Characterization of Muscarinic Receptor Involvement in Human
The C-terminal Tail of the M3-Muscarinic Receptor Possesses Anti ...
Transcript of The C-terminal Tail of the M3-Muscarinic Receptor Possesses Anti ...
![Page 1: The C-terminal Tail of the M3-Muscarinic Receptor Possesses Anti ...](https://reader034.fdocuments.in/reader034/viewer/2022050901/58a038161a28abb24d8bd23e/html5/thumbnails/1.jpg)
1
The C-terminal Tail of the M 3-Muscarinic Receptor
Possesses Anti-apoptotic Properties.
David C. Budd, John McDonald, Nita Emsley, Kelvin Cain# and Andrew B. Tobin
Department of Cell Physiology & Pharmacology, Medical Sciences Building,
University of Leicester, University Road, Leicester, LE1 9HN. # Centre for
Mechanisms of Human Toxicology, Hodgkin Building, Lancaster Road, University of
Leicester, Leicester, LE1 9HN.
Corresponding Author
Dr. David C. Budd
Department of Cell Physiology and Pharmacology
University of Leicester
P.O. Box 138, Medical Sciences Building,
University Road, Leicester, LE1 9HN, United Kingdom.
Tel: 0116 252 5249
Fax: 0116 252 5045
E-mail: [email protected]
Running Title:
Muscarinic receptor inhibition of apoptosis.
Abbreviations:
GPCR, G-protein coupled receptor; CHO, Chinese hamster ovary; [Ca2+]I,
intracellular calcium transient; MAP kinase, mitogen-activated protein kinase; ERK,
extracellular-regulated kinase; JNK, c-jun kinase; C-terminal tail; carboxy terminal
tail.
Copyright 2003 by The American Society for Biochemistry and Molecular Biology, Inc.
JBC Papers in Press. Published on March 20, 2003 as Manuscript M211670200 by guest on A
pril 10, 2018http://w
ww
.jbc.org/D
ownloaded from
![Page 2: The C-terminal Tail of the M3-Muscarinic Receptor Possesses Anti ...](https://reader034.fdocuments.in/reader034/viewer/2022050901/58a038161a28abb24d8bd23e/html5/thumbnails/2.jpg)
2
Abstract: This study investigates the mechanisms by which the muscarinic receptor
gene family can protect against apoptosis. Chinese hamster ovary cells transfected
with human muscarinic receptor subtypes underwent apopotic cell death following
treatment with the DNA damaging agent etoposide. Apoptosis was significantly
reduced following muscarinic receptor stimulation of cells that were transfected with
receptor subtypes that couple to the Gq/11/phospholipase C pathway, namely M1, M3
and M5. No protection was detected in cells transfected with the Gi-coupled M2 and
M4 receptors. Further analysis of the Gq/11-coupled M3 receptor revealed that
truncation of the carboxyl -tail (∆565-M3 mutant) removed the ability of the receptor
to protect against etoposide-induced cell death. This mutation did not affect the ability
of the receptor to signal through the phospholipase C pathway. Furthermore,
activation of the ∆565-M3 receptor resulted in robust activation of the extracellular-
regulated kinase (ERK) and c-jun kinase (JNK). The ∆565-M3 receptor mutant also
underwent agonist-driven phosphorylation in a similar manner to the wild-type
receptor indicating that the anti-apoptotic effect of the M3-receptor was independent
of receptor phosphorylation. Consistent with this was the fact that two M3-muscarinic
receptor mutants deficient in agonist- induced receptor phosphorylation were capable
of producing a full anti-apoptotic response. We conclude that the anti-apoptotic
response of the muscarinic receptor family was confined to the Gq/11-coupled
members of this family. The direct involvement of Gq/11/phospholipase C signalling
and the ERK-1/2 and JNK pathways together with receptor phosphorylation in the
anti-apoptotic response were eliminated. Mutation of a poly-basic region within the
short C-terminal tail of the M3-muscarinic receptor inhibited the ability of the
receptor to induce an anti-apoptotic response. We conclude that the conserved
poly-basic region in the C-terminal tail of the M1, M3 and M5 receptors
contributes to the ability of these receptors to mediate protection against
apoptotic cell death.
by guest on April 10, 2018
http://ww
w.jbc.org/
Dow
nloaded from
![Page 3: The C-terminal Tail of the M3-Muscarinic Receptor Possesses Anti ...](https://reader034.fdocuments.in/reader034/viewer/2022050901/58a038161a28abb24d8bd23e/html5/thumbnails/3.jpg)
3
Introduction:
Apoptosis or programmed cell death is the process by which cells initiate a series of
biochemical reactions which ultimately results in the breakdown of the cell
cytoskeleton, destruction of the integrity of the nucleus and cleavage of cellular DNA,
leading to cell death. Apoptosis is manifested during a number of physiological
processes including embryogenesis and development where specific populations of
cells are targeted for elimination (1). However, it is also now widely appreciated that
the process of programmed cell death can play a central role in the onset and
development of various disease states, particularly in the mammalian CNS and is
characteristic of such neuronal disorders as Alzheimer’s disease and ischemia (2).
The process of cellular degradation during apoptosis involves the activation of
intracellular cysteine proteases (caspases) that cleave substrates after specific
aspartate residues. Caspases exist in healthy cells as zymogens with low degradative
activity but become fully activated via autocatalytic processing in response to an
apoptotic signal (3). Apoptosis can be induced in mammalian cells by receptor-
specific mechanisms (e.g. Fas ligand, TRAIL) or by the addition of cytotoxic agents
(4). However, in the case of UV irradiation or the DNA damaging agent etoposide,
apoptosis in cells occurs via biochemical pathways which appear to involve
mitochondrial depolarisation, an increase in the mitochondrial permeability transition
pore, and release of apoptogenic factors such as cytochrome C from the inner
mitochondrial membrane to the cytosol. Cytosolic cytochrome C is able to interact
with Apaf-1 and pro-caspase 9 to form the apoptosome (5,6). The formation of this
large multimeric complex is the signal for the autocatalytic processing and activation
of pro-caspase 9 that in turn leads to the sequential activation of downstream
executioner caspases and degradation of cellular proteins that ultimately leads to the
destruction of the cell cytoskeleton, nuclear structure, and DNA (4).
It is now clear that a number of G-protein coupled receptors (GPCRs) have the
ability to control apoptosis, either initiating a pro- or anti- apoptotic signal depending
on the receptor subtype and cell type in which the receptor is expressed (7,8). Among
those receptors initiating an anti-apoptotic signal is the muscarinic receptor family,
which is composed of five distinct members, three of which (M1, M3, and M5) are
coupled to the Gq/11-phospholipase C pathway and two (M2 and M4) that inhibit
adenylate cyclase via coupling to Gi/o (9). Muscarinic receptors (most likely the M3-
subtype) expressed endogenously in cerebellar granule cells have been shown to
by guest on April 10, 2018
http://ww
w.jbc.org/
Dow
nloaded from
![Page 4: The C-terminal Tail of the M3-Muscarinic Receptor Possesses Anti ...](https://reader034.fdocuments.in/reader034/viewer/2022050901/58a038161a28abb24d8bd23e/html5/thumbnails/4.jpg)
4
protect against apoptotic-cell death induced by culturing in non-depolarising
conditions (10). Similarly, the Gq/11-coupled M1-muscarinic receptor expressed as a
recombinant protein in PC-12 cells protected against apoptosis following serum
deprivation (11). The mechanism by which muscarinic receptors are able to attenuate
apoptosis is not clear with some studies demonstrating a role for the cell survival
pathway mediated by PI-3 kinase /akt (8) and others reporting that this pathway in
addition to the mitogen-activated protein (MAP) kinase pathway and downstream G-
protein mediated second messenger pathways (e.g. calcium, cAMP and PKC) are not
important (11,12).
In the current study we use apoptosis induced by the DNA damaging agent,
etoposide, in Chinese hamster ovary (CHO) cells as our experimental model to
investigate the properties of the anti-apoptotic response elicited by the muscarinic
receptor family. We show that only the muscarinic receptor subtypes coupled to Gq/11-
proteins (M1, M3, and M5) elicit an anti-apoptotic response. Further analysis of the
M3-muscarinic receptor revealed that the anti-apoptotic signal does not involve direct
activation of the Gq/11/phospholipase C-signalling pathway, the MAP-kinase pathway,
or receptor phosphorylation but that a conserved poly-basic region within the C-
terminal tail of the receptor contributes to the anti-apoptotic response.
by guest on April 10, 2018
http://ww
w.jbc.org/
Dow
nloaded from
![Page 5: The C-terminal Tail of the M3-Muscarinic Receptor Possesses Anti ...](https://reader034.fdocuments.in/reader034/viewer/2022050901/58a038161a28abb24d8bd23e/html5/thumbnails/5.jpg)
5
Materials and Methods: Etoposide, phorbol-12,13-dibutyrate (PDBu) were from
Calbiochem (Nottingham, UK). DEVD-pNA was purchased from Bachem
(Merseyside, UK). G418 sulphate and all tissue culture reagents were purchased from
Gibco BRL (Glasgow, UK). Rabbit anti-ERK antisera was obtained from Santa Cruz
(California, USA). Carbachol chloride, atropine sulphate, and 3-(4,5-
dimethylthiazol-2-yl)-2,5,-diphenyl tetrazolium bromide (MTT) were from Sigma
(Poole, UK). All other chemicals were research grade and purchased from Fisher
(Loughborough, UK). All radiochemicals were purchased from Amersham Life
Sciences (Amersham, UK). The specific activity of radionucleotides were
3000Ci/mmol, 81Ci/mmol, 10mCi/ml for [32P]-adenosine trisphosphate, [3H]-N-
methylscopolamine, [32P]-orthophosphate respectively.
Generation of receptor mutants
The T-A tail mutant was generated by mutating threonine 551, 553 and 554 to
alanines by site directed mutagenesis (Qiuckchange, Stratagene) and PCR using 5’
primer
GCTCTGTGCAACAAAGCATTCAGAGCCGCTTTTAAGATGCTGCTGCTG and
3’ primer
CAGCAGCAGCATCTTAAAAGCGGTCCTGAATGCTTTGTTGCACAGAGC.
Mutant 6 was produced by the sequential mutation of 16 serines in the 3rd
intracellular loop. All serines were mutated to alanine except for serine 450 that was
mutated to a glycine. Serine-alanine mutations were at positions 286, 287, 289, 291,
292, 332, 333, 334, 336, 419, 423, 425, 433, 445 and 446. Serine-glycine mutation
was at position 450.
The ∆565-M3 mutant was produced by introducing a stop codon at position
565 using 5’ primer CCCGGATCCATGACCTTGCACAATAACAGTACA and 3’
primer CCCGAATTCCTAGTCACACTGGCACAGCAGCAG. All mutant cDNAs
were checked for the correct mutations by sequencing (AltaBioscience, Birmingham,
UK). The K-A mutant was produced by mutating K565KKRRK570 to alanine
using 5’ primer
AAGATGCTGCTGCTGGTCCAGTGTGACGCCGCGGCGGCGGCCGCGC
AGCAGTACCAGCAGAGACAGTCGGTC and 3’ primer
by guest on April 10, 2018
http://ww
w.jbc.org/
Dow
nloaded from
![Page 6: The C-terminal Tail of the M3-Muscarinic Receptor Possesses Anti ...](https://reader034.fdocuments.in/reader034/viewer/2022050901/58a038161a28abb24d8bd23e/html5/thumbnails/6.jpg)
6
GACCGACTGTCTCTGCTGGTACTGCTGCGCGGCCGCCGCCGCGGCGT
CACACTGGCACAGCAGCAGCATCTT
Tissue Culture: Chinese hamster ovary (CHO) cells were transfected with
cDNA encoding for the wild-type human M1, M2, M3, M4, M5, mutant 6, T-A tail or
∆565-muscarinic receptor and stably transfected clones were obtained by G418
sulphate selection. CHO cells stably expressing the muscarinic M1, M2, M3, M4, or M5
receptor at 1.58, 0.75, 0.40, 1.08, and 0.85 pmole/mg protein respectively, were
chosen for further study. CHO cells stably expressing the ∆565-M3, T-A tail, mutant
6, and K-A receptors at 0.35, 0.23, 0.36, and 0.31 pmole/mg protein were chosen for
further study. Stably transfected CHO cells were maintained in α-MEM media
supplemented with 10% foetal calf serum, 100IU/ml penicillin/streptomycin,
2.5µg/ml fungizone, and 500µg/ml G418 sulphate. In experiments investigating
various M3-muscarinic receptor mutants, at least two clones were tested in order to
eliminate clonal artifacts.
Annexin V-FITC and Propidium Iodide Staining: CHO-m3 cells were
plated on 25mm glass coverslips in 6 well plates. Following overnight incubation with
the appropriate drugs, cells were washed twice with binding buffer. Binding buffer
(1ml) was added together with 5µls each of annexin V-FITC and propidium iodide to
each well. Plates were then incubated for 15 minutes in the dark at room temperature.
Coverslips were washed 3x with phosphate-buffered saline (PBS) and then coated
with citifluor to enhance fluorescence. Annexin V-FITC and propidium iodide stained
cells were visualised on an inverted fluorescence microscope using a dual filter set for
FITC and rhodamine.
Measurement of Apoptotic DNA Laddering: CHO-m3 cells grown in
10cm2 plates were treated overnight with the appropriate drugs and DNA laddering
measured using a commercially available apoptotic DNA laddering kit (Roche
Biosciences Ltd, Lewes UK). Floating and adhered cells were collected in
PBS/0.5mM EDTA. Cells were centrifuged at 1500rpm for 3 minutes and pellets
resuspended in 200µls of PBS. Cells were lysed with 200µls of lysis buffer (6M
by guest on April 10, 2018
http://ww
w.jbc.org/
Dow
nloaded from
![Page 7: The C-terminal Tail of the M3-Muscarinic Receptor Possesses Anti ...](https://reader034.fdocuments.in/reader034/viewer/2022050901/58a038161a28abb24d8bd23e/html5/thumbnails/7.jpg)
7
guanidine-HCl, 10mM urea, 10mM Tris-HCl, 20% triton x-100 (vol/vol), pH4.4).
Samples were then processed as described in the manufacturers instructions.
MTT Assay: CHO-M3 cells grown in 10cm2 plates were treated overnight
with the appropriate drugs and 3-(4,5-dimethylthiazol-2-yl)-2,5,-diphenyl
tetrazolium bromide (MTT) added (0.5mgs/ml) to the plates. The plates were
incubated at 370C for 1 hour and then floating and adhered cells were collected
in PBS/0.5mM EDTA. An aliquot of cell suspension was used to measure protein
concentration. The remainder of the CHO-M3 cell suspension was then
centrifuged at 1500rpm for 3 minutes and the resultant cell pellet was dissolved
in 100% DMSO to liberate and solubilise the insoluble formazen product. The
level of formazen product was measured spectrophotometrically at 550nm.
Caspase 3 Assay: Sub-confluent cells plated in 10cm2 plates were treated
with the appropriate concentration of etoposide for the desired time. Floating and
attached cells were harvested in PBS/0.5 mM EDTA and cells centrifuged at 1500rpm
in a bench-top centrifuge. The pellets were resuspended in lysis buffer (50 mM
HEPES, pH7.4, 0.1% CHAPS, 1 mM DDT, 0.1 mM EDTA) and the cells left on ice
for 10 minutes. The cell lysates were pre-cleared by centrifugation at 10000xg for 1
minute. A Bradford assay was performed on the lysate and 200-400µg of cell lysate
was diluted 1:2 in reaction buffer (50 mM HEPES, pH 7.4, 100 mM NaCl, 0.1%
CHAPS, 10 mM DTT, 1 mM EDTA, 10% glycerol) in plastic 96 well plates. 1:10
vol/vol of 4 mM DEVD-pNA was added to the each well of the 96 well plate and the
plate placed at 370C for 2-4 hours. Cleavage of the DEVD-pNA substrate was
monitored colorimetrically at 405nm in a microplate reader.
Receptor Phosphorylation: Stably transfected CHO cells were grown in 6
well plates. Cells were incubated with 50µCi/ml [32P]-orthophosphate for 1 hour in
phosphate-free Krebs/HEPES buffer (KHB: 10mM HEPES pH 7.4, 118 mM NaCl,
4.3mM KCl, 1.17mM MgSO.7H2O, 1.3mM CaCl2, 25mM NaHCO3, 11.7mM
glucose). CCH (1mM) added for 5 minutes and reactions terminated by aspiration
and the addition of 1ml RIPA buffer (10mM Tris pH 7.4, 10mM EDTA, 500mM
by guest on April 10, 2018
http://ww
w.jbc.org/
Dow
nloaded from
![Page 8: The C-terminal Tail of the M3-Muscarinic Receptor Possesses Anti ...](https://reader034.fdocuments.in/reader034/viewer/2022050901/58a038161a28abb24d8bd23e/html5/thumbnails/8.jpg)
8
NaCl, 1% v/v NP-40, 0.5% w/v Na-deoxycholate). Receptor expression was
determined by [3H] N-methylscopolamine binding (see below) in order to ensure that
an equal number of receptors were present in the lysates. Lysates were pre-cleared by
centrifugation and 3µls anti-M3 muscarinic receptor antisera added.
Immunocomplexes were precipitated on protein A sepharose. Samples were washed
four times with TE buffer (10mM Tris pH 7.4, 2.5mM EDTA) and resolved on 8%
SDS/PAGE gels. Gels were stained with 0.2% Coomassie Blue to ensure that there
was equal immunoprecipitation. The gels were then dried and phosphoproteins were
visualised by autoradiography.
Receptor Density Determination: Confluent CHO cells grown in 6 well
plates were incubated with 0.14µCi of [3H]-N-methylscopolamine for 1 hour at 370C.
Cells were washed three times with ice-cold KHB and solubilised by the addition of
1ml of ice-cold RIPA buffer, and receptor number was determined by liquid
scintillation counting. Non-specific binding was determined by the inclusion of 10µM
atropine sulphate.
ERK and JNK Assays: Stably transfected CHO cells were grown to
confluence in 6 well plates. CCH (1mM) was added for the times indicated. For the
ERK assay PDBu (1µM) was added for 5 minutes and for JNK assay 0.3M sorbitol
was added for 30 minutes. Reactions were terminated by the addition of 0.5mls ice-
cold lysis buffer (20mM Tris, pH 7.6, 0.5% NP-40, 250mM NaCl, 3mM EDTA, 3mM
EGTA, 1mM Phenylmethylsulfonyl fluoride, 1Mm Na3VO4, 1mM dithithreitol,
5µg/ml benzamidine) and cells placed on ice for 5 minutes. Cells were then lysed by
scraping and lysates pre-cleared by centrifugation. For ERK assays 0.2µgs of anti-
ERK antisera (Santa Cruz, California) was added and immunoprecitations performed
for 1 hour at 40C. For JNK assays 5µg of GST-c-jun was added and samples placed
on a roller for 1 hour at 40C. For the ERK assay immunocomplexes were isolated on
protein A sepharose beads and for JNK assay JNK/c-jun complexes were isolated on
glutathione sepahrose beads. Samples were washed twice with lysis buffer and twice
with assay buffer (20mM HEPES pH 7.2, 20mM β-glycerophosphate pH 7.2, 10mM
MgCl2, 1mM dithiothreitol, 50µM Na3VO4). ERK activity was measured by
resuspending immunocomplexes in assay buffer containing 2µCi [32P]-ATP, 20µM
by guest on April 10, 2018
http://ww
w.jbc.org/
Dow
nloaded from
![Page 9: The C-terminal Tail of the M3-Muscarinic Receptor Possesses Anti ...](https://reader034.fdocuments.in/reader034/viewer/2022050901/58a038161a28abb24d8bd23e/html5/thumbnails/9.jpg)
9
ATP, 200µM epidermal growth factor receptor peptide (peptide encompassing region
661-681 of EGF receptor). For JNK assays JNK/c-jun complexes were resuspended in
assay buffer containing 2µCi/ml [32P]-ATP, 20µM ATP. For ERK assays the
reactions were terminated by the addition of 25% trichloroacetic acid and samples
were spotted on P81 phosphocellulose squares. P81 squares were washed four times
with 0.05% orthophosphoric acid and the incorporation of radioactivity measured by
scintillation counting. For JNK experiments the assays were terminated by the
addition of sample buffer. Samples were resolved on 12% SDS/PAGE gels and
phospho-c-jun visualised by autoradiography. Quantification of radioactivity
incorporated into c-jun was performed by excising the protein from the coomassie
blue-stained gel and measuring by scintillation counting.
Measurement of [Ca2+]I: CHO cells grown on 22mm coverslips were loaded with
5µM fura-2 acetoxymethyl-ester for 30 minutes at 370C. Measurement of [Ca2+]i was
performed as previously described (13).
by guest on April 10, 2018
http://ww
w.jbc.org/
Dow
nloaded from
![Page 10: The C-terminal Tail of the M3-Muscarinic Receptor Possesses Anti ...](https://reader034.fdocuments.in/reader034/viewer/2022050901/58a038161a28abb24d8bd23e/html5/thumbnails/10.jpg)
10
Results
Anti-apoptotic response of Gq/11-coupled muscarinic receptor subtypes
Apoptosis is mediated by the activation of caspases that was measured
colorimetrically in this study by the cleavage of the peptide substrate DEVD-pNA
(see methods). Treatment of CHO cells stably expressing recombinant human M1-M5
muscarinic receptors showed an increase in caspase activity following an overnight
treatment with the DNA damaging agent, etoposide (Fig 1). This increase in caspase
activity was significantly attenuated by muscarinic receptor stimulation in cells
expressing the M1, M3 or M5 muscarinic receptor subtypes (Fig 1: 59.0 ± 1.0%, n=4;
51.6 ± 1.2%, n=3; 54.4 ± 0.2%, n=4 for the M1, M3, and M5 respectively). In contrast,
muscarinic receptor stimulation of cells expressing the M2- or M4-muscarinic receptor
subtypes had no significant affect on etoposide-mediated caspase activation (Fig 1:
95.0 ± 11.0%, n=3; 93.1± 1.0%, n=4 for the M2- and M4-muscarinic receptor
respectively).
Characterisation of the anti-apoptotic response of the M3-muscarinic receptor.
Detailed characterisation of the anti-apoptotic response shown by the Gq/11-coupled
muscarinic receptors was investigated in CHO cells expressing the recombinant
human M3-muscarinic receptor (CHO-M3 cells). The appearance of
phosphatidylserine on the outer- leaflet of the plasma membrane is a marker of
apoptosis and can be detected by utilising the extremely high affinity that annexin V
exhibits for this phospholipid (14). Phase contrast images of CHO-M3 cells showed
that an overnight treatment with etoposide resulted in a marked reduction in cell
number with a large percentage of cells displaying phenotypic features characteristic
of apoptosis such as cell rounding, membrane blebbing and annexin V-FITC binding
(Fig. 2). Significant inhibition of these markers of apoptosis was observed in CHO-M3
cells treated with the muscarinic agonist carbachol (Fig 2). In particular, the increase
in annexin V-FITC staining observed following etoposide treatment was markedly
reduced by muscarinic receptor stimulation (Fig 2). As a control for necrotic cell
death, CHO-M3 cells treated with etoposide, etoposide and carbachol or vechicle were
stained with propidium iodide as a marker of necrosis. No significant difference in
propidium iodide staining was observed with the different cell treatments consistent
with apoptotic rather than necrotic cell death (data not shown).
by guest on April 10, 2018
http://ww
w.jbc.org/
Dow
nloaded from
![Page 11: The C-terminal Tail of the M3-Muscarinic Receptor Possesses Anti ...](https://reader034.fdocuments.in/reader034/viewer/2022050901/58a038161a28abb24d8bd23e/html5/thumbnails/11.jpg)
11
During the later stages of apoptosis caspase-dependent DNAase activation
results in the degradation of genomic DNA that is characterised by a 200bp DNA
ladder (15). Following an overnight treatment of CHO-M3 cells with etoposide the
extracted genomic DNA shows a distinctive apoptotic DNA ladder that was
attenuated by muscarinic receptor stimulation (Fig 3). This data combined with the
measurement of caspase activity (Fig 1) and the determination of annexin V staining
(Fig 2) are consistent with etoposide mediating apoptosis in CHO-M3 cells and that
stimulation of the M3-muscarinic receptor results in attenuation of this apoptotic
response.
The reduction of 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium
bromide (MTT) to an insoluble formazen product is catalysed by mitochondrial
succinate dehydrogenase and is used as measure of cellular viability (16). An
overnight treatment of CHO-M3 cells with etoposide resulted in an inhibition in
the level of MTT reduction compared to CHO-M3 cells treated with vehicle only
confirming that the apoptotic agent reduces the viability of the cell population
(Fig 4). Stimulation of the M3-muscarinic receptor prevented this reduction in
cellular viability induced by etoposide treatment (Fig 4).
Characterisation of the M3-muscarinic receptor anti-apoptotic response.
We explored the kinetics of the muscarinic-induced protection of CHO-M3 cells by
treating cells with carbachol for various time periods. M3-muscarinic receptor
signalling was terminated by the addition of atropine (0.5µM) followed by three
washes with α-MEM. Apoptosis was then induced by an overnight treatment of cells
with etoposide. Surprisingly, muscarinic receptor-mediated protection was induced
extremely rapidly as a brief 0.5min exposure of CHO-M3 cells to carbachol resulted in
a maximal anti-apoptotic response to a subsequent overnight exposure to etoposide
(Fig. 5A). It should be noted that the continued presence of muscarinic receptor
stimulation was not necessary to provide protection from etoposide- induced cell
death. The suppression of cell death by the M3-muscarinic receptor was also dose-
dependent with an EC50 of 4.9µM (Fig. 5B & 5C).
We have utilised chemical inhibitors of ERK, p38, and phospatidylinositol-3-
kinase (PI-3-kinase) to determine whether these signalling components play any
role in mediating the anti-apoptotic response of the M3-muscarinic receptor. All
by guest on April 10, 2018
http://ww
w.jbc.org/
Dow
nloaded from
![Page 12: The C-terminal Tail of the M3-Muscarinic Receptor Possesses Anti ...](https://reader034.fdocuments.in/reader034/viewer/2022050901/58a038161a28abb24d8bd23e/html5/thumbnails/12.jpg)
12
the chemical inhibitors were tested for their expected activity in cell signalling
experiments in CHO-M3 cells (data not shown). Inhibition of ERK and p38 with
PD98059 (50µM) and SB202190 (10µM) respectively, had little affect on the M3-
muscarinic receptor protective response (data not shown). Importantly, these
inhibitors did not mediate an apoptotic response in their own right. Likewise,
inhibition of PI-3-kinase with wortmannin (100nM), alone did not induce cell death.
However, incubation of CHO-M3 cells with wortmannin (100nM) had no significant
affect on the ability of the M3-muscarinic receptor to induce protection against
etoposide-mediated cell death (data not shown).
Functional role of the C-terminal tail of the M3- muscarinic receptor in the anti-
apoptotic mechanism.
Sequence alignment of the 5 members of the muscarinic receptor family
revealed that the C-terminal tail of the Gq/11-coupled receptors all share a degree of
homology in the membrane distal portion that is not present in the Gi/o-coupled
members (Fig. 6A). In order to address the functional role of the C-terminal tail in
mediating the anti-apoptotic effects of the Gq/11-coupled muscarinic receptors, we
truncated the M3-muscarinic receptor C-terminal tail at position 565 (∆565-M3, Fig
6B). These receptors were stably expressed in CHO cells at the plasma membrane as
determined by ligand binding using the hydrophilic muscarinic receptor antagonist
[3H]-N-methyscopolamine (see methods). Furthermore, this mutant receptor was able
to signal through phospholipase C/calcium and the MAPK kinase pathways in a
similar manner to the wild-type receptor (see below). Care was taken to select mutant
receptor cell lines that expressed similar levels of receptor to wild-type receptor cell
lines for these studies (see methods).
Overnight treatment of CHO cells stably expressing the ∆565-M3 receptor
with etoposide lead to a significant increase in caspase activity. However, in contrast
to the wild-type receptor, activation of the ∆565-M3 muscarinic receptor was unable
to prevent etoposide-mediated caspase activation (Fig. 7A). These data together with
the sequence alignment of the C-terminal tails of muscarinic receptor, suggest that the
C-terminal tail region of the M3-muscarinic receptor and particularly the poly-basic
region in the membrane proximal region (Fig 6A) may be central in allowing the
receptor to inhibit etoposide-mediated cell death in CHO cells.
by guest on April 10, 2018
http://ww
w.jbc.org/
Dow
nloaded from
![Page 13: The C-terminal Tail of the M3-Muscarinic Receptor Possesses Anti ...](https://reader034.fdocuments.in/reader034/viewer/2022050901/58a038161a28abb24d8bd23e/html5/thumbnails/13.jpg)
13
In order to test the importance of the poly-basic region of the C-terminal
tail in mediating the anti-apoptotic response of the M3-muscarinic receptor we
produced a receptor mutant where the basic residues in the region
K565KKRRK570 were mutated to alanine (K-A) (Fig 6B). These receptors were
stably expressed in CHO cells at the plasma membrane as determined by ligand
binding using the hydrophilic muscarinic receptor antagonist [3H]-N-
methyscopolamine (see methods). As observed with CHO cells expressing the
∆565-M3 receptor, activation of the K-A receptor significantly attenuated the
ability of etoposide to induce activation of caspase 3 (Fig 7B). This data strongly
suggests that the conserved poly-basic region in the C-terminal tail of the
muscarinic M3 receptor plays an important role in mediating the anti-apoptotic
effects of the receptor.
The M3-Muscarinic receptor-mediated anti-apoptotic response is independent of
receptor phosphorylation.
We have previously shown that M3-muscarinic receptors are subject to rapid agonist-
driven phosphorylation (17,18). Here we examined the role of receptor
phosphorylation in the M3-muscarinic receptor anti-apoptotic response by generating
two receptor mutants that were deficient in their ability to undergo agonist-mediated
receptor phosphorylation. The T-A tail mutant was produced by site-directed
mutagenesis of three threonine residues (threonine 551, 553, and 554) to alanine in
the membrane proximal region of the C-terminal tail of the M3-muscarinic receptor
(Fig 6B). This mutant receptor showed a 54.3 ± 8.6% decrease in agonist-mediated
receptor phosphorylation compared to wild-type receptor (Fig 8A + 8D). A second
mutant, designated mutant-6, was generated by site-directed mutagenesis of the serine
phospho-acceptor sites in the third intracellular loop of the M3-muscarinic receptor
(Fig 6C). Mutant-6 also showed a significant reduction in agonist-mediated receptor
phosphorylation (Fig.8B + 8D, 62.9 ± 1.9% reduction compared to wild-type
receptor). It should be noted that both mutant-6 and the T-A tail mutants were
expressed at the cell surface and were able to couple to down-stream signalling
pathways such as calcium/phospholipase C and the MAPK pathway (data not shown).
Importantly mutant-6, which contains point changes in the region to which the M3-
muscarinic receptor antibody was raised (i.e. S345-L463 in the third intracellular loop of
by guest on April 10, 2018
http://ww
w.jbc.org/
Dow
nloaded from
![Page 14: The C-terminal Tail of the M3-Muscarinic Receptor Possesses Anti ...](https://reader034.fdocuments.in/reader034/viewer/2022050901/58a038161a28abb24d8bd23e/html5/thumbnails/14.jpg)
14
the human M3-muscarinic receptor), was recognised by the anti-M3-muscarinic
receptor antibody as determined by immunoprecipitation of biotinylated receptor with
an efficiency equivalent to the wild-type receptor (data not shown).
Despite the fact that the mutant-6 and the T-A tail mutant receptors showed
reduced levels of agonist-mediated phosphorylation both were able to mediate an anti-
apoptotic response similar to that observed for the wild-type receptor (Fig 9: 56.2 ±
2.4%; 46.8 ± 6.4%; 65.0 ± 3.9% attenuation of the etoposide activation of caspase by
wild type, T-A tail mutant and mutant-6 respectively, n=4). In addition, the ∆565-M3
truncation mutant that was unable to mediate an anti-apoptotic response (Fig 7A) did
undergo agonist-mediated phosphorylation in a manner similar to the wild-type
receptor (Fig 8C + 8D). These data strongly suggest that phosphorylation of the M3-
muscarinic receptor is not involved in the anti-apoptotic response.
Signalling properties of the ∆565-M3 mutant
GPCR activation of the MAP kinase signalling pathways have been shown to
be central in the regulation of cell death in a variety of cell lines (19-22). In order to
test this in the current study, the ability of the truncation mutant ∆565-M3 to stimulate
the ERK and JNK pathways was investigated. Stimulation of the ∆565-M3 receptor
induced a robust increase in ERK activity in a manner similar to the wild-type M3-
muscarinic receptor (Fig 10A). Similarly, stimulation of the ∆565-M3 receptor also
resulted in activation of the JNK pathway that was similar to that seen following wild-
type M3-muscarinic receptor activation (Fig 10B & 10C: 134.2 ± 26.0 and 118.7 ±
33.1 fmol phosphate incorporated/mg/min following a 60 minute stimulation with
1mM carbachol for the wild-type M3-muscarinic receptor and ∆565-M3 respectively,
n=3). These data, coupled with the inhibitor studies above, strongly imply that the
M3-muscarinic receptor anti-apoptotic affects are not mediated via stimulation of the
MAP kinase family.
It has been widely recognised that cytosolic increases in intracellular calcium
[Ca2+]i can either protect or induce apoptosis under certain experimental conditions
(23). In this study we have demonstrated that the Gq/11/phospholipase C-coupled
muscarinic receptors are able to protect CHO cells against etoposide-mediated cell
death whereas the Gi/o-coupled muscarinic receptor family members are not (Fig. 1).
In order to determine whether activation of the phospholipase C pathway is essential
by guest on April 10, 2018
http://ww
w.jbc.org/
Dow
nloaded from
![Page 15: The C-terminal Tail of the M3-Muscarinic Receptor Possesses Anti ...](https://reader034.fdocuments.in/reader034/viewer/2022050901/58a038161a28abb24d8bd23e/html5/thumbnails/15.jpg)
15
in mediating the anti-apoptotic effects of the Gq/11-coupled members of the muscarinic
receptor family we examined whether the ∆565-M3 receptor, which is unable to
protect against etoposide-mediated cell death, was able to produce a [Ca2+]i transient
following receptor activation. Fig. 11A shows that activation of the ∆565-M3 receptor
with a maximal dose of carbachol initiates a [Ca2+]i transient that was similar to that
observed following activation of wild-type M3-muscarinic receptors. Similarly,
submaximal doses of carbachol gave a comparable response in the mutant and wild-
type expressing cell lines (Fig 11B). As an internal control endogenous purinergic
receptors expressed in CHO cells were stimulated with 100µM ATP which resulted in
a robust [Ca2+]i transient (Fig 11A). The conclusion from these data is that the anti-
apoptotic properties of the Gq/11-coupled muscarinic receptors is not due to their
ability to activate the phospholipase C pathway but is due to a conserved poly-
basic region found within the membrane distal portion of the C-terminal tail of
these receptors that is not shared by the Gi/o-coupled members of the receptor
family.
by guest on April 10, 2018
http://ww
w.jbc.org/
Dow
nloaded from
![Page 16: The C-terminal Tail of the M3-Muscarinic Receptor Possesses Anti ...](https://reader034.fdocuments.in/reader034/viewer/2022050901/58a038161a28abb24d8bd23e/html5/thumbnails/16.jpg)
16
Discussion
We report here that the Gq/11-coupled members of the muscarinic receptor family
expressed in CHO cells protect against apoptotic cell death. Detailed analysis of the
M3-muscarinic receptor demonstrated that the distal portion of the C-terminal tail
provided a motif that was essential in this anti-apoptotic response.
One of most intriguing characteristics of the M3-muscarinic receptor cell
survival response was the rapid time-course. A short 0.5min pulse of muscarinic
receptor agonist was sufficient to protect against apoptosis induced by an overnight
treatment with etoposide. This suggested that the mechanism of the M3-muscarinic
receptor response was rapid in its onset and was then maintained for an extended
period after agonist withdrawal. A strong candidate for mediating such a mechanism
was rapid changes in intracellular calcium, which in the case of a number of GPCRs
has been shown to encode for longer adaptive responses such as changes in gene
transcription (24,25). However, analysis of a truncated mutant of the M3-muscarinic
receptor (∆565-M3), which was unable to mediate an anti-apoptotic response, revealed
that this receptor was still coupled to the calcium/PLC pathway in a manner similar to
the wild-type receptor. These data would appear to eliminate a role for calcium/PLC
signalling in the M3-muscarinic receptor cell survival response. In this regard our
work is consistent with that of Lindenboim and colleagues who demonstrated that the
M1-muscarinc receptor in PC-12 cells protected against serum deprivation- induced
cell death via a Ca2+-independent mechanism (11).
Detailed analysis of the truncation mutant ∆565-M3 provided a unique
opportunity to probe other signalling pathways for their involvement in the M3-
muscarinic receptor anti-apoptotic response. In particular, focus was placed on the
MAP kinase pathway that has previously been shown to be involved in the anti-
apoptotic response of a number of GPCRs including the neurokinin-1, LPA, and
endothelin-1 receptors (20,21,26). In the current study a robust activation of both
ERK and JNK was clearly detectable following activation of ∆565-M3 receptor
indicating that neither of these MAP kinase pathways are involved in the M3-
muscarinic receptor-induced protection from cell death. We have also tested chemical
inhibitors of ERK and P38 MAP kinase and found that the receptor- induced anti-
apoptotic response was not inhibited in the presence of either inhibitor. These data
by guest on April 10, 2018
http://ww
w.jbc.org/
Dow
nloaded from
![Page 17: The C-terminal Tail of the M3-Muscarinic Receptor Possesses Anti ...](https://reader034.fdocuments.in/reader034/viewer/2022050901/58a038161a28abb24d8bd23e/html5/thumbnails/17.jpg)
17
would indicate that MAPK pathways are not involved in the anti-apoptotic response
of the M3-muscarinic receptor observed here.
Previous studies in COS-7 cells have demonstrated that M1- and M2-
muscarinic receptors can protect against cell death, in part, through the pro-survival
PKB/akt pathway (8). Activation of PKB/akt is down-stream of the phosphoinositide
lipid products of the PI3-kinases (27). By using wortmannin, an inhibitor of PI3-
kinase, previous studies have demonstrated that M3-muscarinic receptors can activate
PKB/akt via PI3-kinase (28). However, the involvement of PKB/akt in the M3-
muscarinic receptor anti-apoptotic response in the current study appears unlikely since
treatment with wortmannin at a concentration reported to inhibit PI3-kinase had no
significant effect on the anti-apoptotic response.
There appears to be discrepancies in the muscarinic anti-apoptotic responses
reported here in CHO cells compared with those previously reported in COS-7 cells
(8). The anti-apoptotic response in CHO cells is confined to the Gq/11-coupled
subtypes whereas in COS-7 cells both Gq/11 and Gi/o-coupled receptor subtypes
provide protection. These discrepancies may be due to cell and receptor-specific
differences but it is also possible that the mechanisms adopted by GPCRs to modulate
cell death might be influenced by the method of inducing cell death (e.g UV-
irradiation in COS-7 cells and etoposide in the current study). We are currently testing
in CHO cells whether muscarinic receptors can protect against cell death induced by
apoptotic stimuli other than etoposide.
We addressed the requirement of M3-muscarinic receptor phosphorylation in
the induction of the anti-apoptotic response. This is important given the growing body
of evidence that suggests the formation of phosphorylated GPCR/arrestin complexes
appears to be essential in allowing for GPCR modulation of the cell death pathway
(20,29). Indeed the formation of rhodopsin-arrestin complexes is essential in inducing
retinal degeneration in drosophila (30). Light- induced photoreceptor apoptosis in
drosophila appears to involve the formation of membrane complexes of
phosphorylated, activated rhodopsin and arrestin, and subsequent clathrin-dependent
endocytosis of these complexes into a cytoplasmic compartment (31). It has been
proposed that similar phosphorylated GPCR/arrestin complexes may be required to
allow GPCR regulation of apoptosis in mammalian cells (29). Indeed prevention of
stable neurokinin-1 receptor/β-arrestin complexes by mutating the C-terminal tail of
by guest on April 10, 2018
http://ww
w.jbc.org/
Dow
nloaded from
![Page 18: The C-terminal Tail of the M3-Muscarinic Receptor Possesses Anti ...](https://reader034.fdocuments.in/reader034/viewer/2022050901/58a038161a28abb24d8bd23e/html5/thumbnails/18.jpg)
18
the receptor is sufficient to prevent substance P-mediated anti-apoptosis (20).
Intriguingly, in the current study phosphorylation of the M3-muscarinic receptor does
not appear to be central in allowing for the anti-apoptotic effects of the receptor as the
∆565-M3 receptor, which lacks the anti-apoptotic properties of the wild-type receptor,
is phosphorylated normally in response to agonist addition. Furthermore, we have also
shown tha t two M3-muscarinic receptor mutants that exhibit significantly reduced
agonist- induced phosphorylation, are able to protect CHO cells against etoposide-
induced cell death in an identical manner to wild-type M3-muscarinic receptors.
Therefore, it appears that the ability of Gq/11-coupled muscarinic receptors to inhibit
apoptotic cell death proceeds via a mechanism that does not involve receptor
phosphorylation.
The inability of the C-terminal tail truncation mutant, ∆565-M3, to mediate an
anti-apoptotic response indicates the existence of structural determinants within the
distal portion of the C-terminal tail that are essential for mediating the pro-survival
response of the receptor. Unlike many other type I GPCRs (e.g. the adrenergic
receptor family) the muscarinic receptor family have relatively short C-terminal tails
(23-39 amino acids). There is a large degree of conservation between the five
muscarinic receptor subtypes in the membrane proximal region of the C-terminal tail
up to the putative cysteine palmitoylation site (see Fig 5A). This conservation across
the family is however lost down-stream of the cysteine palmitoylation site. In the case
of the Gq/11-coupled receptors (M1, M3 and M5) there is a poly-basic motif which is
not present in the Gi/o-coupled members (M2 and M4). We assessed whether this
poly-basic region was important in mediating the anti-apoptotic effects of the
Gq/11-coupled muscarinic receptors by mutating the basic residues in this region
of the M3-muscarinic receptor to alanine (K-A). Indeed activation of the K-A
mutant significantly reduced the ability of etoposide to induce activation of
caspase 3 in CHO cells. Since it is only the Gq/11-coupled members of the
muscarinic receptor family that are able to protect against cell death this data
strongly implies that this poly-basic region is the common structural element
that is essential for the anti-apoptotic response of the M1, M3 and M5-muscarinic
receptors.
The conclusions from the current study are that the M3-muscarinic receptor
(and most probably the M1 and M5 receptors) are able to protect against etoposide-
by guest on April 10, 2018
http://ww
w.jbc.org/
Dow
nloaded from
![Page 19: The C-terminal Tail of the M3-Muscarinic Receptor Possesses Anti ...](https://reader034.fdocuments.in/reader034/viewer/2022050901/58a038161a28abb24d8bd23e/html5/thumbnails/19.jpg)
19
mediated cell death in CHO cells by a mechanism that is rapid in its onset, is
independent of calcium/PLC signalling, receptor phosphorylation and the MAP-
kinase and PI3-kinase pathways and is dependent on a conserved poly-basic region
within the distal region of the C-terminal tail. The physiological importance of these
findings have yet to be clearly defined. However, an anti-apoptotic response mediated
by M3-muscarinic receptors in native tissues has been demonstrated. For example,
muscarinic activation in cerebellar granule cells has been shown to protect from
apoptosis induced by culturing in non-depolarising conditions suggesting that this
process may be involved in regulating neuronal apoptosis in the developing central
nervous system (10). Furthermore, the recent finding that acetylcholine can be
released from cells of haemaopoietic lineage (32), and that both T and B-lymphocytes
express functional M3-muscarinic receptors (33), leads to the intriguing possibility
that the immune function of circulating T and B-lymphocytes may be controlled in an
autocrine/paracrine manner by cir culating acetylcholine via M3-muscarinic receptors.
As the function, growth, and differentiation of lymphocytes is highly dependent on
apoptosis this may provide a novel, physiological setting whereby M3-muscarinic
receptor modulation of programmed cell death may be important in mediating
immune responses.
Acknowledgments
We would like to thank the Wellcome Trust for their financial support (grant 047600).
by guest on April 10, 2018
http://ww
w.jbc.org/
Dow
nloaded from
![Page 20: The C-terminal Tail of the M3-Muscarinic Receptor Possesses Anti ...](https://reader034.fdocuments.in/reader034/viewer/2022050901/58a038161a28abb24d8bd23e/html5/thumbnails/20.jpg)
20
Bibliography
1. Wylie, P. G., Challiss, R. A., and Blank, J. L. (1999) Biochem J 338, 619-628.
2. Raff, M., Barres, B., Burne, J., Coles, H., Ishizaki, Y., and Jacobson, M.
(1993) Science 262, 695-700
3. Adams, J., and Cory, S. (2001) Trends Biochem Sci 26, 61-66
4. Konopleva, M., Zhao, S., Xie, Z., Segall, H., Younes, A., Claxton, D. F.,
Estrov, Z., Kornblau, S. M., and Andreeff, M. (1999) Adv Exp Med Biol 457,
217-236
5. Hengartner, M. O. (2000) Nature 407, 770-776.
6. Strasser, A., O'Connor, L., and Dixit, V. M. (2000) Annu Rev Biochem 69,
217-245
7. Ueda, H., Morishita, R., Itoh, H., Narumiya, S., Mikoshiba, K., Kato, K., and
Asano, T. (2001) J Biol Chem 276, 42527-42533
8. Murga, C., Laguinge, L., Wetzker, R., Cuadrado, A., and Gutkind, J. S. (1998)
J Biol Chem 273, 19080-19085.
9. Caulfield, M. P. (1993) Pharmacol Ther 58, 319-379.
10. Yan, G. M., Lin, S. Z., Irwin, R. P., and Paul, S. M. (1995) Mol Pharmacol
47, 248-257.
11. Lindenboim, L., Pinkas-Kramarski, R., Sokolovsky, M., and Stein, R. (1995) J
Neurochem 64, 2491-2499.
12. Leloup, C., Michaelson, D. M., Fisher, A., Hartmann, T., Beyreuther, K., and
Stein, R. (2000) Cell Death Differ 7, 825-833.
13. Budd, D. C., Challiss, R. A., Young, K. W., and Tobin, A. B. (1999) Mol
Pharmacol 56, 813-823.
14. Montaville, P., Neumann, J., Russo-Marie, F., Ochsenbein, F., and Sanson, A.
(2002) J Biol Chem 277, 24684-93.
15. Enari, M., Sakahira, H., Yokoyama, H., Okawa, K., Iwamatsu, A., and Nagata,
S. (1998) Nature 391, 43-50
16. Berridge, M. V., and Tan, A. S. (1993) Arch Biochem Biophys 303, 474-482
17. Tobin, A. B. (1997) Pharmacol Ther 75, 135-151.
18. Budd, D. C., McDonald, J. E., and Tobin, A. B. (2000) J Biol Chem 275,
19667-19675.
by guest on April 10, 2018
http://ww
w.jbc.org/
Dow
nloaded from
![Page 21: The C-terminal Tail of the M3-Muscarinic Receptor Possesses Anti ...](https://reader034.fdocuments.in/reader034/viewer/2022050901/58a038161a28abb24d8bd23e/html5/thumbnails/21.jpg)
21
19. Communal, C., Colucci, W. S., and Singh, K. (2000) J Biol Chem 275, 19395-
19400.
20. DeFea, K. A., Vaughn, Z. D., O'Bryan, E. M., Nishijima, D., Dery, O., and
Bunnett, N. W. (2000) Proc Natl Acad Sci U S A 97, 11086-11091.
21. Fang, X., Yu, S., LaPushin, R., Lu, Y., Furui, T., Penn, L. Z., Stokoe, D.,
Erickson, J. R., Bast, R. C., Jr., and Mills, G. B. (2000) Biochem J 352 Pt 1,
135-143.
22. Ham, J., Eilers, A., Whitfield, J., Neame, S. J., and Shah, B. (2000) Biochem
Pharmacol 60, 1015-1021.
23. Nicotera, P., and Orrenius, S. (1998) Cell Calcium 23, 173-180.
24. Trejo, J., and Brown, J. H. (1991) J Biol Chem 266, 7876-7882.
25. Albrecht, C., von Der Kammer, H., Mayhaus, M., Klaudiny, J., Schweizer, M.,
and Nitsch, R. M. (2000) J Biol Chem 275, 28929-28936.
26. Wu-Wong, J. R., Chiou, W. J., and Wang, J. (2000) J Pharmacol Exp Ther
293, 514-521.
27. Tanaka, K., Adachi, H., Konishi, H., Iwamatsu, A., Ohkawa, K., Shirai, T.,
Nagata, S., Kikkawa, U., and Fukui, Y. (1999) Biosci Biotechnol Biochem 63,
368-372.
28. Tang, X., Batty, I. H., and Downes, C. P. (2002) J Biol Chem 277, 338-344.
29. Miller, W. E., and Lefkowitz, R. J. (2001) Sci STKE 2001, PE1.
30. Alloway, P. G., Howard, L., and Dolph, P. J. (2000) Neuron 28, 129-138.
31. Kiselev, A., Socolich, M., Vinos, J., Hardy, R. W., Zuker, C. S., and
Ranganathan, R. (2000) Neuron 28, 139-152.
32. Kawashima, K., and Fujii, T. (2000) Pharmacol Ther 86, 29-48.
33. Fujii, T., and Kawashima, K. (2000) Naunyn Schmiedebergs Arch Pharmacol 362, 14-21.
by guest on April 10, 2018
http://ww
w.jbc.org/
Dow
nloaded from
![Page 22: The C-terminal Tail of the M3-Muscarinic Receptor Possesses Anti ...](https://reader034.fdocuments.in/reader034/viewer/2022050901/58a038161a28abb24d8bd23e/html5/thumbnails/22.jpg)
22
Figure Legends: Fig 1: Muscarinic receptor subtype-specific inhibition of etoposide -mediated cell death. CHO cells stably expressing M1-M5-muscarinic receptor subtypes were treated with carbachol (1mM) and/or etoposide (250µM) overnight and cell lysates processed for caspase activity. Data shown is the mean ± S.E.M. (n=3-6). Fig 2: M3-muscarinic receptor stimulation attenuates etoposide -induced apoptosis as measured by Annexin V-FITC staining. CHO-M3 cells seeded on glass coverslips were treated with overnight with; A vehicle (Cont), B etoposide (Etop; 250µM) and C carbachol (CCH; 1 mM) and etoposide (Etop 250µM). Phase contrast images of CHO-M3 cells are shown in the left panel. Fluorescent images of CHO-M3 cells stained with annexin V-FITC are shown in the right panel. Data shown is representative of three separate experiments. Fig 3: M3-muscarinic receptor stimulation attenuates etoposide -induced apoptosis as measured by DNA laddering. CHO-M3 cells seeded on 10cm2 plates were treated with carbachol (CCH; 1 mM) and/or etoposide (Etop; 250µM) overnight. Genomic DNA was isolated and electrophoresed on a 2% agarose gel and visualised by ethidium bromide staining and UV transillumination. Data shown is representative of three separate experiments. Fig 4: M3-muscarinic receptor stimulation inhibits the etoposide -mediated decrease in cell viability. CHO-M3 cells seeded on 10cm2 plates were treated with carbachol (CCH; 1 mM) and/or etoposide (Etop; 250µM) overnight. 0.5mgs/ml 3-(4,5-dimethylthiazol-2-yl)-2,5,-diphenyl tetrazolium bromide (MTT) was added to the plates and the cells were incubated at 370C for 1 hour. The insoluble, coloured formazen product was solubilised and measured spectrophotometrically at 550nm as described in the methods section. Data shown is the mean ± S.E.M. (n=3). Fig 5: Time-course and dose-response of the anti-apoptotic effects of the M3-muscarinic receptor. A: CHO-M3 cells seeded on 10cm2 plates were treated with carbachol (CCH; 1 mM) for the times indicated. Atropine (0.5µM) was then added and cells washed 3x with α-MEM. CHO-M3 cells were then treated with etoposide (Et; 250µM) overnight and cell lysates processed for caspase activity. Data shown are the mean ± S.E.M. (n=3). B: CHO-M3 cells seeded on 10cm2 plates were treated with the indicated concentration of carbachol (CCH; -Log [M]) and/or etoposide (Et; 250µM) overnight and cell lysates processed for caspase activity. C: Dose-response curve for carbachol-mediated inhibition of etoposide-induced cell death. 100% inhibition is given as the difference between caspase activity observed in the presence of etoposide alone compared to that seen in the presence of etoposide and 1 mM carbachol. Data shown are the mean ± S.E.M. (n=3).
by guest on April 10, 2018
http://ww
w.jbc.org/
Dow
nloaded from
![Page 23: The C-terminal Tail of the M3-Muscarinic Receptor Possesses Anti ...](https://reader034.fdocuments.in/reader034/viewer/2022050901/58a038161a28abb24d8bd23e/html5/thumbnails/23.jpg)
23
Fig 6: Amino acid sequences of the C-terminal tails of the M1-M5-muscarinic receptor subtypes and M3-muscarinic receptor mutants. A: Alignment of the C-terminal tails of the human muscarinic receptor family. The sequences are divided into the proximal region which is the region N-terminal to the putative cysteine palmitoylation site (marker by *), and the distal region which is C-terminal to the palmitoylation site. The box indicates the conserved poly-basic region identified in the Gq/11-coupled muscarinic receptor subtypes B: C-terminal tail mutations of the human M3-muscarinic receptor showing the position of the theronine-alanine (highlighted in bold and underlined) substitutions in the T-A mutant and the truncation mutant ∆565-M3 are shown. The substitution of basic residues in the K-A mutant are also shown. C: Graphical representation of the 15 serine-alanine and one serine-glycine mutation made in the 3rd intracellular loop of the M3-muscarinic receptor to create mutant-6. Fig 7: The ∆565-M3 and K-A receptor mutants are unable to protect CHO cells from etoposide-mediated cell death. A: CHO cells stably expressing the wild-type M3-muscarinic receptor (Wt-M3) or the ∆565-M3 were treated with carbachol (1mM) and/or etoposide (250µM) overnight and cell lysates processed for caspase activity. Note the cell surface expression levels of the wild type and mutant receptor was 0.40 and 0.35 pmoles/mg protein respectively. Data shown is the mean ± S.E.M. (n=6). B: CHO cells stably expressing the wild-type M3-muscarinic receptor (Wt-M3) or the K-A receptor were treated with carbachol (1mM) and/or etoposide (250µM) overnight and cell lysates processed for caspase activity. Note the cell surface expression levels of the wild type and mutant receptor was 0.40 and 0.30 pmoles/mg protein respectively. Data shown is the mean ± S.E.M. (n=3). Fig 8: Comparison of the agonist-mediated phosphorylation of wild-type M3 -muscarinic receptors, T-A tail receptors, mutant -6 receptors and ∆565-M3 receptors stably expressed in CHO cells. CHO cells incubated with [32P]-orthophosphate for 1 hour (see methods) were stimulated with 0.1mM CCH for 5 minutes. Muscarinic receptors were solubilised and immunoprecipitated and receptors resolved on 8% SDS/PAGE gels. Muscarinic receptor expression was determined by ligand binding and equal numbers of receptor were loaded in each lane. Data shown is representative of at least 3 separate experiments. A: Comparison of phosphorylation profile of Wt-M3 and T-A tail receptors. B: Comparison of phosphorylation profile of wild-type M3-muscarinic receptors (Wt-M3) and mutant-6 receptors (Mut 6). C: Comparison of phosphorylation profile of Wt-M3 and ∆565-M3 receptors. D: Densitometric analysis of receptor phosphorylation profiles of Wt-M3, T-A tail, Mut-6 and ∆565-M3 receptors. Phosphorylation of mutant M3-muscarinic receptors were normalised to the phosphorylation of Wt-M3 receptors, which is given as 100%. Fig 9: Phosphorylation deficient mutants, mut-6 and T-A tail receptor, are capable of inhibiting etoposide -mediated cell death. CHO cells stably expressing either the wild-type M3-muscarinic receptor (Wt-M3), mutant-6 receptor (Mut 6), or the T-A tail receptor were treated with carbachol (1mM) and/or etoposide (250µM) overnight and cell lysates processed for caspase activity. Data shown is the mean ± S.E.M. (n=3-6).
by guest on April 10, 2018
http://ww
w.jbc.org/
Dow
nloaded from
![Page 24: The C-terminal Tail of the M3-Muscarinic Receptor Possesses Anti ...](https://reader034.fdocuments.in/reader034/viewer/2022050901/58a038161a28abb24d8bd23e/html5/thumbnails/24.jpg)
24
Fig 10: ERK and JNK are activated following ∆565-M3 receptor stimulation. A: ERK activation following stimulation of cells expressing wild-type M3-muscarinic receptors (Wt-M3) and ∆565-M3 receptors with 1mM CCH. Data shown is mean ± S.E.M. (n=3). B: JNK activation following stimulation of CHO cells expressing Wt-M3 and ∆565-M3 receptors with 1mM CCH. Gel shown is representative of 3 separate experiments. C: JNK activation following stimulation of Wt-M3 and ∆565-M3 receptors with 1mM CCH. Data shown is mean ± S.E.M. (n=3). Fig 11: Initiation of [Ca2+]I transients following activation of stably transfected wild-type M3-muscarinic receptors (Wt-M3) and ∆565-M3 receptors is similar in CHO cells. A: CHO cells stably expressing either Wt-M3 or ∆565-M3 receptors were loaded with fura-2. Cells were treated with 1mM CCH or 100µM ATP and changes in [Ca2+]I measured via Ca2+ imaging. B: CHO cells stably expressing either Wt-M3 or ∆565-M3 receptors were loaded with fura-2. Cells were treated with 10µM, 30µM, or 1mM CCH and changes in [Ca2+]I visualised via Ca2+ imaging.
by guest on April 10, 2018
http://ww
w.jbc.org/
Dow
nloaded from
![Page 31: The C-terminal Tail of the M3-Muscarinic Receptor Possesses Anti ...](https://reader034.fdocuments.in/reader034/viewer/2022050901/58a038161a28abb24d8bd23e/html5/thumbnails/31.jpg)
31
Etop
Wt-M3
∆ 565-M
3
40
60
80
100
120
% In
hibi
tion
ofE
topo
side
-med
iate
dC
aspa
se A
ctiv
atio
n
Etop
Wt-M3
K-A40
60
80
100
120
% In
hibi
tion
ofE
topo
side
-med
iate
dC
aspa
se A
ctiv
atio
n
A
B
Figure 7Budd et al.
by guest on April 10, 2018
http://ww
w.jbc.org/
Dow
nloaded from
![Page 32: The C-terminal Tail of the M3-Muscarinic Receptor Possesses Anti ...](https://reader034.fdocuments.in/reader034/viewer/2022050901/58a038161a28abb24d8bd23e/html5/thumbnails/32.jpg)
32
T-A tail Mut 6 ∆565-M3
0
50
100
150
Ago
nist
-med
iate
dR
ecep
tor
Pho
spho
ryla
tion
(% o
fW
ild-t
ype
rece
pto
r)
A
B
C
D
Figure 8 Budd et al.
by guest on April 10, 2018
http://ww
w.jbc.org/
Dow
nloaded from
![Page 36: The C-terminal Tail of the M3-Muscarinic Receptor Possesses Anti ...](https://reader034.fdocuments.in/reader034/viewer/2022050901/58a038161a28abb24d8bd23e/html5/thumbnails/36.jpg)
David C. Budd, John McDonald, Nita Emsley, Kelvin Cain and Andrew B. Tobinproperties
The C-terminal tail of the M3-muscarinic receptor possesses anti-apoptotic
published online March 20, 2003J. Biol. Chem.
10.1074/jbc.M211670200Access the most updated version of this article at doi:
Alerts:
When a correction for this article is posted•
When this article is cited•
to choose from all of JBC's e-mail alertsClick here
by guest on April 10, 2018
http://ww
w.jbc.org/
Dow
nloaded from