The A730 loop is an important component of the active site of the VS ribozyme

doi:10.1006/jmbi.2001.4996 available online at http://www.idealibrary.com on J. Mol. Biol. (2001) 312, 663±674

The A730 Loop is an Important Component of theActive Site of the VS Ribozyme

Daniel A. Lafontaine, Timothy J. Wilson, David G. Norman andDavid M. J. Lilley*

CRC Nucleic Acid StructureResearch Group, Department ofBiochemistry, MSI/WTBComplex, The University ofDundee, Dundee DD1 5EHUK

E-mail address of the [email protected]

Abbreviation used: FRET, ¯uorenenergy transfer.

0022-2836/01/040663±12 $35.00/0

The core of the VS ribozyme comprises ®ve helices, that act either in cisor in trans on a stem-loop substrate to catalyse site-speci®c cleavage. Thestructure of the 2-3-6 helical junction indicates that a cleft is formedbetween helices II and VI that is likely to serve as a receptor for the sub-strate. Detailed analysis of sequence variants suggests that the basebulges of helices II and VI play an architectural role. By contrast, theidentity of the nucleotides in the A730 loop is very important for ribo-zyme activity. The base of A756 is particularly vital, and substitution byany other nucleotide or ablation of the base leads to a major reduction incleavage rate. However, variants of A756 bind substrate ef®ciently, andare not defective in global folding. These results suggest that the A730loop is an important component of the active site of the ribozyme, andthat A756 could play a key role in catalysis.

# 2001 Academic Press

Keywords: RNA catalysis; rate enhancement; nucleobases; FRET;metal ions
*Corresponding author
Introduction

Ribozyme catalysis is of basic importance for cellfunction. It is known to be involved in the proces-sing of RNA molecules including group I1 and II2

introns, tRNA3 and the replication intermediates ofcertain viruses,4 ± 9 and there is increasing evidencesuggesting that the splicing of mammalian mRNAmay be RNA-catalysed.10,11 The recent demon-stration that the peptidyl transferase activity ofbacterial ribosomes is catalysed by the 23 SrRNA12 shows that RNA catalysis is both versatileand ubiquitous, and may re¯ect a stage in the evol-ution of life when RNA had both informationaland catalytic functions.

Catalytic RNA species require folding into theiractive conformations, for which the binding ofdivalent metal ions is generally required.13 Thiscreates a local environment in which reaction ratesare accelerated, due to a combination of factorsthat may include metal ion and nucleobase cataly-sis and local stereochemical effects. The smallnucleolytic ribozymes provide a good experimentalsystem for studying the mechanism of RNA cataly-

ing author:

scence resonance

sis because of their small size and relative simpli-city. These undergo a site-speci®c breakage of thephosphodiester backbone by means of a transester-i®cation reaction in which the 20-hydroxyl groupattacks the adjacent 30-phosphate group in anSN2 reaction generating cyclic 20,30-phosphate and50-hydroxyl termini.

The VS ribozyme is intermediate in size andcomplexity between the smallest nucleolyticribozymes and the fungal self-splicing introns. The154 nt ribozyme14 is contained within the VS RNAthat is transcribed from the Varkud satellite DNAin the mitochondria of Neurospora.15 The sequenceand secondary structure of VS16 are shown inFigure 1; despite the apparent mechanistic simi-larity with the other nucleolytic ribozymes, theycan have little in common structurally. Althoughthe natural VS RNA undergoes self-cleavage as aunit, it can be divided into a substrate andtrans-acting ribozyme.17 Cleavage occurs withinstem-loop I, with helices II through VI acting asthe ribozyme in the reaction. The substrate stem-loop interacts with the ribozyme by essentially ter-tiary interactions. These are largely unknown atpresent, beyond the demonstration by Collins andco-workers18 of an interaction between the terminalloops of helices V and I. However, it is highlylikely that the substrate docks into the body of theribozyme in some manner, creating the local

# 2001 Academic Press

mailto:[email protected]

Figure 1. The base sequence and secondary structureof the VS ribozyme. (a) The complete sequence of theribozyme,16 with the position of self-cleavage arrowed.The helices are numbered conventionally, but for thepurposes of this study helices II and VI have been sub-divided by the bulges and loops that interrupt them.(b) Division of the ribozyme into a trans-acting ribozymeand substrate. The separation is made between A639and G640 as illustrated. This ribozyme 1 � substrate 1combination21 gives relatively rapid, monophasic clea-vage kinetics.

664 The VS Ribozyme Active Site

environment in which the cleavage reaction iscatalysed. Two structures for the substrate stem-loop have recently been obtained by NMR spectro-scopy.19,20

We have shown that the three-way junctionbetween helices II, III and VI (junction 2-3-6) hasan important role in the ribozyme.21 In the pre-sence of magnesium ions this junction folds by acoaxial stacking of helices III and VI, with helix IIbrought into the same quadrant as helix VI.Sequence changes, particularly at A656 and G768,lead to perturbed folding of this junction andreduced catalytic activity of the completeribozyme.21 It is thus probable that this junctionorganises the architecture of the ribozyme, creatingthe correct structure into which the substrate stem-loop can interact productively. The position of thesubstrate is severely constrained by the covalentlinkage to the end of helix II in the cis-acting ribo-zyme, suggesting that it interacts with helices IIand VI, perhaps docked into the cleft betweenthem. It therefore seemed likely that the active siteof the ribozyme would be contained within thesehelices, and we have previously suggested that theloop containing A730 was a strong candidate.21

Here we have focussed on structural elements inhelices II and VI. Our results lend strong supportto a critical role for the A730 loop, and suggest aparticularly important function for A756.

Results

Kinetic analysis of the VS ribozyme actingin trans

In this study we have investigated the cleavageof the substrate stem-loop I by the ribozyme (com-prising helices II through VI) in trans. We have

previously analysed two forms of this ribozyme-substrate combination.21 In the present work wehave used substrate 1 plus ribozyme 1 in whichhelix Ia only forms in the complex between thetwo (Figure 1(b)). This gives a faster cleavage ratethan other substrate plus ribozyme combinations.

Reaction progress is shown as a function of timefor the natural sequence ribozyme in Figure 2(a).These data were ®tted to a single exponential func-tion (Figure 2(b)), giving an observed rate constantof kobs � 1.0 minÿ1. We have analysed the reactionon the assumption of the formation of a non-covalent complex between the ribozyme (Rz) andsubstrate (S), i.e.:

Rz� S�kÿ1

Kÿ1

Rz:S�k2

Kÿ2

Rz:P1:P2

where P1 and P2 are the products. k2 is the rate ofthe central conversion of the bound substrate intoproduct. In addition to the chemical step, it mayencompass conformational changes, such as arearrangement of substrate secondary structure.22

The 50 reaction product should rapidly diffuseaway, and we have therefore ignored kÿ2 in thisanalysis. This assumption is supported by theobservation that the presence or absence of helix Iadoes not affect the observed rate of cleavage of thesubstrate used in these studies.21 The rate of thecleavage reaction was measured as a function ofribozyme concentration, shown in Figure 2(c). Thedata were ®tted to the equation:

kobs � �k2�Rz��=��Rz� � KappM � �1�

corresponding to the reaction scheme above. Fromthis we have determined the values ofKM

app � 1.0 mM and k2 � 2.0 minÿ1 for the naturalVS ribozyme sequence. This analysis has beenrepeated for selected sequence variants in thecourse of these studies.

Sequence requirements in helices II and VI

We have analysed the sequence requirementswithin helices II and VI for cleavage activity of theVS ribozyme. Except where indicated, these exper-iments have used the ribozyme 1 plus substrate 1system in trans, under single turnover conditionsusing 1 mM ribozyme at 37 �C in 50 mM Tris-HCl(pH 8.0), 10 mM MgCl2, 25 mM KCl and 2 mMspermidine. The observed rate constants are col-lected in Tables 1-3. Helix VI can be subdividedinto ®ve sections (see Figure 1). Three helical sec-tions (VIa, b and c) comprising either Watson-Crick or G �U base-pairs are interrupted by the A2

bulge and the A730 loop.

Importance of bulged adenine in helix II

The most important feature of helix II (Table 1)for the cleavage activity of the ribozyme is thesingle-adenine bulge (A652). Deletion of this leads

Figure 2. Kinetic analysis of substrate cleavage by theVS ribozyme in trans. (a) Cleavage of radioactively(50-32P)-labelled substrate by VS ribozyme under single-turnover conditions at 37 �C. The substrate and 5 nt pro-duct were separated by gel electrophoresis, and an auto-radiograph of the gel is shown. The reaction timepointsare written above the gel. (b) Plotted reaction progressfor the cleavage of substrate (*). The line shows asingle-exponential function ®tted to the experimentaldata. (c) The cleavage reaction as a function of ribozymeconcentration. Rate constants for substrate cleavagewere measured over a range of ribozyme concentrations.These data are plotted, and ®tted to equation (1), givingk2 � 2.0 minÿ1 and KM

app � 1.0 mM. The inset shows analternative representation of the data according to arearrangement of the equation to give a linear relation-ship between kobs and kobs/[Rz].

Table 1. Effect of sequence changes in helix II oncleavage activity

Sequence kobs (minÿ1) kred

Natural sequence 1.0 (1)�A652a 0.013 77�650G: � 772Cb 1.1 0.91�653G: � 770Cc 0.0056 180A652G 0.01 100A652C 0.17 5.9A652U 0.24 4.1A652 Invd <0.001 >1000

Observed rate constants (kobs) were measured under standardconditions for the VS ribozyme variants used in these studies.kred is the factor by which rates are reduced relative to the nat-ural ribozyme under the same conditions. Replicate measure-ments made in representative cases indicates an experimentalerror of less than 10 %. Nomenclature for sequence alterations:deleted bases indicated by �, added bases indicated by � andthe number of the nucleotide 50 to the point of insertion. Invdenotes base bulges relocated to the opposing strand.

a Removal of bulged A652.b Addition of G �C base-pair into helix IIa.c Addition of G �C base-pair into helix IIb.d Relocation of the bulged adenine to the opposite strand, i.e.

�A652: � 771A.

The VS Ribozyme Active Site 665

to a 77-fold reduction in the rate of cleavage intrans (similar results have been found using a cis-acting ribozyme16), while the effect of transferringthe bulged adenosine to the opposite strand iseven greater, with a > 1000-fold reduction. How-

ever, it is not critical that the bulge is adenine,since replacement by a pyrimidine base has smalleffects on cleavage rate. Substitution by guaninehas a more signi®cant effect; however, this may beexplained by base-pairing of G652 with C771,potentially propagating the bulge three nucleotidesto G655 at the 2-3-6 junction. The position of thebulge relative to the junction is also important.Insertion of an additional base-pair into helix IIblead to a 180-fold rate reduction, while a similarinsertion into helix IIa had no effect. Collectivelythe results show that a correctly located andoriented bulge is important to cleavage activity,but the chemical nature of the bulged base is notcritical.

The junction-distal end of helix VIis unimportant

Helix VIc comprises ten base-pairs, of whichthree are G �U pairs, terminated by a classicalGNRA-type tetraloop. Removal of the loop (divid-ing the ribozyme into two strands) resulted in aminimal change in cleavage rate (see below). Indi-vidual alteration of uridine to cytosine in the G �Upairs of helix VIc had no effect on cleavage rateslarger than a factor of 2.4. The helix was shortenedby successive removal of 2, 4, 6 and 8 bp from thejunction-distal end, leaving the ®nal C-G base-pairthat closes the loop in each case. Removal of 2 bpand 4 bp had no signi®cant effect, while longerdeletions gave a small impairment of activity(Table 2). Even when this helix was reduced to twobase-pairs, the cleavage rate was only reducedtwofold. We conclude that this helix does not playan important role in ribozyme activity. Similarresults were obtained with a cis-acting VS ribo-zyme by Collins and co-workers,23 who found that

Table 2. Effect of sequence changes in helix VI oncleavage activity


A. Helix VIaG722C:C763G 0.84 1.2C723G:G762C 0.84 1.2U724A:A761U 0.21 4.8

B. Helix VIbG727C:C760G 0.35 2.9U728A:A759U 1.3 0.77G729C:C758G 0.43 2.3

C. Helix VIcC731G:G754C 0.042 23G732U:U753G:G733U:U752G 0.47 2.1U752C 0.80 1.3U753C 0.42 2.4U752C:U753C 0.52 1.9VIc: �2 bpa 0.97 1.0VIc: �4 bpb 1.0 1.0VIc: �6 bpc 0.70 1.4VIc: �8 bpd 0.46 2.2

D. Helix VI:AA bulgeA725G 0.055 18A725C 1.6 0.62A725U 1.5 0.67A726G 1.2 0.83A726C 1.7 0.59A726U 1.1 0.91�A725e 0.17 5.9�A725:�A726f 0.0071 140�A725:A726Gg 0.25 4.0�A725:A726Cg 1.6 0.63�A725:A726Ug 0.37 2.7A725, A726 Inv 0.0028 360�A725: A726 Inv 0.043 23

a Helix VIc shortened by 2 bp by removal of nucleotides 738,739, 746 and 747.

b Helix VIc shortened by 4 bp by removal of nucleotides 736-739 and 746-749.

c Helix VIc shortened by 6 bp by removal of nucleotides 734-739 and 746 -751.

d Helix VIc shortened by 8 bp by removal of nucleotides 732-739 and 746-753.

e Removal of one bulged A base from helix VI.f Removal of both bulged A bases from helix VI.g Replacement of double-A bulge in helix VI by single non-A

nucleotide as indicated.


large deletions of this helix failed to reduce signi®-cantly the cleavage activity. The largest effectobserved by modi®cation of helix VIc wasobserved on reversing the base-pair adjacent to theA730 loop, which leads to a 23-fold reduction incleavage rate.

The roles of helices VIa and VIb, and theA2 bulge

We have previously shown that reversal of thebase-pair of helix VIa adjacent to the 2-3-6 junctionhas almost no effect on cleavage activity.21 Wehave extended this to include each base-pair ofhelices VIa and VIb individually (Table 2). Theidentity of none of these base-pairs appears to becritical for cleavage activity; the largest reductionin the rate of cleavage was ®vefold. However, wenote that the two base-pairs giving the largesteffects were those that ¯ank the A2 bulge. Modi®-cation of the bulge itself leads to more signi®cantperturbation of cleavage rates. Removal of oneadenine was tolerated relatively well, but removalof both leads to a 140-fold reduction in the rate ofcleavage. The double-deletion gave a signi®cantloss of binding af®nity, with a KM

app � 6.8 mM(Table 4). As with the bulge in helix II, the largestimpairment of cleavage rate occurred when thebulge was transferred to the opposite strand. Bycontrast, individual replacements of the bulgedadenine bases by alternative nucleotides generallylead to small changes in activity, several of whichwere stimulations. Furthermore, the substitutionswith the greatest effect are those that could base-pair with C760 or A761, thus shifting the locationof the bulge. This suggests an architectural role forthe bulge, possibly due to local axial bending.

The important role of the A730 loop

The only remaining feature of helix VI is theA730 loop, an asymmetric bulge in which a singleadenine (A730) on one strand is opposed by aCAG sequence on the other. Deletion of this loopleads to a total loss of cleavage activity in cis,23 andwe have therefore carried out a complete substi-tution analysis of this feature, in which eachnucleotide was individually replaced by the threeother possibilities (Figure 3 and Table 3).

VS ribozyme activity was quite sensitive toreplacement of A730, with rates reduced by factorsof from 18 (A730C) to 91 (A730G). It was similarlyaffected by nucleotide substitution at G757, withrates reduced from 23-fold (G757A) to 67-fold(G757C). The position exhibiting greatest variabil-ity in sensitivity to substitution was C755; cleavagewas almost unaffected by adenine substitution,whereas cleavage in the C755G variant wasreduced by a factor of 50. The position exhibitingthe most striking sensitivity to nucleotide substi-tution was A756, where replacement by any of thenormal bases leads to very severe impairment ofcleavage, largely due to a reduced value of k2

(Table 4). When these experiments were repeatedusing the cis-acting ribozyme, cleavage wasundetectable after three hours incubation with anyof the variants substituted at A756 (data notshown). It is therefore likely that this adenine playsa particularly critical role in the function of theribozyme.

We have further analysed the requirements atposition 756 by functional group substitution. Todo this we generated a new semi-synthetic con-struct in which the complete ribozyme was dividedby opening the loop of stem VI. This is equivalentto that shown in Figure 5(a), below, but lackinghelix I or the ¯uorophores. The lower strand ofhelices II and VI was made by chemical synthesis,thereby allowing the introduction of nucleotideanalogues at selected positions. The top strand wastruncated at the 50 end, and corresponded to the

Figure 3. The effect of sequencevariation in the A730 loop on clea-vage rates in trans. (a) Gel electro-phoretic separation of radioactivesubstrate and product for the natu-ral sequence ribozyme, and repre-sentative sequence variants after45 minutes incubation. An auto-radiograph of the gel is shown.Tracks: 1, uncleaved substrate; 2,cleavage by natural sequenceribozyme; 3-8, cleavage by variantribozymes A730G, C755G, G757C,A756G, A756C and A756U respect-ively. (b) Schematic summarising

the effect of sequence changes in the A730 loop on cleavage rates. The values show the factor by which the reactionrate is reduced relative to the natural sequence ribozyme.


trans-acting ribozyme 1. The semi-synthetic ribo-zyme gave complete cleavage of the substrate intrans; however, we found that the cleavage ratewas a little slower for the latter compared to theall-transcribed version, possibly due to the openingof the loop of helix VI, and we have therefore refer-enced rates measured in this system to the valuefor the natural sequence in this form. Removal ofthe 20-OH group from A756 lead to a ninefold low-ering of the rate of cleavage. By contrast, removalof the base (creating an abasic deoxyribose group),resulted in a large reduction in cleavage rate. Weconclude that the base is more important than thesugar in the function of A756.

A756G is a competitive inhibitor in the transcleavage reaction

If the variant ribozyme retains its ability to bindsubstrate, then it should act as a competitive

Table 3. Effect of sequence changes in the A730 loop ofhelix VI on cleavage activity


A730G 0.011 91A730C 0.055 18A730U 0.036 28C755A 0.84 1.2C755G 0.020 50C755U 0.17 5.9A756G 0.0027 370A756C 0.0019 530A756U 0.0013 770G757A 0.044 23G757C 0.015 67G757U 0.018 56

Semi-synthetic, trans-acting speciesNatural sequence 0.28 (1)A756-20Ha 0.032 8.8A756 abasicb <0.001 >280

a Replacement of the ribose of A756 by 20-deoxyribose.b Replacement of A756 by an abasic 20-deoxyribose linker.

Relative rates for the semi-synthetic species are compared tothe corresponding natural sequence.

inhibitor, sequestering substrate from the activeribozyme. We therefore measured the rate of sub-strate cleavage in trans over a ®ve minute time-course (during which time cleavage by the A756Gribozyme is negligible), in the presence of a rangeof concentrations of the trans-acting ribozyme (i.e.helices II -VI) containing the A756G change. Weobserved that the rate of cleavage was progress-ively reduced by increasing concentrations of thevariant ribozyme (Figure 4), indicative of substratebinding by the variant. We have analysed thisaccording to the scheme:

Figure 4. Competition by A756 variants. The rate ofcleavage of substrate RNA by natural sequence ribo-zyme under single-turnover conditions was measured asa function of added A756G variant ribozyme concen-tration. The observed rate constant in the presence ofthe variant ribozyme (kobs(Rv)) is plotted as a functionof variant ribozyme concentration, and ®tted to equation(2), from which KI � 4.5 mM was calculated.

Table 4. Kinetic parameters for ribozyme variants

Sequence k2 (minÿ1) KMapp (mM) k2/KM

app (minÿ1 mMÿ1)

Natural 2.0 1.0 2.0�A652 0.31 5.4 0.058�A725:�A726 0.057 6.8 0.0085A730C 0.17 2.1 0.083A730U 0.19 3.8 0.050G757A 0.22 4.1 0.054C755G 0.11 4.6 0.023A756G 0.012 3.5 0.0034A756C 0.0083 2.5 0.0033A756U 0.0061 3.5 0.0018

Ribozyme titrations were performed for selected variants, from which k2 and KMapp were measured. The second-order rate constant

k2/KMapp was calculated from these values. Asymptotic standard deviations on the ®ts indicate that errors in k2 and KM

app are generallyless than 10 % of values.


where Rv is the variant ribozyme. The dissociationconstant for the complex between the variant ribo-zyme and substrate is KI � kÿ3/k3. This was deter-mined from the dependence of kobs on theconcentration of Rv, according to:

kobs�Rv� � k2 � kobs�0� � KI=

��Rv� � �KI ÿ kobs�0�� KI � k2��2�

where kobs(0) and kobs(Rv) are the measured rateconstants at zero and prevailing Rv concentrations,respectively. This gave a value of KI � 4.5 and3.5 mM for the A756G and A756U variants, respect-ively. These are close to the KM

app values measuredby ribozyme titration.

Ion-induced folding of the 2-3-6 junction in thecomplete ribozyme

The analysis of the VS ribozyme variants to thispoint has centred on cleavage activity. Since anyloss of activity could result either directly fromeffects on the catalytic mechanism, or from a per-turbed folding of the ribozyme, we sought ameasure of RNA folding in the VS ribozyme. Wehave previously shown that the 2-3-6 junctionplays an important role in the architecture of theribozyme.21 In isolation it undergoes an ion-induced structural transition in which helices IIIand VI become coaxially stacked, and we havedemonstrated a correlation between sequencealterations leading to perturbed folding of thejunction and those that reduce cleavage activityin the complete ribozyme. In TB buffer (90 mMTris-borate (pH 8.3)) the main folding transitionis characterised by a Hill coef®cient of n � 1.0 � 0.1

and a half-magnesium ion concentration[Mg2�]1/2 � 93 mM, as observed by the 2-6 vector.

We have developed a FRET assay of folding ofthe 2-3-6 junction in the context of the completeribozyme, using the construct illustrated inFigure 5(a). The lower strand of the ribozyme waschemically synthesised, with donor (¯uorescein)and acceptor (Cy3) ¯uorophores located at the 30and 50 ends. Fluorescein was attached via the 5-position of a penultimate uridine nucleotide. Whenthis strand was hybridised to a transcribed RNAstrand to assemble the complete ribozyme (i.e.stems II through VI), the ¯uorophores were locatedat the junction-distal ends of helices II and VI. Theef®ciency of energy transfer between these ¯uoro-phores was measured as a function of magnesiumion concentration. As in the isolated 2-3-6 junction,the ef®ciency increased with ion concentration,showing that the ribozyme changes conformationsuch that the II - VI distance becomes shortened.The transition was well ®tted by the simple two-state model (data not shown), from which a Hillcoef®cient n � 1.0 � 0.1 and [Mg2�]1/2 � 75 mMwere calculated in TB buffer. Thus, the ion-inducedfolding of the junction is not signi®cantly changedin the context of the complete ribozyme. The mag-nesium ion titration was repeated in the same buf-fer as that used in the cleavage experiments (apartfrom the omission of spermidine), i.e. 50 mM Tris-HCl (pH 8.0), 25 mM KCl (Figure 5(b)). Underthese conditions we obtained values ofn � 1.4 � 0.1 and [Mg2 �]1/2 � 140 mM, i.e. theapparent af®nity for magnesium ions was reducedin the cleavage buffer.

A756G does not affect ribozyme folding

The FRET experiments were repeated using alower strand containing the A756G sequencechange (Figure 5(c)). The folding characteristics incleavage buffer were virtually identical with thoseof the natural sequence, with values ofn � 1.2 � 0.2 and [Mg2�]1/2 � 140 mM. Thus, thechange in sequence does not appear to affect theglobal folding of the ribozyme.

Figure 5. Folding of the VS ribozyme as a function of magnesium ion concentration, studied by ¯uorescence reson-ance energy transfer. (a) Schematic showing the construct used in these experiments. The top strand is the standardsequence used in the cleavage experiments, made by transcription. The lower strand was chemically synthesised. Ithas a Cy3 ¯uorophore (C) attached to the 50 phosphate group by a standard three-carbon linkage42 and a ¯uoresceinmolecule (F) attached to the penultimate 30 nucleotide via the 5-position of uracil. The location of the ¯uorophorescorresponds to vector 2-6 in our earlier study of the isolated 2-3-6 junction.21 A similar construct was prepared inwhich the 50 end of the top strand was extended to include the product stem-loop I (indicated in grey). In each casethe ef®ciency of energy transfer (EFRET) from ¯uorescein to Cy3 was measured as a function of magnesium ionconcentration (plotted on a logarithmic scale). The experimental data (*) have been ®tted by regression to a simpletwo-state model (lines) where the binding of metal ions to the RNA induces a structural change. (b) Ion-dependentfolding of the natural sequence ribozyme (helices II-VI). (c) Ion-dependent folding of the A756G ribozyme. (d) Ion-dependent folding of the natural sequence ribozyme with the product attached in cis (helices I-VI). (e) Ion-dependentfolding of the A756G ribozyme with the product attached in cis.



We wanted to extend these experiments toinclude the substrate stem-loop, and thus examinethe effect of the A756G change in the context of thecomplete ribozyme-substrate complex. But toavoid the complication of cleavage occurringduring the magnesium ion titration we opted tostudy the product instead. We hybridised the¯uorescently labelled bottom strand (natural orA756G sequence) to a transcribed top strand thatincluded the stem-loop I beginning from A621 (seeFigure 5(a)). Since the 50 end was generated byhammerhead ribozyme cleavage, this corre-sponded exactly to the product of the VS ribozymecleavage. FRET ef®ciency was measured as a func-tion of magnesium ion concentration as before(Figure 5(d)). The overall FRET ef®ciencies werehigher, apparently due to an altered environmentfor the ¯uorescein when the product was linked tothe end of helix II. The apparent magnesium ionaf®nity was not greatly altered by the presence ofthe product stem-loop, although an increase in thecooperativity was observed. Fitting the data to thetwo-state model gave values of n � 1.9 � 0.1 and[Mg2 �]1/2 � 140 mM for the natural sequence. Clo-sely similar values of n � 1.7 � 0.1 and [Mg2 �]1/2

� 130 mM were obtained using the correspondingA756G construct (Figure 5(e)). Thus, despite itslarge effect on catalytic activity, the A756Gsequence change leads to no signi®cant differencesin the global folding of the ribozyme, even in thepresence of the product stem-loop linked as in thecis-acting ribozyme.

Discussion

Detailed analysis of the sequence requirementsin helices II and VI for cleavage by the VS ribo-zyme have revealed a number of important fea-

Figure 6. Summary of the critical regions of helices IIand VI in the cleavage activity of the VS ribozyme. Junc-tion 2-3-6 plays an important architectural role in thefunction of the ribozyme, with a particularly critical rolefor A656 and G768.21 The presence and location of thetwo bulges (A652 of helix II and A725, A726 of helix VI)are also important, but not the exact nature of the bases.The junction-distal end of helix VI is completely dispen-sable. All the nucleotides contained within the A730loop appear to be important in the cleavage reaction,with a special sensitivity to changes of A756. X denotespositions at which the chemical nature of the base isrelatively unimportant.

tures, summarised in Figure 6. In general theactual sequence of most of the base-pairing hasbeen found to be relatively unimportant, and theterminal helix VIc is almost totally dispensable.This leaves the interruptions in the Watson-Crickbase-pairing, comprising the junction 2-3-6, thetwo base bulges and the internal loop that includesA730. We have previously demonstrated theimportance of the three-way junction as an archi-tectural element, and shown a correlation betweenmutations in the junction that affect its folding,and those that reduce the cleavage activity of thecomplete ribozyme.21 Here, we have further shownthat the folding of this junction has the samecharacteristics in the context of the completeribozyme as it does as an isolated element.

We have now found that the remaining threeelements are also important in the activity of theribozyme. Deletion of the adenine and two-adeninebase bulges in helices II and VI, respectively, leadsto major reduction in substrate cleavage rates.Moving the bulges onto the opposing strand leadsto even larger effects in both cases. However, theexact nature of the bulged bases is generally notimportant. For example, changing the bulged ade-nine of helix II to uridine leads to only a fourfoldloss of activity, and replacement of the two-adenine bulge of helix VI by uridine results in onlya threefold lower cleavage rate. We have observedno loss of activity due to reversal of base-pairs inhelix IIb,21 but insertion of an additional base-pairgave a 180-fold lower cleavage activity; an equival-ent insertion on the other side of the bulge had vir-tually no effect on the cleavage rate in trans. Themain consequence of insertion into helix IIb is arotation of the bulged adenine. All this suggeststhat the bulges are important in determining thestructure of the active ribozyme, but that the basesthemselves are unlikely to be playing a direct rolein the cleavage process. Base bulges in RNA intro-duce local kinking of the axis, thereby changingthe trajectory of the helix.24,25 Removal of the bulgewill therefore alter the overall shape of the mol-ecule, while transfer to the opposing strand willhave an even greater effect. Collectively theseelements determine the global shape of the ribo-zyme, and the disposition of the parts responsiblefor binding the substrate.

The A730 loop exhibits the greatest sensitivity toindividual sequence changes. While the nature ofC755 is relatively unimportant (only replacementby guanine leads to a large rate reduction), eventhe best single-base variants at the remaining pos-itions are impaired by at least a factor of 20 andsome changes lead to 1000-fold reduction inactivity. This indicates that this loop plays a par-ticularly critical role in the activity of the VS ribo-zyme, and we suggest that the A730 loop is animportant component of the active site of the VSribozyme.

Simple molecular modelling suggests that theA730 loop could be well positioned to make adirect interaction with the scissile phosphate group

Figure 7. Illustrative model of substrate loop docked into helices II and VI of the VS ribozyme. Backbone ribbonrepresentation showing the possible arrangement of substrate and active site on the lower junction of the ribozyme.The model was created by manually docking the substrate structure onto the 2-3-6 junction model deduced pre-viously.21 The substrate structure was derived from NMR data from a model substrate (PDB accession code 1E4P),19

and is shorter in helix Ib by two base-pairs compared to the natural substrate. The linker between the substrate andjunction (represented by a grey tube) is three nucleotides in length. The helices are colour coded; green I, magenta II,orange III and blue VI. The A730 loop region is coloured red, and the scissile phosphate group in the substrate isindicated by a magenta sphere.


in helix I, and we have tested this possibility usingmolecular modelling. We have attached the knownstructure of the substrate helix19 to our previouslyestablished geometry for the 2-3-6 junction21

(Figure 7), as it would be in the cis-acting ribozymein the natural VS RNA. While this very simplemodel makes no attempt to represent the trajec-tories of the helical discontinuities, it illustratesthat helix I can be easily located in the narrowangle between helices II and VI, with the cleavagesite located where it can interact with the A730loop. The model immediately suggests an expla-nation of the observation that when the substratestem-loop was reconnected via the 30 end of helixII, cleavage activity was retained.23 The loop ofhelix I is directed towards helix III in the structure,where it could interact with the loop of helix V;18

preliminary data on the structure of the 3-4-5 junc-tion (D.A.L., D.G.N. & D.M.J.L., unpublished data)indicate that this junction should direct helix Vdown towards the loop of helix I.

The 2-3-6 junction plays an important architec-tural role in setting up the correct global confor-mation in which this can occur productively,creating the binding cleft between helices II andVI. Association between the substrate and A730loops should provide a local environment in whichthere is an acceleration of cleavage or ligation in astrand of one loop. This situation is quite similar tothat found in the hairpin ribozyme, where a helicaljunction organises helices resulting in close inter-action between two loops.26 ± 28 Intimate associationbetween the substrate and A730 loop is likely toalter the local structure of each of them. Close

association between the substrate and A730 loopsrequires multiple interactions between the sub-strate and ribozyme. Base-pairing with the loop ofhelix V is likely to be very important and providethe larger part of the binding energy, since nosingle change in helices II or VI leads to more thansevenfold elevation of KM

app. In general, biggerreductions in af®nity are found when the overallgeometry of the ribozyme is affected (notably theremoval of the base bulges in helices II and VI; seeTable 2). Sequence changes in the A730 loop tendto have smaller effects; in these cases it is likelythat the substrate is held by interactions elsewhere,but that the local contacts with the A730 loop aredisrupted. Cleavage of the backboneis only accelerated when these interactions occurcorrectly.

There are a number of ways in which the A730loop might contribute to the catalytic activity inthe VS ribozyme. First, RNA conformation will bea signi®cant factor. Folding of the RNA will berequired to create the local structure appropriate towhatever mechanism generates the catalysis of thetransesteri®cation reaction. It may also play a moredirect role, facilitating the trajectory into an in-linetransition state in which there is an alignment ofthe attacking 20-oxygen, the 30-phosphorus and thedeparting 50-oxygen atoms. However, such anorientation factor is highly unlikely to provide theentire rate enhancement (see discussion by Jenks29),and so other mechanisms must exist in parallel.

Metal ions will also be important. These willundoubtedly play a structural role, and we haveshown that divalent metal ions are required for the


correct folding of the organising 2-3-6 junction,both in isolation and in the context of the completeribozyme. There is also evidence for the binding ofmetal ions within the A730 loop. Phosphorothioateeffects and their reversal by manganese ions havebeen observed in the lower strand of the loop,30

and we have observed uranyl ion-induced photo-cleavage in the same region (C. Hammann, D.A.L.& D.M.J.L. unpublished data). 1H NMR data indi-cate that the structure of the A730 loop is stronglyin¯uenced by magnesium ion binding (C. Ham-mann, D.G.N. & D.M.J.L., unpublished data).Metal ions could also play a direct role in thechemistry, by increasing the nucleophilicity of the20-oxygen atom and in stabilising the charged tran-sition state and the 50-oxyanion leaving group.However, activity of the ribozyme in high concen-trations of monovalent ions suggest that site bind-ing is not indispensable.31

A third possible factor in the generation of cata-lytic activity is the participation of nucleobases ingeneral acid-base catalysis. There is good evidencefor the role of a cytosine base in the HDVribozyme.32,33 In the case of the VS ribozyme,Andersen & Collins22 have identi®ed four nucleo-tides in helix I that are required for high activity.Of these two are involved in the interaction of theloop with that of helix V, and one in base-pair for-mation in the rearranged helix. The remaining gua-nine can be replaced by adenine with retention ofactivity. Thus, no nucleotide in the substrateappears a likely catalyst. However, we proposethat A756 is a good candidate in this role. Cleavageactivity is highly intolerant to any substitution atthis position; it is the only single nucleotide thatexhibits such pronounced sensitivity out of themany that we have examined. Ablation of the basealso leads to severe loss of activity. By contrast, wefound that the activity was relatively insensitive tomodi®cation of the sugar; removal of the 20-hydroxyl group reduced the cleavage rate only bya factor of less than 10. Thus, the importantelement appears to be the nucleobase. The effect ofbase substitution at A756 is largely manifested atthe level of k2, since the af®nities are generally low-ered by a factor of 3.5 or less, corresponding to achange in binding free energy of ��Gbind < 1 kcalmolÿ1. This is con®rmed by the competition exper-iments using the A756 variants, and the measuredKI values. Furthermore, our FRET experimentsshow that the global folding of the ribozyme (withor without stem I) is unaffected by the sequencechange A756G. It therefore appears likely thatA756 plays a direct role in the cleavage reaction,although we cannot exclude the possibility thatthis base effects a critical conformational changenot detected by the FRET experiments. Partici-pation in general acid-base catalysis would requirean elevation of the pKa value of a ring nitrogenatom (probably N1), which might occur within theenvironment of the active site. Further experimentsare in hand to examine these possibilities in greaterdetail.

Materials and Methods

Transcription of RNA

RNA for cleavage activity experiments was syn-thesised by transcription using T7 RNA polymerase34

from double-stranded DNA templates. Templates fortranscription of ribozymes were made by recursive poly-merase chain reactions from synthetic DNA oligonucleo-tides. RNA was puri®ed by electrophoresis in 8 % or20 % (w/v) polyacrylamide gels containing 7 M urea.RNA was recovered from crushed gel slices by elution inwater at 4 �C overnight. Eluted RNA was ®ltered, recov-ered by ethanol-precipitation and dissolved in water.

Analysis of ribozyme cleavage

For most experiments we used the substrate 1 plusribozyme 1 combination,21 based on the sequences (allwritten 50 to 30): substrate sequence, GCGCGAAGGGC-GUCGUCGCCCCGA; ribozyme sequence, GCGGUA-GUAAGCAGGGAACUCACCUCCAAUUUCAGUACU-GAAAUUGUCGUAGCAGUUGACUACUGUUAUGU-GAUUGGUAGAGGCUAAGUGACGGUAUUGGCGUAAGUCAGUAUUGCAGCACAGCACAAGCCCGCUUGCGAGAAU. Sequence variations indicated in the textwere included in the ribozyme sequence for speci®cexperiments.

Ribozyme cleavage reactions were performed usingtrace concentrations (�1 nM) of radioactively (50-32P)-labelled substrate and a large excess of ribozyme (1 mM,except in the ribozyme titration experiment ofFigure 2(c)). Cleavage buffer contained 50 mM Tris-HCl(pH 8.0), 10 mM MgCl2, 25 mM KCl and 2 mM spermi-dine. Substrate and ribozyme were incubated individu-ally in cleavage buffer at 37 �C for 15 minutes and thenmixed to initiate the reaction. Aliquots (2 ml) wereremoved at different times, and quenched by addition of8 ml of 95 % (v/v) formamide, 20 mM EDTA, 0.05 %(w/v) xylene cyanol FF and 0.05 % (w/v) bromophenolblue. Competition experiments were performed inexactly the same way, except that the variant ribozymewas mixed with active, natural-sequence ribozyme at theoutset. Substrate and product were separated by electro-phoresis in a 20 % polyacrylamide gel containing 7 Murea. They were quanti®ed by exposure to a storagephosphor screen and imaging (Fuji BAS-1500). Datawere ®tted to single exponential functions by non-linearregression analysis (Kalaidagraph, Abelbeck Software).

Semi-synthetic ribozyme species

Constructs comprising both transcribed and syntheticRNA strands were used in both cleavage assays and ¯u-orescence experiments (e.g. see Figure 5(a)). The lowerstrand of helices II and VI was made by chemical syn-thesis, introducing modi®ed nucleotides and/or ¯uoro-phores where required. The upper strand (with orwithout stem-loop I) was made by transcription using T7RNA polymerase from a DNA template prepared byrecursive PCR. In order to create a homogeneous 30 ter-minus, an HDV ribozyme (genomic) sequence35 wasincluded in the RNA; this undergoes self cleavageduring the transcription reaction. The ribozyme-producttop strand used in the ¯uorescence experiments includedhammerhead and HDV ribozymes at the 50 and 30 termi-ni, respectively, both of which process during transcrip-tion. The following RNA sequences were prepared, withthe hammerhead and HDV sequences underlined: VS


top strand without substrate, GCGGAAGCAGGGAA-CUCACCUCCAAUUUCAGUACUGAAAUUGUCGUAGCAGUUGACUACUGUUAUGUGAUUGGUAGAGGCUAAGUGACGGUAGUGGAGGCCGGCAUGGUCCCAGCCUCCUCGCUGGCGCCGGCUGGGCAACAUUCUUCGGAAUGGCGAAUGGGACC; VS top strandincluding substrate, GCGCGAAGGGCGUCGUCGCCCCGACCCGUUGGAAGCAGGGAACUCACCUCCAAUUUCAGUACUGAAAUUGUCGUAGCAGUUGACUA-CUGUUAUGUGAUUGGUAGAGGCUAAGUGACGGUAGUGGAGGCCGGCAUGGUCCCAGCCUCCUCGCUGGCGCCGGCUGGGCAACAUUCUUCGGAAUGGCGAAUGGGACC; VS top strand including product, GCGGGCGACGACGCCCUUCUGAUGAGGCCGAAAGGCCGAAACUCGUAAGAGUCAAGGGCGUCGUCGCCCCGACCCGUUGGAAGCAGGGAACUCACCUCCAAUUUCAGUACUGAAAUUGUCGUAGCAGUUGACUACUGUUAUGUGAUUGGUAGAGGCUAAGUGACGGUAGUGGAGGCCGGCAUGGUCCCAGCCUCCUCGCUGGCGCCGGCUGGGCAACAUUCUUCGGAAUGGCGAAUGGGACC.

The processed VS RNA in each case was puri®ed bygel electrophoresis in polyacrylamide and electroelution.

Cleavage experiments using semi-synthetic ribozyme

Cleavage experiments in trans were performed using1 mM each of the transcribed top strand (minus sub-strate) and synthetic lower strand, together with a traceamount of radioactively (50-32P)-labelled substrate. Clea-vage kinetics were measured using the proceduredescribed above. The reaction was started by addition of10 mM MgCl2.

RNA synthesis and preparation of RNA constructs

DNA, RNA and mixed DNA-RNA oligonucleotideswere synthesised using phosphoramidite chemistry.36 Anabasic site was created by coupling a deoxyribose phos-phoramidite (Glen), and the ¯uorophores 20deoxyuracil-5-¯uorescein and Cy3 were coupled as phosphoramidites(Glen). Synthesis and puri®cation were performed asdescribed by Bassi et al.,37 except that the base deprotec-tion in ammonia/ethanol (3:1, v/v) was carried out for®ve hours at 55 �C. Constructs were prepared by incu-bating stoichiometric amounts of the oligonucleotides in90 mM Tris-borate (pH 8.3), 25 mM NaCl for ten min-utes at 80 �C, followed by slow cooling. The hybridisedspecies were puri®ed by electrophoresis in a polyacryl-amide gel at 4 �C for 22 hours at 120 V. The buffer sys-tem contained 90 mM Tris-borate (pH 8.3), 25 mM NaCland was recirculated at >1 l/hour. Fluorescent specieswere visualised by exposure to a Dark Reader transillu-minator (Clare Chemical Research). The bands wereexcised, the RNA electroeluted into 8 M ammoniumacetate and recovered by ethanol-precipitation.

Fluorescence spectroscopy

Fluorescence spectroscopy was performed on an SLM-Aminco 8100 ¯uorimeter, and spectra were corrected forlamp ¯uctuations and instrumental variations asdescribed.38 Polarisation artifacts were avoided by cross-ing excitation and emission polarisers at 54.74 �. Valuesof EFRET were measured using the acceptor normalisationmethod39,40 described.41 Data from magnesium iontitrations were analysed on the basis of a two-statemodel for ion-induced folding. The change in FRET ef®-

ciency on magnesium ion binding (�EFRET ) was ®tted tothe equation:

�EFRET � �EFRET�folded� ÿ EFRET�unfolded�� KA � �Mg2��n=�1� KA �Mg2��n�

�3�

by non-linear regression, where KA is the apparentassociation constant for magnesium ions and n is a Hillcoef®cient. The magnesium ion concentration at whichthe transition is half complete ([Mg2�]1/2 ) is given by(1/KA)1/n.

The synthetic lower strand used in the constructs forFRET experiments had the sequence: Cy3-TCCA-CUACCGCAGCACAGCACAAGCCCGCUUCCFT; with20-deoxyribonucleotides underlined; F denotes 5-¯uor-escein-20deoxyuracil.

Acknowledgements

We thank Martha Fedor for discussion of kinetics, ourcolleagues Chris Hammann and Franck Coste for discus-sion, Z. Zhao and Kaera Maxwell for chemical synthesisof RNA, the Cancer Research Campaign for ®nancialsupport and EMBO for the award of a fellowship (toD.A.L.).

References

1. Cech, T. R. & Herschlag, D. (1996). Group I ribo-zymes: substrate recognition, catalytic strategies andcomparative mechanistic analysis. In RNA Catalysis(Eckstein, F. & Lilley, D. M. J., eds), vol. 10, pp.1-17, Springer-Verlag, Heidelberg.

2. Michel, F. & Ferat, J. L. (1995). Structure and activi-ties of group II introns. Annu. Rev. Biochem. 64, 435-461.

3. Guerrier-Takada, C., Gardiner, K., Marsh, T., Pace,N. & Altman, S. (1983). The RNA moiety of ribo-nuclease P is the catalytic subunit of the enzyme.Cell, 35, 849-857.

4. Forster, A. C. & Symons, R. H. (1987). Self-cleavageof plus and minus RNAs of a virusoid and a struc-tural model for the active sites. Cell, 49, 211-220.

5. Hazeloff, J. P. & Gerlach, W. L. (1988). Simple RNAenzymes with new and highly speci®c endoribonu-clease activities. Nature, 334, 585-591.

6. Buzayan, J. M., Gerlach, W. L. & Bruening, G.(1986). Non-enzymatic cleavage and ligation ofRNAs complementary to a plant virus satelliteRNA. Nature, 323, 349-353.

7. Feldstein, P. A., Buzayan, J. M. & Bruening, G.(1989). Two sequences participating in the autolyticprocessing of satellite tobacco ringspot virus comp-lementary RNA. Gene, 82, 53-61.

8. Hampel, A. & Tritz, R. (1989). RNA catalytic proper-ties of the minimum (ÿ)sTRSV sequence. Biochemis-try, 28, 4929-4933.

9. Sharmeen, L., Kuo, M. Y., Dinter-Gottlieb, G. &Taylor, J. (1988). Antigenomic RNA of human hepa-titis delta virus can undergo self-cleavage. J. Virol.62, 2674-2679.

10. Gordon, P. M., Sontheimer, E. J. & Piccirilli, J. A.(2000). Metal ion catalysis during the exon-ligationstep of nuclear pre-mRNA splicing: extending the


parallels between the spliceosome and group IIintrons. RNA, 6, 199-205.

11. Yean, S. L., Wuenschell, G., Termini, J. & Lin, R. J.(2000). Metal-ion coordination by U6 small nuclearRNA contributes to catalysis in the spliceosome.Nature, 408, 881-884.

12. Nissen, P., Hansen, J., Ban, N., Moore, P. B. &Steitz, T. A. (2000). The structural basis of ribosomeactivity in peptide bond synthesis. Science, 289, 920-930.

13. Lilley, D. M. J. (1999). Structure, folding and cataly-sis in the small nucleolytic ribozymes. Curr. Opin.Struct. Biol. 9, 330-338.

14. Guo, H. C., De Abreu, D. M., Tillier, E. R., Saville,B. J., Olive, J. E. & Collins, R. A. (1993). Nucleotidesequence requirements for self-cleavage of Neuro-spora VS RNA. J. Mol. Biol. 232, 351-361.

15. Kennell, J. C., Saville, B. J., Mohr, S., Kuiper, M. T.,Sabourin, J. R., Collins, R. A. & Lambowitz, A. M.(1995). The VS catalytic RNA replicates by reversetranscription as a satellite of a retroplasmid. GenesDev. 9, 294-303.

16. Beattie, T. L., Olive, J. E. & Collins, R. A. (1995).A secondary-structure model for the self-cleavingregion of Neurospora VS RNA. Proc. Natl Acad. Sci.USA, 92, 4686-4690.

17. Guo, H. C. T. & Collins, R. A. (1995). Ef®cienttrans-cleavage of a stem-loop RNA substrate by aribozyme derived from Neurospora VS RNA. EMBOJ. 14, 368-376.

18. Rastogi, T., Beattie, T. L., Olive, J. E. & Collins, R. A.(1996). A long-range pseudoknot is required foractivity of the Neurospora VS ribozyme. EMBO J. 15,2820-2825.

19. Michiels, P. J. A., Schouten, C. H. J., Hilbers, C. W.& Heus, H. A. (2000). Structure of the ribozyme sub-strate hairpin of Neurospora VS RNA: a close look atthe cleavage site. RNA, 6, 1821-1832.

20. Flinders, J. & Dieckmann, T. (2001). A pH controlledconformational switch in the cleavage site of the VSribozyme substrate RNA. J. Mol. Biol. 308, 665-679.

21. Lafontaine, D. A., Norman, D. G. & Lilley, D. M. J.(2001). Structure, folding and activity of the VS ribo-zyme: importance of the 2-3-6 helical junction.EMBO J. 20, 1415-1424.

22. Andersen, A. A. & Collins, R. A. (2000). Rearrange-ment of a stable RNA secondary structure duringVS ribozyme catalysis. Mol. Cell, 5, 469-478.

23. Rastogi, T. & Collins, R. A. (1998). Smaller, fasterribozymes reveal the catalytic core of Neurospora VSRNA. J. Mol. Biol. 277, 215-224.

24. Bhattacharyya, A., Murchie, A. I. H. & Lilley, D. M. J.(1990). RNA bulges and the helical periodicity ofdouble-stranded RNA. Nature, 343, 484-487.

25. Tang, R. S. & Draper, D. E. (1990). Bulge loops usedto measure the helical twist of RNA in solution.Biochemistry, 29, 5232-5237.

26. Murchie, A. I. H., Thomson, J. B., Walter, F. &Lilley, D. M. J. (1998). Folding of the hairpin ribo-zyme in its natural conformation achieves closephysical proximity of the loops. Mol. Cell, 1, 873-881.

27. Walter, N. G., Burke, J. M. & Millar, D. P. (1999).Stability of hairpin ribozyme tertiary structure isgoverned by the interdomain junction. Nature Struct.Biol. 6, 544-549.

28. Rupert, P. B. & FerreÂ-D'AmareÂ, A. R. (2001). Crystalstructure of a hairpin ribozyme-inhibitor complexwith implications for catalysis. Nature, 410, 780-786.

29. Jenks, W. P. (1987). Catalysis in Chemistry and Enzy-mology, 2nd edit., pp. 1-836, Dover Publications Inc.,New York.

30. Sood, V. D., Beattie, T. L. & Collins, R. A. (1998).Identi®cation of phosphate groups involved in metalbinding and tertiary interactions in the core of theNeurospora VS ribozyme. J. Mol. Biol. 282, 741-750.

31. Murray, J. B., Seyhan, A. A., Walter, N. G., Burke,J. M. & Scott, W. G. (1998). The hammerhead, hair-pin and VS ribozymes are catalytically pro®cient inmonovalent cations alone. Chem. Biol. 5, 587-595.

32. Nakano, S., Chadalavada, D. M. & Bevilacqua, P. C.(2000). General acid-base catalysis in the mechanismof a hepatitis delta virus ribozyme. Science, 287,1493-1497.

33. Perrotta, A. T., Shih, I. & Been, M. D. (1999). Imida-zole rescue of a cytosine mutation in a self-cleavingribozyme. Science, 286, 123-126.

34. Milligan, J. F., Groebe, D. R., Witherall, G. W. &Uhlenbeck, O. C. (1987). Oligoribonucleotide syn-thesis using T7 RNA polymerase and syntheticDNA templates. Nucl. Acids Res. 15, 8783-8798.

35. Perrotta, A. T. & Been, M. D. (1991). A pseudoknot-like structure required for ef®cient self-cleavage ofhepatitis delta virus RNA. Nature, 350, 434-436.

36. Beaucage, S. L. & Caruthers, M. H. (1981). Deoxy-nucleoside phosphoramidites - a new class of keyintermediates for deoxypolynucleotide synthesis.Tetrahedron Letters, 22, 1859-1862.

37. Bassi, G., Mùllegaard, N. E., Murchie, A. I. H.,von Kitzing, E. & Lilley, D. M. J. (1995). Ionicinteractions and the global conformations of thehammerhead ribozyme. Nature Struct. Biol. 2, 45-55.

38. Bassi, G. S., Murchie, A. I. H., Walter, F., Clegg,R. M. & Lilley, D. M. J. (1997). Ion-induced foldingof the hammerhead ribozyme: a ¯uorescence reson-ance energy transfer study. EMBO J. 16, 7481-7489.

39. Clegg, R. M. (1992). Fluorescence resonance energytransfer and nucleic acids. Methods Enzymol. 211,353-388.

40. Murchie, A. I. H., Clegg, R. M., von Kitzing, E.,Duckett, D. R., Diekmann, S. & Lilley, D. M. J.(1989). Fluorescence energy transfer shows that thefour-way DNA junction is a right-handed cross ofantiparallel molecules. Nature, 341, 763-766.

41. Lilley, D. M. J. (2000). Analysis of the global confor-mation of branched RNA species by a combinedelectrophoresis and ¯uorescence approach. MethodsEnzymol. 317, 368-393.

42. Norman, D. G., Grainger, R. J., Uhrin, D. & Lilley,D. M. J. (2000). The location of Cyanine-3 ondouble-stranded DNA; importance for ¯uorescenceresonance energy transfer studies. Biochemistry, 39,6317-6324.

Edited by J. Karn

(Received 18 June 2001; received in revised form 1 August 2001; accepted 1 August 2001)

The A730 loop is an important component of the active site of the VS ribozyme

Documents

Transcript of The A730 loop is an important component of the active site of the VS ribozyme