Short Communication

Terminal repeat retrotransposons as DNA markers in fungi

Mateus Ferreira Santana, Aline Duarte Batista, Lílian Emídio Ribeiro, Elza Fernandes de Araújo andMarisa Vieira de Queiroz

Departamento de Microbiologia, Universidade Federal de Viçosa, Viçosa, Minas Gerais, Brazil

In this study, we demonstrate that ClIRAP primers designed using the transposable elementRetroCl1 sequence from Colletotrichum lindemuthianum can be used to generate an efficient IRAP(inter-retrotransposon amplified polymorphism) molecular marker to study intra- and inter-species diversity in fungi. It has been previously demonstrated that primers generated from thisTRIM-like element can be used in the Colletotrichum species. We now prove that the RetroCl1sequence can also be used to analyze diversity in different fungi. IRAP profiles were successfullygenerated for 27 fungi species from 11 different orders, and intra-species genetic variability wasdetected in six species. The ClIRAP primers facilitate the use of the IRAP technique for a variety offungi without prior knowledge of the genome.

Keywords: IRAP / Molecular marker / Retrotransposon / TRIM

Received: August 7, 2012; accepted: September 12, 2012

DOI 10.1002/jobm.201200453

Introduction

DNA-based molecular markers are used to study geneticvariability and diversity as well as for linkage mapconstruction. A large fraction of repetitive sequences infungal genomes is predominantly composed of transpos-able elements (TEs) [1, 2]; thus, they may be useful asmolecular markers.

TEs can be divided into two classes, which aredifferentiated by the presence or absence of an RNAintermediary. For the class II TEs, the excision process isdirect and is followed by integration. For class I, reversetranscriptase catalyzes DNA synthesis based on a copy ofthe retrotransposon RNA, which can then be insertedinto a target site [3]. Retrotransposons have two primarysubclasses, long terminal repeat (LTR) retrotransposonsand non-LTR retrotransposons (LINEs, long interspersednuclear elements, and SINEs, short interspersed nuclearelements), which are distinguished by the respectivepresence or absence of LTRs at the end. Furthermore,groups of non-autonomous TEs lack one or more of thegenes essential for transposition, including miniature

inverted-repeat terminal elements (MITEs) for class II,SINEs for non-LTR retrotransposons, and terminal-repeatretrotransposon in miniature (TRIM) retrotransposonsand large retrotransposon derivates (LARDs) for LTRretrotransposons [4].

Retrotransposons are advantageous molecularmarkers because of their replication structure andstrategy. They contain long, defined, conserved sequen-ces that can be used as specific markers for primerdesign. In addition, the replication activity of retro-transposons produces a high degree of polymorphism inthe genome. The insertions can be detected and used forphylogenic analysis. In this context, fingerprint techni-ques used for genetic diversity studies have been based onretrotransposons, such as sequence-specific amplifiedpolymorphism (S-SAP) [5], inter-retrotransposon amplifiedpolymorphism (IRAP) [6], REtrotransposon-microsatelliteamplified polymorphism (REMAP) [6], and retrotranspo-son-based insertion polymorphism (RBIP) [7].

Among these techniques, IRAP has been widely usedprimarily due to its simplicity [4]. The IRAP technique canexamine polymorphisms in regions where retrotranspo-sons are inserted. In this technique, primers are designedfor conserved retrotransposon regions, such as LTRs [6].Recently, it was demonstrated that TRIMs are ubiquitousin many species and may be useful for studying diversityamong correlated species [8, 9]. In particular, Santoset al. [10] characterized a TRIM-like element, RetroCI1, and

Correspondence: Marisa Vieira de Queiroz, Departamento de Micro-biologia, Universidade Federal de Viçosa, CEP 36571-000 Viçosa, MinasGerais, BrazilE-mail: mvqueiro@ufv.brPhone: þ55 (31) 38992971Fax: þ55 (31) 38992573

Environment � Health � Techniques

Retrotransposons as DNA markers in fungi 1

� 2013 WILEY-VCH Verlag GmbH & Co.KGaA,Weinheim www.jbm-journal.com 2013, 9999, 1–5

demonstrated through IRAP that this element could beused to analyze genetic variability in different speciesfrom the genus Colletotrichum. Herein, we examine theutility of IRAP markers based on primers generated fromRetroCI1 as a molecular marker for different fungispecies.

Materials and methods

Species and DNA extractionThe isolates used belong to the mycological collection inthe Molecular Genetics of Microorganisms Laboratoryof the Universidade Federal de Viçosa (Table 1), and theywere cultivated on a potato dextrose agar (PDA) medium.

The total DNA was extracted using the Ultra Clean™Microbial DNA Isolation extraction kit from MOBIOLaboratories, Inc. Twenty-seven fungi species were used,and six species were selected for intra-specific poly-morphisms analysis.

IRAP–PCR amplification and primersClIRAP1 (50CGTACGGAACACGCTACAGA30) and ClIRAP4(50CTTTTGACGAGGCCATGC 30) primer combinationswere used, which have been previously described bySantos et al. [10]. In the above combination, the primersare in the same sense of amplification. A new primer,ClIRAP2 (50AATAACGTCTCGGCCTTCAG30), was designedbased on the direct terminal repeats (DTRs) in RetroCl1(access no. JF313218). This primer was used in

Table 1. Isolates used in the IRAP analysis.

Identification inthe collection Species Phylum Class Order

09 Moniliophthora perniciosa Basidiomycota Agaricomycetes Agaricales17 Moniliophthora perniciosa Basidiomycota Agaricomycetes Agaricales08 Moniliophthora perniciosa Basidiomycota Agaricomycetes AgaricalesCMT28 Cryptococcus zeae Basidiomycota Tremellomycetes TremellalesC18 Sporobolomyces oryzicola Basidiomycota Pucciniomycetes ErythrobasidialesC8 Rhodotorula sp. Basidiomycota Urediniomycetes Sporidiales

Stemphylium solani Ascomycota Dothideomycetes PleosporalesCMON10 Microsphaeropsis arundinis Ascomycota Dothideomycetes PleosporalesCMT35 Leptosphaerulina chartarum Ascomycota Dothideomycetes PleosporalesCMT47 Cochliobolus kusanoi Ascomycota Dothideomycetes PleosporalesM51 Ampelomyces sp. Ascomycota Dothideomycetes PleosporalesMAP15C Epicoccum nigrum Ascomycota Dothideomycetes PleosporalesC15 Cladosporium pini-ponderosae Ascomycota Dothideomycetes CapnodialesCMT1 Cladosporium tenuissimum Ascomycota Dothideomycetes CapnodialesCMT48 Cladosporium tenuissimum Ascomycota Dothideomycetes CapnodialesCMON40 Cladospororium tenuissimum Ascomycota Dothideomycetes CapnodialesCMT52 Cladospororium tenuissimum Ascomycota Dothideomycetes CapnodialesCAP18C Cercospora zebrinae Ascomycota Dothideomycetes CapnodialesCMT27 Cercospora kikuchii Ascomycota Dothideomycetes CapnodialesCMT54 Cercospora kikuchii Ascomycota Dothideomycetes CapnodialesCMT63 Cercospora kikuchii Ascomycota Dothideomycetes CapnodialesCMON3 Cercospora sp. Ascomycota Dothideomycetes CapnodialesCMON18 Penicillium brevicompactum Ascomycota Eurotiomycetes EurotialesCMT13 Cladophialophora sp Ascomycota Eurotiomycetes ChaetothyrialesM2P16F Fusarium proliferatum Ascomycota Sordariomycetes HypocrealesMBP21D Fusarium equiseti Ascomycota Sordariomycetes HypocrealesCMT37 Fusarium equiseti Ascomycota Sordariomycetes HypocrealesC3P34D Fusarium equiseti Ascomycota Sordariomycetes HypocrealesC13.1 Myrothecium inundatum Ascomycota Sordariomycetes HypocrealesM45 Annulohypoxylon stygium Ascomycota Sordariomycetes XylarialesC28 Xylaria berteri Ascomycota Sordariomycetes XylarialesCMT29 Anthostomella sp. Ascomycota Sordariomycetes XylarialesM30 Hypoxylon sp. Ascomycota Sordariomycetes XylarialesM39 Diaporthe phaseolorum Ascomycota Sordariomycetes DiaporthalesC6 Diaporthe helianthi Ascomycota Sordariomycetes DiaporthalesC29 Diaporthe helianthi Ascomycota Sordariomycetes DiaporthalesC62 Diaporthe helianthi Ascomycota Sordariomycetes DiaporthalesCMT33 Phomopsis longicolla Ascomycota Sordariomycetes DiaporthalesCMT38 Phomopsis longicolla Ascomycota Sordariomycetes DiaporthalesCMON20 Phomopsis longicolla Ascomycota Sordariomycetes Diaporthales

2 Mateus Ferreira Santana et al.

� 2013 WILEY-VCHVerlag GmbH & Co.KGaA,Weinheim www.jbm-journal.com 2013, 9999, 1–5

conjunction with ClIRAP4; in this combination, theprimers are in opposite sense of amplification.

The IRAP reactions were performed in a reactionvolume of 25 µl containing 1� Thermophilic DNAPolymerase Buffer (Promega), 2.0 µmol L�1 MgCl2 (Prom-ega), 100 µmol L�1 of each dNTP, 0.2 µmol L�1 of eachprimer, 40 ng of DNA and 1 unit of Taq DNA polymerase(Promega). PCRs were performed in a PTC-100 thermalcycler (MJ Research) programmed to undergo an initialdenaturation step of 2 min at 94 °C, six cycles of 30 s at94 °C, 30 s at 50 °C, and 2 min at 72 °C. Twenty-fourcycles were added to these six initial cycles, with 30 sadded to the extension time (at 72 °C) every six cycles.The final extension step was 10 min at 72 °C. Differencesin the amplicon patterns among the isolates were visuallyevaluated using a 1.5% agarose gel. The reproducibility of

the DNA band profile was tested by repeating the PCRwith each of the selected primers.

Results and discussion

Many TEs are ubiquitous and have been used asmolecular markers to analyze genetic diversity [10, 11],classify banana cultivars [12], detect similarity amongrice cultivars [13], and fingerprint different mushroomspecies [14]. In the large majority of cases, whether TEsare used as molecular markers depends on priorknowledge of the genome or the TE sequences.

Herein, we demonstrate that the IRAP technique canbe used with primers designed for a TRIM-like element,RetroCl1 from Colletotrichum lindemuthianum [10], in

Figure 1. IRAP markers generated with the ClIRAPs primers. The band profile generated with the primer combinations ClIRAP2 and ClIRAP4(A) as well as ClIRAP1 and ClIRAP4 (B). The species and respective identifications in the mycological collection are represented by numbersfrom 1 to 22. 1, P. brevicompactum (CMON 18); 2, C. zeae (CMT28); 3, S. oryzicola (C18); 4, Rhodotorula sp. (C8); 5, E. nigrum (MAP15C); 6,Ampelomyces sp. (M51); 7, C. kusanoi (CMT47); 8, L. chartarum (CMT 35); 9, M. arundinis (CMON 10); 10, S. solani (C30); 11, F. proliferatum(M2P16F); 12,M. inundatum (C13.1); 13, C. pini-ponderosae (C15); 14, C. tenuissimum (CMON40); 15, C. zebrinae (CAP18C); 16, Cercosporasp. (CMON3); 17, A. stygium (M45); 18, X. berteri (C28); 19, Anthostomella sp. (CMT29); 20, Hypoxylon sp. (M30); 21, D. phaseolorum (M39);and 22, Cladophialophora sp. (CMT 13). M represents the 1 kb DNA Ladder molecular marker and the respective molecular weights in kilobases (kb).

Retrotransposons as DNA markers in fungi 3

� 2013 WILEY-VCH Verlag GmbH & Co.KGaA,Weinheim www.jbm-journal.com 2013, 9999, 1–5

different species of fungi. Twenty-seven species wereevaluated using RetroCI1 primers to generate polymor-phic markers using the IRAP technique. Six isolatesrepresentative of the class Basidiomycota and 21 isolatesrepresentative of the class Ascomycota were analyzed,which correspond to 11 orders. In the repeated experi-ments performed for each primer set, there were nochanges in the band profiles obtained for each isolate.This technique generated amplicons that varied fromapproximately 4 kb in Cladophialophora sp. to <250 bp indifferent fungi such as Microsphaeropsis arundinis (Fig. 1).The number of amplicons generated varied in accordancewith the species and combination of primers used.Therefore, the primers designed for RetroCl1 couldamplify DNA sequences from different fungi species,which demonstrates their potential for discriminatingdifferent fungi species.

Six fungi species were used to determine the capacityof this technique for intra-specific polymorphism detec-tion. The combinations of primers analyzed hereinfacilitated polymorphism detection even with a smallnumber of isolates (three) from the same species (Fig. 2).In certain species such as Cercospora kikuchii, manyamplicons were detected using both combinations ofprimers (Fig. 2). However, in Fusarium equiseti, the ClIRAP2and ClIRAP4 combination generated more polymorphicbands. In addition to primer selection, the efficiency forpolymorphism detection may vary with TE orientation inthe genome. Nearby TEs with different orientations (headto head, tail to tail, head to tail) may be detected.

The ClIRAPs primers were efficient in detecting inter-and intra-species polymorphisms. In addition to the IRAPtechnique, the RetroCl1 primers can be used with primersfor different microsatellite regions in the REMAPtechnique. For the REMAP technique, the PCR amplifica-tion product contains sequences between TEs andmicrosatellites, which are also widely dispersed in thegenome. Thus, it is expected that REMAP will generatemore polymorphic markers than IRAP [6]. Thesetechniques may allow for exclusive amplification ofproducts from certain species or isolates, which facili-tates the use of these markers to generate primers forsequence characterized amplified region- (SCAR) basedmolecular markers.

IRAP and REMAP are advantageous relative to othertechniques used in population analysis because they areversatile, they use combinations of different primers thatanneal to conserved regions in retrotransposons (IRAP) ormicrosatellites (REMAP), they are highly reproduciblebecause they use specific primers and involve a simple PCRprocess, they are inexpensive, they require little work, andthey generate a large number of polymorphic markers.

In conclusion, the IRAP technique based on the ClIRAPprimers constructed for the TRIM-like element RetroCl1has high potential for use in studying inter- and intra-species diversity and variability in fungi withoutknowing the TEs in the genome.

References

[1] Martin, F., Aerts, A., Ahrén, D., Brun, A. et al., 2008. Thegenome of Laccaria bicolor provides insights into mycor-rhizal symbiosis. Nature, 452, 88–92.

Figure 2. IRAP markers generated using ClIRAP primers. The bandprofile generated from the primer combinations ClIRAP2 and ClIRAP4(A) as well as ClIRAP1 and ClIRAP4 (B). The species and respectiveidentifications in the mycological collection are represented bynumbers from 1 to 6 and by letters from “a” to “c” to identify differentisolates of the same species. 1a, D. helianthi (C6); 1b, D. helianthi(C29); 1c,D. helianthi (C62); 2a, F. equiseti (MBP21D); 2b, F. equiseti(CMT37); 2c, F. equiseti (C3P34D); 3a, M. perniciosa (09); 3b, M.perniciosa (17); 3c,M. perniciosa (08); 4a, C. kikuchii (CMT27); 4b, C.kikuchii (CMT54); 4c, C. kikuchii (CMT63); 5a, C. tenuissimum(CMT1); 5b, C. tenuissimum (CMT48); 5c, C. tenuissimum (CMT52);6a, P. longicolla (CMT33); 6b, P. longicolla (CMT38); and 6c, P.longicolla (CMON20). M represents the 1 kb DNA Ladder molecularmarker and the respective molecular weights in kilo bases (kb).

4 Mateus Ferreira Santana et al.

� 2013 WILEY-VCHVerlag GmbH & Co.KGaA,Weinheim www.jbm-journal.com 2013, 9999, 1–5

[2] Martin, F., Kohler, A., Murat, C., Balestrini, R. et al., 2010.Périgord black truffle genome uncovers evolutionaryorigins and mechanisms of symbiosis. Nature, 464,1033–1038.

[3] Wicker, T., Sabot, F., Huan-Van, A., Bennetzen, J.L. et al.,2007. A unified classification system for eukaryotictransposable elements. Nature, 8, 973–982.

[4] Kalendar, R., Flavell, A.J., Ellis, T.H.N., Sjakste, T. et al.,2011. Analysis of plant diversity with retrotransposon-based molecular markers. Heredity, 106, 520–530.

[5] Waugh, R., Mclean, K., Flavell, A.J., Pearce, S.R. et al., 1997.Genetic distribution of BARE-1 retrotransposable elementsin the barley genome revealed by sequence-specificamplification polymorphisms (S-SAP). Mol. Genet. Geno-mics, 253, 687–694.

[6] Kalendar, R., Grob, T., Regina, M., Suoniemi, A. et al., 1999.IRAP and REMAP: two new retrotransposon-based DNAfingerprinting techniques. Theor. Appl. Genet., 98, 704–711.

[7] Flavell, A.J., Knox, M.R., Pearce, S.R., Ellis, T.H.N., 1998.Retrotransposon-based insertion polymorphism (RBIP) forhigh throughput marker analysis. Plant J., 16, 643–650.

[8] Kalendar, R., Tanskanen, J., Chang, W., Antonious, K. et al.,2008. Cassandra retrotransposon carry independently

transcribed 5S RNA. Proc. Natl. Acad. Sci. USA, 105,5833–5838.

[9] Kwon, S.-J., Kim, D.-H., Lim, M.-H., Long, Y. et al., 2007.Terminal repeat retrotransposon in miniature (TRIM) asDNA markers in Brassica relatives. Mol. Genet. Genomics,278, 361–370.

[10] Santos, L.V., Queiroz, M.V., Santana, M.F., Soares, M.A.et al., 2012. Development of newmolecularmarkers for theColletotrichum genus using RetroCl1 sequences. World J.Microbiol. Biotechnol., 28, 1087–1095.

[11] Vuckich, M., Schulman, A.H., Giordani, T., Natali, L. et al.,2009. Genetic variability in sunflower and in the Helianthusgenus as assessed by retrotransposon-based molecularmarkers. Theor. Appl. Genet., 19, 1027–1138.

[12] Nair, A.S., Teo, C.H., Schwarzacher, T., Heslop-Harrison, P.,2005. Genome classification of banana cultivars fromSouth India using IRAP markers. Euphytica, 144, 285–290.

[13] Branco, C.S.J., Vieira, E.A., Malone, G., Kopp, M.M. et al.,2007. IRAP and REMAP assessments of genetic similarity inRice. J. Appl. Genet., 48, 107–113.

[14] Le, Q.V., Won, H.-K., Lee, T.-S., Lee, C.-Y. et al., 2008.Retrotransposon microsatellite amplified polymorphismstrain fingerprinting markers applicable to various mush-room species. Mycobiology, 36, 161–166.

Retrotransposons as DNA markers in fungi 5

� 2013 WILEY-VCH Verlag GmbH & Co.KGaA,Weinheim www.jbm-journal.com 2013, 9999, 1–5