mutant LPH-Y1473X does not contain any

of these criteria, but the mutant LPH-D1786fs includes the stretch region in domain

IV. The results of the co-immunoprecipitation experiments offered that neither the

mutant LPH-Y1473X nor the mutant LPH-D1796fs interact with the wild type in a co-

transfection setup. The enzymatic activity of the wild type does not differ in the single

or the co-transfected samples indicating that no interaction has taken place and that

the wild type retains unaffected also in the presence of the pathogenic mutants.

These data support the hypothesis that dimerization only happens if both criteria are

fulfilled or at least that those criteria play an important role in the process of

heterodimerization. To further prove if heterodimerization per se is possible, the

mutant form should contain the transmembrane domain and the stretch region in

domain IV. Adequate candidates for this experiment would be e.g. the LPH-G1363S,

LPH-R1587H or LPH-Q268H mutant. Figure 4 summaries the knowledge about

heterodimerization of LPH wild type and a mutant form. The criteria for

homodimerization (Figure 4A) will be taken under closer consideration in the next

paragraph of the discussion.

Discussion 73

Figure 4: Potential requirements for heterodimerization of LPH wild type with a

pathogenic mutant. A) LPH normally forms homodimers in the ER before the further

transport along the secretory pathway to the Golgi apparatus. Mutant forms of LPH (orange

circles), which are anchorless due to the missing transmembrane domain and with B) the

lacking or C) consisting the stretch region in domain IV (light blue balk). Possible

heterodimers of the wild type LPH (blue circles) and mutated forms of LPH build of the full

length pro-LPH D) only missing the stretch region in domain IV or E) consisting both the

transmembrane region and the stretch region in domain IV.

The potential heterodimerization could lead to protein complexes with altered

functional or trafficking characteristics of either one of them and could thereby

explain the wide range of normal enzymatic activity levels. Previous studies have

shown that the maximum levels of enzymatic activities of the disaccharidases in the

intestine are often two-fold higher than the minimal recognized normal levels (Alfalah

et al., 2009; Naim et al., 2012). A recent study identified an intermediate

physiological phenotype of lactose intolerance caused by nucleotide variants

influencing the transcript levels of the LCT gene, which may explain the range of

normal lactase activity (Dzialanski et al., 2015). This intermediate physiological

phenotype is caused by the heterozygous state CT−13910, while the homozygotes

either lead to lactose intolerance in case of CC−13910 or to lactose tolerance in case of

74 Discussion

TT−13910 (Dzialanski et al., 2015) Those heterodimeric interactions have been

described already for many proteins, such as connexin, G-protein-coupled receptors

or GABA receptors (Doms et al., 1987; Jordan and Devi, 1999; Maza et al., 2003). In

case LPH would exclusively forms homodimers in the presence of other pathogenic

mutations, which fulfill the known requirements for dimerization, this could be one

possible explanation why heterozygous carriers of one mutation underlying CLD are

symptom-free and show normal lactase activity levels. Another possible theory why

heterozygous carriers of certain diseases are symptom-free is a translation-coupled

mechanism (NMD) that eliminates mRNA containing premature termination codons

and thus limiting the synthesis of abnormal proteins (Palacios, 2013). NMD accounts

for genotypic/phenotypic differences and has a protective function, which sometimes

benefits for heterozygous carriers. Recently, a group could show that the phenotypic

variability in heterozygous carriers of mutations causing growth hormone insensitivity

syndrome (GHIS) is moderated by NMD (Gorbenko del Blanco et al., 2012).

Characterization and implication of the subdomains of LPH, a multi-domain

protein, on its function and folding

Proteins have to fulfill a wide spectrum of functions, ranging from binding molecules

(from simple ions to large molecules like fats, sugars, nucleic acids and other

proteins) to catalyzing an extraordinary range of chemical reactions, providing

structural rigidity to the cell, controlling flow of material through membranes,

regulating the concentrations of metabolites, acting as sensors and switches, causing

motion and controlling gene function (Lodish H, 2000). The three-dimensional

structures of proteins have been identified to play a crucial role for these functions

and their precise control. The spatial organization is a key player in the

understanding of protein structure and functioning.

Proteins are constructed from only 20 different amino acids, which form single,

unbranched polypeptide chains. Their unique spatial confirmation arises from

Discussion 75

noncovalent interactions between regions in the linear amino acid sequence. Only

correctly folded proteins are able to fulfill their physiological functions. Besides the

class of cell signaling and ligand binding, proteins may act as structural elements or

enzymes by catalyzing chemical reactions.

In general, the International Union of Biochemistry and Molecular Biology (IUBMB)

has developed a nomenclature for enzymes, containing oxireductases (EC 1),

transferases (EC 2), hydrolases (EC 3), lysases (EC 4), isomerases (EC 5) and

ligases (EC 6). One class of hydrolases, the glycoside hydrolases (GHs, EC 3.2.1)

are a widespread group of enzymes that hydrolase glycosidic linkages between two

or more carbohydrates. LPH is grouped with other β-galactosidases in a few families

of GHs, which are responsible for the hydrolysis of terminal non-reducing β-D-

galactose residues in β-D-galactosides (Henrissat and Davies, 2000). Human

lactase-phlorizin hydrolase belongs to the protein family GH 1. While most members

of the GH 1 family consist of only a single domain, LPH is synthesized in the ER as a

multi-domain pro-LPH (Naim et al., 1991). While the three-dimensional structure for

many members of the GH 1 family is identified, the one for LPH is still undiscovered.

The first three-dimensional structure solved for the GH 1 family is those of a

cyanogenic β-glucosidase from the white clover (Trifolium repens), a single-domain

protein (Barrett et al., 1995). The actual advanced method using NMR spectroscopy

for determining membrane protein structures, has the limitation that only small

soluble proteins can be analysed (Hong, 2006). For large multi-domain membrane

proteins electron crystallography represents the best approach to understand

membrane protein structures in the context of a lipid bilayer (Ubarretxena-Belandia

and Stokes, 2010). Another approach for extraction and purification of functional

protein is the X-ray crystallization, which was used to solve the first crystal structures

of mammalian proteins e.g. the rabbit Ca2+-ATPase SERCA1a (Jidenko et al., 2005)

and the rat voltage-dependent potassium ion channel Kv1.2 (Long et al., 2005).

Nevertheless, all these methods cannot display the structural changes during the

biosynthesis of the protein and therefore it is important to use other approaches as

well.

76 Discussion

During its transport along the secretory pathway, LPH is post-translationally modified

by N- and O-glycosylation, it dimerizes in the ER, is proteolytically cleaved in the

Golgi apparatus and at the apical membrane (Naim and Lentze, 1992; Jacob et al.,

1996; Wuthrich et al., 1996). The mature LPH consists only of domain III and domain

IV of the extracellular domain, which comprise the phlorizin hydrolase activity and the

lactase activity, respectively (Zecca et al., 1998). Domains I and II are defined as the

profragment LPHα, which acts as an intramolecular chaperone for the rest of the

protein (Jacob et al., 2002). Domain III also fulfills an intramolecular chaperone

function (Behrendt et al., 2010).

Previous studies could give first insights into the intramolecular organization of LPH.

The membrane anchor and the 87 amino acid long sequence in domain IV are crucial

for the attainment of a transport-competent homodimer in the ER (Naim and Naim,

1996; Panzer et al., 1998). Further studies identified the function of each domain of

the extracellular domain by utilizing deletion mutants of each domain. The deletion of

domain IV, which contains the lactase activity site, leads to the formation of a

transport-competent, correctly folded protein, which fails to dimerize in the ER and

reveals slightly reduced phlorizin hydrolase activity. In contrast, the deletion of

domain III, which harbors the phlorizin hydrolase activity site, results in a mannose-

rich N-glycosylated misfolded monomeric protein with absent lactase activity.

Interestingly, the same study disclosed that domain III alone expressed is transport-

competent per se, despite it neither dimerizes nor acquires complete phlorizin

hydrolase activity (Behrendt et al., 2010), indicating that dimerization is not, as

previously described (Naim and Naim, 1996), essential for transport competence and

acquisition of enzymatic activity. These data revealed an intramolecular chaperone

function of domain III besides the profragment LPHα (Naim et al., 1994). LPHα,

consisting of domain I and part of domain II, is proteolytically cleaved off during the

first cleavage step in the Golgi apparatus before LPH is further transported to the

apical membrane where it is finally cleaved to the mature form (Wuthrich et al.,

1996). These cleavage steps are not essential for the acquisition of an enzymatically

active molecule, because expressed pro-LPH in COS-1 cells does not undergo

Discussion 77

intramolecular proteolytic cleavage, but is enzymatic as active as the isolated LPH

from the brush border membrane (Naim et al., 1991).

The role of each domain of the profragment LPHα on the function of LPH was

determined by utilizing again deletion mutants. Deletion of domain II leads to a

transport-competent protein, which fails to dimerize in the ER and its enzymatic

activities are substantially reduced. On the other hand, the deletion of domain I

results in a mannose-rich N-glycosylated misfolded monomeric molecule, which is

enzymatically inactive (Behrendt, 2010). These results underline the hypothesis that

LPH might have arisen from two subsequent duplications (Wacker et al., 1992),

because the function of domain I is similar to that of domain III by acting as an

intramolecular chaperone and their deletion lead to a malfolded protein, which is

blocked in the ER and degraded. Comparably, domain II and domain IV are not

essential for the acquisition of transport competence or the correct folding of LPH,

but influencing partially the dimerization step in the ER.

A previous study could detect an 87 amino acid long sequence in domain IV to be

essential for the dimerization step in the ER in addition to the presence of the

transmembrane domain (Naim and Naim, 1996; Panzer et al., 1998). Interestingly,

domain II also contains a stretch region of 134 amino acids in its C-terminal region,

which distinguishes LPHβinitial from LPHβfinal. The intramolecular role of these

stretches is conflictive. The presence of the stretch in domain IV leads to transport

competence and dimerization of LPH in the ER (Panzer et al., 1998), while the

stretch in domain II leads to a retention of the protein in the ER as a monomer even if

it is linked to the autonomous domain III (Behrendt et al., 2010). The data presented

here assign that the presence of the stretch in domain II, either in LPH∆1 or in

LPHβinitial, results in a failure of the protein to dimerize in the ER, while its deletion in

LPHβfinal leads to the formation of oligomeric structures, which are probably build later

along the secretory pathway in the Golgi apparatus. The formation of higher

oligomeric structures like tetramers is confirmed by a cell surface biotinylation

experiment, which shows a band for LPHβfinal with a definitely higher molecular

weight compared to the wild type. One possible explanation of the ER retention of

78 Discussion

LPHβinitial is the misfolding of the protein due to the missing domain I. Domain I is

normally responsible for the correct folding of the protein and especially of domain II,

because LPHβfinal is transport competent without domain I and domain II.

Closer sequence analysis of this stretch region offered a unique N-glycosylation site

at position Asn821, which could be responsible for the retention of LPH in the ER by

interacting with an ER-resident chaperone. Notably, a similar N-glycosylation site

was also found in domain IV at position Asn1814. The ER-resident chaperone BiP has

been identified to interact with LPH and thereby to improve the folding of LPH (Jacob

et al., 1995). To prove if the different LPH variants also interact with calnexin, a co-

immunoprecipitation experiment was performed, because the mono-glycosylated N-

glycans at the above mentioned N-glycosylation sites may serve as sites for the

association with calnexin. Interestingly, the constructs containing the stretch region in

domain II, like LPH wild type or LPHβinitial, show increased association with calnexin

compared to those constructs lacking the stretch like LPH∆2 or LPHβfinal. The fact

that both, LPH wild type or LPHβinitial, interact more intensive with the ER chaperone,

but LPH wild type is completely transport-competent, while LPHβinitial is mannose-rich

N-glycosylated and degraded in the ER. These results confirm the hypothesis that

domain I is required for the folding of domain II and due to its absence in LPHβinitial

the protein is misfolded and thereby degraded during the ERAD pathway. Possibly,

the wild type is able to mask this interaction site with calnexin by its correct folding

and the formation of homodimers, while LPHβinitial remains as a monomer. The

distinct role of individual N-linked glycans in CNX/CRT binding and in co- and post-

translational folding was also established in a previous study using influenza virus

hemagglutinin as a model protein (Hebert et al., 1997).

Conclusion 79

Conclusion

To sum up: I) Domain I and domain III of the extracellular domain of LPH act as

intramolecular chaperones, while domain II and domain IV are not essential for the

transport competence. II) LPH interacts with calnexin due to its possible N-

glycosylation sites in domain II and domain IV. III) The transmembrane domain,

domain II and the stretch region in domain IV are essential for the homodimerization

of LPH in the ER (Naim and Naim, 1996; Panzer et al., 1998). IV) The

homodimerization of LPH in the ER is required for the acquisition of enzymatic

lactase activity (Naim and Naim, 1996), but not for the attainment of transport

competence.

All of these structural requirements, which need to be fulfilled to obtain a transport-

competent and functional protein, are important in regard to the complete

understanding of the development of severe pathogenic mutations in the gene of

LPH causing CLD. The best experimental setup would be either protein

crystallization or the use of 3D protein structure prediction tools to unravel the spatial

confirmation of LPH to determine the influence of specific mutations. The results from

this dissertation give insights into the function of each single domain and the situation

in heterozygote carriers. The first part of this dissertation analyzed two pathogenic

mutants in the coding region of LPH causing CLD. Both are located in domain IV of

the extracellular domain of LPH, resulting in a premature truncation of LPH. Those

anchorless mutants do not interact with the wild type and thereby leading to the

formation of full functional wild type homodimers in a co-transfection setup. The

presence of the transmembrane domain seems to be one requirement for the

formation of heterodimers. The presence of the stretch in domain IV, which is

necessary for homodimerization, has to be taken under closer consideration for the

formation of heterodimers. The second part of this dissertation detected the stretch

region in domain II of the extracellular domain of LPH as an important structural

element and showed that LPH interacts due to possible N-glycosylation site in this

stretch region with calnexin.

80 References

References

Aikawa J., Matsuo I.,Ito Y. (2012). "In vitro mannose trimming property of human ER

alpha-1,2 mannosidase I." Glycoconj J 29(1): 35-45.

Alfalah M., Jacob R., Preuss U., Zimmer K.P., Naim H.,Naim H.Y. (1999). "O-linked

glycans mediate apical sorting of human intestinal sucrase-isomaltase through

association with lipid rafts." Curr Biol 9(11): 593-6.

Alfalah M., Keiser M., Leeb T., Zimmer K.P.,Naim H.Y. (2009). "Compound

heterozygous mutations affect protein folding and function in patients with

congenital sucrase-isomaltase deficiency." Gastroenterology 136(3): 883-92.

Almeida C.C., Lorena S.L., Pavan C.R., Akasaka H.M.,Mesquita M.A. (2012).

"Beneficial effects of long-term consumption of a probiotic combination of

Lactobacillus casei Shirota and Bifidobacterium breve Yakult may persist after

suspension of therapy in lactose-intolerant patients." Nutr Clin Pract 27(2):

247-51.

Amiri M., Diekmann L., von Kockritz-Blickwede M.,Naim H.Y. (2015). "The Diverse

Forms of Lactose Intolerance and the Putative Linkage to Several Cancers."

Nutrients 7(9): 7209-30.

Antonowicz I.,Lebenthal E. (1977). "Developmental pattern of small intestinal

enterokinase and disaccharidase activities in the human fetus."

Gastroenterology 72(6): 1299-303.

Apweiler R., Hermjakob H.,Sharon N. (1999). "On the frequency of protein

glycosylation, as deduced from analysis of the SWISS-PROT database."

Biochim Biophys Acta 1473(1): 4-8.

Arola H. (1994). "Diagnosis of hypolactasia and lactose malabsorption." Scand J

Gastroenterol Suppl 202: 26-35.

References 81

Arvan P., Zhao X., Ramos-Castaneda J.,Chang A. (2002). "Secretory pathway

quality control operating in Golgi, plasmalemmal, and endosomal systems."

Traffic 3(11): 771-80.

Asp N.G., Dahlqvist A., Kuitunen P., Launiala K.,Visakorpi J.K. (1973). "Complete

deficiency of brush-border lactase in congenital lactose malabsorption."

Lancet 2(7824): 329-30.

Avezov E., Frenkel Z., Ehrlich M., Herscovics A.,Lederkremer G.Z. (2008).

"Endoplasmic reticulum (ER) mannosidase I is compartmentalized and

required for N-glycan trimming to Man5-6GlcNAc2 in glycoprotein ER-

associated degradation." Mol Biol Cell 19(1): 216-25.

Balmana M., Gimenez E., Puerta A. et al (2016). "Increased alpha1-3 fucosylation of

alpha-1-acid glycoprotein (AGP) in pancreatic cancer." J Proteomics 132: 144-

54.

Barrett T., Suresh C.G., Tolley S.P., Dodson E.J.,Hughes M.A. (1995). "The crystal

structure of a cyanogenic beta-glucosidase from white clover, a family 1

glycosyl hydrolase." Structure 3(9): 951-60.

Baserga S.J.,Benz E.J., Jr. (1988). "Nonsense mutations in the human beta-globin

gene affect mRNA metabolism." Proc Natl Acad Sci U S A 85(7): 2056-60.

Behrendt M. (2010). "Characterization of natural and artificial mutants of human

intestinal lactase phlorizin hydrolase." Gottfried Wilhelm Leibniz Universität

Hannover.

Behrendt M., Keiser M., Hoch M.,Naim H.Y. (2009). "Impaired trafficking and

subcellular localization of a mutant lactase associated with congenital lactase

deficiency." Gastroenterology 136(7): 2295-303.

Behrendt M., Polaina J.,Naim H.Y. (2010). "Structural hierarchy of regulatory

elements in the folding and transport of an intestinal multidomain protein." J

Biol Chem 285(6): 4143-52.

82 References

Berg N.O., Dahlqvist A., Lindberg T.,Studnitz W. (1969). "Severe familial lactose

intolerance--a gastrogen disorder?" Acta Paediatr Scand 58(5): 525-7.

Boll W., Wagner P.,Mantei N. (1991). "Structure of the chromosomal gene and

cDNAs coding for lactase-phlorizin hydrolase in humans with adult-type

hypolactasia or persistence of lactase." Am J Hum Genet 48(5): 889-902.

Boukamel R.,Freund J.N. (1992). "The rat LPH gene 5' region: comparative structure

with the human gene." DNA Seq 3(2): 119-21.

Braakman I.,Hebert D.N. (2013). "Protein folding in the endoplasmic reticulum." Cold

Spring Harb Perspect Biol 5(5): a013201.

Briant K., Koay Y.H., Otsuka Y.,Swanton E. (2015). "ERAD of proteins containing

aberrant transmembrane domains requires ubiquitylation of cytoplasmic lysine

residues." J Cell Sci 128(22): 4112-25.

Brockhausen I., Schachter H.,Stanley P. (2009). O-GalNAc Glycans. Essentials of

Glycobiology. A. Varki, R. D. Cummings, J. D. Eskoet al., Cold Spring Harbor

Laboratory Press.

Brown D.A.,Rose J.K. (1992). "Sorting of GPI-anchored proteins to glycolipid-

enriched membrane subdomains during transport to the apical cell surface."

Cell 68(3): 533-44.

Brussow H. (2013). "Nutrition, population growth and disease: a short history of

lactose." Environ Microbiol 15(8): 2154-61.

Bukau B., Weissman J.,Horwich A. (2006). "Molecular chaperones and protein

quality control." Cell 125(3): 443-51.

Bull C., Boltje T.J., Wassink M. et al (2013). "Targeting aberrant sialylation in cancer

cells using a fluorinated sialic acid analog impairs adhesion, migration, and in

vivo tumor growth." Mol Cancer Ther 12(10): 1935-46.

References 83

Caballero B., Solomons N.W.,Torun B. (1983). "Fecal reducing substances and

breath hydrogen excretion as indicators of carbohydrate malabsorption." J

Pediatr Gastroenterol Nutr 2(3): 487-90.

Canani R.B., Castaldo G., Bacchetta R., Martin M.G.,Goulet O. (2015). "Congenital

diarrhoeal disorders: advances in this evolving web of inherited

enteropathies." Nat Rev Gastroenterol Hepatol 12(5): 293-302.

Carvalho P., Goder V.,Rapoport T.A. (2006). "Distinct ubiquitin-ligase complexes

define convergent pathways for the degradation of ER proteins." Cell 126(2):

361-73.

Cederlund A., Kai-Larsen Y., Printz G. et al (2013). "Lactose in human breast milk an

inducer of innate immunity with implications for a role in intestinal

homeostasis." PLoS One 8(1): e53876.

Cheng S.H., Gregory R.J., Marshall J. et al (1990). "Defective intracellular transport

and processing of CFTR is the molecular basis of most cystic fibrosis." Cell

63(4): 827-34.

Christianson J.C.,Ye Y. (2014). "Cleaning up in the endoplasmic reticulum: ubiquitin

in charge." Nat Struct Mol Biol 21(4): 325-35.

Coelho M., Sequeira F., Luiselli D., Beleza S.,Rocha J. (2009). "On the edge of

Bantu expansions: mtDNA, Y chromosome and lactase persistence genetic

variation in southwestern Angola." BMC Evol Biol 9: 80.

Cox J.S., Shamu C.E.,Walter P. (1993). "Transcriptional induction of genes encoding

endoplasmic reticulum resident proteins requires a transmembrane protein

kinase." Cell 73(6): 1197-206.

Danielsen E.M. (1990). "Biosynthesis of intestinal microvillar proteins. Dimerization of

aminopeptidase N and lactase-phlorizin hydrolase." Biochemistry 29(1): 305-8.

84 References

Danielsen E.M. (1995). "Involvement of detergent-insoluble complexes in the

intracellular transport of intestinal brush border enzymes." Biochemistry 34(5):

1596-605.

Danielsen E.M., Skovbjerg H., Noren O.,Sjostrom H. (1984). "Biosynthesis of

intestinal microvillar proteins. Intracellular processing of lactase-phlorizin

hydrolase." Biochem Biophys Res Commun 122(1): 82-90.

Day A.J., Canada F.J., Diaz J.C. et al (2000). "Dietary flavonoid and isoflavone

glycosides are hydrolysed by the lactase site of lactase phlorizin hydrolase."

FEBS Lett 468(2-3): 166-70.

Dejgaard K., Theberge J.F., Heath-Engel H., Chevet E., Tremblay M.L.,Thomas D.Y.

(2010). "Organization of the Sec61 translocon, studied by high resolution

native electrophoresis." J Proteome Res 9(4): 1763-71.

Delacour D., Cramm-Behrens C.I., Drobecq H., Le Bivic A., Naim H.Y.,Jacob R.

(2006). "Requirement for galectin-3 in apical protein sorting." Curr Biol 16(4):

408-14.

Delacour D., Greb C., Koch A. et al (2007). "Apical sorting by galectin-3-dependent

glycoprotein clustering." Traffic 8(4): 379-88.

Delacour D., Koch A.,Jacob R. (2009). "The role of galectins in protein trafficking."

Traffic 10(10): 1405-13.

Doms R.W., Keller D.S., Helenius A.,Balch W.E. (1987). "Role for adenosine

triphosphate in regulating the assembly and transport of vesicular stomatitis

virus G protein trimers." J Cell Biol 105(5): 1957-69.

Dzialanski Z., Barany M., Engfeldt P., Magnuson A., Olsson L.A.,Nilsson T.K. (2015).

"Lactase persistence versus lactose intolerance: Is there an intermediate

phenotype?" Clin Biochem.

References 85

Ellgaard L.,Helenius A. (2003). "Quality control in the endoplasmic reticulum." Nat

Rev Mol Cell Biol 4(3): 181-91.

Enattah N.S., Jensen T.G., Nielsen M. et al (2008). "Independent introduction of two

lactase-persistence alleles into human populations reflects different history of

adaptation to milk culture." Am J Hum Genet 82(1): 57-72.

Enattah N.S., Sahi T., Savilahti E., Terwilliger J.D., Peltonen L.,Jarvela I. (2002).

"Identification of a variant associated with adult-type hypolactasia." Nat Genet

30(2): 233-7.

Erasmus H.D., Ludwig-Auser H.M., Paterson P.G., Sun D.,Sankaran K. (2002).

"Enhanced weight gain in preterm infants receiving lactase-treated feeds: a

randomized, double-blind, controlled trial." J Pediatr 141(4): 532-7.

Evans R.C., Fear S., Ashby D. et al (2002). "Diet and colorectal cancer: an

investigation of the lectin/galactose hypothesis." Gastroenterology 122(7):

1784-92.

Fabre A., Charroux B., Martinez-Vinson C. et al (2012). "SKIV2L mutations cause

syndromic diarrhea, or trichohepatoenteric syndrome." Am J Hum Genet

90(4): 689-92.

Fajardo O., Naim H.Y.,Lacey S.W. (1994). "The polymorphic expression of lactase in

adults is regulated at the messenger RNA level." Gastroenterology 106(5):

1233-41.

Fazeli W., Kaczmarek S., Kirschstein M.,Santer R. (2015). "A novel mutation within

the lactase gene (LCT): the first report of congenital lactase deficiency

diagnosed in Central Europe." BMC Gastroenterol 15(1): 90.

Ferraris R.P. (2001). "Dietary and developmental regulation of intestinal sugar

transport." Biochem J 360(Pt 2): 265-76.

86 References

Ferris S.P., Kodali V.K.,Kaufman R.J. (2014). "Glycoprotein folding and quality-

control mechanisms in protein-folding diseases." Dis Model Mech 7(3): 331-

41.

Fink A.L. (1999). "Chaperone-mediated protein folding." Physiol Rev 79(2): 425-49.

Flynn G.C., Pohl J., Flocco M.T.,Rothman J.E. (1991). "Peptide-binding specificity of

the molecular chaperone BiP." Nature 353(6346): 726-30.

Freedman R.B., Bulleid N.J., Hawkins H.C.,Paver J.L. (1989). "Role of protein

disulphide-isomerase in the expression of native proteins." Biochem Soc

Symp 55: 167-92.

Freiburghaus A.U., Schmitz J., Schindler M. et al (1976). "Protein patterns of brush-

border fragments in congenital lactose malabsorption and in specific

hypolactasia of the adult." N Engl J Med 294(19): 1030-2.

Frischmeyer P.A.,Dietz H.C. (1999). "Nonsense-mediated mRNA decay in health and

disease." Hum Mol Genet 8(10): 1893-900.

Gasbarrini A., Corazza G.R., Gasbarrini G. et al (2009). "Methodology and

indications of H2-breath testing in gastrointestinal diseases: the Rome

Consensus Conference." Aliment Pharmacol Ther 29 Suppl 1: 1-49.

Gendrel D., Richard-Lenoble D., Kombila M. et al (1992). "Influence of intestinal

parasitism on lactose absorption in well-nourished African children." Am J

Trop Med Hyg 46(2): 137-40.

Gorbenko del Blanco D., de Graaff L.C., Visser T.J.,Hokken-Koelega A.C. (2012).

"Growth hormone insensitivity syndrome caused by a heterozygous GHR

mutation: phenotypic variability owing to moderation by nonsense-mediated

decay." Clin Endocrinol (Oxf) 76(5): 706-12.

Gornik O.,Lauc G. (2008). "Glycosylation of serum proteins in inflammatory

diseases." Dis Markers 25(4-5): 267-78.

References 87

Grunberg J., Luginbuhl U.,Sterchi E.E. (1992). "Proteolytic processing of human

intestinal lactase-phlorizin hydrolase precursor is not a prerequisite for correct

sorting in Madin Darby canine kidney (MDCK) cells." FEBS Lett 314(3): 224-8.

Hammond C., Braakman I.,Helenius A. (1994). "Role of N-linked oligosaccharide

recognition, glucose trimming, and calnexin in glycoprotein folding and quality

control." Proc Natl Acad Sci U S A 91(3): 913-7.

Harding H.P., Zhang Y.,Ron D. (1999). "Protein translation and folding are coupled

by an endoplasmic-reticulum-resident kinase." Nature 397(6716): 271-4.

Hartley J.L., Zachos N.C., Dawood B. et al (2010). "Mutations in TTC37 cause

trichohepatoenteric syndrome (phenotypic diarrhea of infancy)."

Gastroenterology 138(7): 2388-98, 98.e1-2.

Harvey C.B., Wang Y., Hughes L.A. et al (1995). "Studies on the expression of

intestinal lactase in different individuals." Gut 36(1): 28-33.

Hauri H.P., Sterchi E.E., Bienz D., Fransen J.A.,Marxer A. (1985). "Expression and

intracellular transport of microvillus membrane hydrolases in human intestinal

epithelial cells." J Cell Biol 101(3): 838-51.

Hebert D.N., Garman S.C.,Molinari M. (2005). "The glycan code of the endoplasmic

reticulum: asparagine-linked carbohydrates as protein maturation and quality-

control tags." Trends Cell Biol 15(7): 364-70.

Hebert D.N.,Molinari M. (2007). "In and out of the ER: protein folding, quality control,

degradation, and related human diseases." Physiol Rev 87(4): 1377-408.

Hebert D.N., Zhang J.X., Chen W., Foellmer B.,Helenius A. (1997). "The Number and

Location of Glycans on Influenza Hemagglutinin Determine Folding and

Association with Calnexin and Calreticulin." J Cell Biol 139(3): 613-23.

Helander H.F.,Fandriks L. (2014). "Surface area of the digestive tract - revisited."

Scand J Gastroenterol 49(6): 681-9.

88 References

Helenius A.,Aebi M. (2004). "Roles of N-linked glycans in the endoplasmic reticulum."

Annu Rev Biochem 73: 1019-49.

Henrissat B.,Davies G.J. (2000). "Glycoside hydrolases and glycosyltransferases.

Families, modules, and implications for genomics." Plant Physiol 124(4): 1515-

9.

Herrinton L.J., Weiss N.S., Beresford S.A. et al (1995). "Lactose and galactose intake

and metabolism in relation to the risk of epithelial ovarian cancer." Am J

Epidemiol 141(5): 407-16.

Heyman M.B. (2006). "Lactose intolerance in infants, children, and adolescents."

Pediatrics 118(3): 1279-86.

Hirschberg C.B.,Snider M.D. (1987). "Topography of glycosylation in the rough

endoplasmic reticulum and Golgi apparatus." Annu Rev Biochem 56: 63-87.

Holden C.,Mace R. (1997). "Phylogenetic analysis of the evolution of lactose

digestion in adults." Hum Biol 69(5): 605-28.

Holzel A. (1967). "Sugar malabsorption due to deficiencies of disaccharidase

activities and of monosaccharide transport." Arch Dis Child 42(224): 341-52.

Holzel A. (1968). "Defects of sugar absorption. Sugar malabsorption and sugar

intolerance in childhood." Proc R Soc Med 61(11 Part 1): 1095-9.

Holzel A., Mereu T.,Thomson M.L. (1962). "Severe lactose intolerance in infancy."

Lancet 2(7270): 1346-8.

Hong M. (2006). "Oligomeric structure, dynamics, and orientation of membrane

proteins from solid-state NMR." Structure 14(12): 1731-40.

Hoskova A., Sabacky J., Mrskos A.,Pospisil R. (1980). "Severe lactose intolerance

with lactosuria and vomiting." Arch Dis Child 55(4): 304-5.

References 89

Hosokawa N., Tremblay L.O., You Z., Herscovics A., Wada I.,Nagata K. (2003).

"Enhancement of endoplasmic reticulum (ER) degradation of misfolded Null

Hong Kong alpha1-antitrypsin by human ER mannosidase I." J Biol Chem

278(28): 26287-94.

Hosokawa N., You Z., Tremblay L.O., Nagata K.,Herscovics A. (2007). "Stimulation

of ERAD of misfolded null Hong Kong alpha1-antitrypsin by Golgi alpha1,2-

mannosidases." Biochem Biophys Res Commun 362(3): 626-32.

Hutt D.M., Powers E.T.,Balch W.E. (2009). "The proteostasis boundary in misfolding

diseases of membrane traffic." FEBS Lett 583(16): 2639-46.

Ingram C.J., Elamin M.F., Mulcare C.A. et al (2007). "A novel polymorphism

associated with lactose tolerance in Africa: multiple causes for lactase

persistence?" Hum Genet 120(6): 779-88.

Ingram C.J., Raga T.O., Tarekegn A. et al (2009). "Multiple rare variants as a cause

of a common phenotype: several different lactase persistence associated

alleles in a single ethnic group." J Mol Evol 69(6): 579-88.

Inoue K., Khajavi M., Ohyama T. et al (2004). "Molecular mechanism for distinct

neurological phenotypes conveyed by allelic truncating mutations." Nat Genet

36(4): 361-9.

Jacob R., Alfalah M., Grunberg J., Obendorf M.,Naim H.Y. (2000). "Structural

determinants required for apical sorting of an intestinal brush-border

membrane protein." J Biol Chem 275(9): 6566-72.

Jacob R., Brewer C., Fransen J.A.,Naim H.Y. (1994). "Transport, function, and

sorting of lactase-phlorizin hydrolase in Madin-Darby canine kidney cells." J

Biol Chem 269(4): 2712-21.

Jacob R., Bulleid N.J.,Naim H.Y. (1995). "Folding of human intestinal lactase-

phlorizin hydrolase." J Biol Chem 270(31): 18678-84.

90 References

Jacob R., Heine M., Alfalah M.,Naim H.Y. (2003). "Distinct cytoskeletal tracks direct

individual vesicle populations to the apical membrane of epithelial cells." Curr

Biol 13(7): 607-12.

Jacob R.,Naim H.Y. (2001). "Apical membrane proteins are transported in distinct

vesicular carriers." Curr Biol 11(18): 1444-50.

Jacob R., Peters K.,Naim H.Y. (2002). "The prosequence of human lactase-phlorizin

hydrolase modulates the folding of the mature enzyme." J Biol Chem 277(10):

8217-25.

Jacob R., Preuss U., Panzer P. et al (1999). "Hierarchy of sorting signals in chimeras

of intestinal lactase-phlorizin hydrolase and the influenza virus hemagglutinin."

J Biol Chem 274(12): 8061-7.

Jacob R., Radebach I., Wuthrich M., Grunberg J., Sterchi E.E.,Naim H.Y. (1996).

"Maturation of human intestinal lactase-phlorizin hydrolase: generation of the

brush border form of the enzyme involves at least two proteolytic cleavage

steps." Eur J Biochem 236(3): 789-95.

Jacob R., Weiner J.R., Stadge S.,Naim H.Y. (2000). "Additional N-glycosylation and

its impact on the folding of intestinal lactase-phlorizin hydrolase." J Biol Chem

275(14): 10630-7.

Jacob R., Zimmer K.P., Naim H.,Naim H.Y. (1997). "The apical sorting of lactase-

phlorizin hydrolase implicates sorting sequences found in the mature domain."

Eur J Cell Biol 72(1): 54-60.

Jarvinen R., Knekt P., Hakulinen T.,Aromaa A. (2001). "Prospective study on milk

products, calcium and cancers of the colon and rectum." Eur J Clin Nutr

55(11): 1000-7.

Jensen P.H., Kolarich D.,Packer N.H. (2010). "Mucin-type O-glycosylation--putting

the pieces together." FEBS J 277(1): 81-94.

References 91

Jensen T.G., Liebert A., Lewinsky R., Swallow D.M., Olsen J.,Troelsen J.T. (2011).

"The -14010*C variant associated with lactase persistence is located between

an Oct-1 and HNF1alpha binding site and increases lactase promoter activity."

Hum Genet 130(4): 483-93.

Jidenko M., Nielsen R.C., Sorensen T.L. et al (2005). "Crystallization of a mammalian

membrane protein overexpressed in Saccharomyces cerevisiae." Proc Natl

Acad Sci U S A 102(33): 11687-91.

Jordan B.A.,Devi L.A. (1999). "G-protein-coupled receptor heterodimerization

modulates receptor function." Nature 399(6737): 697-700.

Kornfeld R.,Kornfeld S. (1985). "Assembly of asparagine-linked oligosaccharides."

Annu Rev Biochem 54: 631-64.

Kruse T.A., Bolund L., Grzeschik K.H. et al (1988). "The human lactase-phlorizin

hydrolase gene is located on chromosome 2." FEBS Lett 240(1-2): 123-6.

Kuhn N.J.,White A. (2009). "The topography of lactose synthesis. 1975." J Mammary

Gland Biol Neoplasia 14(3): 213-20.

Kuokkanen M., Enattah N.S., Oksanen A., Savilahti E., Orpana A.,Jarvela I. (2003).

"Transcriptional regulation of the lactase-phlorizin hydrolase gene by

polymorphisms associated with adult-type hypolactasia." Gut 52(5): 647-52.

Kuokkanen M., Kokkonen J., Enattah N.S. et al (2006). "Mutations in the translated

region of the lactase gene (LCT) underlie congenital lactase deficiency." Am J

Hum Genet 78(2): 339-44.

Kwak H.L., WJ.; Lee, MR. (2012). "Revisiting lactose as an enhancer of calcium

absorption." International Dairy Journal 22(2): 147-51.

Laaksonen M.M., Impivaara O., Sievanen H. et al (2009). "Associations of genetic

lactase non-persistence and sex with bone loss in young adulthood." Bone

44(5): 1003-9.

92 References

Launiala K., Kuitunen P.,Visakorpi J.K. (1966). "Disaccharidases and histology of

duodenal mucosa in congenital lactose malabsorption." Acta Paediatr Scand

55(3): 257-63.

Leese H.J.,Semenza G. (1973). "On the identity between the small intestinal

enzymes phlorizin hydrolase and glycosylceramidase." J Biol Chem 248(23):

8170-3.

Lemus L.,Goder V. (2014). "Regulation of Endoplasmic Reticulum-Associated Protein

Degradation (ERAD) by Ubiquitin." Cells 3(3): 824-47.

Lerchbaum E., Giuliani A., Gruber H.J., Pieber T.R.,Obermayer-Pietsch B. (2012).

"Adult-type hypolactasia and calcium intake in polycystic ovary syndrome."

Clin Endocrinol (Oxf) 77(6): 834-43.

Lewinsky R.H., Jensen T.G., Moller J., Stensballe A., Olsen J.,Troelsen J.T. (2005).

"T-13910 DNA variant associated with lactase persistence interacts with Oct-1

and stimulates lactase promoter activity in vitro." Hum Mol Genet 14(24):

3945-53.

Lobo G.P., Ebke L.A., Au A.,Hagstrom S.A. (2016). "TULP1 Missense Mutations

Induces the Endoplasmic Reticulum Unfolded Protein Response Stress

Complex (ER-UPR)." Adv Exp Med Biol 854: 223-30.

Lodish H B.A., Zipursky SL, et al. (2000). "Molecular Cell Biology." 4th edition.

Lomer M.C., Parkes G.C.,Sanderson J.D. (2008). "Review article: lactose intolerance

in clinical practice--myths and realities." Aliment Pharmacol Ther 27(2): 93-

103.

Long S.B., Campbell E.B.,Mackinnon R. (2005). "Crystal structure of a mammalian

voltage-dependent Shaker family K+ channel." Science 309(5736): 897-903.

Luan C.J., Shen W., Yu Z. et al (2015). "Two nonsense mutations cause protein C

deficiency by nonsense-mediated mRNA decay." Thromb Res 135(4): 733-8.

References 93

Maffei H.V., Daher S.R.,Moreira F.L. (1984). "Carbohydrate malabsorption in infants

with diarrhea: diagnostic and evolutive aspects." Arq Gastroenterol 21(3): 136-

42.

Maiuri L., Rossi M., Raia V. et al (1994). "Mosaic regulation of lactase in human

adult-type hypolactasia." Gastroenterology 107(1): 54-60.

Mantei N., Villa M., Enzler T. et al (1988). "Complete primary structure of human and

rabbit lactase-phlorizin hydrolase: implications for biosynthesis, membrane

anchoring and evolution of the enzyme." EMBO J 7(9): 2705-13.

Maquat L.E. (2005). "Nonsense-mediated mRNA decay in mammals." J Cell Sci

118(Pt 9): 1773-6.

Martin M.G., Turk E., Lostao M.P., Kerner C.,Wright E.M. (1996). "Defects in

Na+/glucose cotransporter (SGLT1) trafficking and function cause glucose-

galactose malabsorption." Nat Genet 12(2): 216-20.

Matthews S.B., Waud J.P., Roberts A.G.,Campbell A.K. (2005). "Systemic lactose

intolerance: a new perspective on an old problem." Postgrad Med J 81(953):

167-73.

Maza J., Mateescu M., Das Sarma J.,Koval M. (2003). "Differential oligomerization of

endoplasmic reticulum-retained connexin43/connexin32 chimeras." Cell

Commun Adhes 10(4-6): 319-22.

Metz G., Jenkins D.J., Peters T.J., Newman A.,Blendis L.M. (1975). "Breath

hydrogen as a diagnostic method for hypolactasia." Lancet 1(7917): 1155-7.

Miller T.L., Orav E.J., Martin S.R., Cooper E.R., McIntosh K.,Winter H.S. (1991).

"Malnutrition and carbohydrate malabsorption in children with vertically

transmitted human immunodeficiency virus 1 infection." Gastroenterology

100(5 Pt 1): 1296-302.

94 References

Minguez P., Parca L., Diella F. et al (2012). "Deciphering a global network of

functionally associated post-translational modifications." Mol Syst Biol 8: 599.

Misselwitz B., Pohl D., Fruhauf H., Fried M., Vavricka S.R.,Fox M. (2013). "Lactose

malabsorption and intolerance: pathogenesis, diagnosis and treatment."

United European Gastroenterol J 1(3): 151-9.

Miwa H.E., Song Y., Alvarez R., Cummings R.D.,Stanley P. (2012). "The bisecting

GlcNAc in cell growth control and tumor progression." Glycoconj J 29(8-9):

609-18.

Mohorko E., Glockshuber R.,Aebi M. (2011). "Oligosaccharyltransferase: the central

enzyme of N-linked protein glycosylation." J Inherit Metab Dis 34(4): 869-78.

Montalto M., Nucera G., Santoro L. et al (2005). "Effect of exogenous beta-

galactosidase in patients with lactose malabsorption and intolerance: a

crossover double-blind placebo-controlled study." Eur J Clin Nutr 59(4): 489-

93.

Moremen K.W. (2002). "Golgi alpha-mannosidase II deficiency in vertebrate systems:

implications for asparagine-linked oligosaccharide processing in mammals."

Biochim Biophys Acta 1573(3): 225-35.

Mottet G., Tuffereau C.,Roux L. (1986). "Reduced temperature can block different

glycoproteins at different steps during transport to the plasma membrane." J

Gen Virol 67 ( Pt 9): 2029-35.

Muller T., Hess M.W., Schiefermeier N. et al (2008). "MYO5B mutations cause

microvillus inclusion disease and disrupt epithelial cell polarity." Nat Genet

40(10): 1163-5.

Munro S.,Pelham H.R. (1986). "An Hsp70-like protein in the ER: identity with the 78

kd glucose-regulated protein and immunoglobulin heavy chain binding

protein." Cell 46(2): 291-300.

References 95

Naim H.Y. (1992). "Processing of human pro-lactase-phlorizin hydrolase at reduced

temperatures: cleavage is preceded by complex glycosylation." Biochem J 285

( Pt 1): 13-6.

Naim H.Y. (1994). "Processing and transport of human small intestinal lactase-

phlorizin hydrolase (LPH). Role of N-linked oligosaccharide modification."

FEBS Lett 342(3): 302-7.

Naim H.Y., Heine M.,Zimmer K.P. (2012). "Congenital sucrase-isomaltase deficiency:

heterogeneity of inheritance, trafficking, and function of an intestinal enzyme

complex." J Pediatr Gastroenterol Nutr 55 Suppl 2: S13-20.

Naim H.Y., Jacob R., Naim H., Sambrook J.F.,Gething M.J. (1994). "The pro region

of human intestinal lactase-phlorizin hydrolase." J Biol Chem 269(43): 26933-

43.

Naim H.Y., Lacey S.W., Sambrook J.F.,Gething M.J. (1991). "Expression of a full-

length cDNA coding for human intestinal lactase-phlorizin hydrolase reveals

an uncleaved, enzymatically active, and transport-competent protein." J Biol

Chem 266(19): 12313-20.

Naim H.Y.,Lentze M.J. (1992). "Impact of O-glycosylation on the function of human

intestinal lactase-phlorizin hydrolase. Characterization of glycoforms varying in

enzyme activity and localization of O-glycoside addition." J Biol Chem 267(35):

25494-504.

Naim H.Y.,Naim H. (1996). "Dimerization of lactase-phlorizin hydrolase occurs in the

endoplasmic reticulum, involves the putative membrane spanning domain and

is required for an efficient transport of the enzyme to the cell surface." Eur J

Cell Biol 70(3): 198-208.

Naim H.Y., Sterchi E.E.,Lentze M.J. (1987). "Biosynthesis and maturation of lactase-

phlorizin hydrolase in the human small intestinal epithelial cells." Biochem J

241(2): 427-34.

96 References

Naim H.Y., Sterchi E.E.,Lentze M.J. (1988). "Biosynthesis of the human sucrase-

isomaltase complex. Differential O-glycosylation of the sucrase subunit

correlates with its position within the enzyme complex." J Biol Chem 263(15):

7242-53.

Naim H.Y., Sterchi E.E.,Lentze M.J. (1988). "Structure, biosynthesis, and

glycosylation of human small intestinal maltase-glucoamylase." J Biol Chem

263(36): 19709-17.

Nemeth K., Plumb G.W., Berrin J.G. et al (2003). "Deglycosylation by small intestinal

epithelial cell beta-glucosidases is a critical step in the absorption and

metabolism of dietary flavonoid glycosides in humans." Eur J Nutr 42(1): 29-

42.

Newcomer A.D., McGill D.B., Thomas P.J.,Hofmann A.F. (1975). "Prospective

comparison of indirect methods for detecting lactase deficiency." N Engl J Med

293(24): 1232-6.

Ng D.P., Poulsen B.E.,Deber C.M. (2012). "Membrane protein misassembly in

disease." Biochim Biophys Acta 1818(4): 1115-22.

Nichols B.L., Avery S.E., Karnsakul W. et al (2002). "Congenital maltase-

glucoamylase deficiency associated with lactase and sucrase deficiencies." J

Pediatr Gastroenterol Nutr 35(4): 573-9.

Ninagawa S., Okada T., Sumitomo Y. et al (2014). "EDEM2 initiates mammalian

glycoprotein ERAD by catalyzing the first mannose trimming step." J Cell Biol

206(3): 347-56.

Norio R. (2003). "Finnish Disease Heritage I: characteristics, causes, background."

Hum Genet 112(5-6): 441-56.

Norio R. (2003). "Finnish Disease Heritage II: population prehistory and genetic roots

of Finns." Hum Genet 112(5-6): 457-69.

References 97

Obermayer-Pietsch B.M., Bonelli C.M., Walter D.E. et al (2004). "Genetic

predisposition for adult lactose intolerance and relation to diet, bone density,

and bone fractures." J Bone Miner Res 19(1): 42-7.

Olds L.C.,Sibley E. (2003). "Lactase persistence DNA variant enhances lactase

promoter activity in vitro: functional role as a cis regulatory element." Hum Mol

Genet 12(18): 2333-40.

Olzmann J.A., Kopito R.R.,Christianson J.C. (2013). "The mammalian endoplasmic

reticulum-associated degradation system." Cold Spring Harb Perspect Biol

5(9).

Overeem A.W., Posovszky C., Rings E.H., Giepmans B.N.,van I.S.C. (2016). "The

role of enterocyte defects in the pathogenesis of congenital diarrheal

disorders." Dis Model Mech 9(1): 1-12.

Oyadomari S., Araki E.,Mori M. (2002). "Endoplasmic reticulum stress-mediated

apoptosis in pancreatic beta-cells." Apoptosis 7(4): 335-45.

Ozdemir O., Mete E., Catal F.,Ozol D. (2009). "Food intolerances and eosinophilic

esophagitis in childhood." Dig Dis Sci 54(1): 8-14.

Palacios I.M. (2013). "Nonsense-mediated mRNA decay: from mechanistic insights

to impacts on human health." Brief Funct Genomics 12(1): 25-36.

Panzer P., Preuss U., Joberty G.,Naim H.Y. (1998). "Protein domains implicated in

intracellular transport and sorting of lactase-phlorizin hydrolase." J Biol Chem

273(22): 13861-9.

Pelletier M.F., Marcil A., Sevigny G. et al (2000). "The heterodimeric structure of

glucosidase II is required for its activity, solubility, and localization in vivo."

Glycobiology 10(8): 815-27.

Peltonen L., Jalanko A.,Varilo T. (1999). "Molecular genetics of the Finnish disease

heritage." Hum Mol Genet 8(10): 1913-23.

98 References

Petrescu A.J., Milac A.L., Petrescu S.M., Dwek R.A.,Wormald M.R. (2004).

"Statistical analysis of the protein environment of N-glycosylation sites:

implications for occupancy, structure, and folding." Glycobiology 14(2): 103-

14.

Pfeffer S., Dudek J., Gogala M. et al (2014). "Structure of the mammalian

oligosaccharyl-transferase complex in the native ER protein translocon." Nat

Commun 5: 3072.

Pramoud D. (1997). "Blood Brain Barrier and Cerebral Metabolism." Neuroscience

Online(4).

Propsting M.J., Jacob R.,Naim H.Y. (2003). "A glutamine to proline exchange at

amino acid residue 1098 in sucrase causes a temperature-sensitive arrest of

sucrase-isomaltase in the endoplasmic reticulum and cis-Golgi." J Biol Chem

278(18): 16310-4.

Rasinpera H., Kuokkanen M., Kolho K.L. et al (2005). "Transcriptional

downregulation of the lactase (LCT) gene during childhood." Gut 54(11): 1660-

1.

Rasinpera H., Savilahti E., Enattah N.S. et al (2004). "A genetic test which can be

used to diagnose adult-type hypolactasia in children." Gut 53(11): 1571-6.

Rhim A.D., Stoykova L.I., Trindade A.J., Glick M.C.,Scanlin T.F. (2004). "Altered

terminal glycosylation and the pathophysiology of CF lung disease." J Cyst

Fibros 3 Suppl 2: 95-6.

Rings E.H., de Boer P.A., Moorman A.F. et al (1992). "Lactase gene expression

during early development of rat small intestine." Gastroenterology 103(4):

1154-61.

Ritz V., Alfalah M., Zimmer K.P., Schmitz J., Jacob R.,Naim H.Y. (2003). "Congenital

sucrase-isomaltase deficiency because of an accumulation of the mutant

enzyme in the endoplasmic reticulum." Gastroenterology 125(6): 1678-85.

References 99

Rock C.L. (2011). "Milk and the risk and progression of cancer." Nestlé Nutrition

workshop series. Paediatric programme 67: 173-85.

Ron D.,Walter P. (2007). "Signal integration in the endoplasmic reticulum unfolded

protein response." Nat Rev Mol Cell Biol 8(7): 519-29.

Ruchkina I.N., Fadeeva N.A., Parfenov A.I. et al (2013). "[The role of small bowel

microflora in the development of secondary lactase deficiency and the

possibilities of its treatment with probiotics]." Ter Arkh 85(2): 21-6.

Ruggiano A., Foresti O.,Carvalho P. (2014). "Quality control: ER-associated

degradation: protein quality control and beyond." J Cell Biol 204(6): 869-79.

Saarela T., Simila S.,Koivisto M. (1995). "Hypercalcemia and nephrocalcinosis in

patients with congenital lactase deficiency." J Pediatr 127(6): 920-3.

Sahi T. (1994). "Genetics and epidemiology of adult-type hypolactasia." Scand J

Gastroenterol Suppl 202: 7-20.

Sahi T. (1994). "Hypolactasia and lactase persistence. Historical review and the

terminology." Scand J Gastroenterol Suppl 202: 1-6.

Sala Coromina J., Vinaixa Verges A.,Garcia Puig R. (2014). "[Congenital lactase

deficiency: Identification of a new mutation.]." An Pediatr (Barc).

Saldova R., Reuben J.M., Abd Hamid U.M., Rudd P.M.,Cristofanilli M. (2011).

"Levels of specific serum N-glycans identify breast cancer patients with higher

circulating tumor cell counts." Ann Oncol 22(5): 1113-9.

Savaiano D.A. (2014). "Lactose digestion from yogurt: mechanism and relevance."

Am J Clin Nutr 99(5 Suppl): 1251S-5S.

100 References

Savaiano D.A., Boushey C.J.,McCabe G.P. (2006). "Lactose intolerance symptoms

assessed by meta-analysis: a grain of truth that leads to exaggeration." J Nutr

136(4): 1107-13.

Savilahti E., Launiala K.,Kuitunen P. (1983). "Congenital lactase deficiency. A clinical

study on 16 patients." Arch Dis Child 58(4): 246-52.

Schedin-Weiss S., Winblad B.,Tjernberg L.O. (2014). "The role of protein

glycosylation in Alzheimer disease." Febs j 281(1): 46-62.

Scholz-Ahrens K.E.,Schrezenmeir J. (2000). "Effects of bioactive substances in milk

on mineral and trace element metabolism with special reference to casein

phosphopeptides." Br J Nutr 84 Suppl 1: S147-53.

Schroder M. (2008). "Endoplasmic reticulum stress responses." Cell Mol Life Sci

65(6): 862-94.

Scrimshaw N.S.,Murray E.B. (1988). "The acceptability of milk and milk products in

populations with a high prevalence of lactose intolerance." Am J Clin Nutr 48(4

Suppl): 1079-159.

Semenza G. (1986). "Anchoring and biosynthesis of stalked brush border membrane

proteins: glycosidases and peptidases of enterocytes and renal tubuli." Annu

Rev Cell Biol 2: 255-313.

Shailubhai K., Pukazhenthi B.S., Saxena E.S., Varma G.M.,Vijay I.K. (1991).

"Glucosidase I, a transmembrane endoplasmic reticular glycoprotein with a

luminal catalytic domain." J Biol Chem 266(25): 16587-93.

Shaukat A., Levitt M.D., Taylor B.C. et al (2010). "Systematic review: effective

management strategies for lactose intolerance." Ann Intern Med 152(12): 797-

803.

References 101

Sim L., Willemsma C., Mohan S., Naim H.Y., Pinto B.M.,Rose D.R. (2010).

"Structural basis for substrate selectivity in human maltase-glucoamylase and

sucrase-isomaltase N-terminal domains." J Biol Chem 285(23): 17763-70.

Simons K.,Ikonen E. (1997). "Functional rafts in cell membranes." Nature 387(6633):

569-72.

Simoons F.J. (1969). "Primary adult lactose intolerance and the milking habit: a

problem in biological and cultural interrelations. I. Review of the medical

research." Am J Dig Dis 14(12): 819-36.

Simoons F.J. (1970). "Primary adult lactose intolerance and the milking habit: a

problem in biologic and cultural interrelations. II. A culture historical

hypothesis." Am J Dig Dis 15(8): 695-710.

Sivagnanam M., Mueller J.L., Lee H. et al (2008). "Identification of EpCAM as the

gene for congenital tufting enteropathy." Gastroenterology 135(2): 429-37.

Slemenda C.W., Christian J.C., Hui S., Fitzgerald J.,Johnston C.C., Jr. (1991). "No

evidence for an effect of lactase deficiency on bone mass in pre- or

postmenopausal women." J Bone Miner Res 6(12): 1367-71.

Solomons N.W. (2002). "Fermentation, fermented foods and lactose intolerance." Eur

J Clin Nutr 56 Suppl 4: S50-5.

Stallings V.A., Oddleifson N.W., Negrini B.Y., Zemel B.S.,Wellens R. (1994). "Bone

mineral content and dietary calcium intake in children prescribed a low-lactose

diet." J Pediatr Gastroenterol Nutr 18(4): 440-5.

Stanley P., Schachter H.,Taniguchi N. (2009). N-Glycans. Essentials of Glycobiology.

A. Varki, R. D. Cummings, J. D. Eskoet al., Cold Spring Harbor Laboratory

Press.

102 References

Suarez F.L., Savaiano D.A.,Levitt M.D. (1995). "A comparison of symptoms after the

consumption of milk or lactose-hydrolyzed milk by people with self-reported

severe lactose intolerance." N Engl J Med 333(1): 1-4.

Swallow D.M. (2003). "Genetics of lactase persistence and lactose intolerance."

Annu Rev Genet 37: 197-219.

Terrin G., Tomaiuolo R., Passariello A. et al (2012). "Congenital diarrheal disorders:

an updated diagnostic approach." Int J Mol Sci 13(4): 4168-85.

Thanabalasingham G., Huffman J.E., Kattla J.J. et al (2013). "Mutations in HNF1A

result in marked alterations of plasma glycan profile." Diabetes 62(4): 1329-37.

Tishkoff S.A., Reed F.A., Ranciaro A. et al (2007). "Convergent adaptation of human

lactase persistence in Africa and Europe." Nat Genet 39(1): 31-40.

Tomar B.S. (2014). "Lactose intolerance and other disaccharidase deficiency." Indian

J Pediatr 81(9): 876-80.

Torniainen S., Freddara R., Routi T. et al (2009). "Four novel mutations in the lactase

gene (LCT) underlying congenital lactase deficiency (CLD)." BMC

Gastroenterol 9: 8.

Travers K.J., Patil C.K., Wodicka L., Lockhart D.J., Weissman J.S.,Walter P. (2000).

"Functional and genomic analyses reveal an essential coordination between

the unfolded protein response and ER-associated degradation." Cell 101(3):

249-58.

Triadou N., Bataille J.,Schmitz J. (1983). "Longitudinal study of the human intestinal

brush border membrane proteins. Distribution of the main disaccharidases and

peptidases." Gastroenterology 85(6): 1326-32.

Troelsen J.T., Mehlum A., Olsen J. et al (1994). "1 kb of the lactase-phlorizin

hydrolase promoter directs post-weaning decline and small intestinal-specific

expression in transgenic mice." FEBS Lett 342(3): 291-6.

References 103

Troelsen J.T., Mitchelmore C., Spodsberg N., Jensen A.M., Noren O.,Sjostrom H.

(1997). "Regulation of lactase-phlorizin hydrolase gene expression by the

caudal-related homoeodomain protein Cdx-2." Biochem J 322 ( Pt 3): 833-8.

Troelsen J.T., Olsen J., Mitchelmore C., Hansen G.H., Sjostrom H.,Noren O. (1994).

"Two intestinal specific nuclear factors binding to the lactase-phlorizin

hydrolase and sucrase-isomaltase promoters are functionally related

oligomeric molecules." FEBS Lett 342(3): 297-301.

Troelsen J.T., Olsen J., Noren O.,Sjostrom H. (1992). "A novel intestinal trans-factor

(NF-LPH1) interacts with the lactase-phlorizin hydrolase promoter and co-

varies with the enzymatic activity." J Biol Chem 267(28): 20407-11.

Trombetta E.S.,Parodi A.J. (2003). "Quality control and protein folding in the

secretory pathway." Annu Rev Cell Dev Biol 19: 649-76.

Ubarretxena-Belandia I.,Stokes D.L. (2010). "Present and future of membrane

protein structure determination by electron crystallography." Adv Protein Chem

Struct Biol 81: 33-60.

Uchida N., Sakamoto O., Irie M. et al (2012). "Two novel mutations in the lactase

gene in a Japanese infant with congenital lactase deficiency." Tohoku J Exp

Med 227(1): 69-72.

Usai-Satta P., Scarpa M., Oppia F.,Cabras F. (2012). "Lactose malabsorption and

intolerance: What should be the best clinical management?" World J

Gastrointest Pharmacol Ther 3(3): 29-33.

Varki A., Freeze H.H.,Manzi A.E. (2009). "Overview of glycoconjugate analysis." Curr

Protoc Protein Sci Chapter 12: Unit 12 1 1 1-8.

Varki A.,Lowe J.B. (2009). Biological Roles of Glycans. Essentials of Glycobiology. A.

Varki, R. D. Cummings, J. D. Eskoet al. Cold Spring Harbor (NY), Cold Spring

Harbor Laboratory Press, The Consortium of Glycobiology Editors, La Jolla,

California.

104 References

Vembar S.S.,Brodsky J.L. (2008). "One step at a time: endoplasmic reticulum-

associated degradation." Nat Rev Mol Cell Biol 9(12): 944-57.

Venema K. (2012). "Intestinal fermentation of lactose and prebiotic lactose

derivatives, including human milk oligosaccharides." International Dairy

Journal 22(2): 123-40.

Vesa T.H., Marteau P.,Korpela R. (2000). "Lactose intolerance." J Am Coll Nutr 19(2

Suppl): 165s-75s.

Wacker H., Keller P., Falchetto R., Legler G.,Semenza G. (1992). "Location of the

two catalytic sites in intestinal lactase-phlorizin hydrolase. Comparison with

sucrase-isomaltase and with other glycosidases, the membrane anchor of

lactase-phlorizin hydrolase." J Biol Chem 267(26): 18744-52.

Wahlqvist M.L. (2015). "Lactose nutrition in lactase nonpersisters." Asia Pac J Clin

Nutr 24 Suppl 1: S21-5.

Wang B.,Brand-Miller J. (2003). "The role and potential of sialic acid in human

nutrition." Eur J Clin Nutr 57(11): 1351-69.

Wiegerinck C.L., Janecke A.R., Schneeberger K. et al (2014). "Loss of syntaxin 3

causes variant microvillus inclusion disease." Gastroenterology 147(1): 65-

8.e10.

Williams D.B. (2006). "Beyond lectins: the calnexin/calreticulin chaperone system of

the endoplasmic reticulum." J Cell Sci 119(Pt 4): 615-23.

Wuthrich M., Grunberg J., Hahn D. et al (1996). "Proteolytic processing of human

lactase-phlorizin hydrolase is a two-step event: identification of the cleavage

sites." Arch Biochem Biophys 336(1): 27-34.

Yang J., Deng Y., Chu H. et al (2013). "Prevalence and presentation of lactose

intolerance and effects on dairy product intake in healthy subjects and patients

with irritable bowel syndrome." Clin Gastroenterol Hepatol 11(3): 262-8 e1.

References 105

Ye J., Rawson R.B., Komuro R. et al (2000). "ER stress induces cleavage of

membrane-bound ATF6 by the same proteases that process SREBPs." Mol

Cell 6(6): 1355-64.

Zecca L., Mesonero J.E., Stutz A. et al (1998). "Intestinal lactase-phlorizin hydrolase

(LPH): the two catalytic sites; the role of the pancreas in pro-LPH maturation."

FEBS Lett 435(2-3): 225-8.

Zhang K.,Kaufman R.J. (2006). "Protein folding in the endoplasmic reticulum and the

unfolded protein response." Handb Exp Pharmacol(172): 69-91.

Zhao J., Fox M., Cong Y. et al (2010). "Lactose intolerance in patients with chronic

functional diarrhoea: the role of small intestinal bacterial overgrowth." Aliment

Pharmacol Ther 31(8): 892-900.

Zheng X., Chu H., Cong Y. et al (2015). "Self-reported lactose intolerance in clinic

patients with functional gastrointestinal symptoms: prevalence, risk factors,

and impact on food choices." Neurogastroenterol Motil 27(8): 1138-46.

Zhong Y., Priebe M.G., Vonk R.J. et al (2004). "The role of colonic microbiota in

lactose intolerance." Dig Dis Sci 49(1): 78-83.

zur Stadt U., Rohr J., Seifert W. et al (2009). "Familial hemophagocytic

lymphohistiocytosis type 5 (FHL-5) is caused by mutations in Munc18-2 and

impaired binding to syntaxin 11." Am J Hum Genet 85(4): 482-92.

Zurawska-Plaksej E., Kratz E.M., Ferens-Sieczkowska M., Knapik-Kordecka

M.,Piwowar A. (2015). "Changes in glycosylation of human blood plasma

chitotriosidase in patients with type 2 diabetes." Glycoconj J.

106 Acknowledgements

Acknowledgements

First, I thank my supervisor Prof. Dr. Hassan Y. Naim who offered me the opportunity

to work on very challenging projects during my Master studies and my doctoral time.

Furthermore, I appreciate his support and guidance as well as his demanding

attitude. I learned a lot from you, not only as a scientist but also for life.

Secondly, I thank Prof. Dr. Rita Gerardy-Schahn who kindly agreed to review my

doctoral thesis.

Special thanks are addressed to my second supervisor Prof. Dr. Georg Herrler for his

contribution as a member of my supervision group.

I thank all present and former members of the Department of Physiological

Chemistry, but especially Gabriele Wetzel, Birthe Gericke and Friederike Reuner.

Gabi, thank you for teaching me a lot of techniques and making daily lab work so

easy. Birthe and Rike, thank you for having always open ears and making the last

years to such a good time in my life.

Finally, I thank my family for their never ending mental support, their love and

confidence. Thank you, Mum and Dad, for always being there for me and believing in

me in every stage of my life. Special big thanks to Stefan for being my haven of

peace. I am grateful for your confidence and love.

Eidesstattliche Erklärung 107

Eidesstattliche Erklärung

Hiermit erkläre ich, dass ich die Dissertation „The concerted action of multiple post-

translational events regulates the trafficking and function of wild type and mutant

disaccharidases” selbstständig verfasst habe. Ich habe keine entgeltliche Hilfe von

Vermittlungs- bzw. Beratungsdiensten (Promotionsberater oder anderer Personen) in

Anspruch genommen. Niemand hat von mir unmittelbar oder mittelbar entgeltliche

Leistungen für Arbeiten erhalten, die im Zusammenhang mit dem Inhalt der

vorgelegten Dissertation stehen.

Ich habe die Dissertation an folgenden Institutionen angefertigt:

Stiftung Tierärztliche Hochschule Hannover

Institut für Physiologische Chemie

Bünteweg 17/218, 30559 Hannover

Die Dissertation wurde bisher nicht für eine Prüfung oder Promotion oder für einen

ähnlichen Zweck zur Beurteilung eingereicht. Ich versichere, dass ich die

vorstehenden Angaben nach bestem Wissen vollständig und der Wahrheit

entsprechend gemacht habe.

Hannover, den 3. März 2016 ____________________

(Lena Diekmann)