The Abscisic Acid lnduction of a Nove1 Peroxidase 1s

Plant Physiol. (1994) 105: 497-507

The Abscisic Acid lnduction of a Nove1 Peroxidase 1s Antagonized by Cytokinin in Spirodela polyrrhiza 1.’

Kateha Chaloupková and Cheryl C. Smart*

lnstitute of Plant Sciences, Plant Biochemistry and Physiology, ETH Zürich, Universitatsstrasse 2, CH-8092 Zürich, Switzerland

The growth regulator abscisic acid (ABA) can be used to induce dormant bud structures (turions) in the duckweed Spirodela polyrrhiza 1. In this paper we show that during this process, ABA rapidly induces elevated levels of mRNA transcripts encoding a nove1 basic peroxidase. In addition, we show that in the presence of the cytokinin kinetin the maintained increase is attenuated. Kinetin not only totally inhibits the induction of turions by ABA but also alleviates ABA-induced growth inhibition. This antagonism of an ABA-induced gene by a cytokinin correlates with an easily observ- able antagonistic effect of these two hormones on plant morphogenesis. These data contribute to a growing body of evidence linking growth regulators with changes in peroxidase gene expression and to the concept of pairs of hormones playing antagonistic roles during plant development. Finally, we discuss the possible functions that peroxidases could have during ABA-induced turion formation and growth inhibition.

Spirodela polyrrhiza L. is a floating aquatic monocot of the family Lemnaceae. As such, it undergoes vegetative repro- duction to produce clonally related groups of plants (fronds) that can colonize large areas of still water (Hillman, 1961; Landolt, 1986). As an overwintering device, S. polyrrhiza produces specialized dormant buds, termed turions, from which new fronds can be produced under appropriate environmental conditions (Jacobs, 1947; Landolt, 1986). Turion development, as opposed to vegetative frond development, involves an apparent reduction in cell expansion and aeren- chyma formation as well as an accumulation of starch and anthocyanin (Smart et al., 1987).

S. polyrrhiza can be grown aseptically with ease and rapid- ity in the laboratory, thereby providing an excellent experimental system for the analysis of factors regulating leaf heterophylly, of which turion/frond formation is an extreme example (Trewavas and Jones, 1991). Such analysis has re- vealed that turion formation can be affected by a number of environmental factors, including temperature, nitrate availa- bility, and light (Jacobs, 1947; Landolt, 1986). Moreover, it has been shown that turion formation can be rapidly induced by addition of low physiological concentrations of the growth regulator ABA (Perry and Byme, 1969; Stewart, 1969; Smart and Trewavas, 1983) and suppressed by the growth regulator cytokinin (Stewart, 1969). In this respect, S. polyrrhiza pro-

l This work was supported by a grant to C.C.S. from the Schweiz-

* Corresponding author; fax 41-1-632-1044. erischer Nationalfonds (grant No. 31-27368.89).

497

vides a unique system for the investigation of the antagonistic effects of two growth regulators on morphogenesis in an intact plant.

We are interested in exploiting the unique aspects of the S. polyrrhiza system to investigate the molecular processes by which growth regulators can induce or regulate plant morphogenesis. Toward this end, we have previously synthesized a cDNA library from mRNA extracted from ABA-treated S. polyrrhiza plants and, via a differential screening strategy, identified a number of cDNAs whose respective transcripts are up-regulated early during ABA-induced turion formation (Smart and Fleming, 1993). One of these cDNAs ( t u r l ) we have identified as encoding a protein with homology to D-

myo-inositol-3-phosphate synthase an enzyme that plays a key role in inositol metabolism. Based on an analysis of the expression of the turl gene in ABA-treated plants, we hy- pothesized that changes in cell wall inositol derivatives following ABA induction might represent an important mechanism by which morphogenesis is affected in this system (Smart and Fleming, 1993).

In this paper we report the identification and characterization of another cDNA, tur4, whose respective mRNA accu- mulates upon ABA treatment. Tur4 has been characterized by sequencing and genomic Southem analysis. The induction of the tur4 mRNA by ABA has been studied by northem analysis. Our analysis reveals that tur4 codes for a basic peroxidase that is likely to be localized to the cell wall. The maintained increase in the leve1 of tur4 peroxidase mRNA by ABA can be inhibited by the concomitant addition of cytokinin to the growth medium. This phenomenon correlates with the observed inhibition of ABA-induced turion formation and growth inhibition by this same growth regulator. We discuss the possible function of the ABA-induced peroxidase, in particular its potential effect on cell wall extensibility and morphogenesis, and examine the significance of the antagonistic effects of ABA and cytokinin on the expression of the gene encoding this peroxidase.

MATERIALS AND METHODS

Plant Material

Spirodela polyrrhiza L. was grown aseptically on 100 mL of half-strength Hutner’s medium in 250-mL Erlenmeyer flasks as described previously (Smart and Trewavas, 1983). Each

Abbreviation: pL, calculated isoelectric point.

Dow

nloaded from https://academ

ic.oup.com/plphys/article/105/2/497/6068285 by guest on 23 February 2022

498 Chaloupková and Smart Plant Physiol. Vol. 105, 1994

experimental flask was inoculated with one plantlet consist- ing of between five and eight fronds and allowed to multiply for 7 d before the start of the experimental manipulations. Each experimental sample consisted at this time of between 50 and 100 plants. Turion formation was induced by adding 250 p L of a 1 0 0 - p ~ solution of filter-sterilized (k) cis-truns- ABA in medium to the flask, to give a final concentration of 250 nM ABA. Control cultures were treated with an equal volume of fresh medium. For cytokinin-reversal experiments, aliquots of filter-sterilized 1 mM kinetin dissolved in 10 mM NaOH were added to the medium to give final concentrations of between 1 and 100 ~LM. In these cases control cultures were treated with an equal volume of 10 m~ NaOH. When kinetin and ABA were both added to a culture, they were added simultaneously. The growth of cultures was measured by determining the fresh weight growth constant k as previously described (Smart and Trewavas, 1983), and the t test was used to analyze the significance of the differences between sample means. Tissue for RNA and DNA isolation was frozen in liquid nitrogen before use.

Construction of S. polyrrhiza cDNA Library and Differential Screening

A cDNA library was constructed from poly(A)' RNA extracted from fronds of S. polyrrhiza treated with 250 nM (k) cis-truns-ABA for 2 h as previously reported (Smart and Fleming, 1993). A portion of the unamplified library on nylon filters was differentially screened for ABA-up-regulated cDNA sequences by hybridization to single-stranded 32P- labeled cDNA probes prepared from poly(A)+ RNA isolated from control fronds (ABA-) and fronds treated for 2 h with 250 nM ABA (ABA+). Filters were washed at high stringency as previously described (Smart and Fleming, 1993). Plaques that showed a significantly greater signal with the ABA+ probe than with the ABA- probe were considered to represent ABA-up-regulated cDNA clones. ABA-up-regulated cDNA clones were plaque purified by another round of differential screening and recovered in pBluescript SK- by in vivo exci- sion (Stratagene).

DNA Sequencing

A deletion library from both ends of the tur4 insert was generated by exonuclease 111 digestion according to the manufacturer's instructions (Pharmacia). In this way, both strands of the insert cDNA of the clone tur4 were sequenced by dideoxynucleotide chain termination using T7 DNA polym- erase (Pharmacia). In some cases Sequenase and dITP (United States Biochemical) were used to interpret compressions.

Sequence Analysis

Searches of GenBank/EMBL and SWISS-PROT for sequences similar to tur4 at the nucleotide and amino acid leve1 were done using the FASTA program of the University of Wisconsin Genetics Computer Group sequencing package (Devereaux et al., 1984). The multiple alignment of the amino acid sequence of tur4 to the other peroxidases was done using the CLUSTAL program, whereas individual optimal align- ments were done with the GAP program.

Cenomic Southern Blot Analysis

S. polyrrhiza genomic DNA was prepared from fronds as described by Rogers and Bendich (1988). The DNA was digested with restriction endonucleases, subjected to electrophoresis 11x1 0.7% (w/v) agarose in 0.5 X TBE (1 X TBE = 89 m Tris-borate, 2.5 mM EDTA, pH 8.3), and bhtted onto Hybond N membranes (Amersham). The blot w as probed with the tur4 cDNA insert labeled with [ L ~ - ~ ~ P ] ~ C T P by the random-priming method (Pharmacia). Hybridization and subsequent high-stringency washes (0.1 X SSC [I x SSC = 150 mM NaCl, 15 mM tri-sodium citrate, pH 7.01, 0.1% [w/v] SDS at 65OC) were performed according to the membrane manufadnrer's protocols. Fragment sizes were calculated by comparison with HindIII-digested X fragments.

RNA lsolation and Northern Blot Analysis

Total RNA from fronds of S. polyrrhizu was prepared by a double guanidine salt method (Han et al., 1987), size-frac- tionated on 1.1% (w/v) agarose-formaldehyde gels, trans- ferred to Hybond N membranes (Amersham), and fixed by baking. The blots were stained with methylenc blue and destainecl before hybridization (Herrin and Schnudt, 1988) to detect the amount of RNA loaded onto each lme and to visualize the RNA mo1 wt markers (Gibco BRL) loaded onto an adjacent lane. The EcoRI-excised tur4 cDNA insert, purified by electroelution from an agarose gel and labeled with [L~-~~P]~C:TP by the random-priming method (F'harmacia), was hybiridized to the RNA blots at 65OC accorciing to the filter manufacturer's instructions (Amersham). The blots were washed to a final stringency of 0.1 X SSPE (1 X SSPE = 180 m~ NaC1, 10 mM NaH2P04, 1 m EDTA, pH 7.7), 0.1% (w/v) SDS at 65OC to ensure specific hybridization and exposed to Hyperfilm MP (Amersham) at -8OOC with an intensifying screen for 3 to 19 d depending on the signal.

RESULTS

Sequencle Analysis of tur4

Figure 1 shows the nucleotide and predicted amino acid sequence of tur4. The 1219-bp cDNA contains an open reading lrame beginning with the first ATG initia tion codon (position 14) and ending with a TAG stop codon (position 1001). I1 encodes a 329-amino acid polypepticle with an apparent mo1 wt of 35,586. The deduced amino acid sequence contains a typical eukaryotic signal peptide of 23 amino acids with a basic N tenninus followed by many hr'drophobic residues (von Heijne, 1990). Ala and Leu constitute over 50% of the residues in the signal peptide. The nucleoticle sequence is GC rich (61% in the coding region), and 85% of the codons have a C or G in the third position. The protein is rich in Phe and poom in Trp (only one residue), Tyr, and Met. The sequences '099AATAAT and "74AAGAAT are possible polyadenylation signals.

tur4 Codes for a Peroxidase

The encoded protein shows significant homolclgy with a11 the known plant peroxidases. Alignment with the other per-

Dow



Cytokinin Antagonizes ABA Induction of Peroxidase 499

Figure 1. Nucleotide and deduced amino acid

which codes for a peroxidase. Nucleotides are

1 CGAGACGGTCTCCA'TGGGTCGCC"CTCCCTCCCTCTTCGCGTCTCTCCGCTTCTCTCTTCTC 58 sequence of the 5. po/yrrh;za tur4 c~~~ insert, -23 MetGlyAruLeuSerLeuPheAlaSerLeuAlaLeuSerLeuLeu -7

5 9 C T A G C A G T G G G A T C A G C A G A A G ~ C C A G C T C C G A G T T G G C T C C C T i i 8 n~mbered in the 5' to 3' direction beginning -8 LeUAlaValGlvSerAlaGluAlaGlnLeuArgValGlyPheTyrSerLysSerCysPro 12 with the first nucleotide in the CDNA ClOne.

The amino acid sequence is shown below the . n

239 53

299 13

359 93

419 113

419 133

539 153

599 173

659 193

719 213

--- CTTCTACTCAACGCCACCAGCTCGAGTAACCCGACGG~GGACGCCCCGCCGAACCAG LeuLeuLeuAsnAlaThrSerSerSerAsnProThrGluLysAspAlaProProAsnGln

TTCCTTAGGGGCTTCGCTCTCATCGhCAGGATCAAGGCGAGGCWXAGAGGGCCTGCCCC PheLeuArgGlyPheAlaLeuI1eAspArgIleLysAlaArgLeuGluArgAlaCysPro

TCCACCGTCTCGTGCGCCGATATCC"CTCCCGCTCTCAT"ZCCA~ACGTCGTACA~CGGAC SerThrValSerCysAlaAspIleLeuAlaLeuIleAlaArgAspValValHisAlaAsp

CAGGGCCCATTCTGGCAAGTCCCCCACGGGGCGCAGGGACGGGTTCGTCTCCATCGCCAGT GlnGlyProPheTrpGlnValProThrGlyArgArgAspGlyPheValSerIleAlaSer

GAGGCCACGCAACTGTTACCCGCC"CTGCCAACATCTCCACCT"ZAAAAGTCAGTTC GluAlaThrGlnLeuLeuProAlaPheSerAlaAsnIleSerThrLeuLysSerGlnPhe

AACGACGTCGGTCTCAGCGCCAAGGhCCTCGTCmTCAGGCGGTCACACAATCGGA

* .

. BOX 2 . I-__I___ ___ ____ -

. BOX 3 . AsnAspVa ~ G l y L e u S e r A l a L y s ~ . ~ R ~ ~ U V ~ . l ~ ~ U ~ ~ u ~ ~ ~ ~ . l y ~ . l Y ~ . ~ ~ ~ ~ ~ . ~ . l . ~ G ~ Y

AACGFC~C~TTCACCTTCACCACCCGCCTGTACAACTTCTCGGGGAGAGGTGATAAC AsnAlaHisCyaPheThrPheThrThrArgLeuTyrAsnPheSerGlyArgGlyAspAsn

TCCGACACCGACCCATCGCWXAGAGGAATTACCTGGCCAAGCTGAGGGCCAAGTGCGCG SerAspThrAspProSerLeuGluArgAsnTyrLeuAlaLysLeuArgAlaLysCyaAla

CAAGAWXCAGCGACGCCCTAAGCTXWXAAATGGACCCGGGGAGCTTCACCACCTTC GlnAspGlySerAspAlaLeuLysLeuValGluMetAspProGlySerPheThrThrPhe

* .

298 72

358 92

418 112

478 132

538 152

598 172

658 192

718 212

778 232

other peroxidases. The apparent signal peptide is double underlined and the putative cleavage site of the signal peptide is indicated by a vertical arrow ( 1 ). The PROSITE peroxidase motifs are underlined with a dotted line, and three regions that are highly conserved in plant peroxidases are overlined (boxes 1, 2, and 3). Two potential polyadenylation signals are underlined. Potential sites of N-glycosylation are marked with an asterisk (*). The distal His4' residue predicted to be involved in acid/base catalysis and the proximal His16' residue predicted to be the fifth ligand of heme are shown in boldface. The 8 conserved Cys residues involved in the four disulfide bridges characteristic of plant peroxidases are also shown in boldface.

779 GACAACAGCTACTTCAAGCTGGTGGCCAAGCGCAGGGGGCTCTTCCAGTCCGACGCCGCT a38 233 AspAsnSerTyrPheLysLeuValAlaLysArgArgGlyLeuPheGlnSerAspAlaAla 252

839 253

899 273

959 293

1019

1079

1139

1199

CTGCTCGACGACGCCGACACGAGGTCCCACGTCATCCACCTCGCCGAGTCCGACAACTG LeuLeuAspAspAlaAspThrArgSerHisValIleHisLeuAlaGluSerAspAsnSer

GTGTTCTTCAAGGAGTTCGCCGGGGCCATGGTGAACA'TGGGCAACATCGCCGTCCTCACC V a l P h e P h e L y s G l u P h e A l a G l y A l a M e t V a l A s n M e t G l y A s n I l e A l a V a l L e u T h r

GGAAGCCAGGGGGAGATCAGGAAGAATECGCCCGCGTCAACTAGAGCGAGCGAGAGAGA GlySerGlnGlyGluIleArgLysAsnCysAlaArgValAsn

G G T C T G A T C G T C C T C T T P G C G G G T E C A G A G A G A C G G C

GGTTTTCAAAACTCAATGAGBBTB&"CCCCGAGGATAACCGGGTTGCAGACGCGACCTCT

G C G G G T G G C T G C ' I T G C T T C C T T T C ~ C T C T C T C T ~ A G C A A T G G T T P G m A C C G A

GTCGC-

898 272

958 292

1018 306

1078

1138

1198

1219

oxidase sequences makes it clear that processing of the signal peptide at the presumed site of cleavage (shown by a vertical arrow in Fig. 1) would result in a mature protein of 306 amino acids and a mo1 wt of 33,313. The TUR4 protein contains the two peroxidase motifs

common to most peroxidases (Fig. 1) and shows extensive homology to the three regions (boxes 1, 2, and 3) conserved in a11 plant peroxidases (Buffard et al., 1990; Morgens et al., 1990; Criqui et al., 1992; Welinder, 1992; Ishige et al., 1993). Residues 34 to 55 (box 1) constitute the conserved area around the distal or active site His (His4*), which serves as an acid-base catalyst in the reaction between hydrogen per- oxide and the enzyme. Residues 161 to 176 (box 3) form the conserved area around the proximal His (H~s'~~), which is the

fifth ligand of the heme prosthetic group (Welinder, 1991). Box 2 (residues 91-109) is conserved for structural reasons (Welinder, 1992). Three potential N-glycosylation sites were found at positions 56, 144, and 185 of TUR4, the latter of which is common to many plant peroxidases (Buffard et al., 1990).

TUR4 1s a Member of a New Peroxidase Family

TUR4 has less than 50% amino acid identity with a11 the plant peroxidases in the GenBank/EMBL data bank (release 34) except for two sequences from tomato referred to as TFXl and TPX2, which encode a moderately acidic peroxidase (pI, = 6.2) and a basic peroxidase (pI, = 8.5), respectively

Dow



500 Chaloupková and Smart Plant Physiol. Vol. 105, 1994

(Valpuesta et al., 1993). The pI, of the predicted mature TUR4 protein is 7.08 without carbohydrates, protoheme, and pyr- oglutamate residue. A multiple alignment was camed out comparing TUR4 to the other 42 complete and partia1 plant peroxidase sequences in GenBank/EMBL or published elsewhere. We show only the alignment of TUR4 with its nearest relative, TPX2, the ABA-induced anionic suberization-associated tomato peroxidase TAPl (its most distant relative), and the ’standard” plant peroxidase from horseradish, HRPC (Fig. 2). The mature polypeptide of TUR4 shows 55% identity to that of TPX2 (Fig. 2B) and 53% identity to TPX1, and therefore TUR4 and the TPX sequences form a new plant peroxidase family (Welinder, 1991), although they are distantly related members thereof. The leader sequences of TPXl and TPX2, however, have only 29 and 26% identity to the leader sequence of TUR4 (Fig. 2A).

TUR4’s next nearest relatives are to be found in the peanut basic peroxidase PNPC2 (48% identity; Buffard et al., 1990); the family represented by the wheat pathogen-induced moderately acidic peroxidase (POX381; Rebmann et al., 1991) and the tumip highly basic peroxidase (TP7; Mazza and Welinder, 1980) with a maximum identity of 45%; and the neutral-basic horseradish and Arabidopsis thaliana peroxidase family (maximum identity is to the neutral-basic A. thaliana PRXEA, 49%; Intapruk et al., 1993). The nucleotide sequence of tur4 is most similar, however, to the rice, wheat, and barley peroxidase sequences.

TUR4, however, has very low homology (in fact the least) with the only other peroxidases whose transcripts have been reported to be ABA-up-regulated, the suberization-associated highly acidic peroxidase from potato (AP) and tomato (TAP1) (Roberts and Kolattukudy, 1989; Sherf et al., 1993). On comparison of the predicted mature polypeptides, TUR4 has only 38% identity with TAPl (Fig. 2B), although, interestingly, the leader sequences are rather similar (55% identicall 82% similar over leader residue positions 4-33 in Fig. 2A).

The multiple sequence alignment of the peroxidases, part of which is shown in Figure 2B, brought to our attention some important differences between TUR4 and its family members TPXl and TPX2 and the consensus sequence shown by Welinder (1992). These are shown in Table I, along with other new examples where the presumed invariant amino acid does not conform to the previous consensus. Our new suggested consensus based on a11 43 sequences is shown in Figure 2B.

Cenomic Southern Analysis of the tur4 Gene in S. polyrrhiza

Southem hybridization analysis of restriction fragments of genomic DNA from S. polyvhiza resulted in a single hybridization band of a different size with each of the four enzymes tested (Fig. 3). This result indicates that tur4 is encoded by a single gene or a small gene family.

fur4 Transcript Levels Are lnduced Transiently by ABA

A northem blot analysis of the time course of tur4 mRNA induction by ABA is shown in Figure 4. tur4 was induced 2 h after adding 250 nM ABA. The transcript level increased

thereafter with a broad maximum around 6 h and then slowly began to decline after 12 h (Fig. 4A). The transcript level retumed to near-control levels 3 to 4 d after ABA addition and remained at this 1ow level throughout AB A-induced turion formation (Fig. 4B). Although turion fomiation can also be inlduced by low-temperature treatment, there was no induction. of the tur4 transcript at any time during cold- induced turion formation (results not shown). Tha induction of the tur4 transcript is therefore specific to ABA. The induction of the tur4 transcript was also very sensitive to ABA. It was found that only 50 nM ABA was necessary to significantly induce th.e transcript after 6 h. The transcript level increased with increasing ABA concentration until at 2.5 pia ABA the response was saturated (Fig. 5).

ABA-lnduced Turion Formation 1s Reversed by Cytokinins

Figure 6 shows the effect of kinetin on ABA-induced turion formation and growth inhibition after 9 d of treatment. Kinetin suppresses ABA-induced turion formation at a con- centratioin of 5 p ~ , and at 10 p ~ , ABA-induced turion formation was completely reversed. These data also suggest that kinetin can to some extent reverse ABA-induced growth inhibition. That this is the case was shown by a separate statistical analysis of frond growth in the presence of 250 nM ABA with or without kinetin at a concentration of 10 p ~ . This analysis gave a mean value for the fresh weight growth constant k in the presence of ABA of 0.0494 wii h an SE of 0.0019 (n = 8), whereas in the presence of ABA and kinetin together the growth constant had a value of 0.0691 f 0.0019 (n = 9). These mean values are significantly diffarent at the leve1 P C: 0.00001. Thus, it appears that kinetin does indeed alleviate a proportion of the growth inhibition brought about by ABA. Kinetin on its own has no significant effect on frond growth until50 p ~ , at which concentration it inhitits growth. At these high concentrations of kinetin, there is no reversal of ABA-induced growth inhibition, although turion formation is still abolished. However, the growth inhibition seen at high concentrations of kinetin is not additive to the inhibition shown by ABA. BA was also effective at reversing ABA-induced turion formation and alleviating AEIA-induced growth inhibition, but a 5-fold higher concentration of BA was requiired to abolish ABA-induced turion formjation compared to kinetin (results not shown), and a11 further experiments were conducted with kinetin.

Kinetin Suppresses the Maintained ABA lndudicln of fur4

Becauee ABA-induced turion formation and growth inhibition were reversed by cytokinins, we decidied to test whether the induction of the tur4 transcript by ABA was similarly affected. Cultures were grown with or without the addition of 250 nM ABA in the presence or absence of 20 p~ kinetin. At this concentration kinetin has no obvious effects on frondl morphology (compare Fig. 7, A and B), has only a small inhibitory effect on growth (26% inhibition), and has no effecí on the level of the tur4 transcript level (Fig. 8, lanes 4, 9, and 14). ABA alone has the effect of inducing turions (Fig. 7C) and of increasing the level of the tur4 transcript level (Fig. 8, lanes 5, 10, and 15). The additiorl of kinetin

Dow




A

TURP TPXZ TAPl HPRC

B TUR4 TPXZ TAPl HRPC

t t t .I .................... ....

Figure 2. Comparison of TUR4 to three other plant peroxidase amino acid sequences. Shown is only part of a multiple alignment of TUR4 performed to all plant peroxidase sequences either in CenBank/EMBL release 34 or published elsewhere (42 sequences). The alignment of S. polyrrhiza TUR4 to tomato TPXZ (Valpuesta et al., 1993), tomato TAPl (Roberts and Kolattukudy, 1989), and horseradish HRPC (Fujiyama et al., 1988) is shown. The amino acid sequence of TUR4 is shown in full, identified by the single-letter code. ldentical amino acids to t h e TUR4 sequence are indicated by dots (.) in the lower lines, and only those amino acids that are not identical to the TUR4 sequence are indicated. Gaps in the sequences, which are included to better the alignment, are indicated by dashes. The position numbers above the TUR4 sequence refer to the alignment shown in the figure and not to an individual sequence. Every 10th residue (or gap) is indicated by a dot. A, Signal peptides. 6, Mature proteins. The regions highly conserved (>70% homology over at least 5 residues) in the complete multiple alignment are boxed. The consensus for plant peroxidases is shown below the sequences (Welinder, 1992). Shown are the invariant residues (*) and highly conserved positions with only two different amino acids (:). Shown below Welinder's consensus is our suggested consensus (white on black) based o n our multiple alignment, which includes 22 new sequences.

along with ABA blocks the induction of turions (Fig. 7D), attenuates ABA-induced growth inhibition, and decreases the leve1 of the tur4 transcript attained after 24 and 72 h of exposure of the tissue to these two hormones (Fig. 8, lanes 11 and 16). Interestingly, the rapid (2 h) induction of the tur4 transcript by ABA is unaffected by kinetin (Fig. 8, lane 6) .

DISCUSSION

ABA lnduces an mRNA Encoding a Nove1 Basic Peroxidase

Our analysis of an ABA-induced cDNA (tur4) from S. polyrrhiza indicates that it encodes a nove1 basic peroxidase. This identification is based on an extensive sequence analysis of the tur4 cDNA, which shows that the protein encoded contains the conserved sequence elements identified so far in a11 plant peroxidases, including those elements at and around the conserved active site residues, and the conserved positions of the 8 Cys residues predicted to be of importance for the correct folding of the mature protein (Welinder, 1991, 1992).

The postulated catalytic site residues Arg3', Phe41, His4', Phe45, GW3, Asn", H ~ s ' ~ ~ , and AspZ5O (Welinder, 1992; Wel-

inder and Gajhede, 1993), the invariant salt bridge residues AS^^^, Gly'2z, and ArglZ3 (Welinder et al., 1992), as well as the putative substrate-binding sites Arg'" and TyrIe4 (Saku- rada et al., 1986) are a11 present in TUR4. The regions Ala6' to Gln7', Leu138 to Ser'42, and Thr18' to TyrlS4 are predicted to line the substrate channel (Welinder, 1992). TUR4 also possesses the 8 Cys residues involved in the four intramolec- ular disulfide bridges characteristic of plant peroxidases (Wel- inder, 1991). These bridges are predicted between Cys residues 11 and 91, 44 and 49, 97 and 302, and 176 and 211. The amino acids AS^^^, Asp5O, and Se?' are predicted ligands for the dista1 bound CaZ+, and ThrI7', AspZz5, Serzz8, and Asp233 are predicted ligands for the proximal Caz+ (Welinder and Gajhede, 1993).

Outside of these conserved regions, the predicted amino acid sequence of tur4 shows only limited identity to previously reported sequences for plant peroxidases. Based on the criteria of Welinder (1991), the sequence identity of TUR4 relative to the other reported peroxidases is sufficiently low to warrant the assignment of the protein encoded by the tur4 gene to a new family of peroxidases, along with the tomato sequences TPXl (pI, = 6.2) and TPXZ (pI, = 8.5) (Valpuesta

Dow



502 Chaloupkova and Smart Plant Physiol. Vol. 105, 1994

Table I. Am/no acids in the new plant peroxidase family that donot conform to the previous consensus

The first column lists residues in the Welinder (1992) consensus(see HRPC sequence in Fig. 28), previously thought to be invariant,which are not conserved in one or more members of the newTUR4/TPX family. The position numbers refer to those shown inFigure 2B and not to a particular sequence. The correspondingresidues in TUR4 and TPX1/TPX2 are shown in the second andthird columns, respectively, along with the relevant amino acid inother new sequences where the same residue is variant (shown inthe last column).

ABA (h) Control (h)

InvariantResidue

Leu104

Ala'07

Cys2'5

Leu245

Gin256

Phe286

Residue inTUR4

Leulie

CysValAlaPhe

Residue inTPX1/TPX2

Val/ValVal/Val

Asnb/CysLeu/ValAla/AlaPhe/Pro

Residue Variantin Other NewSequences'

ThrinNo. D11337Cly in No. M91372Serin No. L08199 and

No. M91373Cly in ricec

lie in No. L08199His in No. L08199

1 D11337, Vigna angularis (Ishige et al., 1993); M91372, Nicotianatabacum; L08199, Gossypium hirsutum; M91373, Cucumis sativus(CenBank/EMBL release 34). b 'cWe are not in a position toexplain the Asn at position 215 in the TPX1 sequence (Valpuesta etal., 1993) nor the Cly in the rice sequence (Intapruk et al., 1993),since the Cys normally in this position is a member of the fourdisulfide bridges found in all plant peroxidases.

et al., 1993). The S. polyrrhiza TUR4 peroxidase has a plc of7.08, and the native protein would presumably be of a basicnature (Welinder, 1992). The TPX1 peroxidase of tomato isapparently expressed in roots, is weakly expressed in shoots,is not expressed in leaves, and is induced by NaCl. It iswound induced in shoots but not in leaves. TPX2 is appar-

10.55.4 —

— origin

—— 8.6

—— 3.6

Figure 3. Cenomic Southern blot analysis of Wr4. Fragments of S.polyrrhiza genomic DNA (3 jig) digested with EcoRI (E), Xbal (X),C/al (C), or BamHI (B) were separated by gel electrophoresis,blotted, and hybridized with 32P-labeled Wr4 cDNA (7.8 x 106 dpmml"'). The autoradiograph was exposed for 11 d. The position ofthe origin and the size in kb of the genomic fragments detected bytur4 cDNA are indicated.

0 1 2 3 4 6 9 12 18 24 6 12 18 24

"Iff!""• •*»f — 1.3

BABA (h) ABA (d)

0 1 2 4 6 8 1 8 1 2 3 4 5

— 1.3

Figure 4. Northern blot analysis of the temporal induction of thetranscript for tur4 in S. polyrrhiza by ABA. RNA samples wereseparated by denaturing gel electrophoresis, blotted, and hybrid-ized with 32P-labeled tur4 cDNA. The Wr4 transcript size wasestimated to be approximately 1.3 kb by comparison with RNA molwt markers. A, Hybridization of 32P-labeled tur4 cDNA (8.1 x 106

dpm ml"') with total RNA (7.5 ^g) from fronds treated with eithera turion-inducing concentration of ABA (250 PM) or an equal volumeof fresh medium (control) for short periods of time up to 24 h. Theautoradiograph was exposed for 3 d. B, Hybridization of 32P-labeledWr4 cDNA (5.5 X 106 dpm ml"') with total RNA (10 /ig) from frondstreated with a turion-inducing concentration of ABA (250 nM) forup to 5 d to include the whole period of turion induction. Theautoradiograph was exposed for 6 d. This blot had been strippedof probe from a previous turl hybridization, which explains therelatively low level of signal compared with the blot in A above.

ently weakly expressed only in roots, and neither salt norwound induction was reported (Valpuesta et al., 1993). It isunlikely, however, that TUR4 and either TPX1 or TPX2 wouldshare the same function due to their relatively low sequenceidentity (Welinder, 1991). While the tpxl transcript is reportedto be unaffected by ABA (Valpuesta et al., 1993), TUR4 hasvery low homology to the well-documented ABA-up-regu-lated highly acidic peroxidase family represented by tomatoTAP1 (Sherf et al., 1993).

The nucleotide sequence of tur4 is most similar, however,to the rice, wheat, and barley peroxidase sequences, probablyreflecting the high GC content of the monocot sequences.This bias in codon usage has been observed for many genesexpressed in monocots (Murray et al., 1989) and probablyreflects a high translation rate (Fincher, 1989).

Dow




ABA (nM) ABA <nM)

00 1 10 50 75 100 250 500 750 1 2.5 5 10

— 1.3

Figure 5. Northern blot analysis of the effect of ABA concentrationon the induction of the 5. polyrrhiza Wr4 transcript. Samples of totalRNAflO^g) extracted from fronds after 6 h of cultivation indifferentconcentrations of ABA were separated by denaturing gel electro-phoresis, blotted, and hybridized with "P-labeled tur4 cDNA (1.6x 107 dpm ml"'). The tur4 transcript size was estimated to beapproximately 1.3 kb by comparison with RNA mol wt markers.The autoradiograph was exposed for 2 d.

shows that it is expressed at a low level in plants growingunder our control conditions, but that the addition of ABAat very low physiological concentrations leads to an increasein the level of the tur4 transcript within 2 h, with a maximumtranscript level being reached 6 h after addition of the growthregulator. This peak is followed by a slow decline in mRNAlevel over the following 4 d. In the presence of kinetin andABA, there is a similar increase in tur4 transcript. However,the subsequent decline in transcript is more rapid than thatobserved in the absence of kinetin, returning to low levelswithin 24 h after hormone treatment.

We have thus identified a novel basic peroxidase gene,tur4, whose transcript level can be rapidly up-regulated byABA, and whose up-regulation by ABA can, after a transientinduction, be attenuated by kinetin. Because it has beenshown, both in this study and in previous work (Stewart,1969), that these two growth regulators have distinct andantagonistic effects on the development of S. polyrrhiza, thisraises the question of whether the TUR4 peroxidase has arole in the mechanism by which ABA and cytokinins carryout their functions.

The TUR4 sequence contains a typical signal peptide, sug-gesting that the protein is secreted or transported to thevacuole (Chrispeels, 1991). All cloned peroxidase genes haveN-terminal signals that target them to the secretory pathway.The evidence available suggests that the TUR4 protein wouldfunction in the cell wall. Thus, the predicted TUR4 aminoacid sequence lacks any C-terminal acidic propeptide, whichhas been postulated as a vacuolar targeting signal in plants(Bednarek et al., 1990; Welinder, 1992). It has been shownthat peroxidases directed to intracellular compartments havesuch a propeptide, which is removed posttranslationally(HRPC, Welinder, 1979; BP1, Johansson et al., 1992; AZ42,Ishige et al., 1993; BP2, Theilade et al., 1993), whereasperoxidases shown to function in the cell wall lack thepropeptide (TobAnPOD, Lagrimini et al., 1987; PNPC1, Buf-fard et al., 1990; HRPA2, Welinder, 1992).

Genomic Southern analysis indicates that tur4 is encodedby a single gene or a small gene family. It also suggests thatthe number of different genes encoding the S. polyrrhiza tur4peroxidase is considerably less than for horseradish peroxi-dases (Fujiyama et al., 1990). A situation similar to that inSpirodela appears to exist for Arabidopsis (Intapruk et al.,1991).

Our data show that the level of the tur4 transcript is up-regulated by ABA. An induction of anionic peroxidasemRNAs by ABA has been demonstrated in both potato andtomato callus cultures (Roberts and Kolattukudy, 1989), aswell as in tomato petioles (Robb et al., 1991; Sherf et al.,1993). More indirect evidence for a role of ABA in regulatingthe transcription of peroxidase genes comes from the findingthat at least two of the promoters of peroxidase genes so farstudied contain sequence elements that might lead to regu-lation of the genes by ABA (Kawaoka et al., 1992; Theiladeand Rasmussen, 1992). Peroxidase genes might thus repre-sent target genes for regulation by ABA in a number ofdifferent plant systems.

Our analysis of the expression pattern of the tur4 gene

The Function of the furl-Encoded Peroxidase

Although over 40 peroxidases have now been cloned fromplants, assigning a precise role within the plant to any ofthese proteins has proved problematical (Caspar et al., 1991).Thus, although various peroxidases have been implicated ina large number of processes (McDougall, 1992; Ros Barceloand Munoz, 1992), the vast number of potential substratesfor these enzymes within the plant, the existence of multipleisoenzymes, and the variety of tissue expression patternsreported make a precise interpretation of their function(s) invivo rather difficult. However, one general theme that recurs

D turion no. with ABA

D growth with ABA

I growth without ABA

1 5 10 50

kinetin [|iM]

100

Figure 6. The effect of kinetin on growth, ABA-induced growthinhibition, and ABA-induced turion formation in S. polyrrhiza. Aknown number of fronds was incubated in different concentrationsof kinetin in the absence or presence of 250 nM ABA for 9 d. Thefronds were counted and weighed, and the fresh weight growthconstant k was calculated for each treatment and is shown here asa percentage of the control value. The number of turions and turionprimordia were counted and expressed as a percentage of the totalnumber of new primordia formed.

Dow



504 Chaloupkova and Smart Plant Physiol. Vol. 105, 1994

throughout the literature on peroxidases is a correlation be-tween high peroxidase activities and a decrease in the rate ofcell elongation (Lagrimini, 1992; MacAdam et al., 1992;McDougall, 1992; Ros Barcelo and Munoz, 1992).

Following the addition of ABA to S. polyrrhiza, a numberof changes at the biochemical and cellular level that accom-pany the formation of the turion structure can be detected.Among these, a general decrease in cellular expansion is mostobvious. Thus, the cells of the turion are distinguished bybeing smaller and having thicker cell walls than their coun-terparts in the frond, and the turion itself is attached to itsmother frond by a stolon structure that is greatly shortenedin comparison to one that normally attaches a daughtervegetative frond to its mother (Smart and Trewavas, 1983;Smart and Fleming, 1993). Moreover, actual measurementsof the cell wall plastic extensibility in S. polyrrhiza have showna decrease in the value of this parameter following theaddition of ABA (Longland, 1986). Taking these observationson the effects of ABA on S. polyrrhiza in conjunction with theproposed functions of many peroxidases in affecting the rateof cell elongation (Fry, 1986; Bradley et al., 1992), it is possiblethat the ABA-induced TUR4 peroxidase functions at leastpartly by increasing the extent of cell wall polymer cross-linking and thus decreasing cell wall extensibility.

If the ABA-induced peroxidase does affect cell wall exten-sibility, then it is pertinent to ask whether there is an intrinsiclink between a change in such extensibility and the devel-opmental fate of the tissue in which such changes are occur-ring. For example, it has been shown that a cationic peroxi-

0_h ____2hC Cl C2 K

72 hA AK Cl C2 K A AK Cl C2 K A AK

*«••••— 1.3

Figure 8. Northern blot analysis of the attenuation of the ABAinduction of the S. polyrrhiza Wr4 transcript by kinetin. Samples oftotal RNA (15 Mg) extracted from fronds during the time course ofincubation in either 20 MM kinetin (K), 250 nM ABA (A), or 20 MMkinetin plus 250 nM ABA (AK) were separated by denaturing gelelectrophoresis, blotted, and hybridized to 32P-labeled turf cDNA(5.5 x 106 dpm ml_~'). Controls consisted of untreated fronds (C),fronds treated with a volume of fresh medium equal to that usedin ABA-treated cultures (C1), and fronds treated with a volume of10 mN NaOH equal to that used in kinetin-treated cultures (C2).The autoradiograph was exposed for 19 d.

dase isolated from cultures of carrot somatic embryos has theability to restore embryogenesis in cultures where it has beenblocked by use of the inhibitor tunicamycin (Cordewener etal., 1991). These data have been interpreted as suggestingthat an appropriate cell wall extensibility is a prerequisite forembryogenesis to occur, and that peroxidases might modulatesuch extensibilities in vivo. Our results add correlative evi-dence to support the notion that peroxidases could act toaffect organ differentiation via their effects on cell wall

2mmFigure 7. The effect of kinetin on ABA-induced turion formation in S. polyrrhiza. A, Control fronds; B, fronds treatedwith 20 MM kinetin; C, fronds treated with 250 nM ABA (arrows indicate turions and turion primordia); D, fronds treatedwith 250 nM ABA plus 20 MM kinetin. Fronds were photographed after 8 d of treatment (bar = 2 mm).

Dow



Cytokinin Antagonizes ABA lnduction of Peroxidase 505

polymer cross-linking. Proof of such an effect awaits further experimentation.

The Antagonistic Effects of ABA and Cytokinins

In many plant experimental systems, an antagonism in the effects of pairs of growth regulators has been reported. These range from the classic role of auxin/cytokinin ratios in regulating root/shoot regeneration in tissue culture (Skoog and Miller, 1957) to the modulation of a-amylase transcript levels in the aleurone of barley by GA3 and ABA (Ho, 1989).

Cytokinins and ABA have often been reported to have opposite effects on plant metabolic, physiological, and developmental events. These include effects on nitrate reductase activity and transcript levels (Lu et al., 1992), PEP carboxylase mRNA levels (Thomas et al., 1992), stomatal opening (Incoll and Jewer, 1987), and senescence (Noodén, 1988; Zeevaart and Creelman, 1988; Smart et al., 1991). S. polyrrhiza is an example of an intact plant system in which ABA and cytokinin have antagonistic effects on a morphogenic event (turion formation) (Stewart, 1969). Our results show that cytokinins antagonize both responses of S. polyrrhiza to ABA (growth and morphogenesis), in contrast to the previous suggestion that only ABA-induced turion formation was repressed by cytokinin (Stewart, 1969). We can explain this apparent discrepancy by pointing out that the alleviation of ABA-induced growth inhibition by cytokinins may be observed only at low cytokinin concentrations that alone have little inhibitory effect on frond growth. We presume that the alleviation of part of the ABA-induced growth inhibition kdirectly due to the reversal of turion formation. Primordia that would normally develop into turions in the presence of ABA develop into small fronds when kinetin as well is present, thus leading to the observed increase in fresh weight.

Our data show that the antagonism at the level of morphogenesis is reflected at the molecular level by an antagonism in the effect of these growth regulators on the expression of the tur4 peroxidase gene. This observation raises two questions. First, is the inhibition of the ABA-up-regulated transcript level for the tur4 peroxidase gene functionally linked to the inhibition of ABA-induced turion formation or growth inhibition? Second, what is the molecular nature of the interaction between the two growth regulators ABA and cytokinin? At present we can only speculate on the answers to these questions.

As to the functional link between the ABA-induced peroxidase and ABA-induced turion formation, we are now carrying out experiments to see whether it is possible to identify a concentration of kinetin at which inhibition of the level of ABA-induced tur4 transcript occurs but at which inhibition of ABA-induced turion formation does not occur. Thus, using the ratio of ABA:cytokinin as a handle, can we dissociate some of the molecular events we observe during ABA-induced turion formation from the morphogenic event?

The pattern of expression of the tur4 transcript with exog- enous ABA concentration correlates physiologically with the concentrations of ABA that induce turion formation and inhibit growth (Smart and Trewavas, 1983). Because we find that a similar induction of tur4 gene expression is not ob-

served during low-temperature induction of turion formation, we conclude that the rise in the tur4 transcript level is not a general feature of turion formation per se, and is either specifically linked to ABAS induction of this morphogenic event or is a specific effect of ABA on S. polyrrhiza fronds, unrelated to turion formation.

With respect to the nature of the interaction between ABA and cytokinin, one can envisage a number of scenarios. For example, it is possible that the signal-transduction pathways of the two regulators converge relatively late at the level of gene transcription, thus predicting the presence of distinct ABA- and cytokinin-associated transcription factors and binding sites. In this respect the regulation of tur4 in S. polyrrhiza by ABA and cytokinins would be reminiscent of the regulation of a-amylase by GA3 and ABA in the barley aleurone system (see, for example, Lazarus, 1991; Skriver et al., 1991). However, since our analysis of the transcript levels of tur4 is based on northem blots, and therefore reflects steady-state transcript levels only, we cannot as yet pinpoint either the level of the ABA up-regulation of tur4 or of the cytokinin interference with this up-regulation. Because the early (2 h) ABA induction of the tur4 transcript is not affected by the simultaneous addition of kinetin, whereas 22 h later this level is very much reduced by kinetin, one could envisage a scenario whereby kinetin accelerates the degradation of the tur4 transcript level. However, because kinetin appears to have no such effect on the steady-state levels of the tur4 transcript in the absence of ABA, the situation may be far more complex. A nuclear run-on analysis of the transcriptional activity of tur4 in the presence and absence of ABA and kinetin should provide some answers to this question.

Altematively, the signal-transduction pathways might interact much earlier, even to the point where the two mole- cules competitively interact for the same binding site on receptors or camers, as suggested by van Overbeek et al. (1967). Moreover, it has also been suggested that ABA and cytokinins might affect the metabolism of each other, thus modulating the effect of each on the plant’s metabolism and development. Cytokinins have been shown to inhibit the biosynthesis of ABA (Cowan and Railton, 1987) and to promote its conjugation (Even-Chen and Itai, 1975). Like- wise, ABA may change cytokinin transport and metabolism (Sondheimer and Tzou, 1971; Back et al., 1972).

Such potential complexity in the mode of action of two growth regulators makes predictions of their interactions rather difficult. However, S. polyrrhiza now affords an intact plant system in which two growth regulators (ABA and cytokinin) interact antagonistically to control an easily ob- servable phenotype (turion formation) and an easily detect- able molecular marker ( tur4) , and that, due to its growth in liquid, is amenable to the analysis of growth regulator metabolism following feeding of labeled precursors.

In conclusion, our identification of a nove1 ABA-inducible basic peroxidase whose maintained induction is suppressed by cytokinin in a plant system that shows a clear developmental response to these two growth regulators provides an insight into how these regulators might affect plant development and provides an experimental framework for the investigation of how growth regulators might interact.

Dow



506 Chaloupková and Smari Plant Physiol. Vol. 105, 1994

ACKNOWLEDCMENTS

We thank Prof. N. Amrhein for his support and encouragement. We also thank Ms. Martha Waibel for help with the DNA sequencing.

Received September 13, 1993; accepted February 23, 1994. Copyright Clearance Center: 0032-0889/94/105/0497/11. The GenBank/EMBL accession number for the sequence reported in

this article is 222920.

LITERATURE CITED

Back A, Bittner S, Richmond AE (1972) The effect of abscisic acid on the metabolism of kinetin in detached leaves of Rumex pulcher.

Bednarek SY, Wilkins TA, Dombrowski JE, Raikhel NV (1990) A carboxyl terminal pro-peptide is necessary for proper sorting of barley lectin to vacuoles of tobacco. Plant Cell 2: 1145-1155

Bradley DJ, Kjellbom P, Lamb CJ (1992) Elicitor- and wound- induced oxidative cross-linking of a proline-rich plant cell wall protein: a novel, rapid defense response. Cell70 21-30

Buffard D, Breda C, van Huystee RB, Asemoa O, Pierre M, Dang Ha DB, Esnault R (1990) Molecular cloning of complementary DNAs encoding two cationic peroxidases from cultivated peanut cells. Proc Natl Acad Sci USA 87: 8874-8878

Chrispeels MJ (1991) Sorting of proteins in the secretory system. Annu Rev Plant Physiol Plant Mo1 Biol42 21-53

Cordewener J, Booij H, van der Zandt H, van Engelen F, van Kammen A, De Vries S (1991) Tunicamycin-inhibited carrot somatic embryogenesis can be restored by secreted cationic peroxidase isoenzymes. Planta 184 478-486

Cowan AK, Railton ID (1987) Cytokinins and ancymidol inhibit abscisic acid biosynthesis in Persea gratissima. J Plant Physiol 130

Criqui M-C, Plesse 8, Durr A, Marbach J, Parmentier Y, Jamet E, Fleck J (1992) Characterization of genes expressed in mesophyll protdplasts of Nicotiana sylvestris before the re-initiation of the DNA replicational activity. Mech Dev 38: 121-132

Devereaux J, Haeberli P, Smithies O (1984) A comprehensive set of sequence analysis programs for the VAX. Nucleic Acids Res 1 2

Even-Chen Z, Itai C (1975) The role of abscisic acid in senescence of detached tobacco leaves. Plant Physiol34 97-100

Fincher GB (1989) Molecular and cellular biology associated with endosperm mobilization in germinating cereal grains. Annu Rev Plant Physiol Plant Mo1 Biol40: 305-346

Fry SC (1986) Cross-linking of matrix polymers in the growing cell walls of angiosperms. Annu Rev Plant Physiol37: 165-186

Fujiyama K, Takemura H, Shibayama S, Kobayashi K, Choi J-K, Shinmyo A, Takano M, Yamada Y, Okada H (1988) Structure of the horseradish peroxidase isozyme C genes. Eur J Biochem 173

Fujiyama K, Takemura H, Shinmyo A, Okada H, Takano M (1990) Genomic DNA structure of two new horseradish peroxidase- encoding genes. Gene 8 9 163-169

Gaspar T, Penel C, Hagege D, Greppin H (1991) Peroxidases in plant growth, differentiation, and development. In J Lobarzewski, H Greppin, C Penel, T Gaspar, eds, Biochemical, Molecular, and Physiological Aspects of Plant Peroxidases. University of Geneva, Geneva, Switzerland, pp 249-280

Han JH, Stratowa C, Rutter WJ (1987) Isolation of full-length putative rat lysophospholipase cDNA using improved methods for mRNA isolation and cDNA cloning. Biochemistry 2 6 1617-1625

Herrin DL, Schmidt GW (1988) Rapid, reversible staining of northem blots prior to hybridization. Biotechniques 6 196-200

Hillman WS (1961) The Lemnaceae, or duckweeds. A review of the descriptive and experimental literature. Bot Rev 27: 221-287

Ho T-HD (1989) Hormonal and stress regulation of gene expression in cereal aleurone layers. In S Kung, CJ Amtzen, eds, Plant Biotechnology. Buttenvorths, Boston, MA, pp 207-228

Incoll LD, Jewer PC (1987) Cytokinins and stomata. In E Zeiger, GD Farquhar, IR Cowan, eds, Stomatal Function. Stanford Uni- versity Press, Stanford, CA, pp 281-292

J EXP Bot 2 3 744-750

2 73-2 77

387-395

681-687

Intapruk C, Higashimura N, Yamamoto K, Okada N, ljhinmyo A, Takanol M (1991) Nucleotide sequences of two genomic DNAs encoding peroxidase of Arabidopsis thaliana. Gene 9 8 237-241

Intapruk C, Yamamoto K, Fujiyama K, Takano M, Shinmyo A (1993) Cloning of cDNAs encoding two peroxidases o f Arabidopsis thaliana and their organ-specific expression. J Fermerit Bioeng 7 5

Ishige F, Mori H, Yamazaki K, Imaseki H (1993) Identification of a basic glycoprotein induced. by ethylene in primary leiives of azuki bean as a cationic peroxidase. Plant Physiol 101: 193-199

Jacobs DIL (1947) An ecological life-history of Spirodela polyrrhiza (greater duckweed) with emphasis on the turion phase. Eco1 Mon-

Johanssoin A, Rasmussen SK, Harthill JE, Welindei: KG (1992) cDNA, amino acid and carbohydrate sequence of barley seed- specific peroxidase BPI. Plant Mo1 Biol18: 1151-1161

Kawaoka A, Sato S, Nakahara K, Matsushima N, Okada N, Sekine M, Shiinmyo A, Takano M (1992) Expression and promoter activity of genes for isozymes of horseradish peroxidase. Plant Cell

Lagrimini LM (1992) Plant peroxidases: under- and over-expression in tranijgenic plants and physiological consequences. In C Penel, T Gaspar, H Greppin, eds, Plant Peroxidases 1980-1990: Topics and Detailed Literature on Molecular, Biochemical, and Physiolog- ical Aspects. University of Geneva, Geneva, Switzerland, pp

Lagrimini LM, Burkhart W, Moyer M, Rothstein S (1987) Molec- ular cloning of complementary DNA encoding the li;,+--forming peroxiclase from tobacco: molecular analysis and tissue-specific expresaion. Proc Natl Acad Sci USA 8 4 7542-7546

Landolt 13 (1986) The Family of Lemnaceae-A Monographic Study, Vol 1. Biosystematic Investigations in the Family of Duckweeds (Lemnaceae), Vol 2. Veroffentlichungen des Geobotanischen In- stituts, ETH, Stiftung Riibel, Ziirich

Lazarus 1CM (1991) Hormonal regulation of plant gene expression. In D Grierson, ed, Developmental Regulation of Plant Gene Expression: Plant Biotechnology, Vol 2. Blackie, C hapman and Hall, Rlew York, pp 42-74

Longlanti J (1986) The molecular mode of action of at)scisic acid in the indluction of dormancy. PhD thesis. University cif Edinburgh, Edinburgh, Scotland

Lu J, Erl.1 JR, Chen C (1992) Transcriptional regulation of nitrate reductase mRNA levels by cytokinin-abscisic acid interactions in etiolated barley leaves. Plant Physiol98 1255-1260

MacAdaim JW, Nelson CJ, Sharp RE (1992) Peroxidase activity in the Ieaf elongation zone of ta11 fescue. 11. Spatial distribution of apoplastic peroxidase activity in genotypes differing in length of the elongation zone. Plant Physiol99 879-885

Mazza G, Welinder KG (1980) Covalent structure of tumip peroxidase 7'. Cyanogen bromide fragments, complete structure and comparison to horseradish peroxidase C. Eur J I3iochem 108

McDoug,all GJ (1992) Plant peroxidases and cell differentiation. In C Penel, T Gaspar, H Greppin, eds, Plant Peroxidases 1980-1990: Topics and Detailed Literature on Molecular, Biochemical, and Physiological Aspects. University of Geneva, Geneva. Switzerland,

Morgenci PH, Callahan AM, Dunn LJ, Abeles FB (1'390) Isolation and sequencing of cDNA clones encoding ethylene-induced putative peroxidases from cucumber cotyledons. Planf- Mo1 Biol 1 4

Murray EE, Lotzer J, Eberle M (1989) Codon usage i11 plant genes. Nucleic Acids Res 17: 477-498

Nooden L (1988) Abscisic acid, auxin and other regulators of senescence. In LD Noodén, AC Leopold, eds, Senescence and Aging in Plants. Academic Press, San Diego, CA, pp 330-3868

Perry TO, Byrne OR (1969) Turion induction in Spirodela polyrrhiza by abscisic acid. Plant Physiol44 784-785

Rebmann G, Hertig C, Bull J, Mauch F, Dudler R (:L991) Cloning and sequencing of cDNAs encoding a pathogen-induced putative peroxidase of wheat (Triticum aestivum L.). Plant Mo1 Biol 1 6

Robb J, Lee SW, Mohan R, Kolattukudy PE (1991) Chemical

166-172

OP 17: 437-469

Physiol 33: 1143-1150

59-69

48 1-489

pp 101.-115

715-7.25

329-331

Dow



Cytokinin Antagonizes ABA lnduction of Peroxidase 507

characterization of stress-induced vascular coating in tomato. Plant Physiol97: 528-536

Roberts E, Kolattukudy PE (1989) Molecular cloning, nucleotide sequence, and abscisic acid induction of a suberization-associated highly anionic peroxidase. Mo1 Gen Genet 217: 223-232

Rogers SO, Bendich AJ (1988) Extraction of DNA from plant tissues. In SB Gelvin, RA Schilperoort, eds, Plant Molecular Biology Man- ual, Part A6. Kluwer Academic Publishers, Dordrecht, The Neth- erlands, pp 1-10

Ros BarcelÓ A, Muííoz R (1992) Peroxidases: their role in the control of plant cell growth. In C Penel, T Gaspar, H Greppin, eds, Plant Peroxidases 1980-1990: Topics and Detailed Literature on Molec- ular, Biochemical, and Physiological Aspects. University of Ge- neva, Geneva, Switzerland, pp 71-89

Sakurada J, Takahashi S, Hosoya T (1986) Nuclear magnetic reso- nance studies on the spatial relationship of aromatic donor mole- cules to the heme iron of horseradish peroxidase. J Biol Chem 261:

Sherf BA, Bajar AM, Kolattukudy P (1993) Abolition of an inducible highly anionic peroxidase activity in transgenic tomato. Plant Physiol 101: 201-208

Skoog F, Miller CO (1957) Chemical regulation of growth and organ formation in plant tissues cultured in vitro. Symp SOC Exp Biol 11:

Skriver K, Olsen FL, Rogers JC, Mundy J (1991) Cis-acting DNA elements responsive to gibberellin and its antagonist abscisic acid. Proc Natl Acad Sci USA 88: 7266-7270

Smart C, Longland J, Trewavas A (1987) The turion: a biological probe for the molecular action of abscisic acid. In JE Fox, M Jacobs, eds, Molecular Biology of Plant Growth Control. Alan Liss, New York, pp 345-359

Smart CC, Fleming AJ (1993) A plant gene with homology to D- myo-inositol-3-phosphate synthase is rapidly and spatially up- regulated during an abscisic acid-induced morphogenic response in Spirodela polyrrhiza. Plant J 4 279-293

Smart CC, Trewavas AJ (1983) Abscisic-acid-induced turion formation in Spirodela polyrrhiza L. I. Production and development of the turion. Plant Cell Environ 6 507-514

Smart CM, Scofield SR, Bevan MW, Dyer TA (1991) Delayed leaf senescence in tobacco plants transformed with tmr, a gene for cytokinin production in Agrobacterium. Plant Cell 3: 647-656

Sondheimer E, Tzou DS (1971) The metabolism of hormones during seed germination and dormancy 11. The metabolism of 8-14C-zeatin in bean axes. Plant Physiol47: 516-520

Stewart GR (1969) Abscisic acid and morphogenesis in Lemna polyrrhiza L. Nature 221: 61-62

9657-9662

118-131

Theilade B, Rasmussen SK (1992) Structure and chromosomal localization of the gene encoding barley seed peroxidase BP 2A. Gene 118: 261-266

Theilade B, Rasmussen SK, Rosenkrands I, Frfikiaer H, Hejgaard J, Theilade J, Pihakaski-Maunsbach K, Maunsbach AB (1993) Subcellular localization of barley grain peroxidase BP2 by immuno- electron microscopy. In KG Welinder, SK Rasmussen, C Penel, H Greppin, eds, Plant Peroxidases: Biochemistry and Physiology. University of Geneva, Geneva, Switzerland, pp 321-328

Thomas JC, McElwain EF, Bohnert HJ (1992) Convergent induction of osmotic stress-responses. Abscisic acid, cytokinin, and the effects of NaCI. Plant Physiol 100 416-423

Trewavas AJ, Jones HG (1991) An assessment of the role of ABA in plant development. In WJ Davies, HG Jones, eds, Abscisic Acid: Physiology and Biochemistry. Bios Scientific Publishers, Oxford,

Valpuesta V, Quesada MA, Pliego F, Hasegawa PM, Botella MA (1993) Changes in the expression of a peroxidase mRNA in tomato plants under salt stress. In KG Welinder, SK Rasmussen, C Penel, H Greppin, eds, Plant Peroxidases: Biochemistry and Physiology. University of Geneva, Geneva, Switzerland, pp 405-412

van Overbeek J, Loeffler JE, Mason MIR (1967) Dormin (abscisin 11), inhibitor of plant DNA synthesis? Science 156 1497-1499

von Heijne G (1990) The signal peptide. J Membr Biol l l5 195-201 Welinder KG (1979) Amino acid sequence studies of horseradish

peroxidase. Amino and carboxyl termini, cyanogen bromide and tryptic fragments, the complete sequence, and some structural characteristics of horseradish peroxidase C. Eur J Biochem 9 6

Welinder KG (1991) The plant peroxidase superfamily. In J Lobar- zewski, H Greppin, C Penel, T Gaspar, eds, Biochemical, Molec- ular, and Physiological Aspects of Plant Peroxidases. University of Geneva, Geneva, Switzerland, pp 3-13

Welinder KG (1992) Plant peroxidases: structure-function relation- ships. In C Penel, T Gaspar, H Greppin, eds, Plant Peroxidases 1980-1990: Topics and Detailed Literature on Molecular, Biochem- ical, and Physiological Aspects. University of Geneva, Geneva, Switzerland, pp 1-24

Welinder KG, Gajhede M (1993) Structure and function of peroxidases. In KG Welinder, SK Rasmussen, C Penel, H Greppin, eds, Plant Peroxidases: Biochemistry and Physiology. University of Geneva, Geneva, Switzerland, pp 35-42

Welinder KG, Mauro JM, N~rskov-Lauritsen L (1992) Structure of plant and funga1 peroxidases. Biochem SOC Trans 2 0 337-340

Zeevaart JAD, Creelman RA (1988) Metabolism and physiology of abscisic acid. Annu Rev Plant Physiol Plant Mo1 Biol 39 439-473

UK, pp 169-188

483-502

Dow



The Abscisic Acid lnduction of a Nove1 Peroxidase 1s

Documents

Transcript of The Abscisic Acid lnduction of a Nove1 Peroxidase 1s