Testing alternative hypotheses. Outline Topology tests: –Templeton test Parametric bootstrapping...

Testing alternative hypotheses

Outline

• Topology tests:– Templeton test

• Parametric bootstrapping (briefly)

• Comparing data sets

Topology tests

• The best tree for your data contradicts a prior hypothesis. This does not mean that the data refute the hypothesis

• Compare the optimality score of the best tree and the best trees given the hypothesis

Tree space

Region of tree space satisfying the hypothesis

Optimal tree

Optimal tree satisfying the hypothesis

Does one tree explain the data significantly better than the other?• If the data are “significantly” more

compatible with the optimal tree than the constrained tree, the hypothesis is rejected

• Parsimony framework– Constrained tree length = X– Optimal tree length = Y– Is the cost (X-Y) significant?

Templeton test

A T G T G A A C A AB T G T G A C C A AC T G C G G C C T AD A G C G G C G T AE A A C T A A G T GF A A C T A A G C GL1 1 1 1 1 2 2 1 2 1 = 12 L4 3 2 2 2 2 1 3 3 2 = 20

Templeton test

A T G T G A A C A AB T G T G A C C A AC T G C G G C C T AD A G C G G C G T AE A A C T A A G T GF A A C T A A G C GL1 1 1 1 1 2 2 1 2 1 = 12 L4 3 2 2 2 2 1 3 3 2 = 20Diff 2 1 1 1 0-1 2 1 1 =

Templeton test

Score Rank

2 1.5

2 1.5

1 5.5

1 5.5

1 5.5

1 5.5

1 5.5

-1 -5.5

Sum of the negative ranks = 5.5

N (number of chars varying in length) = 8

P-value = ca. 0.045

Problems of topology tests

• The tests compare trees, they don’t compare the competing hypotheses

Tree space

Region of tree space satisfying the hypothesis

Optimal tree


Another problem of topology tests

• Suppose we had a prior hypothesis that species A-B form a clade

• We conduct a phylogenetic analysis of 8 species and find that A-B do not form a clade

• The shortest tree that has them as a clade is 6 steps longer (decay = -6) which is significant under a Templeton test

• Suppose we had a prior hypothesis that species A-Z form a clade

• We conduct a phylogenetic analysis of 100 species and find that A-Z do not form a clade

• The shortest tree that has them as a clade is 6 steps longer (decay = -6) which is significant under a Templeton test

Another problem of topology tests

Are these results equivalent?

• The two hypotheses are differently stringent– The former delimits a much larger proportion of tree-space

• One solution is to reverse the question: If the hypothesis were true, how likely is it that the optimal tree would reject it?

– Requires parametric bootstrapping

Find the region of tree space that is plausible if the hypothesis is true:

Tree space

Optimal tree


Hypothesis rejected

Find the region of tree space that is plausible if the hypothesis is true:

Tree space

Optimal tree


Hypothesis not rejected

How do you do this?

• Find the optimal tree under the constraint (not just the optimal topology but also branch lengths, etc.)

• Simulate data up that tree many times

• For each data set calculate the cost of the hypothesis

• If the observed cost was greater than the cost from the simulated data, the hypothesis is rejected.

Strepsiptera sister to the

Diptera (Whiting et

al. 1997)

Could be a long-branch problem(Huelsenbeck, 1997)

What if this were the true tree?

Probability of Strepsiptera being sister to Diptera on the MP tree = 92%

Testing hypotheses

• Topology tests are good ways to test hypotheses

• Parametric bootstraping tests are powerful but laborious

• Other approaches are available using likelihood or Bayesian approaches (later)

Multiple data sets for the same sets of taxa

• Analyze each data set separately and then compare the trees (consense)

• Concatenate the data and conduct a single combined analysis (combine)

Argument for consensus

• If the same clades appear with multiple data sets we can be more confident

• The method is conservative

Is consensus conservative?Barrett et al. 1994. Syst. Zool. 40:486

Arguments against combined analysis

• Some data sets might have strong misleading signals (e.g., due to lab errors)

• Different partitions might have tracked different histories

Conditional combined analysis

• Assess if the data look like they have tracked different histories– If they do not: combine– If they do: analyze separately

• Can you do this with topology tests?

Optimal tree for data set 2


Do they conflict?

But topology tests can be used more carefully

• Two data sets don’t conflict significantly if there is one tree that neither data set rejects

• Two data sets do conflict if:– Data set 1 rejects all trees that lack a certain

clade– Data set 2 rejects all trees that have that same

clade



Significantly worse

Optimal tree without the constraint for data set 2

Optimal tree with the constraint for data set 1

Significantly worse

The Incongruence Length Difference (ILD) test

(Farris et al., 1994)• Conflict is manifest as longer trees (or

lower likelihood)

• Look to see how length (or likelihood) increases when we combine data

• Determine significance compared to random partitions

ILD test (= Partition Homogeneity Test in PAUP*)

One TACATAAACAAGCCTAAAATGCGACACTACGTTCACTGTTACGCTCTCCACTGCCTAGACGAAGAAGCTTCATwo TACATAAACAAGCCCAAAATGCGACACTACGTCCACTGTTATGCTCTCCACTGCCTAGACGAAGACGCTTCAThree TACATAAACAAGCCCAAAATGCGACACTACGTCCACTGTTACGCTCTTCACTGCCTAGACGAGGATGCCTCGFour TACATAAATAAGCCAAAAATGCGACACTACGTTCATTGTTACGCACTCCATTGCCTCGACGAAGAAGCTTCAFive TACATAAACAAACCCAAAATGCGACACTACGTCCACTGTTATGCTCTCCACTGTCTAGACGAAGACGCTTCGSix TACATAAACAAGCCCAAGATGCGTCACTACGTCCACTGCTACGCCCTCCACTGTCTCGACGAGGAGGCCTCGSeven TACATAAACAAACCAAAAATGCGACACTACGTCCATTGTTACGCCCTACACTGCCTAGACGAAGACGCTTCAEight TACATAAACAAACCAAAAATGCGACACTACGTCCATTGTTACGCCCTACACTGCCTAGACGAAGACGCTTCA

Partition 1Length = 12


Combined L = 21


Combined L = 25



Partition 2Length =11

Results Sum of Number of tree lengths replicates ----------------------------- 1661 1 1662 2 1663 1 1665* 9 1666 8 1667 9 1668 5 1669 11 1670 10 1671 9

* = sum of lengths for original partition P value = 1 - (87/100) = 0.130000

Sum of Number of tree lengths replicates -------------------------------- 1672 10 1673 7 1674 4 1675 4 1676 1 1677 4 1678 2 1679 1 1680 1 1683 1

What does a positive result mean?

• The data sets have tracked different histories?

• The original partition is non-random

• Does not even look at topology

Option if you find conflict

• Conduct separate analyses only

• Delete taxa until conflict disappears - then combine

• Combine anyway

Conditional conditional combined analysis

• You believe that conflict reflects data partitions tracking different histories– Keep the data separate and find ways to

summarize the discrepancy

• You believe that conflict reflects artifactual signals (noise) in one or both data sets– Combine anyway in the hope that the real

signal will come to dominate

Testing alternative hypotheses. Outline Topology tests: –Templeton test Parametric bootstrapping...

Documents

Transcript of Testing alternative hypotheses. Outline Topology tests: –Templeton test Parametric bootstrapping...