JOURNAL OF BACTERIOLOGY,0021-9193/98/$04.0010

Apr. 1998, p. 2265–2270 Vol. 180, No. 8

Copyright © 1998, American Society for Microbiology

The Bacillus subtilis galE Gene Is Essential in thePresence of Glucose and Galactose

OLIVER KRISPIN AND RUDOLF ALLMANSBERGER*

Lehrstuhl fur Mikrobiologie, Universitat Erlangen-Nurnberg, D-91058 Erlangen, Germany

Received 26 November 1997/Accepted 19 February 1998

Bacillus subtilis is unable to grow by consuming galactose because it is unable to transport it into the cell. Thetranscription of galE is not influenced by galactose but is repressed by glucose. Galactose is toxic forgalE-negative bacteria because it results in elevated levels of metabolic intermediates. These negative effects arereduced in galK and galT mutants. Glucose is also toxic for galE-negative strains.

Bacillus subtilis 168 is unable to use sugars such as lactose,galactose, and xylose (11, 18) as its sole carbon source. This issurprising given the fact that genes which encode the proteinsnecessary for the degradation of lactose and xylose are presentin B. subtilis and that these genes are expressed under inducingconditions (2, 4). For xylose it has been shown that this sugaris not transported inside the cell (14).

We cloned and sequenced a B. subtilis homolog of the Esch-erichia coli galE gene (16). Meanwhile, the complete B. subtilisgenome has been sequenced (9). Besides the galE homolog,putative galK and galT genes have been identified (5). Again,the genetic equipment of the bacterium should allow the uti-lization of galactose as the sole carbon source, but neverthelessgalactose does not support growth. We were therefore inter-ested in whether the B. subtilis galE gene serves any function.We were able to prove that the gene is expressed in B. subtilis168. The transcription is not influenced by galactose but isrepressed in the presence of glucose. Galactose is not activelytransported into B. subtilis 168. Even minor amounts of inter-nal UDP-galactose are toxic for galE-negative B. subtilisstrains. Glucose is able to alleviate the effects of galactose butcauses cell death during late log phase. One task of the GalEprotein is therefore to protect the cell from the toxic effects ofgalactose and glucose or derivatives of both sugars which ac-cumulate in its absence.

Identification of the galE gene. We cloned and sequenced aB. subtilis galE homolog (16), which encodes a protein that is57% identical to the product of the E. coli gene. The structureof the protein from E. coli has been solved recently (19).Fourteen of 15 amino acids known to interact with NADH areconserved between E. coli and B. subtilis; the only difference isat position 59 where the E. coli protein has isoleucine and theB. subtilis protein has leucine. Of eight amino acids known tointeract with either UDP-glucose or UDP-galactose, seven areconserved, with alanine 216 in E. coli versus serine 215 in B.subtilis. This residue is known to interact via the backbone ofthe protein; therefore, the side chain of the residue is of minorimportance.

The strains and plasmids used in this study are listed inTable 1. To test whether the galE homolog gene is functionalin vivo we transformed plasmid pB8 into galE-negative E. coliMK30-3. This plasmid was constructed by ExoIII digestion ofthe galE-containing HindIII fragment described in reference

16 (EMBL gene bank accession no. X99339). The resulting1,677-bp fragment (nucleotide numbers 1 to 1677, as describedby Schrogel et al. [16]) was cloned into pBluescriptII SK1(Stratagene, La Jolla, Calif.). The transformed bacterium wasable to grow on minimal media with galactose as the solecarbon source (data not shown). This proves that the clonedgene indeed encodes a UDP-glucose epimerase.

Regulation of galE transcription and mapping of the galEpromoter. We wanted to test whether galE is actively tran-scribed in B. subtilis 168. To do so, we constructed plasmidpEP10. This plasmid was constructed by cloning the NciI-PvuIIfragment from pB8 (nucleotide numbers 1048 to 1359 [16])into pDH32M. The resulting plasmid contains a transcriptionalfusion of the region upstream of galE to lacZ. pEP10 wasintegrated into the amyE locus of B. subtilis 168. The b-galac-tosidase activity of the resulting strain in minimal media withdifferent carbon sources was determined as described previ-ously (4). Fifteen to 16 U of b-galactosidase activity was ob-tained, irrespective of the presence of galactose. This is signif-icantly higher than background activity (about 1 U under theseconditions). lacZ expression by B. subtilis EP10 was reduced to1.3 U in the presence of glucose, whereas background activitywas reduced to 0.2 U. We were interested in whether this effectwas specific for glucose or carbon catabolite repression. Wetested a set of carbon sources known to mediate cataboliterepression (7). As seen in Fig. 1, all carbon sources known torepress xylA transcription had a similar effect on galE transcrip-tion. In a ccpA-negative mutant the effect was abolished. Thisindicates that galE is transcribed in B. subtilis 168 under director indirect control of CcpA. To characterize the promoter indetail, we mapped the 59 end of the galE transcript by primerextension. The primer (59 GCCAATGTAACCGGCACCGC39) was labeled with [g-32P]dATP and used for the primerextension reaction as described previously (21). It hybridizes tothe translated part of the galE transcript. A signal was obtained27 bp upstream of the translational start codon (Fig. 2A). Asequence with homology to sA-dependent promoters wasfound upstream of the putative transcriptional start site (Fig.2B). Eight of 12 bp are conserved.

Effects of a galE inactivation. B. subtilis 168 is unable to growon galactose as the sole carbon source (18). Therefore, lack ofgrowth on galactose is not a specific trait for galE-negative B.subtilis strains. We tested whether the presence of galactosehas a negative effect on galE strains. Such effects have beendescribed for gal mutants of E. coli and Salmonella typhi-murium (3, 10, 13, 22). To obtain a galE-negative mutant, weconstructed plasmid pEP2. This was done by inserting theaphA3-containing SmaI fragment from pBEST501 (8) into

* Corresponding author. Mailing address: Lehrstuhl fur Mikrobiolo-gie, Universitat Erlangen-Nurnberg, Staudtstr. 5, D-91058 Erlangen,Germany. Phone: 49 9131 858084. Fax: 49 9131 858082. E-mail: rallmans@biologie.uni-erlangen.de.

2265

on February 16, 2021 by guest

http://jb.asm.org/

Dow

nloaded from

StyI-digested pB8. The protruding ends were filled in withKlenow polymerase. The resistance gene was inserted in thedirection opposite to that of the galE gene. pEP2 was linear-ized and transformed into B. subtilis 168 to give B. subtilis EP2.

We grew B. subtilis 168 and the isogenic galE-negative deriva-tive in NB medium with and without 10 mM galactose. Growthof the wild type and the mutant was similar in unsupplementedNB medium, indicating that galE expression is not necessary incomplex media. The presence of galactose had no influence onthe growth of B. subtilis 168 but caused a decrease of the celldensity of B. subtilis EP2 (Fig. 3A). In galactose-supplementedmedium the mutant cells started to swell and lysed at an opticaldensity at 600 nm (OD600) of about 0.4 (Fig. 3C). Cell titersindicated that galactose is a bactericidal compound for thesecells; the decrease in viable-cell number is even more pro-nounced than the decrease in OD (Table 2). Mutations in galKand galT encoding galactokinase and galactose-1-phosphateuridylyltransferase, respectively, abolish the lytic effects of thegalE mutation in S. typhimurium (17). We tested whether thesame is true for B. subtilis. To do so, we created plasmid pKL9by digesting plasmid pKL6 (15) with SalI and by subsequentreligation. Plasmid pGK1 was constructed to inactivate the B.subtilis galK gene. Therefore, an internal region of the galKgene was amplified by PCR with chromosomal B. subtilis 168DNA as the template (primer I: 59 GCAAACTCAATGTCTCAGGCC 39; primer II: 59 GTTCTCTTTGAACATATGGGCCG 39). The resulting fragment was digested with NruI andAccI (nucleotide numbers 36381 and 36578 [5]) and clonedinto NruI- and AccI-digested pKL9. Plasmid pGT1 was con-structed to inactivate galT. An internal fragment of galT wasamplified (primer I: 59 CGAGAAACCGTCTTTATGAAGC39; primer II: 59 CACCGTCCAATGAACATTTTTGG 39),digested with AvaI and EcoRI (nucleotide numbers 37050 and37282 [5]), and ligated to EcoRI- and AvaI-digested pKL9. We

FIG. 1. Catabolite repression of galE transcription. B. subtilis EP10 and B.subtilis EP10ccpA were grown in MOPSO minimal medium containing 0.5%succinate and 0.2% concentrations of the indicated carbon sources. The LacZactivities of the respective cultures were determined. One hundred percentcorresponds to 23 U for the wild-type strain (solid bars) and 39 U for theccpA-negative mutant (open bars).

FIG. 2. (A) Mapping of the putative transcriptional start site by primerextension. Left side (from left to right): A, C, G, and T lanes of a sequencereaction done with the primer extension primer. Lanes 1 and 2, RNA isolatedfrom two different NB medium-grown cultures; lanes 3 and 4, RNA from cellsgrown on MOPSO medium without and with galactose, respectively. A signal isobtained 27 bp upstream of the translational start codon. (B) Sequence of theputative galE promoter. The poly(dA) stretches upstream of the promoter, theputative promoter sequence, and the start point of transcription and translationare indicated.

TABLE 1. Strains and plasmids used during this study

Strain or plasmid Genotype or relevant markers Source orreference

StrainsE. coli DH5a hsdR17 endA1 recA1 gyrA96 thi

relA1 supE44 f80dlacZDM15D(lacZ-argF)U169

BRL

E. coli MK30-3 D(lac-proAB) recA galE strA F9[proAB lacIq ZDM15]

8a

B. subtilis 168 trpC2 BGSCa

B. subtilis MD156 trpC2 ccpA::spec 1B. subtilis DH32M trpC2 amyE::(spoVG-lacZ, cat) This workB. subtilis EP2 trpC2 galE::aphA3 This workB. subtilis EP10 trpC2 amyE::(P galE-spoVG-lacZ

cat)This work

B. subtilis EP10ccpA trpC2 amyE::(P galE-spoVG-lacZcat) ccpA::spec

This work

B. subtilis GK1 trpC2 galK-pGK1 This workB. subtilis GT1 trpC2 galT-pGT1 This workB. subtilis EP2GK1 trpC2 galE::aphA3 galK-pGK1 This workB. subtilis EP2GT1 trpC2 galE::aphA3 galT-pGT1 This work

PlasmidspBluescriptII SK1 bla StratagenepB8 bla galE This workpDH32M bla amyE::(cat spoVG-lacZ) 8bpBEST501 bla aphA3 8pEP2 bla galE::aphA3 This workpEP10 bla amyE::(galE-lacZ cat) This workpKL6 bla erm bgaB 16pKL9 bla erm This workpGK1 bla erm 9galK9 This workpGT1 bla erm 9galT9 This work

a BGSC, Bacillus Genetic Stock Center.

2266 NOTES J. BACTERIOL.

on February 16, 2021 by guest

http://jb.asm.org/

Dow

nloaded from

FIG. 3. (A) Growth of different B. subtilis strains in NB medium and NB medium supplemented with galactose. B. subtilis 168 and B. subtilis EP2 were diluted inNB medium to an OD600 of 0.1. The cell suspensions were divided into two parts, and galactose was added to one part. Solid symbols, growth in NB medium; opensymbols, growth in NB medium supplemented with galactose; circles, B. subtilis 168; squares, B. subtilis EP2. (B) Growth of B. subtilis with mutations in different galgenes on NB medium with galactose. Bacteria were resuspended in media containing galactose to an OD600 of 0.02. Circles, B. subtilis 168; inverted triangles, B. subtilisEP2; squares, B. subtilis GK1; diamonds, B. subtilis GT1; hexagons, B. subtilis EP2GT1; triangles, B. subtilis EP2GK1. The numbers of CFU were determined at theindicated times (arrows; see Table 2). (C) Cell morphology of bacteria grown on NB medium containing galactose. Left panel, B. subtilis 168; right panel, B. subtilisEP2.

VOL. 180, 1998 NOTES 2267

on February 16, 2021 by guest

http://jb.asm.org/

Dow

nloaded from

inactivated galK and galT by a single crossover and determinedthe effects of galactose on the respective mutants and on mu-tants with a defect in galE and additionally with a defect in galKor galT. As seen in Fig. 3B galactose had no effect on either thegalT- or the galK-defective strain. Furthermore, the toxic effectof galactose on galE-negative strains was abolished or at leastreduced if galK or galT was also inactivated. This experimentindicates that none of the gal genes is cryptic because inacti-vation of any of the genes had an effect on the phenotype, atleast in media with galactose. The toxic effect of galactose ismost likely mainly due to UDP-galactose or a derivativethereof, because it is observed only in the presence of galactoseand is reduced or completely abolished if the synthesis of thiscompound is inhibited by the inactivation of galT or galK.Neither the galT nor the galK mutation alone had a toxic effecton growth in the presence of galactose (Table 2). Therefore, itis unlikely that the amounts of galactose-phosphate which arepresent in the galT strain are toxic for B. subtilis. In a second setof experiments we tested the influence of glucose on galE-negative mutants. Glucose is able to suppress the effects ofgalactose on galE-negative enterobacteria because of catabo-lite repression (17, 22). The toxic effects of galactose on B.subtilis are also reduced by the presence of glucose (data notshown). But in contrast to what is found for enterobacteria,glucose itself is toxic for B. subtilis galE mutants. At the end ofthe exponential growth phase the cells do not lyse (data notshown) but nevertheless die rapidly in the presence of glucose(Table 3 and Fig. 4). Taken together, these results indicate thatGalE is per se not necessary for the growth of B. subtilis 168 incomplex media. It is necessary only in the presence of eitherglucose or galactose. In the presence of both glucose andgalactose the galE-negative strain is able to synthesize everycompound which is synthesized by the activity of UDP-glucoseepimerase in wild-type galE strains. But the addition of bothsugars at one time is nevertheless lethal. Therefore, the effectsof the mutation are not due to the fact that a compoundnecessary for survival is missing. Although it is likely that GalEserves in a biosynthetic role in the cell, our results rule out anunanticipated biosynthetic function of GalE which is necessary

for the survival of the cells in the absence of galactose orglucose. They strongly argue for the hypothesis that B. subtilisproduces compounds in the presence of glucose and galactosewhich are removed by the activity of GalE. If these compoundsare not removed the cell is bound to die.

Metabolic intermediates in galactose-grown B. subtilis EP2.For enterobacteria it is believed that the toxic effects of galac-tose are due to the accumulation of galactose-1-phosphate andUDP-galactose (10, 13). We tested whether B. subtilis 168 andB. subtilis EP2 are able to transport galactose. While we wereable to demonstrate galactose accumulation by E. coli, onlybackground levels were obtained for B. subtilis in an identicalassay (data not shown). Nevertheless, we grew different B.subtilis strains in media containing radioactively labeled galac-tose.

Cells were grown to an OD600 of 0.2 in NB medium at 37°C.Then 0.2% unlabeled galactose (final concentration) and 5 3106 cpm of labeled galactose (final concentration, 105 cpm/ml)were added, and the bacteria were incubated for another 60min. The cells were concentrated by centrifugation and washedthoroughly in b-mercaptoethanol-free Z buffer (12). The cellswere lysed by sonication, and the protein concentration of thesupernatant was determined. Equal amounts of supernatantwere analyzed by thin-layer chromatography. The sampleswere fractionated on SilicaGel 60 (Merck, Darmstadt, Ger-many) with a mixture of n-butanol, ethanol, and H2O (5:3:2) inthe liquid phase. The plates were dried and exposed against aBAS-III imaging plate (Fuji Photo Film Co., Tokyo, Japan).The sugars were additionally stained with a mixture of p-anis-aldehyde, acetic acid, methanol, and H2SO4 (1:20:340:10),which allows both detection of sugars and their differentiationby color (6). To differentiate between sugar acids and phos-phorylated sugars, the samples were treated with either tri-fluoroacetic acid (TFA) or alkaline phosphatase to removePO4

32 groups and analyzed as described above.

FIG. 4. Growth of different B. subtilis strains in NB medium and NB mediumsupplemented with glucose. Solid symbols, growth in NB medium; open symbols,growth in NB medium supplemented with glucose; circles, B. subtilis 168; in-verted triangles, B. subtilis EP2. The numbers of CFU were determined at theindicated times (see Table 3).

TABLE 2. Toxic effect of galactose on B. subtilis EP2

B. subtilisstrain

Growth of bacteria in indicated medium at timea:

t0 (107 CFU) t5 (109 CFU) t7 (109 CFU)

NB NB 1 gal NB NB 1 gal NB NB 1 gal

168 1.2 0.8 0.6 0.9 3.1 1.4EP2 0.6 0.5 1.3 0.005 2.7 0.002GK1 0.7 0.6 0.4 0.6 1.1 1.3EP2GK1 0.2 0.3 0.6 0.7 1.5 1.4GT1 0.4 0.4 0.8 0.2 1.2 0.9EP2GT1 0.2 0.1 1.2 0.2 2.3 0.026

a t0, t5, and t7, 0, 5, and 7 h, respectively; see Fig. 3B. gal, galactose.

TABLE 3. Toxic effect of glucose on B. subtilis EP2

B. subtilisstrain

CFU (107) in indicated medium ata:

t0 t3 t5

NB NB 1 glucose NB NB 1 glucose NB NB 1 glucose

168 0.4 0.3 30 8 150 15EP2 0.4 0.3 3 0.05 43 0.009

a t0, t3, and t5, 0, 3, and 5 h, respectively; see Fig. 4.

2268 NOTES J. BACTERIOL.

on February 16, 2021 by guest

http://jb.asm.org/

Dow

nloaded from

The result of this experiment is depicted in Fig. 5A. Severaldifferent galactose derivatives were obtained from the strainwith mutant galE and from the strain with mutant galE andgalT. One band migrated similarly to UDP-galactose, and oneband migrated similarly to galactose-1-phosphate. A thirdband migrated slower than galactose-1-phosphate (Fig. 5A).To determine the chemical natures of the respective com-pounds, we treated the samples with phosphatase. After thattreatment the two bands which migrated similarly to andslower than galactose-1-phosphate both migrated like galac-tose, indicating that these bands are galactose phosphates. Wedo not know whether the two bands are due to different formsof galactose phosphate or indicate different numbers of phos-phates linked to one galactose. The band that migrated likeUDP-galactose was not impaired by that treatment (Fig. 5B).TFA treatment removed the modification linked to galactosein this band (Fig. 5C), indicating that this modification is linkedvia an acid-labile ester to galactose. Treatment with UDP-glucose epimerase and subsequent TFA hydrolysis resulted intwo spots, galactose and glucose (data not shown). Therefore,the original spot is indeed UDP-galactose.

We quantified the amounts of the respective compounds. Todo so, we determined the amount of radioactivity in each singlespot of the thin-layer chromatography plate. For this determi-nation, 104 cpm corresponded to 1 mmol of galactose. Theamount of radioactivity was divided by the number of cells

loaded on the respective lane. To obtain galactose concentra-tions, it was assumed that a single cell has a volume of 1 mm3

(20). Whereas we were unable to detect any momomeric ga-lactose derivatives in wild-type B. subtilis, B. subtilis EP2 hadinternal concentrations of 0.2 mM galactose-phosphate and 0.2mM UDP-galactose. B. subtilis EP2GT1, whose growth is onlyslightly impaired by the presence of galactose, accumulated 0.4mM galactose phosphate. The concentration of these com-pounds within the cell is therefore less than 1 mM. This is lowcompared to the external galactose concentration of 10 mMand is in accordance with the fact that there is no active importof galactose in the cell. This concentration is comparable to thebacteriotoxic concentrations of antibiotics. The antibiotic tet-racycline, which is able to cross the membrane, accumulates toa concentration of about 1 mM inside the cell (14a). Thisconcentration is lethal for the cell. Therefore UDP-galactose isas toxic as the antibiotic tetracycline.

Conclusion. The results presented in this paper prove thatthe galE gene of B. subtilis is essential for growth in mediacontaining either glucose or galactose. This is not due to thefact that metabolic intermediates are not produced in the ab-

FIG. 5. (A) Analysis of galactose derivatives accumulated in B. subtilis galE-negative strains. The respective strains were fed with 14C-labeled galactose. Acell suspension with an OD600 of 1 was sonicated, and the supernatant wasanalyzed by thin-layer chromatography. The chromatograms were developed andcompared to chromatograms of pure reagents. Lane 1, B. subtilis EP2GK1; lane2, B. subtilis EP2; lane 3, B. subtilis EP2GT1; lane 4, B. subtilis 168. (B) Analysisof galactose derivatives after treatment with phosphatase. Lanes 1, 4, and 7,untreated samples; lanes 2, 5, and 8, phosphatase-treated samples; lanes 3, 6, and9, samples in phosphatase buffer without phosphatase. Lanes 1 to 3, B. subtilisEP2GK1; lanes 4 to 6, B. subtilis EP2GT1; lanes 7 to 9, B. subtilis EP2. The twolower bands are converted to galactose by the treatment. (C) Analysis of galac-tose derivatives after treatment with TFA. Lane 1, B. subtilis EP2GK1; lane 2, B.subtilis EP2GT1; lane 3, B. subtilis EP2; All bands are converted to galactose bythat treatment.

VOL. 180, 1998 NOTES 2269

on February 16, 2021 by guest

http://jb.asm.org/

Dow

nloaded from

sence of GalE, because this effect is not abolished in the pres-ence of both sugars. Therefore, the presence and not the ab-sence of such an intermediate is the reason for the toxic effect.In the presence of galactose this compound is most likelyUDP-galactose. Even very small amounts of UDP-galactoseseem to be toxic for B. subtilis. The molecular reason for thistoxicity is unknown.

We thank W. Hillen for support and discussion, M. Dahl for B.subtilis MD156, and E. Kruger for critically reading the manuscript.

This work was supported by the DFG (via Schwerpunkt MolekulareAnalyse von Regulationsnetzwerken in Bakterien).

REFERENCES

1. Dahl, M. K., and W. Hillen. 1995. Contributions of XylR, CcpA and Hpr tocatabolite repression of the xyl operon in Bacillus subtilis. FEMS Microbiol.Lett. 132:79–83.

2. Errington, J., and C. H. Vogt. 1990. Isolation and characterization of muta-tions in the gene encoding an endogenous Bacillus subtilis beta-galactosidaseand its regulator. J. Bacteriol. 172:488–490.

3. Fukasawa, T., and H. Nikaido. 1961. Galactose-sensitive mutants of Salmo-nella. II. Bacteriolysis induced by galactose. Biochim. Biophys. Acta 48:470–483.

4. Gartner, D., M. Geissendorfer, and W. Hillen. 1988. Expression of theBacillus subtilis xyl operon is repressed at the level of transcription and isinduced by xylose. J. Bacteriol. 170:3102–3109.

5. Glaser, P., F. Kunst, M. Arnaud, M. P. Coudart, W. Gonzales, M. F. Hullo,M. Ionescu, B. Lubochinsky, L. Marcelino, I. Moszer, E. Presecan, M.Santana, E. Schneider, J. Schweizer, A. Vertes, G. Rapoport, and A.Danchin. 1993. Bacillus subtilis genome project: cloning and sequencing ofthe 97 kb region from 325 degrees to 333 degrees. Mol. Microbiol. 10:371–384.

6. Haußmann, W. 1994. Ph.D. thesis. Universitat Tubingen, Tubingen, Ger-many.

7. Hueck, C. J., A. Kraus, D. Schmiedel, and W. Hillen. 1995. Cloning, expres-sion and functional analyses of the catabolite control protein CcpA fromBacillus megaterium. Mol. Microbiol. 16:855–864.

8. Itaya, M., K. Kondo, and T. Tanaka. 1989. A neomycin resistance cassetteselectable in a single copy state in the Bacillus subtilis chromosome. NucleicAcids Res. 17:4410.

8a.Kramer, W., V. Drutsa, H. W. Jansen, B. Kramer, M. Pflugfelder, and H. J.Fritz. 1984. The gapped duplex DNA approach to oligonucleotide-directedmutation construction. Nucleic Acids Res. 12:9441–9456.

8b.Kraus, A., C. Hueck, D. Gartner, and W. Hillen. 1994. Catabolite repressionof the Bacillus subtilis xyl operon involves a cis element functional in thecontext of an unrelated sequence, and glucose exerts additional xylR-depen-dent repression. J Bacteriol. 176:1738–1745.

9. Kunst, F., N. Ogasawara, I. Moszer, A. M. Albertini, G. Alloni, V. Azevedo,M. G. Bertero, P. Bessieres, A. Bolotin, S. Borchert, R. Borriss, L. Boursier,A. Brans, M. Braun, S. C. Brignell, S. Bron, S. Brouillet, C. V. Bruschi, B.Caldwell, V. Capuano, N. M. Carter, S. K. Choi, J. J. Codani, I. F. Conner-ton, A. Danchin, et al. 1997. The complete genome sequence of the gram-positive bacterium Bacillus subtilis. Nature 390:249–256.

10. Kurahashi, K., and A. J. Wahba. 1958. Interference of growth with certainEscherichia coli mutants by galactose. Biochim. Biophys. Acta 30:298–302.

11. Lindner, C., J. Stulke, and M. Hecker. 1994. Regulation of xylanolytic en-zymes in Bacillus subtilis. Microbiology 140:753–757.

12. Miller, J. H. 1972. Experiments in molecular genetics. Cold Spring HarborLaboratory Press, Cold Spring Harbor, N.Y.

13. Nikaido, H. 1961. Galactose-sensitive mutants of Salmonella. I. Metabolismof galactose. Biochim. Biophys. Acta 48:460–469.

14. Schmiedel, D., and W. Hillen. 1996. A Bacillus subtilis 168 mutant withincreased xylose uptake can utilize xylose as sole carbon source. FEMSMicrobiol. Lett. 135:175–178.

14a.Scholz, O. Personal communication.15. Schrogel, O., and R. Allmansberger. 1997. Optimisation of the BgaB re-

porter system: determination of transcriptional regulation of stress respon-sive genes in Bacillus subtilis. FEMS Microbiol. Lett. 153:237–243.

16. Schrogel, O., O. Krispin, and R. Allmansberger. 1996. Expression of a pepThomologue from Bacillus subtilis. FEMS Microbiol. Lett. 145:341–348.

17. Shuster, C. W., and K. Rundell. 1969. Resistance of Salmonella typhimuriummutants to galactose death. J. Bacteriol. 100:103–109.

18. Steinmetz, M. 1993. Carbohydrate metabolism: pathways, enzymes, geneticregulation, and evolution, p. 157–170. In A. Sonenshein, J. Hoch, and R.Losick (ed.), Bacillus subtilis and other gram-positive bacteria. AmericanSociety for Microbiology, Washington, D.C.

19. Thoden, J. B., P. A. Frey, and H. M. Holden. 1996. Crystal structures of theoxidized and reduced forms of UDP-galactose 4-epimerase isolated fromEscherichia coli. Biochemistry 35:2557–2566.

20. Whatmore, A. M., and R. H. Reed. 1990. Determination of turgor pressure inBacillus subtilis: a possible role for K1 in turgor regulation. J. Gen. Micro-biol. 136:2521–2526.

21. Williams, J. G., and P. J. Mason. 1985. Hybridisation in the analysis of RNA,p. 139–160. In B. D. Hames and S. J. Higgins (ed.), Nucleic acid hybridisa-tion, a practical approach. IRL Press, Oxford, United Kingdom.

22. Yarmolinsky, M. B., H. Wiesmeyer, H. M. Kalckar, and E. Jordan. 1959.Hereditary defects in galactose metabolism in Escherichia coli mutants. II.Galactose-induced sensitivity. Proc. Natl. Acad. Sci. USA 45:1786–1791.

2270 NOTES J. BACTERIOL.

on February 16, 2021 by guest

http://jb.asm.org/

Dow

nloaded from