The CFAR Biohazard Animal Core

25
The CFAR Biohazard Animal Core Director: John Chan, MD Co-Director: Larry Herbst, PhD Staff: Jiayong Xu, BA Location: AECOM, Chanin Bldg AECOM, Price Bldg

description

The CFAR Biohazard Animal Core. Director: John Chan, MD Co-Director: Larry Herbst, PhD Staff: Jiayong Xu , BA Location:AECOM, Chanin Bldg AECOM, Price Bldg. The Goal of the Biohazard Animal Core. - PowerPoint PPT Presentation

Transcript of The CFAR Biohazard Animal Core

Page 1: The CFAR Biohazard Animal Core

The CFAR Biohazard Animal Core

Director: John Chan, MDCo-Director: Larry Herbst, PhD

Staff: Jiayong Xu, BA

Location: AECOM, Chanin BldgAECOM, Price Bldg

Page 2: The CFAR Biohazard Animal Core

The Goal of the Biohazard Animal Core

To provide a biosafety level 3 (BSL 3) containment facility for studies involving in vivo modeling of infection with HIV-1 and AIDS-associated pathogens using various murine experimental models

Page 3: The CFAR Biohazard Animal Core

Implementation of the Goals of the Biohazard Animal Core

To provide a safe laboratory environment for the performance of experiments involving biohazardous pathogens that require a BSL 3 containment facility.

To provide reagents, including specific strains of pathogens, training, and technical assistance to facilitate research using murine infectious disease models involving HIV-1 and AIDS-associated pathogens such as Mycobacterium tuberculosis and Cryptococcus neoformans.

To provide comprehensive services to researchers not familiar with studies involving infection of mouse with biohazardous pathogens, which are designed to investigate pathogen-host interaction, pathogen-pathogen interaction, drug discovery, as well as mechanisms involved in pathogenesis and host defense.

To provide assistance in the study design and data interpretation of in vivo studies involving the use of murine models of infection.

To provide support in breeding, genotyping, and maintenance of specific transgenic and gene-knockout mouse strains.

Page 4: The CFAR Biohazard Animal Core

• The Chanin lab (~1,500 sq ft): 2,000 mice

• The Price lab (~2,000 sq ft): 2,200 mice

Capacity of the Animal Core

Page 5: The CFAR Biohazard Animal Core

Infection by Aerogenic Challenge

We have extensive experience in infecting mice with Mycobacterium tuberculosis via aerosols using the "Wisconsin" chamber or the In-Tox "nose-only" aerosolization apparatus and will optimize conditions for the aerosolization of other pathogens

Page 6: The CFAR Biohazard Animal Core

The Chanin Aerosolization Machine

Page 7: The CFAR Biohazard Animal Core

The Intox Nose-Only Aerosolization Apparatus

Page 8: The CFAR Biohazard Animal Core

Tis

sue

Bac

teria

l Bur

den

Time

Adaptive Immunity

Initiation of Immunosuppressive

Therapy

Chronic Phase

Reactivation Phase

Low-Dose Reactivation Model of Tuberculosis

Page 9: The CFAR Biohazard Animal Core

Tis

sue

Bac

teri

al B

urd

en

Time

Adaptive Immunity

Initiation of Anti-TB Therapy

Apparent Sterile State

Reactivation Phase

The Cornell Model of Reactivation Tuberculosis

Page 10: The CFAR Biohazard Animal Core

Lung: 3 months Post-Mtb Infection (Paraffin-embedded Tissues

Analysis of Tissues of Pathogen-infected Animals

Lungs: 6 months Post-Mtb Infection (Frozen Sections)

Liver: 6 months Post-Mtb Infection (Laser Capture Microdissection)

Page 11: The CFAR Biohazard Animal Core

Immunofluorescence Staining of Tuberculous Tissues

Page 12: The CFAR Biohazard Animal Core

Immunophenotyping of Cells from Infected Tissues

Page 13: The CFAR Biohazard Animal Core

The SCID-hu Mouse Model

The thy/liv-SCID-hu mice are generated by the core and can be infected with various titered R5, X4, and X4R5 primary isolates of HIV obtained from the BSL3/Virology Core to examine anti-HIV effects of novel therapeutics developed by

CFAR investigators

Page 14: The CFAR Biohazard Animal Core

Thy-liv-SCID-hu mice: An in vivo Model for Evaluating Anti-HIV-1 Therapy

Constructed by implanting human fetal thymus and liver under the kidney capsule of SCID mice.

The peripheral blood and lymphoid tissues of the mice are populated with > 5% human T cells and monocytes.

After i.p. inoculation of HIV-1, human cells in the peritoneum become infected, migrate to lymph nodes and traffic to and infect the human thymic implant.

Page 15: The CFAR Biohazard Animal Core

Mice with Infection of Thymic Implants of thy/liv-SCID-hu HIV-1

Inject HIV-1 into thy/liv SCID-hu mouse

Limiting Co-culture of implant to analyze for HIV infection

Page 16: The CFAR Biohazard Animal Core

Specialty Mouse Strains

Provide a number of mouse strains including SCID, Rag-/-, Rag2-/-c-/-,

and the NOD (nonobese-diabetic)/SCID/IL2Rnull mouse models.

Cryopreservation of mouse strains

Page 17: The CFAR Biohazard Animal Core

A Novel Transgenic Mouse Model Construct #1: human CD4-P2A-CCR5

E: mCD4 Enhancer P: mCD4 Promotor

2

4

3 SalI SalI

hCD4 hCCR5P2A1

Primer 1: ACGC GTCGACGCCACCATGAACCGGGGAGTCCCTTTTAG

 Primer 2: CTGCTTGCTTTAACAGAGAGAAGTTCGTGGC TCCGGAACCAATGGGGCTACATGTCTTC 

Primer 3: GCCACGAACTTCTCTCTGTTAAAGCAAGCAGGAGACGTGGAAGAAAACCCCGGTCCC atggattatcaagtgtcaag

Primer 4: TTCCGCGGCCGCTATGGCCGAC GTCGACTCACAAGCCCACAGATATTTC

SalI CD4

P2A CD4

P2A CCR5

CCR5SalI

Construct # 2: human Cyclin T1

Page 18: The CFAR Biohazard Animal Core

10 1 10 2 10 3 10 4 10 5

10 1

10 2

10 3

10 4

10 5

10 1 10 2 10 3 10 4 10 5

10 1

10 2

10 3

10 4

10 5

101 102 103 104 105

101

102

103

104

1050 0

0.9499.1

F1 progeny transgenic mouse

3.3513.7

10 1 10 2 10 3 10 4 10 5

10 1

10 2

10 3

10 4

10 510.3 1.16

4.3884.1

10 1 10 2 10 3 10 4 10 5

10 1

10 2

10 3

10 4

10 510.6 0.93

2.6885.7

10 1 10 2 10 3 10 4 10 5

10 1

10 2

10 3

10 4

10 5 53% 30%

4.7911.7

12.9 0.86

4.381.9

10 1 10 2 10 3 10 4 10 5

10 1

10 2

10 3

10 4

10 5 72% 10%

1.8215.9

101 102 10 3 104 10 5

101

102

103

104

1053.65 0

0.7395.6

Control mouse No. 724 No. 726 No. 730

Mouse CD4 cells

Mouse CD8 cells

Human CCR5

Hu

man

CD

4

Selective expression of hCD4 and CCR5 by mouse CD4 cells. PBMCs were isolated from a control mouse and three F1 progeny of founder mouse No.479. Expression of hCD4 and CCR5 by the mouse CD4+ cells and CD8+ cells was analyzed by two-color flow cytometry. The percentage of positive cells in each quadrant is indicated.

A Novel Transgenic HIV Mouse Model

51% 32%

Page 19: The CFAR Biohazard Animal Core

The Gnotobiotic Facility

Page 20: The CFAR Biohazard Animal Core

In vivo Imaging: the IVIS Spectrum

The IVIS

Page 21: The CFAR Biohazard Animal Core

IVIS: Tracking Malaria Infection

CQ: Chloroquine; PQ: Primaquine; Ato: Atovaquone

Page 22: The CFAR Biohazard Animal Core

Behavioral Study of NeuroAIDS

Page 23: The CFAR Biohazard Animal Core

Other Animal Procedures

post-mortem dissection for the procurement of infected organs

retro-orbital bleed

delivery of pharmacological or biological agents by various routes (oral, subcutaneous, intramuscular, intravenous, respiratory, intraperitoneal, retro-orbital and intracranial)

Provide biohazard barrier housing and husbandry for mice infected with HIV and various AIDS-related pathogens

Provide training for experimental techniques involved in conducting animal BSL3 experiments with various pathogens

Page 24: The CFAR Biohazard Animal Core

Accomplishments of the Animal Core• Acquisition of the in vitro imaging system: IVIS Spectrum

• The NeuroAIDS model, including the establishment of the radial water maze for behavorial study (addition of 500 sq ft)

• Establishment of a novel HIV mouse model: mice transgenic for expression of human CD4, CCR5 and Cyclin T1 that display successful in vitro and in vivo HIV infection.

• Novel mouse strains: Rag2-/-c-/-, and the NOD/SCID/IL2Rnull mouse models

• Additional 1,500 sq ft BSL3 facility (2,200 mice)

• New programs: interactions between HIV and M. tuberculosis, Malaria, and Herpes Virus; in vivo analysis of neuroAIDS in mice

• Publication (2008-2011): 36

• Users: the Core supports the research of 25 investigators (2011 progress report; 21 major users); first progress report of 2004 listed 8 investigators as major users

Page 25: The CFAR Biohazard Animal Core

Acknowledgements

• CFAR Cores and Staff: Virology, Developmental, Flow Cytometry, Immunology/Pathology, Clinical Cores.

• CFAR investigators and collaborators• Albert Einstein College of Medicine/Montefiore

Medical Center