The a nkyrin -like protein A nkB interact s with CatB, affects …€¦ · 129 was used in this...
Transcript of The a nkyrin -like protein A nkB interact s with CatB, affects …€¦ · 129 was used in this...
![Page 1: The a nkyrin -like protein A nkB interact s with CatB, affects …€¦ · 129 was used in this study (33). The whole genome sequence s of KACC 1033 1 and 130 BLS256 wer e used as](https://reader033.fdocuments.in/reader033/viewer/2022043018/5f3ab558bf686253d02ce05b/html5/thumbnails/1.jpg)
The ankyrin-like protein AnkB interacts with CatB, affects 1
catalase activity, and enhances resistance of Xanthomonas 2
oryzae pv. oryzae and Xanthomonas oryzae pv. oryzicola to 3
phenazine-1-carboxylic acid 4
Xiayan Pan, Shu Xu, Jian Wu, Yabing Duan, Zhitian Zhen, Jianxin Wang, Xiushi 5
Song and Mingguo Zhou 6
CORRESPONDENT FOOTNOTE 7
College of Plant Protection, State & Local Joint Engineering Research Center of 8
Green Pesticide Invention and Application, Nanjing Agricultural University, Nanjing, 9
210095, China. 10
Present Address: Nanjing Agricultural University, Nanjing 210095, China 11
Phone: 086-25-84395641; Fax: 086-25-84395641; 12
Corresponding author: Mingguo Zhou, E-mail: [email protected] 13
Keywords: ankB, catB, catalase activity, Xanthomonas oryzae pv. oryzae, 14
Xanthomonas oryzae pv. oryzicola, phenazine-1-carboxylic acid, oxidative stress 15
ABSTRACT 16
Xanthomonas oryzae pv. oryzae (Xoo), which causes rice bacterial leaf blight, and 17
Xanthomonas oryzae pv. oryzicola (Xoc), which causes rice bacterial leaf streak, are 18
important plant-pathogenic bacteria. A member of adaptor proteins family, ankyrin 19
protein, was largely investigated in humans, but rarely in plant-pathogenic bacteria. In 20
this study, a novel ankyrin-like protein, AnkB, was identified in Xoo and Xoc. The 21
expression of ankB was significantly up-regulated when these bacteria were treated 22
AEM Accepted Manuscript Posted Online 27 November 2017Appl. Environ. Microbiol. doi:10.1128/AEM.02145-17Copyright © 2017 American Society for Microbiology. All Rights Reserved.
on August 17, 2020 by guest
http://aem.asm
.org/D
ownloaded from
![Page 2: The a nkyrin -like protein A nkB interact s with CatB, affects …€¦ · 129 was used in this study (33). The whole genome sequence s of KACC 1033 1 and 130 BLS256 wer e used as](https://reader033.fdocuments.in/reader033/viewer/2022043018/5f3ab558bf686253d02ce05b/html5/thumbnails/2.jpg)
with phenazine-1-carboxylic acid (PCA). ankB is located 58 bp downstream of the 23
gene catB (which encodes a catalase) in both bacteria, and the gene expression of 24
catB and catalase activity were reduced following ankB deletion in Xoo and Xoc. 25
Furthermore, we demonstrated that AnkB directly interacts with CatB by 26
Gluthathione-S-transferase (GST) pull-down assays. Deletion of ankB increased Xoo 27
and Xoc sensitivity to H2O2 and PCA, decreased bacterial biofilm formation, 28
swimming ability and EPS production, and also reduced virulence on rice. Together 29
our results indicate that the ankyrin-like protein AnkB has important and conserved 30
roles in antioxidant systems and pathogenicity in Xoo and Xoc. 31
IMPORTANCE 32
This study demonstrates that ankyrin protein AnkB directly interacted with catalase 33
CatB in Xanthomonas oryzae pv. oryzae and Xanthomonas oryzae pv. oryzicola. 34
Ankyrin protein AnkB can affect the gene expression of catB, catalase activity and 35
sensitivity to H2O2. In Xanthomonas spp., the location of genes ankB and catB, and 36
the amino acid sequence of AnkB are highly conserved. It’s suggested that, in 37
prokaryotes, AnkB plays a conserved role in the defense against oxidative stress. 38
INTRODUCTION 39
Rice bacterial leaf blight caused by Xanthomonas oryzae pv. oryzae (Xoo) and rice 40
bacterial leaf streak caused by Xanthomonas oryzae pv. oryzicola (Xoc) are important 41
diseases of rice worldwide (1, 2). These diseases, which can reduce yields by 75 % or 42
more (3, 4, 5), can be controlled by phenazine-1-carboxylic acid (PCA), an antibiotic 43
produced by not only Pseudomonas spp., but also plant-associated bacteria, such as 44
on August 17, 2020 by guest
http://aem.asm
.org/D
ownloaded from
![Page 3: The a nkyrin -like protein A nkB interact s with CatB, affects …€¦ · 129 was used in this study (33). The whole genome sequence s of KACC 1033 1 and 130 BLS256 wer e used as](https://reader033.fdocuments.in/reader033/viewer/2022043018/5f3ab558bf686253d02ce05b/html5/thumbnails/3.jpg)
Burkholderia, Pectobacterium, Brevibacterium, Streptomyces and others (6, 7, 8, 9, 45
10). In vitro anti-bacterial activity of PCA against Xoo and Xoc has been documented, 46
and PCA has recently been used to control rice bacterial leaf streak in South China 47
fields (11, 12, 13). In addition to being toxic to bacteria, PCA is also toxic to 48
eukaryotes, as it causes the accumulation of reactive oxide species (ROS). The 49
mechanism underlying the toxicity of PCA to bacteria is incompletely understood (12, 50
14). The current study concerns the involvement of an ankyrin-like protein in the 51
responses of Xoo and Xoc to PCA. 52
Ankyrins belong to the family of adaptor proteins that anchor the cytoskeleton to the 53
plasma membrane and thereby provide cellular stability in eukaryotic cells (15, 16). 54
Ankyrins, have three domains: an N-terminal membrane-binding domain, a central 55
spectrin-binding domain, and a C-terminal regulatory domain (17, 18). Ankyrins are 56
widespread in eukaryotes but are uncommon in prokaryotes (19). Most research 57
concerning ankyrins has been conducted in humans because a variety of human 58
diseases are related to the dysfunction of ankyrin proteins (20). Functional analysis 59
confirmed that ankyrins have a regulatory or structural role rather than an enzymatic 60
one (21). Ankyrins in plants are involved in defense responses to reactive oxygen 61
species (ROS) and in regulating the hypersensitive reaction (HR) (22). 62
Overexpression of the ankyrin repeat-containing protein OsBIANK1 in Arabidopsis 63
decreases ROS levels after infection by Botrytis cinerea (23). Ankyrins are also 64
necessary for regulating cell motility, adhesion, and the maintenance of specialized 65
membrane domains, ion channels, and transporters (20, 24, 25). They are also 66
on August 17, 2020 by guest
http://aem.asm
.org/D
ownloaded from
![Page 4: The a nkyrin -like protein A nkB interact s with CatB, affects …€¦ · 129 was used in this study (33). The whole genome sequence s of KACC 1033 1 and 130 BLS256 wer e used as](https://reader033.fdocuments.in/reader033/viewer/2022043018/5f3ab558bf686253d02ce05b/html5/thumbnails/4.jpg)
involved in intra-cellular signaling, such as regulating the transcription factor NF-κB 67
to influence gene expression (26). Together, these studies demonstrate that ankyrins 68
have a variety of functions. 69
In bacteria, genes encoding predicted ankyrin-like proteins are often located in close 70
proximity to genes encoding proteins involved in responses to oxidative stress (27, 28, 71
29). The Cj1386 gene encoding an ankyrin-containing protein is located downstream 72
from katA (which encodes a catalase) and is involved in the same detoxification 73
pathway as catalase in Campylobacter jejuni (30). In Pseudomonas aeruginosa, the 74
ankyrin AnkB is required for the detoxification of H2O2 by catalase (KatB) (29). In 75
our previous study, CatB was the key protein for total catalase activity and reduced 76
bactericidal effects of PCA on Xoo and Xoc (31). Similarly, the gene encoding the 77
ankyrin protein AnkB is also located downstream from the gene encoding CatB 78
(catalase) in these two strains. The ankyrins and their functions in the 79
plant-pathogenic bacteria have not been characterized. In addition, there are no 80
reports concerning interactions between ankyrins and catalases in any other species. 81
Therefore, investigation is warranted to resolve whether AnkB is required for catalase 82
activity in Xoo and Xoc in response to PCA, and, if it does, whether the two proteins 83
directly interact. 84
In this study, we cloned the gene ankB, which encodes an ankyrin-like protein in Xoo 85
and Xoc, and investigated the role of AnkB when the two bacteria are under oxidative 86
stress. Our study also revealed the relationship between AnkB and CatB and the 87
functions of AnkB involved in protecting cells from PCA and regulating the virulence 88
on August 17, 2020 by guest
http://aem.asm
.org/D
ownloaded from
![Page 5: The a nkyrin -like protein A nkB interact s with CatB, affects …€¦ · 129 was used in this study (33). The whole genome sequence s of KACC 1033 1 and 130 BLS256 wer e used as](https://reader033.fdocuments.in/reader033/viewer/2022043018/5f3ab558bf686253d02ce05b/html5/thumbnails/5.jpg)
of both bacteria. 89
MATERIALS AND METHODS 90
Strains, plasmids, bactericides, and media. All strains and plasmids used in this 91
study are listed in Table 1. ZJ173 and RS105, the wild-type strain of Xoo and Xoc 92
used in this study, respectively, are commonly used in China (12). Xoo and Xoc strains 93
were grown at 28°C in nutrient broth (NB) medium consisting of 1 μg/mL yeast 94
extract, 3 μg/mL beef extract, 5 μg/mL polypeptone, and 10 μg/mL sucrose. NA 95
medium contained the same components plus 12 μg/mL agar powder. Minimal (MMX) 96
medium at pH 7.0 contained 0.2 μg/mL MgSO4•7H2O, 5 μg/mL glucose, 2 μg/mL 97
(NH4)2SO4, 4 μg/mL K2HPO4, 6 μg/mL KH2PO4, and 1 μg/mL trisodium citrate. E. 98
coli strains were grown at 37°C. E. coli DH5α (Vazyme), which was used in vector 99
construction, was cultured in LB medium containing 50 μg/mL kanamycin. E. coli 100
Rosetta (TIANGEN Biotech, Beijing, China) was used in protein expression and was 101
cultured in LB medium containing 100 μg/mL ampicillin, 20 µg/ml gentamicin, and 102
50 μg/mL of kanamycin. Phenazine-1-carboxylic acid (98% PCA) was provided by 103
Shanghai Nongle Biological Products Co., Ltd. (China) and was dissolved in acetone 104
as a stock solution. 105
Determination of gene expression of ankB and catB in Xoo and Xoc. Gene 106
expression of ankB and catB in ZJ173 and RS105 was detected with real-time PCR. 107
Before doing the qRT-PCR experiment, we did a pre-experiment with a concentration 108
gradient of PCA and selected the concentration at which the gene expression changed 109
most obviously but growth was not inhibited. For ZJ173 it was 4 μg/mL and for 110
on August 17, 2020 by guest
http://aem.asm
.org/D
ownloaded from
![Page 6: The a nkyrin -like protein A nkB interact s with CatB, affects …€¦ · 129 was used in this study (33). The whole genome sequence s of KACC 1033 1 and 130 BLS256 wer e used as](https://reader033.fdocuments.in/reader033/viewer/2022043018/5f3ab558bf686253d02ce05b/html5/thumbnails/6.jpg)
RS105 it was 32 μg/mL (as well as the following experiments performed in this study). 111
To perform qRT-PCR, all tested strains were grown to early logarithmic phase at an 112
OD600 of 0.2 (2×108 cfu/mL) in NB medium at 28°C with shaking at 175 rpm. A 113
25-mL culture was then treated with 100 μL of different concentrations of PCA. After 114
incubating for approximately 4 h when the OD600 ≈ 0.5 (5×108 cfu/mL), the cultures 115
were harvested by centrifugation (12,000×g for 2 min at 4°C). Total RNA was 116
extracted with the RNAprep pure cell / bacteria kit (TIANGEN Biotech, Beijing, 117
China) and reverse transcribed into cDNA with the HiScript II Q RT SuperMix for 118
qPCR (+gDNA wiper) Kit (Vazyme, Nanjing, China) according to the instruction 119
manual. qRT-PCR was conducted using SYBR qPCR Master mix (Vazyme, Nanjing, 120
China) with a CFX ConnectTM
Real-Time System (BIO-RAD, California, USA). Gene 121
expression of ankB and catB in XOO0418 (ankB), XOO0417 (catB), XOC_4324 122
(ankB), and XOC_4325 (catB) was assessed, and 16S rRNA was used as the internal 123
control. The primers are listed in Table 1. Three biological replicates were conducted 124
in this experiment, each repeated three times. 125
Generation of ankB deletion mutants in Xoo and Xoc. We used a non-marker 126
homologous recombination method (32) to generate the deletion mutants in order to 127
investigate the functions of AnkB in Xoo and Xoc. The suicide vector pk18mobsacB 128
was used in this study (33). The whole genome sequences of KACC 10331 and 129
BLS256 were used as reference sequences for ZJ173 and RS105, respectively. The 130
genomic DNAs of ZJ173 and RS105 were used as the templates to amplify the 131
upstream and downstream fragments of ankB. The primers for all upstream and 132
on August 17, 2020 by guest
http://aem.asm
.org/D
ownloaded from
![Page 7: The a nkyrin -like protein A nkB interact s with CatB, affects …€¦ · 129 was used in this study (33). The whole genome sequence s of KACC 1033 1 and 130 BLS256 wer e used as](https://reader033.fdocuments.in/reader033/viewer/2022043018/5f3ab558bf686253d02ce05b/html5/thumbnails/7.jpg)
downstream fragments are listed in Table 1. ZJ173 and RS105 competent cells were 133
transformed with the recombinant plasmids listed in Table 1 using an electroporation 134
method (34), and the cells were subsequently screened on NAN plates (NA medium 135
without sucrose) containing 20 μg/mL kanamycin. Single colonies were picked and 136
added to 25 mL of NBN medium (NB medium without sucrose). After 7-9 h 137
incubation at 28°C, 120 μL of the suspension was spread on NAS plates (NA medium 138
containing 100 μg/mL sucrose). The constructs were subsequently confirmed by PCR 139
and qRT-PCR using the primers listed in Table 1. The confirmed mutants were used in 140
further studies. Complemented mutants were constructed using plasmid pUFR034. 141
The whole sequences of ankB (including predicted promoters) were amplified from 142
genomic DNA of ZJ173 and RS105 with the primers listed in Table 1. The prediction 143
of promoter sequences and electroporation methods were previously described (35). 144
Determination of growth rate in NB medium 145
All tested strains were cultured to an OD600 of 1.0 (109 cfu/mL) in NB medium at 146
28 °C with shaking at 175 rpm. Bacterial cells were then collected by centrifugation 147
(4,000 × g for 2 min) from 2 mL of culture. The cells were re-suspended in 2-mL of 148
fresh NB medium. A 2-mL volume of cell resuspension of the Xoo wild-type strain 149
ZJ173 and its ankB mutant was added to 100 mL of NB medium. A 1.2-mL volume of 150
cell resuspension of Xoc wild-type strain RS105 and its ankB mutant was added to 151
100 mL of NB medium. The cultures were then grown at 28 °C with shaking at 175 152
rpm. The OD600 values were determined using an Eppendorf BioPhotometer Plus 153
every 2 h during 12 h of incubation. 154
on August 17, 2020 by guest
http://aem.asm
.org/D
ownloaded from
![Page 8: The a nkyrin -like protein A nkB interact s with CatB, affects …€¦ · 129 was used in this study (33). The whole genome sequence s of KACC 1033 1 and 130 BLS256 wer e used as](https://reader033.fdocuments.in/reader033/viewer/2022043018/5f3ab558bf686253d02ce05b/html5/thumbnails/8.jpg)
Determination of catalase activity. All tested strains were cultured to an OD600 of 155
0.5 (5×108 cfu/mL) in NB medium at 28 °C with shaking at 175 rpm. Bacterial cells 156
were then collected from 2 mL of culture by centrifugation (8,000 × g for 2 min at 157
4°C), and were re-suspended in 200 μL of Western and IP Cell Lysis Liquid 158
(Beyotime, China). The supernatant was collected by centrifugation (8,000 × g for 2 159
min at 4°C) after 30 min of incubation. The protein concentrations were determined 160
with the BCA Protein Concentration Determination Kit (Beyotime, China). Total 161
catalase activities were then determined with the Catalase Test Kit (Beyotime, China). 162
Each sample was assayed three times, and three independent experiments were carried 163
out. The results were analyzed with SPSS 20.0 (independent-sample t-tests). 164
Expression and purification of proteins. The full-length of ankB and catB of Xoo 165
ZJ173 and Xoc RS105 were amplified by primers (Table S1). catB was ligated into 166
vector pGEX-2TK for GST-tagged protein expression, and ankB was ligated into 167
vector pET-28a for His-tagged protein expression. All recombinant vectors were used 168
to transform the E. coli Rosetta strain, and cells were collected by centrifugation 169
(5000 × g for 15 min at 4°C) after induction for 12-16 h in LB medium containing 0.1 170
mM IPTG. The cells were re-suspended in 15 mL of 1×extraction buffer (50 mM Tris, 171
100 mM NaCl, 1 mM EDTA, and 1 mM DTT) and were subjected to ultrasonication 172
after addition of 40 μL of lysozyme. The precipitate was removed by centrifugation 173
(10000 × g for 60 min at 4°C), and the supernatant was stored at -80°C. 174
GST pull-down assay and western blotting. The GST-labeled proteins were 175
incubated with Glutathione Sepharose beads (Beyotime, China). The proteins retained 176
on August 17, 2020 by guest
http://aem.asm
.org/D
ownloaded from
![Page 9: The a nkyrin -like protein A nkB interact s with CatB, affects …€¦ · 129 was used in this study (33). The whole genome sequence s of KACC 1033 1 and 130 BLS256 wer e used as](https://reader033.fdocuments.in/reader033/viewer/2022043018/5f3ab558bf686253d02ce05b/html5/thumbnails/9.jpg)
by the Glutathione Sepharose beads were mixed with 900 μL of His6-tagged proteins. 177
Bound proteins were analyzed by SDS-PAGE and detected by western analysis using 178
a previously reported method (36). Briefly, proteins were transferred to a PVDF 179
membrane that had been soaked in methanol for 3-5 minutes. The membrane was then 180
placed in 5% skim milk for 1 h before primary anti-GST (1:8000, Sigma-Aldrich) or 181
anti-His (1:5000, Sigma-Aldrich) antibodies were added to probe the resulting blots. 182
The preparation was kept at room temperature for 90 min. Then added second 183
antibodies HRP-conjugated goat anti-rabbit (1:10000, Sigma-Aldrich) or anti-mouse 184
(1:10000, Sigma-Aldrich) and incubated at room temperature for 60 min to detect the 185
blots. Finally, the resulting blots were developed using the ECL Substrate Kit 186
(Thermo Scientific, USA). 187
Determination of H2O2 sensitivity. All tested strains were cultured to an OD600 of 1.0 188
(109 cfu/mL) in NB medium, and suspensions were diluted 3-fold and 9-fold in NB 189
medium. NA plates containing 0, 0.05, 0.1, or 0.2 mM H2O2 were also prepared. A 190
5-µL volume of the undiluted or diluted cultures was spotted onto NA plates (in 191
triplicate), and the plates were kept for 48 h at 28 °C (31). H2O2 sensitivity was 192
assessed based on colony growth. This experiment was repeated three times. 193
Determination of PCA sensitivity. All tested strains were grown to an OD600 of 1.0 194
(109 cfu/mL) at 28 °C with shaking at 175 rpm in NB medium, and the bacterial 195
suspensions were adjusted to an OD600 of 0.2 with fresh NB medium. A 120-μL 196
volume of the diluted bacterial suspension was then added to 25 mL of fresh NB 197
medium containing PCA at 0, 0.025, 0.05, 0.1, 0.2, 0.4, or 0.8 μg/mL for the Xoo 198
on August 17, 2020 by guest
http://aem.asm
.org/D
ownloaded from
![Page 10: The a nkyrin -like protein A nkB interact s with CatB, affects …€¦ · 129 was used in this study (33). The whole genome sequence s of KACC 1033 1 and 130 BLS256 wer e used as](https://reader033.fdocuments.in/reader033/viewer/2022043018/5f3ab558bf686253d02ce05b/html5/thumbnails/10.jpg)
suspension or containing PCA at 0, 1, 2, 4, 8, 16, or 32 μg/mL for the Xoc suspension; 199
the final acetone concentration was 0.4% v/v in all cases. Three replicates for each 200
PCA concentration were used for each strain. Bacterial cultures were grown at 28 °C 201
with shaking at 175 rpm for 36 h for Xoo and for 24 h for Xoc. For each strain, the 202
average OD600 values were used to calculate the PCA concentration that resulted in 203
50% inhibition of bacterial cell growth (EC50). The EC50 values were calculated with 204
the Data Processing System (DPS) computer program (Hangzhou Reifeng 205
Information Technology Ltd., Hangzhou, China). Each sample was assayed three 206
times, and the experiment was repeated three times. 207
Biofilm formation, swimming ability and EPS production assays. For biofilm 208
formation, bacterial strains were grown in NB medium at 28°C with shaking at 175 209
rpm until an OD600 of 0.6 (6×108 cfu/mL) was attained. A 50-μL volume of each 210
culture was transferred to a glass tube containing 2 mL of fresh NB medium, and the 211
tubes were kept at 28°C. The cultures were removed after 5 d for Xoo and 3 d for Xoc. 212
Two mL of 1% (w/v) crystal violet was added to each tube, and the tubes were 213
incubated for 15 min at room temperature. The unbound dye was removed by washing 214
with water, and the tubes were air dried and then photographed. For quantification, 215
the bound dyes were dissolved in ethanol, and the OD590 of the samples was measured. 216
Each strain was assayed three time, and the experiment was repeated three times. 217
To assay swimming ability, bacterial strains were grown in NB medium at 28°C 218
with shaking (175 rpm) until an OD600 of 1.0 (109 cfu/mL) was attained. Cells were 219
collected by centrifugation and were re-suspended in water. A 2-µL volume of each 220
on August 17, 2020 by guest
http://aem.asm
.org/D
ownloaded from
![Page 11: The a nkyrin -like protein A nkB interact s with CatB, affects …€¦ · 129 was used in this study (33). The whole genome sequence s of KACC 1033 1 and 130 BLS256 wer e used as](https://reader033.fdocuments.in/reader033/viewer/2022043018/5f3ab558bf686253d02ce05b/html5/thumbnails/11.jpg)
suspension was added to swim plates (peptone 0.3 g/L; yeast extract 0.3 g/L; agar 2.5 221
g/L) (37), and the plates were kept at 28°C. The swimming ability zone as indicated 222
by colony morphology was measured after 3 d for Xoo and after 2 d for Xoc. For EPS 223
production, a 500-µL volume of each cell suspension was added to 25-mL of fresh 224
NB medium and then cultured for 5 d at 28°C in shaking flasks (175 rpm). The 225
culture densities of all test strains were normalized because the initial concentration of 226
bacteria was equal and the growth rate in NB medium was also the same. The 227
bacterial cells were harvested by centrifugation (8000 rpm, 10 min), and a 3-fold 228
volume of 95 % ethanol was added to the supernatant. The supernatant was stored 229
overnight and then centrifuged (8000 rpm, 10 min) again (38). The pellet, which 230
consisted of EPS, was dried at 60°C to a constant weight (39). Carbohydrates were 231
not quantified in media controls since the volume of NB medium was the same 232
(25-mL) for every test strain. Each EPS assay was replicated three times, and the 233
experiments were repeated three times. 234
Pathogenicity assay. The susceptible rice cultivar IR24 was used for pathogenicity 235
assays, and was conducted in a lighted growth chamber at 25 °C. The rice cultivar 236
was inoculated with bacterial suspensions as previously described (40) with slight 237
modification. In brief, bacterial strains were incubated in NB medium at 28 °C with 238
shaking at 175 rpm until an OD600 of 1.0 (109 cfu/mL) was attained. Rice leaves (6 239
weeks old for Xoo and 8 weeks old for Xoc) were inoculated by cutting the leaves 240
with sterile scissors dipped in bacterial suspension or by piercing the leaves with 241
sterile needles dipped in bacterial suspension. Five plants and three leaves per plant 242
on August 17, 2020 by guest
http://aem.asm
.org/D
ownloaded from
![Page 12: The a nkyrin -like protein A nkB interact s with CatB, affects …€¦ · 129 was used in this study (33). The whole genome sequence s of KACC 1033 1 and 130 BLS256 wer e used as](https://reader033.fdocuments.in/reader033/viewer/2022043018/5f3ab558bf686253d02ce05b/html5/thumbnails/12.jpg)
were inoculated for each strain. Lesion lengths were measured 10 d after inoculation. 243
This experiment was performed two times. 244
RESULTS 245
ankB expression is up-regulated in Xoo and Xoc by exogenous PCA. RNA-seq 246
showed that the expression of ankB was strongly increased in Xoo ZJ173 in response 247
to treatment with 4 μg/mL PCA (data not shown). The highest PCA concentration was 248
determined to be 4 μg/mL for ZJ173 and 32 μg/mL for RS105, which were the 249
amounts that didn’t slow culture growth. The qRT-PCR experiment was repeated to 250
verify the results. The results revealed that the expression of ankB in Xoo ZJ173 was 251
3.5-, 7.5-, and 11.4-fold up-regulated in response to PCA at 1, 2, and 4 μg/mL PCA, 252
respectively (Fig. 1A). Similarly, the expression of ankB in Xoc RS105 was 3.6-, 3.1- 253
and 8.1-fold up-regulated in response to PCA at 8, 16, and 32 μg/mL PCA, 254
respectively (Fig. 1B). 255
Sequence analysis, deletion, and complementation of ankB in Xoo and Xoc. ankB 256
in Xoo (XOO0418) and ankB in Xoc (XOC_4324) (gene names are according to the 257
annotations of Xoo KACC 10331 and Xoc BLS256, respectively) are previously 258
uncharacterized genes that encode ankyrin-like proteins. The ankB nucleotide 259
sequences in these two strains are 576 bp long and encode 191 amino acids, which 260
include ankyrin repeats. ankB is located 58 bp downstream of catB (which encodes a 261
catalase) in both strains (Fig. 1C) (http://www.genome.jp/kegg/). According to NCBI 262
database, the sequence from 69 bp to 175 bp of ankB of Xoo KACC 10331 is an ANK 263
superfamily domain. The link is as follows: 264
on August 17, 2020 by guest
http://aem.asm
.org/D
ownloaded from
![Page 13: The a nkyrin -like protein A nkB interact s with CatB, affects …€¦ · 129 was used in this study (33). The whole genome sequence s of KACC 1033 1 and 130 BLS256 wer e used as](https://reader033.fdocuments.in/reader033/viewer/2022043018/5f3ab558bf686253d02ce05b/html5/thumbnails/13.jpg)
(https://www.ncbi.nlm.nih.gov/Structure/cdd/wrpsb.cgi?INPUT_TYPE=precalc&SE265
QUENCE=58424635). By analyzing the sequence alignment in ANK superfamily 266
domains, we found that the ankyrin repeat domains are highly conserved in 267
Xanthomonas (Fig. 1D). 268
To investigate the role of ankB in Xoo and Xoc, we generated targeted deletion 269
mutants of ZJ173 and RS105 by a non-marker homologous recombination method. 270
Deletion strains ΔZ/ankB of Xoo ZJ173 and ΔR/ankB of Xoc RS105 were verified by 271
PCR using ZankB-1F/2R and RankB-1F/2R primers in Table 1, respectively. 272
qRT-PCR analysis showed that ankB expression was absent in the deletion mutants 273
(Fig. 2). The ΔZ/ankB mutant and the ΔR/ankB mutant were complemented with 274
plasmids pUFRZCB and pUFRRCB, which are derivatives of pUFR034 carrying the 275
open reading frames of ankB and their predicted promoters in ZJ173 or RS105, 276
respectively. The promoters were 123 bp upstream of the start codon of the ankB 277
coding sequence in both Xoo and Xoc. Complementation of the mutants was 278
confirmed by PCR (Fig. S1C). 279
ankB is necessary for expression of catB and for total catalase activity in Xoo and 280
Xoc under no stress or PCA-stress. To investigate the importance of ankB in 281
affecting expression of the catalase gene catB, we analyzed the expression of catB in 282
the ankB deletion mutants. The gene expression of catB in Xoo and Xoc was 283
significantly reduced in ΔZ/ankB and ΔR/ankB but was restored in the complemented 284
strains (Fig. 2A, B). In addition, catalase activity was significantly lower in ΔZ/ankB 285
when compared to the wild-type strain ZJ173 (Fig. 2C). Catalase activity was also 286
on August 17, 2020 by guest
http://aem.asm
.org/D
ownloaded from
![Page 14: The a nkyrin -like protein A nkB interact s with CatB, affects …€¦ · 129 was used in this study (33). The whole genome sequence s of KACC 1033 1 and 130 BLS256 wer e used as](https://reader033.fdocuments.in/reader033/viewer/2022043018/5f3ab558bf686253d02ce05b/html5/thumbnails/14.jpg)
significantly lower in ΔR/ankB compared to the wild-type strain RS105 (Fig. 2D). As 287
expected, catalase activities did not significantly differ between the complemented 288
mutants ΔZ/ankB (ankB) and ΔR/ankB (ankB) and their corresponding wild-type 289
strains. 290
To further confirm that AnkB affects CatB activity, qRT-PCR was used to 291
investigate the expression of catB in response to PCA-stress in ankB deletion mutants 292
of Xoo and Xoc. The results demonstrated that the gene expression of catB was 293
significantly induced after treatment with PCA at 4μg/mL for Xoo and at 32μg/mL for 294
Xoc (Fig. 3A,B). However, the up-regulation of catB was much lower in the deletion 295
mutants ΔZ/ankB and ΔR/ankB than in the wild-type strains (Fig. 3B). Catalase 296
activities in ΔZ/ankB and ΔR/ankB were also significantly reduced by PCA (Fig. 3C). 297
AnkB directly interacts with CatB and enhances the resistance of Xoo and Xoc to 298
H2O2 and PCA. Having established that AnkB likely functions as an interacting 299
protein of CatB, we then used GST pull-down to verify our speculation. AnkB-His 300
was detected when CatB-GST was present in the mixture in both Xoo and Xoc, 301
indicating that AnkB can directly interact with CatB in vitro (Fig. 4A). 302
To further investigate the role of ankB in the detoxification of exogenous ROS, a 303
H2O2 growth-inhibition assay was carried out with ΔZ/ankB and ΔR/ankB. As 304
expected, ΔZ/ankB and ΔR/ankB were more susceptible to H2O2 than their wild-type 305
strains (Fig. 4B). Susceptibility to H2O2 did not significantly differ, however, between 306
the complemented strains and wild-type strains. In a PCA growth-inhibition assay, we 307
found that the sensitivity to PCA was much higher in ΔZ/ankB and ΔR/ankB than in 308
on August 17, 2020 by guest
http://aem.asm
.org/D
ownloaded from
![Page 15: The a nkyrin -like protein A nkB interact s with CatB, affects …€¦ · 129 was used in this study (33). The whole genome sequence s of KACC 1033 1 and 130 BLS256 wer e used as](https://reader033.fdocuments.in/reader033/viewer/2022043018/5f3ab558bf686253d02ce05b/html5/thumbnails/15.jpg)
the wild-type strains and complemented strains (Table 2). 309
ankB is essential for Xoo and Xoc biofilm formation, swimming motility, EPS 310
production and virulence on rice. Since ankyrin protein AnkB was related to 311
oxidative stress which influenced most of biological processes of cells, we evaluated 312
the roles of AnkB in biofilm formation, swimming motility, EPS production and 313
virulence on rice. A biofilm formation assay showed that the mass of biofilm formed 314
was 55% lower for the ΔZ/ankB and ΔZ/catB strains than for the wild-type strain 315
ZJ173. Similarly, biofilm formation was significantly lower for strains ΔR/ankB and 316
ΔR/catB than for the wild-type strain RS105 (Fig. 5A). In the swimming ability assay, 317
strains ΔZ/ankB and ΔZ/catB formed a smaller colony with a less diffuse surface than 318
the wild-type strain ZJ173 on the semi-solid NA plate. Colony diameter and 319
morphology also indicated that the ability to swim was reduced for strain ΔR/ankB 320
and ΔR/catB relative to the wild-type strain RS105 (Fig. 5B). In the EPS production 321
assay, strains ΔZ/ankB and ΔZ/catB produced a lower amount of EPS (1.09 and 0.67 322
mg/mL, respectively) than the wild-type strain ZJ173 (1.75 mg/mL) in NB medium. 323
EPS production also decreased in strains ΔR/ankB and ΔR/catB (0.53 and 0.46 mg/mL, 324
respectively) compared with the wild-type strain RS105 (1.30 mg/mL) (Fig. 5C). 325
These decreases in biofilm formation, swimming motility, and EPS production were 326
all rescued in the complemented strains ΔZ/ankB (ankB) and ΔR/ankB (ankB) (Fig. 5) 327
To assess the importance of ankB for Xoo and Xoc virulence on rice, we inoculated 328
the susceptible rice cultivar IR24 with Xoo ZJ173, ΔZ/ankB, ΔZ/ankB/ (ankB), Xoc 329
RS105, ΔR/ankB, and ΔR/ankB/ (ankB). Lesion length was much shorter for strains 330
on August 17, 2020 by guest
http://aem.asm
.org/D
ownloaded from
![Page 16: The a nkyrin -like protein A nkB interact s with CatB, affects …€¦ · 129 was used in this study (33). The whole genome sequence s of KACC 1033 1 and 130 BLS256 wer e used as](https://reader033.fdocuments.in/reader033/viewer/2022043018/5f3ab558bf686253d02ce05b/html5/thumbnails/16.jpg)
ΔZ/ankB and ΔR/ankB (1.8 ± 0.4 and 1.3 ± 0.2 cm) than for strains ZJ173 and RS105 331
(5.5 ± 0.4 and 4.3 ± 0.3 cm), respectively (Fig. 6). Lesion length was more than 90% 332
restored in the ankB complemented strains. 333
Discussion 334
Previous studies demonstrated that ankyrins have essential regulatory and structural 335
functions in eukaryotes and viruses (20, 41, 42, 43, 44). However, the functions of 336
ankyrins are largely unknown in prokaryotes. Our study revealed that ankB encoding 337
an ankyrin AnkB in Xoo and Xoc affects the gene expression of catB and catalase 338
activity. Moreover, AnkB directly interacts with CatB and enhances resistance to 339
H2O2 and PCA. Our study also revealed that AnkB participates in Xoo and Xoc 340
biofilm formation, swimming ability, EPS production and pathogenicity. 341
Earlier studies revealed that PCA functions as a redox-active compound that generates 342
ROS not only in Xoo, but also in Vibrio anguillarum and Phellinus noxius (12, 31, 45, 343
46, 47, 48). The enhanced ROS production can lead to altered electrical charge and to 344
DNA or membrane damage in cells (49, 50). Catalase is one of the most important 345
enzymatic mechanisms to detoxify excessive levels of ROS (51). We previously 346
reported that the expression of the catalase encoding genes catB and katE in Xoo and 347
Xoc increased dramatically in response to PCA treatment (31). In this study, the gene 348
expression of ankB in Xoo and Xoc was also significantly increased when bacteria 349
were treated with PCA, indicating that the protein encoded by ankB (AnkB) may be 350
important for bacterial resistance to PCA (Fig. 1A, B). In Pseudomonas aeruginosa, 351
AnkB stabilizes KatB, and the location of ankB is 57 bp downstream of katB. 352
on August 17, 2020 by guest
http://aem.asm
.org/D
ownloaded from
![Page 17: The a nkyrin -like protein A nkB interact s with CatB, affects …€¦ · 129 was used in this study (33). The whole genome sequence s of KACC 1033 1 and 130 BLS256 wer e used as](https://reader033.fdocuments.in/reader033/viewer/2022043018/5f3ab558bf686253d02ce05b/html5/thumbnails/17.jpg)
Intriguingly, that location of these genes is similar (ankB is 58 bp downstream of catB) 353
in Xoo and Xoc, suggesting that ankyrin protein AnkB is closely linked to catalase 354
CatB in Xoo and Xoc. The alignment analysis showed that the amino acid sequence of 355
the ANK superfamily is highly conserved in Xanthomonas spp. (Fig. 1D), suggesting 356
that the function of ankyrins is relatively conserved. 357
The growth rate experiment showed that the growth rates of the deletion mutants did 358
not differ from those of the wild-type strains in NB medium (Fig. 1E). Therefore, we 359
used the NB medium in the experiments to sure that the differences exhibited by the 360
ankB deletion mutants were not caused by growth defects. We found that catB gene 361
expression and catalase activities were significantly decreased in the ankB deletion 362
mutants of Xoo and Xoc (Fig. 2), indicating that ankyrin protein AnkB is important for 363
gene expression of catB and for catalase activity in Xoo and Xoc. In line with our 364
findings and as noted earlier, AnkB is required for catalase (KatB) activity in 365
Pseudomonas aeruginosa (29). Furthermore, the expression of catB in ankB deletion 366
mutants of Xoo and Xoc was partly activated in response to PCA, and catalase 367
activities in both deletion mutants were significantly inhibited by PCA (Fig. 3). 368
Combined with a previous report that PCA acts as a redox-active compound and leads 369
to ROS accumulation in Xoo (12), the current results further demonstrate that ankyrin 370
protein AnkB alters catalase function under oxidative stress. In view of these results, 371
we hypothesized that AnkB interacts with CatB to ensure full catalase activity in 372
response to PCA. Consistent with our hypothesis, a GST pull-down assay showed that 373
AnkB directly interacts with CatB in Xoo and Xoc (Fig. 4A). Because CatB helped 374
on August 17, 2020 by guest
http://aem.asm
.org/D
ownloaded from
![Page 18: The a nkyrin -like protein A nkB interact s with CatB, affects …€¦ · 129 was used in this study (33). The whole genome sequence s of KACC 1033 1 and 130 BLS256 wer e used as](https://reader033.fdocuments.in/reader033/viewer/2022043018/5f3ab558bf686253d02ce05b/html5/thumbnails/18.jpg)
protect Xoo and Xoc under H2O2 and PCA stress (52), we investigated the 375
anti-oxidation activity in the ankB deletion mutants of Xoo and Xoc under H2O2 and 376
PCA stress. We found that the ankB deletion mutants were more sensitive to H2O2 and 377
PCA than the wild-type strains (Fig. 4B, Table. 2), indicating that AnkB is essential 378
for protecting Xoo and Xoc against H2O2 and PCA. These results further suggested 379
that catalase protection of cells against oxidizing agents in Xoo and Xoc partly 380
depends on ankyrin protein AnkB. 381
Recent studies found that oxidative stress in Campylobacter jejuni and KatG (catalase) 382
in Xanthomonas citri subsp. citri are important in biofilm formation (53, 54). In 383
antioxidase ahpC mutant of Vibrio parahaemolyticus, the ability to swim in a 384
semi-solid medium was decreased (55). It also was reported that EPS had an 385
important role in protecting cells against ROS in plant-pathogenic bacteria (56). 386
Consistent with these previous studies, our results clearly indicated that catalase and 387
ankyrin protein are necessary for biofilm formation, swimming ability and EPS 388
production by Xoo and Xoc because these phenotypes were reduced in catB and ankB 389
gene deletion mutants of Xoo ZJ173 and Xoc RS105 (Fig. 5). Many studies showed 390
that ROS and their detoxifying enzymes are involved in plant defense (57, 58, 59, 60). 391
Catalases were required for plant pathogenesis in Pseudomonas syringae and 392
Xanthomonas campestris pv. campestris (61, 62). In our study, virulence was lower 393
for strains ΔZ/ankB and ΔR/ankB than for their wild-type strains (Fig. 7). Given that 394
catB deletion mutants of Xoo and Xoc had reduced virulence (31, 52), we speculate 395
that the reduced catalase activity in ankB deletion mutants reduces the ability of the 396
on August 17, 2020 by guest
http://aem.asm
.org/D
ownloaded from
![Page 19: The a nkyrin -like protein A nkB interact s with CatB, affects …€¦ · 129 was used in this study (33). The whole genome sequence s of KACC 1033 1 and 130 BLS256 wer e used as](https://reader033.fdocuments.in/reader033/viewer/2022043018/5f3ab558bf686253d02ce05b/html5/thumbnails/19.jpg)
bacteria to detoxify ROS and therefore reduces virulence. Although the results have 397
revealed that catB and ankB are involved in biofilm formation, swimming ability, EPS 398
production and pathogenicity, the phenotypes were less severe for the ankB mutants 399
than for the catB mutants. This may be attributed to the possibility that the ankyrin 400
AnkB only indirectly affects physiological functions by affecting the function of 401
catalase CatB. 402
In summary, our study demonstrates a direct interaction between the ankyrin AnkB 403
and the catalase CatB. It further provides evidence that deletion of ankB results in 404
lower gene expression of catB and catalase activity, which in turn increases PCA 405
sensitivity in Xoo and Xoc. AnkB is also important for biofilm formation, swimming 406
ability, EPS production and virulence in Xoo and Xoc. 407
408
FUNDING INFORMATION 409
This research was supported by the Special Fund for Agro-scientific Research in the 410
Public Interest (201303023) and a grant (no. 2013-6) from the Innovation Team 411
Program for Jiangsu Universities. 412
413
REFERENCES 414
1. Ou SH. 1984. Exploring tropical rice diseases: a reminiscence. Annu. Rev. Phytopathol. 22: 1-11. 415
2. Nino-Liu DO, Ronald PC, Bogdanove AJ. 2006. Xanthomonas oryzae pathovars: model pathogens 416
of a model crop. Mol Plant Pathol 7: 303-324. 417
3. Xie G, Sun S, Chen J, Zhu X, Chen J, Ye Y, Feng Z, Liang, M. 1990. Studies on rice seed 418
on August 17, 2020 by guest
http://aem.asm
.org/D
ownloaded from
![Page 20: The a nkyrin -like protein A nkB interact s with CatB, affects …€¦ · 129 was used in this study (33). The whole genome sequence s of KACC 1033 1 and 130 BLS256 wer e used as](https://reader033.fdocuments.in/reader033/viewer/2022043018/5f3ab558bf686253d02ce05b/html5/thumbnails/20.jpg)
inspection of Xanthomonas campestris pv. oryzicola: immunoradiometric assay. Chinese J 419
Rice Sci 4: 127–132. 420
4. Reddy APK, Mackenzie DR, Rouse DI, Rao AV. 1979. Relationship of bacterial leaf 421
blight severity to grain yield of rice. Phytopathology 69: 967–969. 422
5. Salzberg SL, Sommer DD, Schatz MC, Phillippy AM, Rabinowicz PD, Tsuge S, Furutani A, 423
Ochiai H, Delcher AL, Kelley D, Madupu R, Puiu D, Radune D, Shumway M, Trapnell C, 424
Aparna G, Jha G, Pandey A, Patil PB, Ishihara H, Meyer DF, Szurek B, Verdier V, 425
Koebnik R, Dow JM, Ryan RP, Hirata H, Tsuyumu S, WonLee S, Seo YS, Sriariyanum 426
M, Ronald PC, Sonti RV, VanSluys MA, Leach JE, White FF, Bogdanove AJ. 2008. 427
Genome sequence and rapid evolution of the rice pathogen Xanthomonas oryzae pv. oryzae 428
PXO99A. BMC Genomics 9: doi: 10.1186/1471-2164-9-204. 429
6. Jaaffar AKM, Parejko JA, Paulitz TC, Weller DM, Thomashow LS. 2017. Sensitivity of 430
Rhizoctonia isolates to phenazine-1-carboxylic acid and biological control by 431
phenazine-producing Pseudomonas spp. Phytopathology 107: 692-703. 432
7. Sun S, Chen B, Jin ZJ, Zhou L, Fang YL, Thawai C, Rampioni G, He YW. 2017. 433
Characterization of the multiple molecular mechanisms underlying RsaL control of 434
phenazine-1-carboxylic acid biosynthesis in the rhizosphere bacterium Pseudomonas 435
aeruginosa PA1201. Mol Microbiol 104: 931-947. 436
8. Thomashow LS, Weller DM, Bonsall RF, Pierson LS. 1990. Production of the antibiotic 437
phenazine-1-carboxylic Acid by fluorescent Pseudomonas species in the rhizosphere of wheat. 438
Appl Environ Microb 56: 908-912. 439
9. Mavrodi DV, Peever TL, Mavrodi OV, Parejko JA, Raaijmakers JM, Lemanceau P, Mazurier 440
on August 17, 2020 by guest
http://aem.asm
.org/D
ownloaded from
![Page 21: The a nkyrin -like protein A nkB interact s with CatB, affects …€¦ · 129 was used in this study (33). The whole genome sequence s of KACC 1033 1 and 130 BLS256 wer e used as](https://reader033.fdocuments.in/reader033/viewer/2022043018/5f3ab558bf686253d02ce05b/html5/thumbnails/21.jpg)
S, Heide L, Blankenfeldt W, Weller DM, Thomashow LS. 2010 Diversity and evolution of 441
the phenazine biosynthesis pathway. Appl Environ Microb 76: 866-879. 442
10. Saleh O, Gust B, Boll B, Fiedler HP, HeideL. 2009 Aromatic prenylation in phenazine 443
biosynthesis: dihydrophenazine-1-carboxylate dimethylallyltransferase from Streptomyces 444
anulatus. Journal Of Biological Chemistry 284: 14439-14447. 445
11. Du X, Li Y, Zhou Q, Xu Y. 2015. Regulation of gene expression in Pseudomonas aeruginosa M18 446
by phenazine-1-carboxylic acid. Appl Microbiol Biot 99: 813-825. 447
12. Xu S, Pan XY, Luo JY, Wu J, Zhou ZH, Liang XY, He YW, Zhou MG. 2015. Effects of 448
phenazine-1-carboxylic acid on the biology of the plant-pathogenic bacterium Xanthomonas 449
oryzae pv. oryzae. Pestic Biochem Phys 117: 39-46. 450
13. Zhou LH, Han Y, Yang J, Li M, Ji GH. 2014. The sensitive baseline of Xanthomonas oxyzae pv. 451
oryzicola in southwest China to pheazino-1-carboxylic acid and zinc thiazole. J Anhui Univ 452
38: 97-102. 453
14. Wang Y, Newman, DK. 2008. Redox reactions of phenazine antibiotics with ferric (hydr) oxides 454
and molecular oxygen. Environ Sci Technol 42: 2380-2386. 455
15. Peters LL, John KM, Lu FM, Eicher EM, Higgins A, Yialamas M, Turtzo LC, Otsuka AJ, 456
Lux SE. 1995. Ank3 (epithelial ankyrin), a widely distributed new member of the ankyrin 457
gene family and the major ankyrin in kidney, is expressed in alternatively spliced forms, 458
including forms that lack the repeat domain. J Cell Biol 130: 313-330. 459
16. Lambert S, Bennett V. 1993. From anemia to cerebellar dysfunction. A review of the ankyrin gene 460
family. FEBS J 211: 1-6. 461
17. Bennett V. 1992. Ankyrins. Adaptors between diverse plasma membrane proteins and the 462
on August 17, 2020 by guest
http://aem.asm
.org/D
ownloaded from
![Page 22: The a nkyrin -like protein A nkB interact s with CatB, affects …€¦ · 129 was used in this study (33). The whole genome sequence s of KACC 1033 1 and 130 BLS256 wer e used as](https://reader033.fdocuments.in/reader033/viewer/2022043018/5f3ab558bf686253d02ce05b/html5/thumbnails/22.jpg)
cytoplasm. J Biol Chem 267: 8703-8706. 463
18. Kordeli E, Lambert S, Bennett V. 1995. AnkyrinG. A new ankyrin gene with neural-specific 464
isoforms localized at the axonal initial segment and node of Ranvier. J Biol Chem 270: 465
2352-2359. 466
19. Herbert MH, Squire CJ, Mercer AA. 2015. Poxviral ankyrin proteins. Viruses-Basel 7: 709-738. 467
20. Cunha SR, Mohler PJ. 2009. Ankyrin protein networks in membrane formation and stabilization. 468
J Cell Mol Med 13: 4364-4376. 469
21. Li J, Mahajan A, Tsai MD. 2006. Ankyrin repeat: a unique motif mediating protein-protein 470
interactions. Biochemistry 45: 15168-15178. 471
22. Vo KTX, Kim CY, Chandran AKN, Jung KH, An G, Jeon JS. 2015. Molecular insights into the 472
function of ankyrin proteins in plants. J Plant Biol 58: 271-284. 473
23. Li DY, Wang FR, Liu B, Zhang YF, Huang L, Zhang HJ, Song FM. 2013. Ectopic expression of 474
rice OsBIANK1, encoding an ankyrin repeat-containing protein, in Arabidopsis confers 475
enhanced disease resistance to Botrytis cinerea and Pseudomonas syringae. J Phytopathol 161: 476
27-34. 477
24. De-Matteis MA, Morrow JS. 1998. The role of ankyrin and spectrin in membrane transport and 478
domain formation. Curr Opin Cell Biol 10: 542-549. 479
25. Wang T, Abou-Ouf H, Hegazy SA, Alshalalfa M, Stoletov K, Lewis J, Donnelly B, Bisar TA. 480
2016. Ankyrin G expression is associated with androgen receptor stability, invasiveness, and 481
lethal outcome in prostate cancer patients. J Mol Med 94: 1411-1422. 482
26. Huxford T, Ghosh G. 2009. A structural guide to proteins of the NF-kappaB signaling module. 483
CSH Perspect Biol 1: a000075. 484
on August 17, 2020 by guest
http://aem.asm
.org/D
ownloaded from
![Page 23: The a nkyrin -like protein A nkB interact s with CatB, affects …€¦ · 129 was used in this study (33). The whole genome sequence s of KACC 1033 1 and 130 BLS256 wer e used as](https://reader033.fdocuments.in/reader033/viewer/2022043018/5f3ab558bf686253d02ce05b/html5/thumbnails/23.jpg)
27. Dolata MM, Van-Beeumen JJ, Ambler RP, Meyer TE, Cusanovich MA. 1993. Nucleotide 485
sequence of the heme subunit of flavocytochrome c from the purple phototrophic bacterium, 486
Chromatium vinosum. J Biol Chem 268: 14426-14431. 487
28. Klotz MG, Anderson AJ. 1995. Sequence of a gene encoding periplasmic Pseudomonas syringae 488
ankyrin. Gene 164: 187-188. 489
29. Howell ML, Alsabbagh E, Ma JF, Ochsner UA, Klotz MG, Beveridge TJ, Blumenthal KM, 490
Niederhoffer EC, Morris RE, Needham D, Dean GE, Wani MA, Hassett DJ. 2000. AnkB, 491
a periplasmic ankyrin-like protein in Pseudomonas aeruginosa, is required for optimal 492
catalase B (KatB) activity and resistance to hydrogen peroxide. J Bacteriol 182: 4545-4556. 493
30. Flint A, Sun YQ, Stintzi A. 2012. Cj1386 is an ankyrin-containing protein involved in heme 494
trafficking to catalase in Campylobacter jejuni. J Bacteriol 194: 334-345. 495
31. Pan XY, Wu J, Xu S, Duan YB, Zhou MG. 2017. CatB is critical for total catalase activity and 496
reduces bactericidal effects of phenazine-1-carboxylic acid on Xanthomonas oryzae pv. oryzae 497
and X. oryzae pv. oryzicola. Phytopathology 107: 163-172. 498
32. Zhao YC, Qian GL, Yin FQ, Fan JQ, Zhai ZW, Liu CH, Hu BS, Liu FQ. 2011. Proteomic 499
analysis of the regulatory function of DSF-dependent quorum sensing in Xanthomonas oryzae 500
pv. oryzicola. Microb Pathogenesis 50: 48-55. 501
33. Schäfer A, Tauch A, Jäger W, Kalinoski J, Thierbach G, Pühler A. 1994. Small mobilizable 502
multi-purpose cloning vectors derived from the Escherichia coli plasmids pK18 and pK19: 503
selection of defined deletions in the chromosome of Corynebacterium glutamicum. Gene 504
145:69–73. 505
34. Yu XY, Liang XY, Liu KX, Dong WX, Wang JX, Zhou MG. 2015. The thiG gene is required for 506
on August 17, 2020 by guest
http://aem.asm
.org/D
ownloaded from
![Page 24: The a nkyrin -like protein A nkB interact s with CatB, affects …€¦ · 129 was used in this study (33). The whole genome sequence s of KACC 1033 1 and 130 BLS256 wer e used as](https://reader033.fdocuments.in/reader033/viewer/2022043018/5f3ab558bf686253d02ce05b/html5/thumbnails/24.jpg)
full virulence of Xanthomonas oryzae pv. oryzae by preventing cell aggregation. PloS One 10: 507
e0134237. 508
35. Qian GL, Liu CH, Wu GC, Yin FQ, Zhao YC, Zhou YJ, Zhang YB, Song ZW, Fan JQ, Hu BS, 509
Liu FQ. 2013. AsnB, regulated by diffusible signal factor and global regulator Clp, is 510
involved in aspartate metabolism, resistance to oxidative stress and virulence in Xanthomonas 511
oryzae pv. oryzicola. Mol Plant Pathol 14: 145-157. 512
36. Zhu M, Jiang L, Bai BH, Zhao WY, Chen XJ, Li J, Liu Y, Chen ZQ, Wang BT, Wang CL, Wu 513
Q, Shen QH, Dinesh-Kumar, SP, Tao XR. 2017. The Intracellular Immune Receptor Sw-5b 514
Confers Broad-spectrum Resistance to Tospoviruses through Recognition of a Conserved 515
21-amino-acid Viral Effector Epitope. Plant Cell. 29: doi:10.1105/tpc.17.00180. 516
37. González JF, Myers MP, Venturi V. 2013. The inter-kingdom solo OryR regulator of 517
Xanthomonas oryzae is important for motility. Mol Plant Pathol, 14: 211-221. 518
38. Sunish Kumar R, Sakthivel N. 2001. Exopolysaccharides of Xanthomonas pathovar strains that 519
infect rice and wheat crops. Appl Microbio Bio, 55: 782-786. 520
39. Yang F, Tian F, Li X, Fan S, Chen H, Wu M, Yang CH, He, CY. 2014. The degenerate 521
EAL-GGDEF domain protein Filp functions as a cyclic di-GMP receptor and specifically 522
interacts with the PilZ-domain protein PXO_02715 to regulate virulence in Xanthomonas 523
oryzae pv. oryzae. Mol Plant Microbe In, 27: 578-589. 524
40. Yang B, Bogdanove A. 2013. Inoculation and virulence assay for bacterial blight and bacterial leaf 525
streak of rice. Methods Mol Biol 956: 249-55. 526
41. Mosavi LK, Cammett TJ, Desrosiers DC, Peng ZY. 2004. The ankyrin repeat as molecular 527
architecture for protein recognition. Protein Sci 13: 1435-1448. 528
on August 17, 2020 by guest
http://aem.asm
.org/D
ownloaded from
![Page 25: The a nkyrin -like protein A nkB interact s with CatB, affects …€¦ · 129 was used in this study (33). The whole genome sequence s of KACC 1033 1 and 130 BLS256 wer e used as](https://reader033.fdocuments.in/reader033/viewer/2022043018/5f3ab558bf686253d02ce05b/html5/thumbnails/25.jpg)
42. Gaudet R. 2008. A primer on ankyrin repeat function in TRP channels and beyond. Mol Biosyst 4: 529
372-379. 530
43. Chen DY, Fabrizio JA, Wilkins SE, Dave KA, Gorman JJ, Gleadle JM, Fleming SM, Peet DJ, 531
Mercer AA. 2017. Ankyrin repeat proteins of orf virus influence the cellular hypoxia response 532
pathway. J Virol 91: e01430-16. 533
44. Li Y, Meng X, Xiang Y, Deng J. 2010. Structure function studies of vaccinia virus host range 534
protein k1 reveal a novel functional surface for ankyrin repeat proteins. J Virol 84: 3331-3338. 535
45. Thomashow LS, Weller DM, Bonsall RF, Pierson LS. 1990. Production of the antibiotic 536
phenazine-1-carboxylic acid by fluorescent pseudomonas species in the rhizosphere of wheat. 537
Appl Environ Microb 56: 908-912. 538
46. Charyulu EM, Sekaran G, Rajakumar GS, Gnanamani A. 2009. Antimicrobial activity of 539
secondary metabolite from marine isolate, Pseudomonas sp. against Gram positive and 540
negative bacteria including MRSA. Indian J Exp Biol 47: 964-968. 541
47. Zhang L, Tian X, Kuang S, Liu G, Zhang C, Sun C. 2017. Antagonistic activity and mode of 542
action of phenazine-1-carboxylic acid, produced by marine bacterium Pseudomonas 543
aeruginosa PA31x, against Vibrio anguillarum in vitro and in a zebrafish in vivo Model. Front 544
Microbiol 8: 289. 545
48. Huang H, Sun L, Bi K, Zhong G, Hu M. 2016. The effect of phenazine-1-carboxylic acid on the 546
morphological, physiological, and molecular characteristics of Phellinus noxius. Molecules 21: 547
doi:10.3390/molecules21050613. 548
49. Yakes FM, Van-Houten B. 1997. Mitochondrial DNA damage is more extensive and persists 549
longer than nuclear DNA damage in human cells following oxidative stress. P Natl Acade Sci 550
on August 17, 2020 by guest
http://aem.asm
.org/D
ownloaded from
![Page 26: The a nkyrin -like protein A nkB interact s with CatB, affects …€¦ · 129 was used in this study (33). The whole genome sequence s of KACC 1033 1 and 130 BLS256 wer e used as](https://reader033.fdocuments.in/reader033/viewer/2022043018/5f3ab558bf686253d02ce05b/html5/thumbnails/26.jpg)
U S A 94: 514-519. 551
50. Mittler R. 2002. Oxidative stress, antioxidants and stress tolerance. Trends plant sci 7: 405-410. 552
51. Blokhina O, Virolainen E, Fagerstedt KV. 2003. Antioxidants, oxidative damage and oxygen 553
deprivation stress: a review. Ann Bot-london 91: 179-194. 554
52. Yu C, Wang N, Wu M, Tian F, Chen H, Yang F, Yuan X, Yang CH, He CY. 2016. 555
OxyR-regulated catalase CatB promotes the virulence in rice via detoxifying hydrogen 556
peroxide in Xanthomonas oryzae pv. oryzae. BMC Microbiol 16: 269. 557
53. Oh E, Kim JC, Jeon B. 2016. Stimulation of biofilm formation by oxidative stress in 558
Campylobacter jejuni under aerobic conditions. Virulence 7: 846-851. 559
54. Tondo ML, Delprato ML, Kraiselburd I, Fernández-Zenoff MV, Farías ME, Orellano EG. 560
2016. KatG, the bifunctional catalase of Xanthomonas citri subsp. citri, responds to hydrogen 561
peroxide and contributes to epiphytic survival on citrus leaves. PloS One 11: e0151657. 562
55. Wang HW, Chung CH, Ma TY, Wong HC. 2013. Roles of alkyl hydroperoxide reductase subunit 563
C (AhpC) in viable but nonculturable Vibrio parahaemolyticus. Appl Environ Microb 79: 564
3734-3743. 565
56. Kiraly Z, ElZahaby HM, Klement Z. 1997. Role of extracellular polysaccharide (EPS) slime of 566
plant pathogenic bacteria in protecting cells to reactive oxygen species. J Phytopathol 145: 567
59-68. 568
57. Zhang J, Zhou JM. 2010. Plant immunity triggered by microbial molecular signatures. Mol Plant 569
3: 783-793. 570
58. Augusto AC, Miguel F, Mendonca S, Pedrazzoli JJ, Gurgueira SA. 2007. Oxidative stress 571
expression status associated to Helicobacter pylori virulence in gastric diseases. Clin Biochem 572
on August 17, 2020 by guest
http://aem.asm
.org/D
ownloaded from
![Page 27: The a nkyrin -like protein A nkB interact s with CatB, affects …€¦ · 129 was used in this study (33). The whole genome sequence s of KACC 1033 1 and 130 BLS256 wer e used as](https://reader033.fdocuments.in/reader033/viewer/2022043018/5f3ab558bf686253d02ce05b/html5/thumbnails/27.jpg)
40: 615-622. 573
59. Giménez-Ibánez S, Hann DR, Ntoukakis V, Petutschnig E, Lipka V, Rathjen JP. 2009. 574
AvrPtoB targets the LysM receptor kinase CERK1 to promote bacterial virulence on plants. 575
Curr Biol 19: 423-429. 576
60. Ding M, Kwok LY, Schluter D, Clayton C, Soldati D. 2004. The antioxidant systems in 577
Toxoplasma gondii and the role of cytosolic catalase in defence against oxidative injury. Mol 578
Microbiol 51: 47-61. 579
61. Guo M, Block A, Bryan CD, Becker DF, Alfano JR. 2012. Pseudomonas syringae catalases are 580
collectively required for plant pathogenesis. J Bacteriol 194: 5054-5064. 581
62. Jittawuttipoka T, Buranajitpakorn S, Vattanaviboon P, Mongkolsuk S. 2009. The 582
catalase-peroxidase KatG is required for virulence of Xanthomonas campestris pv. campestris 583
in a host plant by providing protection against low levels of H2O2. J Bacteriol 191: 7372-7377. 584
585
Table 1. Strains, plasmids, and primers used in this study. 586
Strains, Plasmids, and
primers
Characteristics Source
Strains
Escherichia coli DH5α φ80 lacZ△M15, △(lacZYA-argF)U169. recA1 Vazyme, Nanjing, China
ZJ173 RifR, wild-type strain of Xanthomonas oryzae pv. oryzae Xu et al. (2015)
ΔZ/ankB RifR, deletion of ankB in wild-type strain ZJ173 This study
ΔZ/ankB(ankB) RifR, KmR, complemented strain of ΔZ/ankB This study
ΔZ/catB RifR, deletion of catB in wild-type strain ZJ173 Pan et al. (2017)
on August 17, 2020 by guest
http://aem.asm
.org/D
ownloaded from
![Page 28: The a nkyrin -like protein A nkB interact s with CatB, affects …€¦ · 129 was used in this study (33). The whole genome sequence s of KACC 1033 1 and 130 BLS256 wer e used as](https://reader033.fdocuments.in/reader033/viewer/2022043018/5f3ab558bf686253d02ce05b/html5/thumbnails/28.jpg)
ΔZ/catB(catB) RifR, KmR, complemented strain of ΔZ/catkB Pan et al. (2017)
RS105 RifR, wild-type strain of Xanthomonas oryzae pv. oryzicola Xu et al. (2015)
ΔR/ankB RifR, deletion of ankB in wild-type strain RS105 This study
ΔR/ankB(ankB) RifR, KmR, complemented strain of ΔR/ankB This study
ΔR/catB RifR, deletion of catB in wild-type strain RS105 Pan et al. (2017)
ΔR/catB(catB) RifR, KmR, complemented strain of ΔR/ankB Pan et al. (2017)
Plasmids
pK18mobsacB KmR, allelic exchange suicide vector, sacB oriT(RP4) Schäfer et al. (1994)
pK18ZAB KmR, a 1839-bp fusion fragment of ZankB-1, ZankB-2gene ligated in pK18mobsacB This study
pK18RAB KmR, a 1796-bp fusion fragment of RankB-1, RankB-2gene ligated in pK18mobsacB This study
pUFR034 lncW, NmR, KmR, Mob+, Mob(p), lacZ alpa, PK2 replicon, cosmid Yu et al. (2015)
pUFRZCB KmR, a 755-bp fusion fragment of ZankB-H gene in ZJ173 ligated in pUFR034 This study
pUFRRCB KmR, a 755-bp fusion fragment of RankB-H gene in RS105 ligated in pUFR034 This study
pGEX-2TK AmpR, CmR, Tac, expression of GST fusion protein Kamitani et al. (1997)
pGEX-ZcatB KmR, a 1524-bp fusion fragment of ZcatB gene in ZJ173 ligated in pGEX-2TK This study
pGEX-RcatB KmR, a 1524-bp fusion fragment of RankB gene in RS105 ligated in pGEX-2TK This study
pET-28a KmR, T7, expression of His6 fusion protein Stockinger et al. (1997)
pET-ZcatB KmR, a 576-bp fusion fragment of ZankB gene in ZJ173 ligated in pET-28a This study
pET-RcatB KmR, a 576-bp fusion fragment of RankB gene in RS105 ligated in pET-28a This study
Primers
ZankB-1F 5′- CGGGATCCAAGAATCTCGATCCCAAAC -3′ This study
ZankB-1R 5′- CGGAATTCAGACAGGCTGCCAAGC-3′ This study
on August 17, 2020 by guest
http://aem.asm
.org/D
ownloaded from
![Page 29: The a nkyrin -like protein A nkB interact s with CatB, affects …€¦ · 129 was used in this study (33). The whole genome sequence s of KACC 1033 1 and 130 BLS256 wer e used as](https://reader033.fdocuments.in/reader033/viewer/2022043018/5f3ab558bf686253d02ce05b/html5/thumbnails/29.jpg)
ZankB-2F 5′- CGGAATTCGCATGCTGCTCTTGCTTG -3′ This study
ZankB-2R 5′- GCTCTAGAGGGTTACGGACACCCACA-3′ This study
RankB-1F 5′- CGGGATCCGAATCTCGATCCCAAACA-3′ This study
RankB-1R 5′- CGGAATTCGAATCTCCCGGACTCAA-3′ This study
RankB-2F 5′- CGGAATTCGCATGCTGCTCTTGCTTG-3′ This study
RankB-2R 5′- GCTCTAGAGGTTACGGACACCCACA-3′ This study
Z/RankBH-F 5′- GGGGTACCAAGCAAGCACCGGATGCT -3′ This study
Z/RankBH-R 5′- CGGGATCCTCAGCGCGCCGGGGCGGT -3′ This study
GST-Z/RcatB-F 5′- CGGGATCCATGCGCCCTGGATCTCTC -3′ This study
GST-Z/RcatB-R 5′- TCCCCCGGGTCAGTCCTGCAGGCTGGA -3′ This study
His-Z/RankB-F 5′- CGGGATCCATGCGCACCCTCTTGTTT -3′ This study
His-Z/RankB-R 5′- CCGCTCGAGTCAGCGCGCCGGGGCGGT -3′ This study
Z16S rRNA-F 5′-GGCGAGCACAATGGCATT-3′ Xu et al. (2011)
Z16S rRNA-R 5′-CCATCCTTCTGCGGGATGT-3′ Xu et al. (2011)
R16S rRNA-F 5′-AATGGGCGCAAGCCTGATC-3′ Zhao et al. (2011)
R16S rRNA-R 5′-AACCACCACCTACGCACGC-3′ Zhao et al. (2011)
qZcatB-F 5′-CGCCCAATCCGTTCTGA-3′ Pan et al. (2017)
qZcatB-R 5′-CGGTGAACTCGCCTTTGA-3′ Pan et al. (2017)
qZankB-F 5′-GTGAAGGTCGCCAAGACAT-3′ This study
qZankB-R 5′-CCAGGATCAACGCGGTATAG-3′ This study
qRcatB-F 5′-CAGGGCCGTATCTTCTCTTATG-3′ Pan et al. (2017)
qRcatB-R 5′-ATCCTGGTTGCCGTTGTT-3′ Pan et al. (2017)
on August 17, 2020 by guest
http://aem.asm
.org/D
ownloaded from
![Page 30: The a nkyrin -like protein A nkB interact s with CatB, affects …€¦ · 129 was used in this study (33). The whole genome sequence s of KACC 1033 1 and 130 BLS256 wer e used as](https://reader033.fdocuments.in/reader033/viewer/2022043018/5f3ab558bf686253d02ce05b/html5/thumbnails/30.jpg)
qRankB-F 5′-CACACCCGAGCAGATCAAG-3′ This study
qRankB-R 5′-CGTAGTGCGAGCGAATGAA-3′ This study
587
Table 2. Sensitivity of Xanthomonas oryzae pv. oryzae and Xanthomonas oryzae pv. 588
oryzicola strains to phenazine-1-carboxylic acidA. 589
Strain EC50 (μg/ml)
ZJ173 0.18±0.016 a
ΔZ/ankB 0.132±0.0349 b
ΔZ/ankB/(ankB) 0.162±0.0158 a
RS105 13.11±0.19 a
ΔR/ankB 7.89±1.32 b
ΔR/ankB/(ankB) 11.032±1.111 a
AValues are means + SE of three experiments. Means followed by the same letter are 590
not significantly different (P > 0.05). 591
592
Fig. 1 For A) and B), relative expression levels of ankB in Xanthomonas oryzae pv. 593
oryzae (strain ZJ173) and Xanthomonas oryzae pv. oryzicola (strain RS105) when 594
stimulated with PCA by RT-PCR. The tested strains were grown in NB medium to an 595
OD600 of 0.2, and PCA was added to a final concentration of 1, 2, and 4 μg/mL for 596
ZJ173, and to final concentration of 8, 16, and 32 μg/mL for RS105. The amount of 597
RNA in acetone was used as the control and was set at 1.0. Values are means ± SD 598
from three technical replicates. Similar results were obtained from three biological 599
on August 17, 2020 by guest
http://aem.asm
.org/D
ownloaded from
![Page 31: The a nkyrin -like protein A nkB interact s with CatB, affects …€¦ · 129 was used in this study (33). The whole genome sequence s of KACC 1033 1 and 130 BLS256 wer e used as](https://reader033.fdocuments.in/reader033/viewer/2022043018/5f3ab558bf686253d02ce05b/html5/thumbnails/31.jpg)
replicates. * P value <0.05 (Student’s t-test). For C), GenBank number is given 600
according to KEGG. The red line represents the locations of primers in real-time 601
RT-PCR. “→” represents the forward primer and “←” represents reverse primer of 602
qRT-PCR. The arrows in purple and blue represent the starting and end positions of 603
deletion of ankB, respectively. For D) the strains were Xanthomonas oryzae pv. 604
oryzae (strain KACC 10331), Xanthomonas oryzae pv. oryzicola (strain BLS256), 605
Xanthomonas axonopodis pv. vasculorum, Xanthomonas citri pv. citri (strain 306), 606
Xanthomonas campestris pv. campestris (strain ATCC 33913), Xanthomonas 607
campestris pv. raphani (strain 756C) and Xanthomonas citri subsp. citri (strain 608
MN11). Amino acid sites that differ are in colored font on a white background. For E) 609
growth rate of wild-type strains, ankB deletion mutants, and their complemented 610
mutants of Xanthomonas oryzae pv. oryzae ZJ173 and Xanthomonas oryzae pv. 611
oryzicola RS105 in a nutrient-rich medium (NB) as indicated by OD600 (optical 612
density at 600 nm). 613
Fig. 2 Gene expression of ankB and catB in A) Xanthomonas oryzae pv. oryzae ZJ173 614
and B) Xanthomonas oryzae pv. oryzicola RS015 and their ankB deletion and 615
complemented mutants, and C and D) their total catalase activity. The tested strains 616
were grown in NB medium. For A and B), gene expression was detected by real-time 617
RT-PCR. Relative mRNA levels of ankB and catB in ZJ173 and RS105 were set at 1. 618
Values are means ± SD of three biological replicates. * P value <0.05 (t-test). For C 619
and D), total catalase activity was measured from total protein extract. Values are 620
means ± SD of three biological replicates. * P value <0.05 (t-test). 621
on August 17, 2020 by guest
http://aem.asm
.org/D
ownloaded from
![Page 32: The a nkyrin -like protein A nkB interact s with CatB, affects …€¦ · 129 was used in this study (33). The whole genome sequence s of KACC 1033 1 and 130 BLS256 wer e used as](https://reader033.fdocuments.in/reader033/viewer/2022043018/5f3ab558bf686253d02ce05b/html5/thumbnails/32.jpg)
Fig. 3 Gene expression of A) ankB and B) catB in Xanthomonas oryzae pv. oryzae 622
ZJ173 and Xanthomonas oryzae pv. oryzicola RS015 and their ankB deletion and 623
complemented mutants when treated with 4 and 32μg/mL PCA, respectively, and C), 624
total catalase activity of ankB deletion mutants in ZJ173 and RS105 when treated with 625
4 and 32μg/mL PCA, respectively. In all cases, strains were grown and treated in NB 626
medium; Values are means ± SD of three biological replicates, and * P value <0.05 627
(t-test). For A), expression was assessed by real-time RT-PCR. Relative mRNA levels 628
of ankB and catB in ZJ173 and RS105 when treated with acetone were set at 1. For C), 629
total catalase activity was measured from total protein extract. 630
Fig. 4 For A), interaction between AnkB and CatB is indicated by a GST pull-down 631
assay. The purified GST-CatB was incubated with AnkB-His6 and pulled down with 632
GST beads. GST-CatB pulled down a significant amount of AnkB-His6 (the bands 633
marked with “*”) by immunoblot using anti-His antibody. The digits represented the 634
molecule size of protein marker. For B), H2O2 sensitivity of Xanthomonas oryzae pv. 635
oryzae ZJ173, Xanthomonas oryzae pv. oryzicola RS015, and their ankB deletion and 636
complemented mutants on NB medium plates. The 1-, 3-, and 9-fold-dilutions (1×, 3637
× and 9×) of the bacterial suspension were added to NB medium containing 0, 0.05, 638
0.1 or 0.2 mM H2O2. 639
Fig 5 Biofilm formation, swimming ability and EPS production of tested strains. A) 640
Biofilm formation, B) Swimming ability and C) EPS production of Xanthomonas 641
oryzae pv. oryzae ZJ173, Xanthomonas oryzae pv. oryzicola RS015, and their ankB 642
deletion and complemented mutants. Representative biological phenotypes were 643
on August 17, 2020 by guest
http://aem.asm
.org/D
ownloaded from
![Page 33: The a nkyrin -like protein A nkB interact s with CatB, affects …€¦ · 129 was used in this study (33). The whole genome sequence s of KACC 1033 1 and 130 BLS256 wer e used as](https://reader033.fdocuments.in/reader033/viewer/2022043018/5f3ab558bf686253d02ce05b/html5/thumbnails/33.jpg)
photographed. Values are means+ SD of three biological replicates, which has similar 644
results. * P value <0.01 (Student’s t-test). 645
Fig. 6 Pathogenicity of A) Xanthomonas oryzae pv. oryzae (Xoo) strains and B) 646
Xanthomonas oryzae pv. oryzicola (Xoc) strains in rice IR24. The bar charts show 647
lesion lengths. Three replicates were used for each treatment, and the experiment was 648
repeated two times. Values are the means + SD of three replicates. 649
650
on August 17, 2020 by guest
http://aem.asm
.org/D
ownloaded from